telomerase activity and telomerase reverse transcriptase catalytic subunit expression in canine...

© 2006 The Authors. Journal compilation © 2006 Blackwell Publishing Ltd 141

Original Article

Telomerase activity and telomerase reverse transcriptase catalytic subunit expression in canine lymphoma: correlation with Ki67 immunoreactivity

M . G . Renwick 1 , D . J . Argyle 2 , S . Long 1 * , C . Nixon 1 , E . A . Gault 1 and L . Nasir 1

1 Institute for Comparative Medicine, University of Glasgow, Faculty of Veterinary Medicine, Glasgow, UK 2 Royal Dick School of Veterinary Studies, The University of Edinburgh, Easter Bush Veterinary Centre, Roslin, Midlothian, UK

Abstract Increased telomerase activity (TA) has been found in human and canine solid tumours, stem cells

and somatic tissues with enhanced proliferative potential. The relationship between TA in normal

and malignant lymphoid tissues remains unclear. The TA and the expression of canine telomerase

reverse transcriptase catalytic subunit (dogTERT) messenger RNA (mRNA) were analyzed in malig-

nant lymph nodes from 30 dogs with lymphoma, from two dogs with non-neoplastic illness and

from two clinically normal dogs, demonstrating a statistically signifi cant difference between TA in

lymphoma lymph nodes ( n = 30) and normal nodes ( n = 4) but no signifi cant difference in dogTERT

mRNA expression. In addition, the expression of telomerase reverse transcriptase catalytic subunit

(TERT) protein and Ki67 was analyzed in malignant lymph nodes from 10 dogs with lymphoma and

from two clinically normal dogs by immunohistochemistry. TERT expression was associated with

Ki67 in all lymphoma nodes ( n = 10), and differences were illustrated between TERT and Ki67 expres-

sion between lymphoma ( n = 10) and non-lymphoma ( n = 2) nodes. This data support further inves-

tigation of telomerase in canine haematopoietic neoplasia through large-scale prospective studies.

Introduction

Mammalian telomeres are DNA protein complexes

that cap the ends of linear chromosomes and consist

of multiple TTAGGG repeats and a number of asso-

ciated proteins. During cell division, telomeres un-

dergo attrition, ultimately limiting cellular replicative

capacity 1,2 . The enzyme telomerase, however, stabi-

lizes chromosome ends by extending the telomeric

repeat sequences and thus plays a critical role in cell

survival 3,4 . Telomerase activity (TA) is essential for

embryogenesis but is repressed upon tissue differen-

tiation during development such that telomerase is

absent from birth in most somatic tissues 5 . Some cell

types, however, including male germ cells, activated

lymphocytes and stem cell populations, continue to

express telomerase at reduced levels 6 – 10 . In contrast,

85 – 90% of human cancers possess TA 11,12 .

The enzyme telomerase is composed minimally

of an RNA component, telomerase RNA (TR), a

telomerase reverse transcriptase catalytic subunit

(TERT) and associated proteins 13,14 . Its function re-

quires the presence of both core components 15 . The

TERT component of telomerase is considered the

primary determinant for enzyme activity. Expression

Keywords dogTERT , immunoreactivity , Ki67 , lymphoma , telomerase

Correspondence address: L. Nasir Division of Pathological Sciences Institute of Comparative Medicine University of Glasgow Faculty of Veterinary Medicine Bearsden Road Glasgow G61 1QH UK e-mail: [email protected]

*Present address: Section of Neurology, Ryan Hospital, University of Pennsylvania, School of Veterinary Medicine, Philadelphia, PA 19104-4192, USA.

142 M. G. Renwick et al.

© 2006 The Authors. Journal compilation © 2006 Blackwell Publishing Ltd, Veterinary and Comparative Oncology, 4, 3, 141–150

of human TERT (hTERT) is repressed in normal

somatic tissues but elevated in most human tu-

mours 11 . Further, ectopic expression of hTERT in

telomerase-negative normal human cells is associ-

ated with extension of cellular lifespan 16,17 , whereas

inhibition of hTERT limits growth of cancer cells 18 .

Several studies support roles for hTERT as a diag-

nostic 19 – 21 and prognostic 22 – 26 tool in solid tumours,

and some investigators describe a correlation be-

tween TA and proliferative activity of cancer cells 27 .

The presence of TA in canine tumour tissues has

been reported 28 – 31 , demonstrating that more than

95% of all canine cancers are associated with this

activity 32 . It has been shown previously that TA in

dogs is largely confi ned to tumour tissues and cells

with a high proliferative potential 33 ; however, little

is known about the differing levels of activity in

normal and cancer tissues of the dog. In two recent

canine studies 34,35 , both TA and TERT immunos-

taining showed similar levels in normal canine

lymph nodes and malignant lymphomas. Canine

lymphomas represent a heterogeneous group of lym-

phoproliferative tumours, accounting for 10 – 15%

of all cancer presentations in the dog and up to 90%

of haematopoietic tumours, with reported incidence

of 13 – 34 per 100 000 dogs 36 – 38 , which is higher than

in humans of 12 – 19 per 100 000 dogs 39 . The aims of

the present study were to further examine TA in

canine lymphomas and normal lymph nodes, to

evaluate whether TA correlates with expression of

canine telomerase reverse transcriptase catalytic

subunit (dogTERT) messenger RNA (mRNA) and

to determine if TERT immunopositivity correlates

with cellular proliferation by assessing the prolifer-

ation marker Ki67 in canine lymphomas.

