somatostatin receptor gene expression in neuroblastoma

Regulatory Peptides 88 (2000) 61–73www.elsevier.com/ locate / regpep

qSomatostatin receptor gene expression in neuroblastoma

a a , a a a*Anne R. Albers , M. Sue O’Dorisio , Douglas A. Balster , Moonkyung Caprara , Pradip Gosh ,a b b a aFeng Chen , Carl Hoeger , Jean Rivier , Gail D. Wenger , Thomas M. O’Dorisio ,

aStephen J. QualmanaThe Ohio State University College of Medicine and Public Health, Departments of Pediatrics, Pathology, and Medicine,

The OSU Comprehensive Cancer Center, 700 Children’s Drive, Columbus, OH 43205, USAbThe Salk Institute for Biological Studies, The Clayton Foundation Laboratories for Peptide Biology, 10010 North Torrey Pines Road, La Jolla,

CA 92037, USA

Received 7 September 1999; received in revised form 13 December 1999; accepted 13 December 1999

Abstract

Somatostatin receptor expression is a favorable prognostic factor in human neuroblastoma. Somatostatin receptors have beendemonstrated in vitro by pharmacologic analysis of tumor tissue and in vivo by diagnostic radioreceptor scintigraphy. However, whichreceptor subtypes (sst , sst , sst , sst , and sst ) are expressed in these tumors has not yet been delineated. We used RT-PCR to analyze1 2 3 4 5

expression of the five somatostatin receptor genes in 32 neuroblastoma tumor specimens. All 32 tumor specimens expressed mRNA forc-abl and sst ; sst mRNA was detected in 27/32 samples and somatostatin mRNA was detected in 30/32 tumor specimens. The1 2

remaining receptor subtypes, sst , sst , and sst were variably expressed. Receptor protein for sst and sst was visualized in tumor3 4 5 1 2

neuroblasts as well as in endothelial cells of tumor vessels using immunostaining with specific anti-receptor antibodies. The effect of highexpression of somatostatin receptors on cell proliferation was examined in SKNSH neuroblastoma cells transfected with sst and sst .1 2

SS binding to wild-type SKNSH cells was undetectable; but the native peptide bound with high affinity to the SKNSH/sst and14 1

SKNSH/sst neuroblastoma cell lines. Pharmacologic analysis of binding with two long-acting analogues, CH275 and octreotide,2

confirmed selective expression of sst and sst in stably transfected SKNSH cells. Formation of neuroblastoma xenograft tumors in nude1 2

mice was significantly delayed for both SKNSH/sst (P , 0.001) and SKNSH/sst (P , 0.05) cells compared to wild-type SKNSH. We1 2

conclude that: (1) Somatostatin receptors, sst and sst , are expressed in the majority of neuroblastomas at diagnosis; and (2) upregulation1 2

of functional sst or sst in neuroblastoma cell lines suppresses tumorigenicity in a xenograft model. These observations suggest that1 2

somatostatin receptors may be a useful therapeutic target in neuroblastoma. 2000 Elsevier Science B.V. All rights reserved.

Keywords: Neuroblastoma; Somatostatin receptors; Xenograft tumors

1. Introduction peripheral nervous system during early childhood. Themalignant cells may be either neuroblasts or Schwann

Neuroblastoma is a malignant tumor which arises in the cells, both of which are derivatives of the neural crest [1].Neuroblastoma tumors have variable outcomes; stage IV-Stumors may spontaneously regress, while stage I tumorsAbbreviations: sst , sst , sst , sst , sst , human somatostatin receptor1 2 3 4 5

subtypes 1–5; RTPCR, reverse-transcriptase polymerase chain reaction; differentiate to ganglioneuroma. Stage II and most stage IIISS , somatostatin 14; SRIF, somatotropin release inhibiting factor;14 neuroblastoma tumors can be cured with surgery and

1,2,5 8CH275, des-amino acid [D-tryptophan , N-p-isopropyl-4-amino- chemotherapy, while stage IV tumors are more aggressive,9methyl-L-phenylalanine ]SRIFq often becoming resistant to chemo- and radiotherapies.Supported by the Howard Hughes Medical Institute (A.R.A.), NCI

Recent investigations suggest that migration of normalROl-CA64177 (M.S.O.) and ACS (M.S.O.).*Corresponding author. Schwann cells into the tumors may contribute to the

0167-0115/00/$ – see front matter 2000 Elsevier Science B.V. All rights reserved.PI I : S0167-0115( 99 )00121-4

62 A.R. Albers et al. / Regulatory Peptides 88 (2000) 61 –73

spontaneous regression and/or maturation of some neuro- Tissues had been obtained at the time of biopsy and frozenblastomas [2]. to 2 808C within 60 min of extraction. All available