Materials and methods

Tissue samples

Lymph node biopsy tissues were obtained from 30

canine patients with lymphoma at the University

of Wisconsin Veterinary Medical Teaching Hospi-

tal, Madison, USA. Two lymph nodes were col-

lected with owner ’ s consent at necropsy from two

non-tumour-bearing dogs at Glasgow University

Veterinary School, Glasgow, Scotland. Lymph

nodes were also taken from two healthy dogs that

had been euthanased in accordance with local

humane society population control guidelines. In

addition, archival paraffi n-embedded lymphoma

lymph node samples from 10 dogs with a diagnosis

of multicentric lymphoma were retrieved from the

Diagnostic Services Pathology archives at the

Faculty of Veterinary Medicine, University of

Glasgow. For all the samples, sections stained with

haematoxylin and eosin were re-evaluated to con-

fi rm the initial diagnosis or non-neoplastic status.

Immunohistochemistry

Tissue samples were immunostained using a

streptavidin – biotin horseradish peroxidase (HRP)

technique. Paraffi n sections were dewaxed in Histo-

Clear (National Diagnostics, Atlanta, GA, USA),

rehydrated in alcohol and incubated in 0.5% H 2 O 2

methanol solution for 20 min. Paraffi n sections

were subjected to antigen retrieval with 0.01 M

sodium citrate (pH 6) in a pressure cooker (120 s at

15 pounds inch − 2 ). All the sections were blocked in

1% normal unlabelled serum (Scottish Antibody

Production Unit, Glasgow, UK) in 0.01 M Tris-

buffered saline (New England Biolabs, Boston,

MA, USA) for 30 min at room temperature and

incubated for 2 h at room temperature with anti-

bodies against hTERT (mouse monoclonal anti-

body diluted 1:200 in 0.1% bovine serum albumin

[BSA]; Novocastra, Newcastle upon Tyne, UK),

Ki67 (clone MIB-1, mouse monoclonal antibody

1:200 in 0.1% BSA; Dako, Cambridgeshire, UK),

CD79 � (B-cell mouse monoclonal antibody 1:20

in 0.1% BSA; Dako) and CD3 (pan-T-cell mouse

monoclonal antibody 1:200 in 0.1% BSA; Dako).

Sections were then incubated for 45 min with

the appropriate biotinylated secondary antibody

(Dako), followed by HRP-conjugated streptavidin –

biotin complex (Dako) for 45 min. Immuno-

re activity was visualized with diaminobenzidine

(Sigma, Dorset, UK), and sections were counter-

stained with haematoxylin (VWR International,

Dorset, UK). Negative controls were exposed to

the same conditions but without the primary anti-

body step. Normal canine testis served as a positive

control for TERT staining (unpublished data).

Normal human and canine tonsil acted as positive

controls for CD3, CD79 � and Ki67.

Telomerase activity and dogTERT expression in canine lymphoma 143

© 2006 The Authors. Journal compilation © 2006 Blackwell Publishing Ltd, Veterinary and Comparative Oncology 4, 3, 141–150

Evaluation of immunohistochemical staining

Immunohistochemical staining was evaluated by

light microscopy photographed at ×400 magnifi -

cation (Olympus , London, UK). For Ki67 and TERT,

fi ve fi elds were selected per section and 500 cells

counted per fi eld. For Ki67, the number of positive

cells was expressed as a percentage of all nuclei

counted. TERT immunoreactivity was scored and

categorized as <10%, negative ( − ); 10 – 20%, positive

(+); 20 – 50%, positive (++); >50%, positive (+++).

Telomerase activity

TA was measured using the TeloTAGGG Telomer-

ase polymerase chain reaction (PCR) enzyme-

linked immunosorbent assay (ELISA) PLUS assay

(Roche Applied Science, East Sussex, UK). Briefl y,

tissue samples were homogenized in 200 � L of ice-

cold lysis buffer and incubated in ice for 30 min.

After centrifugation at 16 000 × g for 20 min at

4 °C, the supernatant was collected and stored at

− 80 °C. Protein concentrations were measured

using the bicinchoninic acid/copper sulphate assay

(Sigma). Protein samples of 1 � g were incubated

with reaction buffer containing biotin-labelled

P1-TS and P2 forward and reverse primers, telom-

erase substrate, and Taq polymerase for 20 min at

25 °C in a fi nal volume of 50 � L. Internal standard

was included in each reaction to control for the

presence of PCR inhibitors in protein extracts.

A fter a further incubation at 94 °C for 5 min, the

resulting mixture was subjected to PCR of 30 cycles

of 30 s at 94 °C, 30 s at 50 °C and 30 s at 72 °C, with

fi nal extension of 10 min at 72 °C. The amplifi c-

ation products were denatured and hybridized with

a digoxigenin-labelled, telomeric-repeat-specifi c

detection probe. The resulting product was immo-

bilized through the biotin- labelled TS primer to a

streptavidin-coated microtitre plate and detected

with an antidigoxigenin antibody conjugated with

HRP. Absorbance values were measured at 450 nm

using a microtitre plate reader, with a reference

wavelength of 690 nm. Samples were regarded as

telomerase positive if the absorbance was higher

than twice the background (A 450 nm – A 690 nm ). TA

in the samples was calculated as the ratio of the

sample to the absorbance value of the positive

control supplied with the kit and represented as

relative TA (RTA).

dogTERT reverse transcriptase – polymerase chain reaction analysis

To assess dogTERT gene expression, reverse

transcriptase – polymerase chain reaction (RT-

PCR) was performed. Briefl y , RNA was extracted

from tissue samples using RNA-Wiz ™ (Ambion,

Cambridgeshire, UK) and cDNA synthesized us-

ing Superscript III ™ reverse transcriptase (Invit-

rogen, Paisley, UK) in the presence of oligo (dT)

primer following the recommended protocol.

PCRs were performed on 5 � L of cDNA tem-

plate in the presence of 0.2 � M dogTERT-specifi c

forward and reverse primers – EX2F (5 � CAG-

GAGCTGCTTGGGAACCA 3 � ) and EX2R (5 � CT-

GGGTTCCCGTGCAGCCAG 3 � ) (Nasir et al. 40 )

(Sigma-Genosys , Dorset, UK) – Platinum ® Taq

high fi delity 1×PCR buffer (Invitrogen), 0.2 � M

dNTP mix, 2 mM MgSO 4 and 1 U Platinum ® Taq

DNA polymerase (Invitrogen), in a total volume of

50 � L. Samples were incubated for 2 min at 94 °C

to activate the hot-start enzyme and denature the

template, followed by 35 cycles of 30 s at 94 °C, 30

s at 55 °C and 1 min at 68 °C, with fi nal extension

of 10 min at 68 °C.

Cyclophilin primers, CycloF (5 � CGTGCTCT-

GAGTACTGGAGAGAAGGGA 3 � ) and CycloR

(5 � CCACTCAGTCTTGGCGGTGCAGATGAA3 � )

(SigmaGenosys), provided positive controls using

the same conditions as mentioned above. To con-

trol for DNA contamination, RNA samples were

subjected to PCR with omission of the reverse

transcription step.

Results

TA and dogTERT expression in canine lymphomas

A total of 30 canine lymphoma nodes and four

non-neoplastic lymph nodes were assessed for TA.

A sample was taken as telomerase positive if the

RTA value was greater than twice the background.

RTA values between 1.0 and 2.0 were taken as

borderline/low TA and values less than 1.0 were



given a negative result. A wide range of activity

was detected in 29 of the 30 (97%) lymphoma

samples ( Fig. 1), with a negative result in one case

(sample L19). Low but detectable levels of activity

were also identifi ed in two of the non-neoplastic

lymph nodes (N3 and N4). RTA values in the lym-

phoma nodes ranged from 0.7 to 13.2 (mean 6.79,

median 6.7). The range in the non-lymphoma

nodes was much narrower at 0.2 – 1.8 (mean 0.93,

median 0.85). Using the Mann – Whitney U -test,

there was a statistically signifi cant difference in

RTA value ( P < 0.001) between the two groups,

with higher levels in lymphoma nodes than in

non-lymphoma nodes. To determine whether the

presence of TA correlates with dogTERT mRNA

expression, the samples were also analyzed for

dogTERT mRNA expression by RT-PCR. Twenty-

fi ve (83%) of the 30 lymphoma samples showed

concordance for TA and dogTERT mRNA expres-

sion (Table 1). No dogTERT mRNA expression

could be detected in the lymphoma node negative

for TA (sample L19); however, four lymphoma

samples (L9, L16, L21 and L23) were discordant,

lacking dogTERT expression but positive for TA.

In the non-neoplastic nodes, only sample N4 was

concordant for TA and dogTERT expression. The

remaining three samples exhibited discordance;

samples N1 and N2 were positive for dogTERT

expression but negative for TA, while sample N3

was negative for dogTERT expression but positive

for TA.

Immunophenotype of canine lymphomas

Ten archival paraffi n-embedded lymphoma nodes

were examined histologically and assessed for

B-cell or T-cell immunophenotype. Eight tumours

were classifi ed as B immunophenotype and one

as T immunophenotype on the basis of CD79 � or

CD3 immunoreactivity 41 – 43 . One tumour did not

express either B-cell or T-cell antigen (Table 2).

dogTERT immunostaining and Ki67 expression

To investigate expression of dogTERT protein in

canine lymphomas, paraffi n-embedded sections

were evaluated for TERT immunoreactivity using

the NCL-hTERT antibody. It has been shown that

this antibody is able to recognize full-length canine

TERT protein 44 . Strong immunopositivity was

detected in 10 of the 10 lymphoma nodes ( Table 2 ).

The staining patterns showed granular nuclear

staining, and some cells exhibited distinct nucleo-

lar uptake, with more diffuse nuclear patterns.