Currently used prognostic indicators in neuroblastoma patient data, including age at diagnosis, sex, site of primaryinclude Shimada classification [3], MYCN amplification, tumor, stage, Shimada classification, DNA analysis forpatient age, and stage [4]. Several laboratories, including MYCN content, and survival (Table 1) were provided byour own, have recently investigated the use of neuro- CHTN in accordance with guidelines established by thepeptide levels as prognostic factors in neuroblastoma [5]. National Cancer Institute and the Children’s HospitalIncreased plasma levels of NPY have been demonstrated to Institutional Review Board (IRB).correlate with a rapidly growing tumor and to predict earlyrelapse [6]. Increased NPY mRNA expression has been 2.2. Culture of neuroblastoma and COS-7 cell linesdemonstrated in stage IVS tumors [7]. Neuropeptides,including NPY, VIP and somatostatin are thought to play a Cell culture reagents were purchased from Gibco BRLrole in neural crest differentiation. Tyrrell and Landis (Grand Island, NY, USA). The cells were incubated in arecently studied NPY and VIP in embryonic neurons, humidified atmosphere of 95% air, 5% CO at 378C. The2

where transcriptional repression of peptide gene expression COS-7 cell line and the human neuroblastoma cell linesplays a role in the final neuropeptide profile of sympathetic IMR32 and SKNSH were purchased from American Typeneurons [8]. During embryonic development, NPY and Culture Collection (ATCC, Rockville, MD, USA). IMR32VIP are detected in dividing neuroblasts and in postmitotic cells were derived from a human abdominal primary andneurons of the rat superior cervical and stellate ganglial express multiple copies of MYCN [20], while SKNSH[8]. High plasma or tumor levels of VIP and somatostatin cells were derived from human bone marrow metastasescorrelate with neuroblast differentiation and are favorable and express a single copy of MYCN [21]. The neuro-prognostic indicators [5]. blastoma cell lines were grown in monolayers in minimal

Expression of somatostatin receptors has also been essential medium (MEM) supplemented with 15% heat-identified as a favorable prognostic indicator in neuro- inactivated fetal bovine serum (FBS), 100 U/ml penicillin,blastoma [9]. Somatostatin receptor (sst) expression has 100 mg/ml streptomycin and nonessential amino acids.been demonstrated in neuroblastoma tumor tissue by The COS-7 cells were grown in monolayers in Dulbecco’sseveral techniques, including scintigraphy [10], competi- modified eagle media (DMEM) supplemented with 10%tive binding to tumor membranes [11], ex vivo autoradiog- FBS, 100 U/ml penicillin, 100 mg/ml streptomycin andraphy of excised tumor tissue [12] and in vivo radiorecep- nonessential amino acids.tor guided surgery [13]. Moertel et al. demonstrated apositive correlation between somatostatin receptor expres- 2.3. RNA isolationsion and a favorable prognosis; in addition, these inves-tigators observed an inverse correlation between somatos- The TRIzolE method was used to isolate RNA fromtatin receptors and MYCN amplification [12]. Similarly, both cultured cells and from tissue. The TRIzolE protocolChen et al., demonstrated a positive correlation between is a modification of the guanidinium/phenol extraction

125high affinity binding of I-SS to tumor membranes, low [22,23]. Briefly, the cultured cell media was aspirated and14

clinical stage, and survival in children with neuroblastoma the cells washed with 1 3 PBS. The TRizolE reagent was[9]. added and cells lysed with exposure to the guanidinium

Five genes for somatostatin receptors (sst ) have [24]. The cell lysate mix was immediately exposed to the1–5

recently been cloned [14–19]; however, which receptor phenol component of the TRIzolE reagent. This mixturesubtypes are expressed in neuroblastoma has not yet been was left at room temperature for 10 min. Chloroform wasdelineated. Accordingly, our purpose was two-fold, first to added to the TRIzol /cell lysate mixture, the mixture left toanalyze the expression of the five receptor subtype genes stand for 2–3 min, and then centrifuged 12 000 3 g for 15in neuroblastoma tissue and second to study the effect of min. The aqueous layer was removed from the centrifugedexpression of specific receptor subtypes on neuroblastoma mixture. Isopropanol was added to precipitate the RNA,cell growth in vivo. The results have important implica- the pellet collected, washed with 75% EtOH and dried intions for the design of diagnostic and therapeutic protocols air (not subjected to vacuum centrifugation).utilizing somatostatin analogues in neuroblastoma. The TRIzolE method was applied to the frozen tumor

tissues. The frozen tissues were weighed into tared eppen-dorfs, kept frozen on dry ice while minced on a sterile

2. Materials and methods culture dish, and added to a sterile tube. Alternatively, amortar and pestle (chilled with liquid nitrogen) were used

2.1. Tumor procurement to grind the tumor tissue into a powder. The TRIzolEreagent was added to the tissue /powder to a volume of

Human neuroblastoma tumor specimens were obtained 1 ml per 100 mg tissue. The mixture was homogenizedthrough the Cooperative Human Tissue Network (CHTN). with an Omni micro-homogenizer (Omni International,

A.R. Albers et al. / Regulatory Peptides 88 (2000) 61 –73 63

Table 1Patient prognostic factors, and outcome

Patient no. Age at Dx Sex Primary Stage Shimada N-Myc Survivala b(months) location A/D

1 12 Male R IV U U Dc2 32 Female R IV U – A

3 10 Female A I F – A4 21 Male A IV U – D5 22 Female R IV – U D6 26 Male Abdomen III U F D7 40 Female A/R IV – U D8 84 Female M IV – F D9 4 Female A IV-S – F A

10 24 Female A IV U U D11 24 Female N II F F A12 1 day Female M III – – A13 96 Female A III – – A14 12 Female A IV High MKl U A15 12 Male A IV U F A16 42 Male A IV U F A17 8 Female Abdomen III F F A18 48 – A III U F D19 6 – M I U F A20 15 Female A III U F A21 – – – IV F F A22 12 Male A I – – A23 40 – M II – F A24 8 Male M I F F A25 24 Female A IV U U A26 4 Male M III F F A27 24 Female A IV – – D28 24 Female U IV U U D29 36 Female A IV – – D30 12 Female M III – – A31 60 Male A IV U U D32 – Male A III F U A

a A, adrenal; M, mediastinum; R, retroperitoneal; N, neck; F, favorable (unamplified); U, unfavorable (amplified).b A, alive; D, dead.c Information not available from Cooperative Human Tissue Network.

Gainesville, VA, USA) for two 15-s bursts, at room 48C. The master mix for reverse transcription of the totaltemperature. The TRIzolE /homogenized-tissue mixture RNA to cDNA was as follows: 25 mM MgCl , 10 3 PCR2

was further treated as above for cultured cells. buffer II (500 mM KCl, 100 mM Tris–HCl, pH 8.3),Total RNA was resuspended in diethylpyrocarbonate- DEPC-treated distilled water, dGTP, dCTP, dATP, dTTP,

treated (DEPC) water and quantified using UV spectro- MuLV reverse transcriptase, RNase inhibitor, randomphotometry at 260 nm. The Message Clean Kit (GenHun- hexamers, and 1 mg total RNA template. The 20-mlter Corporation, Nashville, TN, USA) was used to DNase reaction volume was placed at 238C for 10 min, 428C forthe isolated total RNA. Following DNase treatment, the 15 min, 998C for 5 min and cooled at 48C. The primers fortotal RNA was run on an agarose gel and stained with PCR amplification of c-abl, somatostatin (SS), somatos-ethidium bromide for UV visualization of the 28 and 18 S tatin receptor types one through five (sst ) were designed1–5

RNA bands, and an mRNA smear. Once the quality of the using the published sequences for the genes (Table 2). TheRNA prep was confirmed, RT-PCR analysis was used to master mix for the PCR reaction follows: 25 mM MgCl2

determine gene expression. solution, 10 3 PCR buffer II (as above), sterile (auto-claved) distilled water, and AmpliTaq DNA polymerase.

2.4. RT-PCR analysis of total RNA The program for PCR amplification was 5 min to reach948C, then 33 cycles of 1 min at 948C, 1 min at 63.88C,

The GeneAmp RNA PCR kit (Perkin Elmer, Roche and 1 min at 728C, and finally dwell at 48C. A 10-mlMolecular Systems, Branchburg, NJ, USA) was used to sample of PCR product was electrophoresed on an agaroseanalyze mRNA expression from total RNA isolated from gel and visualized using ethidium bromide staining andtumors or cultured cells. One mg each of the total RNA UV illumination.templates was first denatured, 5 min at 708C, and chilled to PCR products were confirmed using Southern analysis

64A

.R.

Albers

etal.

/R

egulatoryP

eptides88

(2000)61

–73

Table 2Primers and probes for somatostatin receptor genes

Gene Accession no. 59 Primer 39 Primer Probe sequence gDNA cDNA

product product

(bp) (bp)

c-abl M14752 TTC AGC GGC CAG TAG CAT CTG ACT T TGT GAT TAT AGC AGA CCC GGA G CCT TGG AGT TCC AAC GAG CGG CCT CAC TCA GAC CCT GAG GCT 764 201

SS J00306 TATGCTGTCCTGCCGCCTCCAG GAAGACAGGATGTGAAAGTCTTCCA CTG GGA CAG ATC TTC AGG TTC CAG GGC ATC ATT CTC CGT CTG 1234 356

sst M81829 CGC TGG CTG GTG GGC TTC GTG TTG CGC CGC CGG ACT CCA GGT TCT CAG ACA GCT GAC TCA CCG TGG CGT CGT CCT GCT CAG CAA ACG CGT 481 4811

sst M81830 CAT GGA CAT GGC GGA TGA G CTC AGA TAC TGG TTT GGA G GAG GTC AAA TGG AAT GGA TAG CCA TGT GTG GCT TCC ATT GAG 1107 11072

sst M96738 GCG AGC CGG CTT CAT CAT CTA CAC GAC CCG GCC GTT CAT CTC CTT C GGC AGT GGG CAC ACC ACG TTG ACG ATG TTG AGC ACG TAG AAG 517 5173

sst L14856 TGG TCG GCA GTC TTC GTG GTC TAC CTT GCG GCC GGG TTC TGG T CGC AGC TGT TGG CAT AGC TGA GGA TAA GGG ACA CGT GGT TGA 516 5164

sst D16827 GCG GCC TGG GTC CTG TCT CT CCC CCG CCT GCA CTC TCA C CTG GGG CAG CGC CAC GGC CAG GTT GAC GAT GTT GAC GGT GAA 627 6275


[25]. A 10-ml sample of each PCR reaction was run on a at setting 7 with 5-s bursts for 1 min to release sst and1