There was also occasional cytoplasmic staining.

Representative examples of TERT staining are

shown in Fig. 2. Staining was not limited to areas

showing strong CD3 or CD79 � positivity. Two

non-neoplastic lymph nodes were also examined;

one sample was negative for TERT expression;

however, the remaining sample (N2) showed

low levels of TERT immunopositivity ( Fig. 2C;

Table 2 ). While there was no evidence for neoplasia

Figure 1. RTA in canine lymphoma nodes (L1 – L30) and non-neoplastic nodes (N1 – N4).



in this node, histopathology was consistent with

reactive hyperplasia. Normal canine testis acted

as a positive control, and staining was confi ned to

the germinal cells of the seminiferous tubules as

expected ( Fig. 2D ).

To determine whether an association between

TERT expression and proliferation index exists,

paraffi n sections were also analyzed for Ki67 im-

munostaining. Immunoreactivity of the Ki67

antigen was exclusively confi ned to the nucleus.

Numerous strongly immunoreactive nuclei were

found in all lymphoma samples, and staining was

throughout the sections, except for small areas of

residual normal tissue ( Fig. 2E ). Proliferative indi-

ces expressed as the percentage of positive nuclei

are shown in Table 2 . Low levels of Ki67 staining

were observed in the non-lymphoma nodes ( Fig. 2E ).

As shown in Table 2 , samples with a Ki67-labelling

index more than 27% had the highest levels of

TERT immunopositivity, while those with a label-

ling index less than 27% had low levels of TERT

immunopositivity, thus suggesting a relationship

between these two parameters.

Discussion

In the present study, TA was detected in the major-

ity (97%) of canine lymphomas, and activity was

greater in lymphoma lymph nodes than in non-

lymphoma nodes. A trend was also illustrated by

TERT immunostaining where lower levels of TERT

immunopositivity were observed in normal nodes

than in lymphoma nodes. These results are in con-

trast to previous fi ndings where similar levels of

TA 34,35 and TERT immunostaining 35 have been re-

ported in canine lymphoma samples and normal

nodes. These differences may be due to the small

number of normal nodes available for analysis in

the present study; however, this study analyzed 30

canine malignant lymphomas, a larger group than

analyzed in previous studies.

While there was general agreement between

samples positive for TA and TERT mRNA positiv-

ity, mRNA expression was not detected in four

telomerase-positive canine lymphoma samples and

was discordant with TERT expression in the non-

neoplastic samples. These discrepancies are consis-

tent with previous fi ndings in human cancers and

cell lines. Some cancer cells exhibited strong TA

assessed by telomere repeat amplifi cation protocol

(TRAP) assay but showed no detectable TERT ex-

pression 45 . The apparent absence of TERT expres-

sion in the presence of TA could simply be due to

undetectably low levels of expression. The lack of

correlation has also led authors to propose that TA

is not determined by TERT expression alone, that

other post-transcriptional and post-translational

modifi cations are necessary 46,47 or that both TR and

TERT and the ratio of expression may affect func-

tion 15,47 – 49 . Similarly, several telomerase-negative

cell lines including normal human fi broblasts have

been shown to exhibit weak TERT expression in

the absence of TA 45,50 . Alternative splicing of the

hTERT is one of the proposed regulatory mech-

anisms of TA 13,51 . Since splice variants are con-

sidered to be non-functional 47,52 , the dogTERT

transcripts detected in the present study may

Table 1. Relationship between dogTERT mRNA expression and TA

dogTERT mRNA

Sample type Telomerase + −

Lymphoma nodes ( n = 30)

+ 25 4 − 0 1

Non-neoplastic nodes ( n = 4)

+ 1 1 − 2 0

Total + 26 5 − 2 1

Table 2. Relationship between Ki67 PI and TERT immunoreactivity

Sample Immunophenotype

PI (%)

TERT immunoreactivity a

L31 B cell 33 +++ L32 Non-T-non-B 26 ++ L33 B cell 21 ++ L34 B cell 25 ++ L35 B cell 23 ++ L36 B cell 42 +++ L37 B cell 62 +++ L38 T cell 40 +++ L39 B cell 28 +++ L40 B cell 45 +++ N1 NA 11 − N2 b NA 6 +

NA, not applicable; PI, proliferation index. a <10%, − ; 10 – 20%, +; 20 – 50%, ++; >50%, +++. b Histopathology – reactive hyperplasia.



represent non-functional isoforms, contributing to

the discordance between TERT mRNA expression

and TA.