1% agarose gel, depurinated in 3 N HCl for 15 min, sst peptides. Supernatants were collected and pellets2

denatured with 0.4 N NaOH–0.6 M NaCl for 30 min, sonicated again. The respective sst and sst supernatants1 2

neutralized in 1.5 M NaCl–0.5 M Tris–HCl, pH 7.5, for 30 were filtered with a 0.45-mm filter (Nalgene, Rochester,min all with gentle agitation and at room temperature. The NY, USA) and the concentration was determined byproducts were transferred from the gel to a Hybond protein assay. The peptides were purified using Pharmaciamembrane (Amersham, Arlington Heights, IL, USA) by HisTrapE column system (Amersham Pharmacia Biotech,capillary action overnight. A stratalinker was used to Uppsala, Sweden) [26–28], dialyzed (Gibco, exclusionautocrosslink the transferred products to the membrane. size , 15 KD) in a 0.9% NaCl solution overnight at 48C,Membranes were prehybridized for 3 h at 608C in hybridi- and concentrated using a centriplus concentrator (Amicon,zation buffer supplemented with 100 mg/ml Herring sperm Beverly, MA, USA).DNA (Gibco BRL). Probes were designed nested to the Male rabbits (2–3 kg) were immunized with 500 mg ofPCR primers (Table 2). Five pmol of dephosphorylated sst or sst peptide in 0.5 ml 0.9% NaCl mixed with an1 2

DNA oligo were incubated for 10 min at 378C with equal volume of Freund’s adjuvant. The emulsified mix-1 3 Forward Reaction Buffer, 10 units T4 polynucleotide tures were injected with equal distribution through both

32kinase (Gibco BRL) and 2.5 ml [g- P] ATP (10 mCi/ml, intramuscular and subcutaneous routes [29]. Each initial3000 Ci /mmol, Amersham). Adding EDTA to 5 mM per injection was followed by four boosts (100 mg of peptide)reaction stopped labeling reactions. Labeled probes were at 3-week intervals. Serum was collected before each boostpurified using the Bio-Spin 6 prefilled column (Bio-Rad, and 3 weeks after the final boost; antisera was stored atHercules, CA, USA). The end-labeled oligos were then 2 208C.denatured by boiling for 10 min, chilled on ice, and addedto the hybridization buffer /membrane, and hybridization

2.6. Immunohistochemistryrun overnight at 608C. Following hybridization, the mem-branes were washed twice with 2 3 SSC (saline sodium

Paraffin sections of tumor were sectioned at 4 mm,citrate) at room temperature with agitation for 5 min each,placed on charged slides and deparaffinized. The slidestwice with 2 3 SSC–1% SDS (sodium dodecyl sulfate) atwere then blocked in 3% H O for 15 min at room658C with agitation for 30 min each, and finally twice with 2 2

temperature, washed in ddH O and placed into preheated0.1 3 SSC at room temperature with agitation for 30 min 2

Antigen Retrieval (Biogenix, San Ramon, CA, USA)each. The membranes were exposed to X-ray film for 1-solution. Slides were microwaved for 10 min on high andand 3-h exposures.left in a sealed container for 15 min, followed by washingin distilled H O three times, and then in OptiMax Wash2.5. Antisera preparation for immunohistochemistry of 2

Buffer (Biogenix, San Ramon, CA, USA). Slides weresst and sst1 2

incubated with PeroxiDaze 1 (Biocare Medical, WalnutCreek, CA, USA) for 15 min at room temperature, againAntibody to sst was generated using a synthetic peptide1

washed in Optimax buffer, and incubated in Power Blockantigen. An oligonucleotide coding for the terminal 57(Biogenix, San Ramon, CA, USA) for 10 min. Primaryamino acids of sst was cloned into the pET-32a( 1 )1

antibody (1:1000 sst antisera or 1:1000 sst antisera orvector (Novagen, Madison, WI, USA) as a C-terminus 1 2

1:1000 pre-immune antisera) in diluent buffer (Biomedia,fusion to thioredoxin using T4 DNA ligase (TA cloningFoster City, OH, USA) was added to the slide andkit, Invitrogen, Carlsbad, CA, USA). Similarly, an oligo-incubated at 408C overnight. Slides were washed innucleotide corresponding to the N-terminal 45 amino acids

OptiMax Wash Buffer 20 min at room temperature.of sst was cloned into pET-32a( 1 ) as a C-terminus2

Secondary antibody Biogenex multilink super sensitivefusion to thioredoxin. The resulting plasmids were se-biotinylated antibody was added to slides and incubated forquenced and the correct sequences confirmed. The plas-20 min at room temperature; slides were rinsed in OptiMaxmids were transformed into AD494 bacteria host strain

Wash Buffer for a minimum of 20 min, followed by(Novagen), and plated on LB plates containing ampicillinincubation in peroxidase-conjugated streptavidin labeland kanamycin overnight at 378C. Colonies were picked(Biogenix, San Ramon, CA, USA) for 20 min. Slides wereand cultured in 20 ml of LB media (containing 100 mg/ml

ampicillin and 30 mg/ml kanamycin) overnight in 378C rinsed in OptiMax Wash Buffer for 20 min. ABC (3-shaker. Bacterial cultures were diluted with fresh media amino-9-ethyl-carbazole) chromogen was applied for 10 to1:50 and cultured for 3 to 4 h until O.D. at 600 was greater 20 min depending on development of slides followed by

than 0.6. IPTG was added to final concentration of 1 mM rinsing in Optimax Wash Buffer and distilled water.to induce protein expression for 2 h. Bacteria were Slides were counterstained with hematoxylin for 10 s,collected by centrifugation at 8000 3 g for 10 min. The rinsed in distilled water, cemented with crystal mount,pellets were resuspended in Start buffer (1 3 PBS and 10 placed in a 60 to 808C oven for 15 min and cover-slippedmM imidazole, pH of 7.4) and sonicated using a polytron with Permamount (Biogenix, San Ramon, CA, USA).


112.7. Expression of sst and sst in cultured cells Tyr ]-somatostatin (Amersham) and unlabeled SS1 2 14 14

(Peninsula, Belmont, CA, USA) as well as two long-actingA cassette containing bp 7–1498 of sst (accession no. analogues of SS ; octreotide (SMS 201-995, DPhe-Cys-1 14

M81829) was provided by Graeme Bell. The cassette was Phe-DTrp-Lys-Thr-Cys-Thr(ol), Sandoz, Basel, Switzer-1,2,5 8cloned into the EcoRV site of pcDNA (Invitrogen, San land) and CH275 (des-amino acid [D-tryptophan , N-p-3

9Diego, CA, USA) by the addition of linkers to the blunt isopropyl-4-aminomethyl-L-phenylalanine ]SRIF) [30].end the cassette. Primers designed to amplify bp 82–1192 Receptor-expressing cell lines were plated in seven wellsof sst (accession no. M81830) were used for PCR to of a 24-well plate. Serum-free MEM was used to wash the2

amplify a sst cDNA from RNA isolated from the IMR32 cells, and 400 ml of Buffer S (50 mM HEPES, 10 mM2

neuroblastoma cell line. The PCR product was ligated into CaCl , 5 mM MgCl , 50 mg/ml bacitracin, 200 KIU/ml2 2

a PCRII cloning vector (Invitrogen) and subcloned to the aprotinin, 0.5% BSA, 0.02 mg/ml PMSF, pH 7.5) was125 11pcDM8 plasmid (Invitrogen). Both plasmid constructs added to each well. [ I-Tyr ]-somatostatin (Amer-14

were confirmed by dideoxy DNA sequencing [25]. The sham) resuspended in 0.05 M acetic acid and diluted inplasmid constructs pcDNA /sst , pcDM8/sst and Buffer S 1 0.5% human serum albumin was added at3 1 2

pcDNA /sst were transiently expressed in low passage 50 000 cpm per well in 50 ml. Dilutions of respective3 2

COS-7 cells (passage 14 or less) for 24 h at which point unlabeled peptides in Buffer S were made and 50 ml addedtotal binding was determined by whole-cell plate binding per well at 0, 0.01, 0.1, 1, 0.01, 0.1, and 1 mM final

125with I-SS (100 000 cpm per 50 ml per 35-mm well). concentrations of unlabeled peptide. The binding reactions14

The transient transfection was run in cells plated at 1.5 3 were incubated at 378C, 5% CO for 30 min, at which2510 cells per 15.5-mm diameter well culture plate (Corn- point the reaction mixture was aspirated, the cell mono-

ing, Corning, NY, USA) 24 h prior to transfection. At layer washed, and 500 ml of trypsin–EDTA added totransfection, the cells were washed with serum-free media, release the monolayer. The cells were collected in Bio-followed by addition of 0.8 ml of Optimem (Gibco BRL) Vials (Beckman, Fullerton, CA, USA) and the mixturesmedia. Two mg of plasmid DNA were added to 100 ml of counted on a gamma counter (Beckman, Irvine, CA, USA).Optimem per well and mixed with 4 ml Lipofectamine per Competitive binding data was analyzed using the LIGAND

100 ml Optimem per well. The DNA/Lipofectamine program [31,32] to generate affinity constants (K ) for theD

mixture was incubated at 258C for 45 min and then added respective unlabeled peptides.to the monolayer cells. After a 4-h incubation at 378C, 1ml of DMEM/20% FCS was added to each well. The cells 2.9. Neuroblastoma xenograft formationwere incubated for 48 h at which point, total bindinganalysis was run. Wild-type SKNSH, SKNSH/sst and SKNSH/sst cells1 2

7The pcDNA /sst construct and the pcDM8/sst plus3 1 2 were harvested during log phase growth; 3 3 10 cellspsV2Neo (Invitrogen) constructs were transfected into were injected into the hind limb of male nude mice asSKNSH neuroblastoma cells using Transfectam (Promega, previously described [33]. The tumor growth was moni-Madison, WI, USA) for the pcDM8/sst 1 psV2Neo con-2 tored daily and tumor size determined by caliper measure-structs or Lipofectamine (Gibco BRL) for pcDNA /sst .3 1 ment.SKNSH cells were cultured in MEM with 15% FBS, 1%l-glutamine, penicillin / streptomycin, and nonessentialamino acids. Selection with geneticin (G418, Gibco BRL)

3. Results500 mg/ml, yielded SKNSH cells expressing either sst or1

sst . These cells were subjected to limiting dilution in2

96-well culture plates (Corning, Corning, NY, USA) and 3.1. Somatostatin receptor expression in humansubsequent clonal expansion from a single cell. The neuroblastoma tumorsresulting cell lines expressing either sst or sst were then1 2

analyzed for sst and sst expression by RT-PCR analysis. Thirty-two neuroblastoma tumor specimens were pro-1 2