There is increasing evidence that high telomer-

ase expression is associated with unfavourable

outcome in human cancer 53 . TA assessment using

the TRAP assay is regarded as the gold standard;

however, the optimal assay to determine telomer-

ase expression remains uncertain 25,54 . Owing to the

limited availability of tissue samples, in the present

study, we were not able to perform all three analy-

ses, TRAP assay, RT-PCR and immunohistochem-

istry, on the same tissues in an attempt to address

this. Based on our fi ndings, TA measured by the

TRAP assay was more sensitive at detecting activity

than RT-PCR for mRNA expression. However, the

fact that we detected two samples negative for TA

but positive by RT-PCR implies that assessment of

Figure 2. Ki67 and TERT immunohistochemistry in canine lymphoma nodes and non-neoplastic lymph nodes (×400 magnifi cation). (A) TERT staining in a lymphoma node showing nuclear and nucleolar-specifi c staining. (B) TERT staining in a lymphoma node demonstrating strong nuclear staining in the majority of cells. (C) Low levels of TERT immunostain-ing in a node from a clinically normal dog. (D) TERT staining in canine testis tissue confi ned to the germinal cells of the seminiferous tubules. (E) Low levels of Ki67 staining in a node from a clinically normal dog. (F) Strong Ki67 staining in a lymphoma node showing nuclear localization. Positive staining is represented by brown colouration in all cases.



telomerase should comprise both approaches.

Interestingly, several studies have shown that

TERT mRNA expression is a stronger prognostic

indi cator than TA 25,54 .

Most of the TERT immunoreactivity detected in

both canine lymphomas and non-lymphoma nodes

was confi ned to the nucleus, in a granular or dif-

fuse pattern, with some strong nucleolar localiz-

ation. Nucleolar staining is suggested to represent

the telomerase holoenzyme, which is assembled

here 26 with more diffuse granular nuclear staining,

representing active telomerase complex at chro-

mosome ends 45 . Some authors have attempted to

differentiate between tumours where one pattern

predominates; however, the clinical signifi cance is

yet to be identifi ed 55 . The function of cytoplasmic

TERT is uncertain, but one hypothesis is that TERT

protein is transcribed in the cytoplasm and then

translocated to and localized in the nucleus 22 .

As a proliferation marker, Ki67 refl ects biologi-

cal behaviour, while TA is a marker for immortal-

ity 11 . TERT expression correlates with TA 35,40,51,56 – 59 .

It follows that a correlation between TERT and

Ki67 will result in overlap between TA and prolif-

eration 23,35,60 . However, Klapper et al. 57 were un-

able to demonstrate this latter correlation. In this

study, TERT expression correlated with Ki67 over-

all in the group with tumour and group with

normal nodes ( Table 2 ).

Conclusions

The overall aim of this study was to evaluate telom-

erase in canine lymphoma lymph nodes with refer-

ence to non-malignant nodes. We conclude that

TA is detectable in the majority of lymphomas,

with low or undetectable levels in non-lymphoma

nodes.

Telomerase plays a role in multistep carcinogen-

esis, and high telomerase expression is associated

with unfavourable outcome in human cancer 53 . TA

has been shown to correlate with disease progres-

sion and to decrease to borderline activity in remis-

sion in patients with leukaemia and lymphoma 61,62 .

This suggests that it may be possible to use telom-

erase as a biomarker in haematopoietic neoplasia

and as a target for therapy 10,63 . In the latter case,

because of their longer telomeres, stem cells and

proliferating lymphocytes might remain unaffected

by antitelomerase therapy, providing a therapeutic

window for new treatment paradigms in haemato-

poietic neoplasia 64 .

Acknowledgments

The authors would like to thank the Vail research

group at the University of Wisconsin – Madison,

for provision of lymphoma samples for this study.

References

1. Blackburn EH . Telomeres . Trends in Biochemical

Sciences 1991 ; 16 : 378 – 381 .

2. Shay JW and Wright WE . Senescence and

immortalization: role of telomeres and telomerase .

Carcinogenesis 2005 ; 26 : 867 – 874 .

3. Greider CW and Blackburn EH . Telomeres,

telomerase and cancer . Scientifi c American 1996 ;

274 : 92 – 97 .

4. Meeker AK and Coffey DS . Telomerase: a

promising marker of biological immortality of

germ, stem, and cancer cells, a review . Biochemistry

(Moscow) 1997 ; 62 : 1323 – 1331 .

5. Wright WE , Piatyszek MA , Rainey WE , Byrd W and

Shay JW . Telomerase activity in human germline

and embryonic tissues and cells . Developmental

Genetics 1996 ; 18 : 173 – 179 .

6. Broccoli D , Young JW and de Lange T . Telomerase

activity in normal and malignant hematopoietic

cells . Proceedings of the National Academy of Sciences

of the United States of America 1995 ; 92 : 9082 – 9086 .

7. Counter CM , Gupta J , Harley CB , Leber B and

Bacchetti S . Telomerase activity in normal

leukocytes and in hematologic malignancies . Blood

1995 ; 85 : 2315 – 2320 .

8. Hiyama K , Hirai Y , Kyoizumi S , Akiyama M ,

Hiyama E , Piatyszek MA , Shay JW , Ishioka S and

Yamakido M . Activation of telomerase in human

lymphocytes and hematopoietic progenitor cells .

Journal of Immunology 1995 ; 155 : 3711 – 3715 .

9. Norrback KF , Hultdin M , Dahlenborg K , Osterman

P , Carlsson R and Roos G . Telomerase regulation

and telomere dynamics in germinal centers .

European Journal of Haematology 2001 ; 67 : 309 – 317 .

10. Shay JW . Meeting report: the role of telomeres and

telomerase in cancer . Cancer Research 2005 ; 65 :

3513 – 3517 .