Briefly, total RNA was isolated from monolayer cells vided by the CHTN (Table 1). The age of patients atusing the TRIzolE reagent (above) and reverse transcrip- diagnosis ranged from 1 day to 8 years. Tumor distributiontion run using random hexamers and RT (as above). PCR was 50% adrenal, 19% mediastinal, 12% retroperitoneal,analysis using primers for sst , sst , and c-abl confirmed and 6% abdominal which is consistent with the frequency1 2

the molecular upregulation of the receptor genes. of primary sites in neuroblastoma [4]. Clinical staging isalso indicated in Table 1: 50% were stage IV, 28% were

2.8. Competitive binding of somatostatin , octreotide stage III, 18% were stages I / II, and 1 patient was stage14

and CH275 IV-S. Shimada classification was 41% unfavorable, 19%favorable, and 41% not classified. MYCN analysis of the

To confirm protein expression, the cell lines were 26 cases indicated 41% with a single copy of MYCN,125subjected to competitive binding analysis using [ I- while 28% had amplified MYCN by Southern blot DNA


analysis. MYCN analysis was not available for 28% of thecases. Survival at most recent follow up remained at 59%overall and 38% for patients with stage IV; however, noneof the patients are . 5 years at diagnosis.

Two neuroblastoma cell lines, IMR32 and SKNSH,were subjected to RT-PCR analysis and Southern con-firmation as control samples. The housekeeping gene, c-abl, was expressed in both cell lines; somatostatin cDNAwas not detected in either of the cell lines. The receptorsubtype analysis demonstrated very low, but detectable sst1

and sst in both SKNSH and IMR32 cells; sst and sst4 2 5

were expressed in IMR32 cells, but not in SKNSH; sst3

was not expressed in either cell line (Table 3).Thirty-two neuroblastoma tumor samples obtained at

diagnosis were subjected to RNA isolation and RT-PCRanalysis (Fig. 1) with confirmation by Southern blot (Fig.

Fig. 2. Neuroblastoma RT-PCR cDNA southern analysis for c-abl (2A),2). Expression of the constitutively transcribed c-abl wasSS (2B), sst (2C) and sst (2D). PCR products of amplified cDNA were1 2included as a positive control for RNA quality [34]. Alltransferred to a Hybond membrane and crosslinked to the membrane

tumor specimens were positive for the 201 bp c-abl gene using a Stratalinker. Internal oligonucleotide probes (Table 2) end-labeled32cDNA product (Fig. 2); the 764 bp gDNA product was not with [g-P ]dATP using T4 polynucleotide kinase were used to probe the

membranes by hybridization at 4200 overnight. The membranes wereseen in any of the 32 samples, indicating RNA free ofwashed at 658C following hybridization. (A) Amplified cDNA products inDNA contamination. Somatostatin cDNA of the expectedlanes 1–12 are positive for 201 bp c-abl cDNA PCR product and negative356 bp size was positive in 30/32 tumor tissue RNAfor the 764 bp c-abl gDNA product. (B) Amplified cDNA products are

samples for 94% expression, with 0 /32 tumors showing positive for 355 bp cDNA SS PCR product in lanes 1–12, and negativethe 1234 bp product for somatostatin gDNA, again verify- for 1233 bp SS gDNA PCR product. (C) Amplified cDNA products in

lanes 1–12 are positive for 481 bp sst PCR product. (D) Amplifieding the purity of the RNA. Four of the somatostatin 1

cDNA products are positive for 1107 bp PCR product in lanes 1–3, 6,receptor genes are intronless [35]; that the product gener-8–10, and 12, and negative for 1107 bp PCR product in lanes 4, 5, 7 andated is the result of amplification of cDNA transcribed11.

from mRNA is substantiated by the lack of gDNA

products for either c-abl or SS , and the positive SouthernTable 3 14

blot analysis using nested probes (Fig. 2). ReceptorExpression of sst , somatostatin (SS), and c-abl (cabl) in neuroblastoma1–5

cell lines expression as measured by RT-PCR, was 100% for sst ,1

84% for sst 32% for sst , 75% for sst , and 22% for sst .sst sst sst sst sst SS cabl 2 3 4 51 2 3 4 5

Loss of sst expression was seen only in stage III and stage2IMR32 1 1 2 1 1 2 1IV tumors (Table 4).SKNSH 1 2 2 1 2 2 1