11. Kim NW , Piatyszek MA , Prowse KR , Harley CB ,

West MD , Ho PL , Coviello GM , Wright WE ,

Weinrich SL and Shay JW . Specifi c association of



human telomerase activity with immortal cells and

cancer . Science 1994 ; 266 : 2011 – 2015 .

12. Shay JW and Bacchetti S . A survey of telomerase

activity in human cancer . European Journal of

Cancer 1997 ; 33 : 787 – 791 .

13. Meyerson M , Counter CM , Eaton EN , Ellisen LW ,

Steiner P , Caddle SD , Ziaugra L , Beijersbergen RL ,

Davidoff MJ , Liu Q , Bacchetti S , Haber DA and

Weinberg RA . hEST2, the putative human

telomerase catalytic subunit gene, is up-regulated in

tumor cells and during immortalization . Cell 1997 ;

90 : 785 – 795 .

14. Nakamura TM , Morin GB , Chapman KB , Weinrich

SL , Andrews WH , Lingner J , Harley CB and Cech

TR . Telomerase catalytic subunit homologs from

fi ssion yeast and human . Science 1997 ; 277 : 955 – 959 .

15. Blackburn EH . Cell biology: Shaggy mouse tales .

Nature 2005 ; 436 : 922 – 923 .

16. Bodnar AG , Ouellette M , Frolkis M , Holt SE , Chiu

CP , Morin GB , Harley CB , Shay JW , Lichtsteiner S

and Wright WE . Extension of life-span by

introduction of telomerase into normal human

cells . Science 1998 ; 279 : 349 – 352 .

17. Counter CM , Meyerson M , Eaton EN , Ellisen LW ,

Caddle SD , Haber DA and Weinberg RA .

Telomerase activity is restored in human cells by

ectopic expression of hTERT (hEST2), the

catalytic subunit of telomerase . Oncogene 1998 ;

16 : 1217 – 1222 .

18. Hahn WC , Stewart SA , Brooks MW , York SG ,

Eaton E , Kurachi A , Beijersbergen RL , Knoll JH ,

Meyerson M and Weinberg RA . Inhibition of

telomerase limits the growth of human cancer cells .

Nature Medicine 1999 ; 5 : 1164 – 1170 .

19. Kolquist KA , Ellisen LW , Counter CM , Meyerson

M , Tan LK , Weinberg RA , Haber DA and Gerald

WL . Expression of TERT in early premalignant

lesions and a subset of cells in normal tissues .

Nature Genetics 1998 ; 19 : 182 – 186 .

20. Chen XQ , Bonnefoi H , Pelte MF , Lyautey J ,

Lederrey C , Movarekhi S , Schaeffer P , Mulcahy HE ,

Meyer P , Stroun M and Anker P . Telomerase

RNA as a detection marker in the serum of breast

cancer patients . Clinical Cancer Research 2000 ; 6 :

3823 – 3826 .

21. Hiroi S , Nakanishi K , Kawai T . Expressions of

human telomerase mRNA component (hTERC)

and telomerase reverse transcriptase (hTERT)

mRNA in effusion cytology . Diagnostic

Cytopathology 2003 ; 29 : 212 – 216 .

22. Iczkowski KA , Pantazis CG , McGregor , Wu Y and

Tawfi k OW . Telomerase reverse transcriptase

subunit immunoreactivity: a marker for high-grade

prostate carcinoma . Cancer 2002 ; 95 : 2487 – 2493 .

23. Ikeda S , Shibata T , Eishi Y , Takizawa T and Koike

M . Correlation between the expression of

telomerase reverse transcriptase and proliferative

activity in breast cancer cells using an

immunocytochemical restaining method . Pathology

International 2003 ; 53 : 762 – 768 .

24. Hiyama E , Yamaoka H , Matsunaga T , Hayashi Y ,

Ando H , Suita S , Horie H , Kaneko M , Sasaki F ,

Hashizume K , Nakagawara A , Ohnuma N and

Yokoyama T . High expression of telomerase is an

independent prognostic indicator of poor outcome

in hepatoblastoma . British Journal of Cancer 2004 ;

91 : 972 – 979 .

25. Sanders RP , Drissi R , Billups CA , Daw NC ,

Valentine MB and Dome JS . Telomerase expression

predicts unfavorable outcome in osteosarcoma .

Journal of Clinical Oncology 2004 ; 22 : 3790 – 3797 .

26. Smith DL , Soria JC , Morat L , Yang Q , Sabatier L ,

Liu DD , Nemr RA , Rashid A and Vauthey JN .

Human telomerase reverse transcriptase (hTERT)

and Ki67 are better predictors of survival than

established clinical indicators in patients undergoing

curative hepatic resection for colorectal metastases .

Annals of Surgical Oncology 2004 ; 11 : 45 – 51 .

27. Miyazu YM , Miyazawa T , Hiyama K , Kurimoto N ,

Iwamoto Y , Matsuura H , Kanoh K , Kohno N ,

Nishiyama M and Hiyama E . Telomerase expression

in noncancerous bronchial epithelia is a possible

marker of early development of lung cancer . Cancer

Research 2005 ; 65 : 9623 – 9627 .

28. Biller BJ , Kitchell BE and Cadile CD . Evaluation of

an assay for detecting telomerase activity in

neoplastic tissues of dogs . American Journal of

Veterinary Research 1998 ; 59 : 1526 – 1529 .

29. Yazawa M , Okuda M , Setoguchi A , Nishimura R ,

Sasaki N , Hasegawa A , Watari T and Tsujimoto H .

Measurement of telomerase activity in dog tumors .

Journal of Veterinary Medical Science 1999 ; 61 :

1125 – 1129 .

30. Funakoshi Y , Nakayama H , Uetsuka K , Nishimura

R , Sasaki N and Doi K . Cellular proliferative and

telomerase activity in canine mammary gland

tumors . Veterinary Pathology 2000 ; 37 : 177 – 183 .

31. Yazawa M , Okuda M , Setoguchi A , Iwabuchi S ,

Nishimura R , Sasaki N , Masuda K , Ohno K and

Tsujimoto H . Telomere length and telomerase

activity in canine mammary gland tumors .

American Journal of Veterinary Research 2001 ; 62 :

1539 – 1543 .

32. Argyle DJ and Nasir L . Telomerase: a potential

diagnostic and therapeutic tool in canine oncology .

Veterinary Pathology 2003 ; 40 : 1 – 7 .

33. Nasir L , Devlin P , Mckevitt T , Rutteman G and

Argyle DJ . Telomere lengths and telomerase activity



in dog tissues: a potential model system to study

human telomere and telomerase biology . Neoplasia

2001 ; 3 : 351 – 359 .

34. Carioto LM , Kruth SA , Betts DH and King WA .

Telomerase activity in clinically normal dogs and

dogs with malignant lymphoma . American Journal

of Veterinary Research 2001 ; 62 : 1442 – 1446 .

35. Hipple AK , Colitz CMH , Mauldin GM and Cho DY .

Telomerase activity and related properties of normal

canine lymph node and canine lymphoma . Veterinary

and Comparative Oncology 2003 ; 1 : 140 – 151 .

36. Dorn CR , Taylor DO and Hibbard HH .

Epizootiologic characteristics of canine and feline

leukemia and lymphoma . American Journal of


37. Teske E . Canine malignant lymphoma: a review and

comparison with human non-Hodgkin ’ s lymphoma .

The Veterinary Quarterly 1994 ; 16 : 209 – 219 .

38. Teske E , van Heerde P , Rutteman GR , Kurzman ID ,

Moore PF and MacEwen EG . Prognostic factors for

treatment of malignant lymphoma in dogs . Journal

of the American Veterinary Medical Association 1994 ;

205 : 1722 – 1728 .

39. Armitage JO , Maugh PM , Harris NL and Bierman

P . Non-Hodgkin ’ s lymphomas . In : Cancer Principles

and Practice of Oncology , 6 th edn. , VT DeVita Jr , S

Hellman and SA Rosenberg , eds ., Lippincott ,

Williams and Wilkins , Philadelphia, PA, USA 2001 :

2256 – 2303 .

40. Nasir L , Gault E , Campbell S , Veeramalai M , Gilbert

D , McFarlane R , Munro A and Argyle DJ . Isolation

and expression of the reverse transcriptase

component of the Canis familiaris telomerase

ribonucleoprotein (dogTERT) . Gene 2004 ; 336 :

105 – 113 .

41. Picker LJ , Weiss LM , Medeiros LJ , Wood GS and

Warnke RA . Immunophenotypic criteria for the

diagnosis of non-Hodgkin ’ s lymphoma . American

Journal of Pathology 1987 ; 128 : 181 – 201 .

42. Cobbold S and Metcalfe S . Monoclonal antibodies

that defi ne canine homologues of human CD

antigens: summary of the First International Canine

Leukocyte Antigen Workshop (CLAW) . Tissue

Antigens 1994 ; 43 : 137 – 154 .

43. Day MJ . Immunophenotypic characterization of

cutaneous lymphoid neoplasia in the dog and cat .

Journal of Comparative Pathology 1995 ; 112 : 79 – 96 .

44. Long S , Argyle DJ , Gault EA , Campbell S and Nasir

L . The canine telomerase catalytic subunit

(dogTERT): characterisation of the gene promoter

and identifi cation of proximal core sequences

necessary for specifi c transcriptional activity in

canine telomerase positive cell lines . Gene 2005 ;

358 : 111 – 120 .

45. Kyo S , Masutomi K , Maida Y , Kanaya T , Yatabe N ,

Nakamura M , Tanaka M , Takarada M , Sugawara I ,

Murakami S , Taira T and Inoue M . Signifi cance of

immunological detection of human telomerase

reverse transcriptase: re-evaluation of expression

and localization of human telomerase reverse

transcriptase . American Journal of Pathology 2003 ;

163 : 859 – 867 .

46. Aisner DL , Wright WE and Shay JW . Telomerase

regulation: not just fl ipping the switch . Current

Opinion in Genetics and Development 2002 ; 12 : 80 – 85 .