Multiple tissue samples were analyzed from four of the32 patients included in our study (Table 5). The sst1

receptor mRNA was identified in all samples, both atdiagnosis and at relapse. All four patients were positive forsst at diagnosis. The sst receptor was down regulated2 2

with progression of disease in two patients. In one of thesetwo patients, tumor samples were analyzed at diagnosis, atsecond look surgery, and at relapse. Positive sst expres-2

sion was observed at diagnosis and at a second surgery, but

Table 4Expression of somatostatin receptors in neuroblastoma at diagnosis

Fig. 1. Neuroblastoma total RNA analyzed by RT-PCR. Total RNATumor c-abl sst sst sst sst sst SS1 2 3 4 5isolated from tumor no. 1 (Table 1) was transcribed to cDNA usingstage

reverse transcriptase and random hexamers (Roche). PCR amplification ofcDNA was performed as described in Methods. PCR products were Stage I 4 /4 4/4 4/4 2/4 3/4 1/4 4/4separated by agarose electrophoresis (1% agarose /1 3 TAE gel at 80 V, 1 Stage II 2 /2 2/2 2/2 1/2 2/2 1/2 2/2h) and visualized using ethidium bromide. Lane 1: sst 481 bp product; Stage III 9 /9 9 /9 7/9 1/9 7/9 1/9 9/91

lane 2: sst 1107 bp product; lane 3: sst no product; lane 4: sst 516 bp Stage IV 16/16 16/16 13/16 7/16 12/16 3/16 14/162 3 4

product; lane 5: sst no product; lane 6: SS 355 bp cDNA product only; Stage IVS 1/1 1/1 1/1 0/1 1/1 1/1 1/15

lane 7: c-abl 201 bp cDNA product only; lane 8: 100 bp ladder, GibcoTotal 32 /32 32/32 27/32 11/32 26/32 7/32 30/32

BRL.


Table 5 component of the tumor, including neuroblasts and neuro-Somatostatin receptor expression during tumor progression nal (Fig. 3A, D). The expression of sst and sst is also1 2

Tumor no. Initial biopsy Second biopsy Relapse clearly demonstrated on the endothelial cells of tumorvessels, but not on vascular collagen (Fig. 3C, F). These92-06-I09 sst , sst , sst sst , sst sst , sst1 2 4 1 2 1 4

94-03-I13 sst , sst , sst sst , sst results demonstrate that the sst and sst mRNA detected1 2 4 1 4 1 295-07-P003 sst , sst , sst , sst sst , sst , sst , sst1 2 3 4 1 2 3 4 by RT-PCR is translated into receptor protein.94-05-I22 sst , sst , sst , sst sst , sst , sst , sst1 2 4 5 1 2 4 5

3.3. Stable expression of sst and sst in neuroblastoma1 2

no sst expression was seen at relapse. In the second cell lines2

patient with down regulation of sst , the tumor sample2

from diagnosis was positive for sst while the tumor The cell line SKNSH was selected for stable transfection2

sample obtained at relapse was negative for sst expres- with sst and sst due to the very low expression of sst2 1 2 1

sion. The third patient from whom multiple samples were and non-detectable sst . Transcriptional upregulation of2

analyzed had positive sst expression in tumor samples both receptor genes was demonstrated by RT-PCR analysis2

obtained at initial diagnosis and at relapse. In the fourth in transfected SKNSH (Fig. 4). Translation into functionalpatient, specimens were obtained from two different foci at receptor protein was confirmed by increased bindingdiagnosis; identical patterns of expression of sst –sst compared to wild-type SKNSH cells which show no1 5

were observed in the two samples (Table 5). detectable high affinity binding (Fig. 5, Table 6). Highaffinity binding of SS was demonstrated in both the14

3.2. Immunohistochemistry of sst and sst in SKNSH/sst and SKNSH/sst cell lines with K s of1 2 1 2 D

neuroblastoma tumors 0.4360.04 and 0.7360.05 nM, respectively (Table 7).CH275 bound to sst expressing cells (K 5 5.662.8 nM)1 D

Neuroblastoma tumors are heterogeneous with respect to but did not bind to SKNSH/sst cells (K . 200 nM).2 D

neuroblastic and Schwann-like cells. The sst and sst Octreotide did not bind to SKNSH/sst cells (K . 2001 2 1 D

receptors appear to be expressed in the neuroblastic nM), but bound to SKNSH/sst (K 5 12.067.8 nM).2 D

Fig. 3. Immunohistochemistry of sst and sst in primary neuroblastoma tumor. Neuroblastoma tissue (tumor no. 9 in Table 1) stained positive for sst1 2 1

antisera (1:1000 dilution) (A–C) and positive for sst antisera (1:1000 dilution) (D–F). The paraffin sections were incubated in primary antisera and2

detected using multi-link anti-rabbit secondary antibody immunoperoxidase. Images were taken at magnification of 4 3 (A,D), 40 3 (B,E) and 100 3

(C,F). Panel B (enlargement of box inset in A) shows the antisera staining various maturing states of neuroblasts. Panel E (enlargement of box inset in D)demonstrates the focal staining of sst antisera. Panels C and F demonstrate sst and sst staining (respectively) of endothelial cells of vascular tissue. The2 1 2

black bar designates 0.5 mm in A,D; 0.05 mm in B,E; and 0.025 mm in C,F.