47. Kyo S and Inoue M . Complex regulatory

mechanisms of telomerase activity in normal and

cancer cells: how can we apply them for cancer

therapy? Oncogene 2002 ; 21 : 688 – 697 .

48. Yoo J , Park SY , Kang SJ , Kim BK , Shim SI and Kang

CS . Expression of telomerase activity, human

telomerase RNA, and telomerase reverse

transcriptase in gastric adenocarcinomas . Modern

Pathology 2003 ; 16 : 700 – 707 .

49. Ohyashiki JH , Hisatomi H , Nagao K , Honda S ,

Takaku T , Zhang Y , Sashida G and Ohyashiki K .

Quantitative relationship between functionally

active telomerase and major telomerase

components (hTERT and hTR) in acute leukaemia

cells . British Journal of Cancer 2005 ; 92 : 1942 – 1947 .

50. Masutomi K and Hahn WC . Telomerase and

tumorigenesis . Cancer Letters 2003 ; 194 : 163 – 172 .

51. Ulaner GA , Hu JF , Vu TH , Giudice LC and

Hoffman AR . Telomerase activity in human

development is regulated by human telomerase

reverse transcriptase (hTERT) transcription and by

alternate splicing of hTERT transcripts . Cancer

Research 1998 ; 58 : 4168 – 4172 .

52. Ulaner GA , Hu JF , Vu TH , Oruganti H , Giudice LC

and Hoffman AR . Regulation of telomerase by

alternate splicing of human telomerase reverse

transcriptase (hTERT) in normal and neoplastic

ovary, endometrium and myometrium .

International Journal of Cancer 2000 ; 85 : 330 – 335 .

53. Hiyama E and Hiyama K . Clinical utility of

telomerase in cancer . Oncogene 2002 ; 21 : 643 – 649 .

54. Dome JS , Bockhold CA , Li SM , Baker SD , Green

DM , Perlman EJ , Hill DA and Breslow NE . High

telomerase RNA expression level is an adverse

prognostic factor for favorable-histology Wilms ’

tumor . Journal of Clinical Oncology 2005 ; 23 :

9138 – 9145 .

55. Maes L , Lippens E , Kalala JP and de Ridder L .

The hTERT-protein and Ki67 labelling index in

recurrent and non-recurrent meningiomas .

Cell Proliferation 2005 ; 38 : 3 – 12 .

56. Buttitta F , Pellegrini C , Marchetti A , Gadducci A ,

Cosio S , Felicioni L , Barassi F , Salvatore S ,



Martella C , Coggi G and Bosari S . Human

telomerase reverse transcriptase mRNA expression

assessed by real-time reverse transcription

polymerase chain reaction predicts chemosensitivity

in patients with ovarian carcinoma . Journal of

Clinical Oncology 2003 ; 21 : 1320 – 1325 .

57. Klapper W , Krams M , Qian W , Janssen D and

Parwaresch R . Telomerase activity in B-cell non-

Hodgkin lymphomas is regulated by hTERT

transcription and correlated with telomere-binding

protein expression but uncoupled from proliferation .

British Journal of Cancer 2003 ; 89 : 713 – 719 .

58. Yazawa M , Okuda M , Kanaya N , Hong SH ,

Takahashi T , Ohashi E , Nakagawa T , Nishimura R ,

Sasaki N , Masuda K , Ohno K and Tsujimoto H .

Molecular cloning of the canine telomerase reverse

transcriptase gene and its expression in neoplastic

and non-neoplastic cells . American Journal of


59. Yazawa M , Okuda M , Uyama R , Nakagawa T ,

Kanaya N , Nishimura R , Sasaki N , Masuda K , Ohno

K and Tsujimoto H . Molecular cloning of the feline

telomerase reverse transcriptase (TERT) gene

and its expression in cell lines and normal tissues .

The Journal of Veterinary Medical Science 2003 ; 65 :

573 – 577 .

60. Falchetti ML , Pallini R , D ’ Ambrosio E , Pierconti F ,

Martini M , Cimino-Reale G , Verna R , Maira G and

Larocca LM . In situ detection of telomerase catalytic

subunit mRNA in glioblastoma multiforme .

International Journal of Cancer 2000 ; 88 : 895 – 901 .

61. Engelhardt M , Mackenzie K , Drullinsky P , Silver RT

and Moore MA . Telomerase activity and telomere

length in acute and chronic leukemia, pre- and

post-ex vivo culture . Cancer Research 2000 ; 60 :

610 – 617 .

62. Ohyashiki JH , Sashida G , Tauchi T and Ohyashiki

K . Telomeres and telomerase in hematologic

neoplasia . Oncogene 2002 ; 21 : 680 – 687 .

63. Meyerson M . Role of telomerase in normal and

cancer cells . Journal of Clinical Oncology 2000 ; 18 :

2626 – 2634 .

64. Gellert GC , Jackson SR , Dikmen ZG , Wright WE

and Shay JW . Telomerase as a therapeutic target in

cancer . Drug Discovery Today: Disease Mechanisms

2005 ; 2 : 159 – 164 .

telomerase activity and telomerase reverse transcriptase catalytic subunit expression in canine...

Documents