Fig. 4. RT-PCR confirmation of sst and sst upregulation in SKNSH neuroblastoma cells. Respective volumes of 100 ml of RT-PCR reactions1 2

electrophoresed on a 1% agarose-1 3 TAE gel, stained with ethidium bromide, and photographed under UV illumination. Confirmation of RNA quality bypositive expression of c-abl cDNA product. Lane 1: 100 bp DNA ladder (Gibco BRL); lane 2: 20 ml SKNSH cDNA product, 481 bp sst product; lane 3:1

10 ml SKNSH cDNA product, no 1107 bp sst product; lane 4: 10 ml SKNSH cDNA product, 201 bp c-abl cDNA product only; lane 5: 5 ml2

SKNSH/pcDNA3/sst cDNA product, 481 bp sst product; lane 6: 10 ml SKNSH/pcDNA3/sst cDNA product, 201 bp c-abl cDNA product only; lane 7:1 1 1

5 ml SKNSH/pcDM8/sst cDNA product, 1107 bp sst product; lane 8: 10 ml SKNSH/pcDM8/sst cDNA product, 201 bp c-abl cDNA product only2 2 2

primers; lane 9: 100 bp ladder (Gibco BRL).

11 125Fig. 5. Somatostatin receptor expression in stably transfected SKNSH neuroblastoma cells. Competitive binding of somatostatin-[tyr ] 3-[ I]11iodotyrosyl versus unlabeled SS was performed on SKNSH/pSV2neo, on SKNSH/pcDNA sst , and on SKNSH/pcDM8sst neuroblastoma cells.14 3 1 2

Cultured SKNSH/psv2neo (j), SKNSH/pcDNA3sst (m), and SKNSH/pcDM8sst (d) cells plated in seven wells each in a Corning 24-well culture1 2125plate. Cells were incubated for 30 min at 378C, 5% CO in Buffer S, 15 pmoles I-SS , and indicated concentration of unlabeled peptide after which the2 14

reaction mixture was aspirated and cells were washed with serum-free MEM (Gibco BRL). The cells were trypsinized and counted on a gamma counter(Beckman).


Table 6 3.4. Effect of sst and sst expression on generation of1 2125Competitive binding analysis of SS , octreotide, and CH275 with [ I-14 SKNSH xenografts in vivo11Tyr ] somatostatin in SKNSH/pcDNA3/sst and SKNSH/pcDM8/14 1

sst2When SKNSH/sst and SKNSH/sst cells were injected1 2a aPeptide K (nM) K (nM)D D into nude mice, xenograft tumor formation was signifi-

SKNSH/pcDNA3/sst SKNSH/pcDM8/sst1 2 cantly delayed compared to wild-type SKNSH cells. AsSS 0.4360.04 0.7360.0514 shown in Fig. 6, the mean time to development of wild-Octreotide . 200 12.067.8

b type SKNSH xenograft tumors was 10 days. Expression ofCH275 5.662.8 . 200functional sst resulted in a delay of tumor development to1a Receptor expressing cell lines were plated in seven wells of a 24-well 33 days (P , 0.001); similarly, sst upregulation delayed125 2plate. I-SS was added at 50 000 cpm per well in 50 ml per well.14 tumor development to 23 days which is also significantlyDilutions of respective unlabeled peptides in Buffer S were made and 50

211 26 delayed compared to wild-type SKNSH (P , 0.05). Thisml added per well at 0, 10 –10 M. The binding reactions wereincubated at 378C, 5% CO for 30 min. The cells were collected and the inhibition was observed in the absence of administering2

mixtures counted on a gamma counter (Beckman). Affinity was estimated exogenous somatostatin to the mice, suggesting that en-using LIGAND. dogenous somatostatin is sufficient to occupy the upregu-b 1,2,5 8 9des-AA [DTrp IAmp ]SRIF.

lated sst and sst .1 2

4. DiscussionTable 7Tumors examined by immunohistochemistry using pre-immune, anti-sst1 Our work presents the first molecular analysis of sstand anti-sst antisera2 expression in human neuroblastoma tumors. We analyzedTumor RT-PCR RT-PCR Pre- SST SST1 2 the expression of the somatostatin peptide gene as well as

SST SST immune AB AB1 2 expression of five somatostatin receptors in 32 tumors1 1 1 2 1 1 from patients with neuroblastoma. All tumors analyzed5 1 1 2 1 1 expressed sst while 27/32 expressed sst .1 26 1 1 2 1 1

The lack of expression of sst in 16% of the tumor28 1 1 2 1 1samples analyzed closely approximates the 15% false9 1 1 2 1 1

13 1 1 2 1 1 negative rate of somatostatin receptor based scintigraphy20 1 1 2 1 1 observed in neuroblastoma patients [10,36,37]. Downregu-22 1 1 2 1 1 lation of sst with progression of disease may explain the2

Fig. 6. Effect of upregulation of somatostatin receptors on tumorigenesis. SKNSH cells with or without upregulated receptor expression were harvested inlog phase growth and immediately injected into the subcutaneous space of hind limb of 4-week-old male nude mice. Survival analysis for xenografttumorigenesis was performed using Kaplan–Meier statistics.


negative scintigraphy in some patients with known disease. Expressions of mRNA and receptor protein do notIn our previous study of eight patients who underwent always correlate. While sst mRNA has been identified in1123I-tyr-3-octreotide scintigraphy, two patients had nega- several tumors, the lack of sst specific ligands has made1

tive scintigraphy in the presence of progressive disease identification of functional sst receptor protein difficult.1

[36]. RT-PCR analysis of an additional two patients both Our own studies demonstrate barely detectable sst mRNA1125at diagnosis and at relapse has now confirmed this down in SKNSH cells, but non-detectable binding of I-SS .14

regulation of sst with progression of neuroblastoma. A The availability of a sst specific ligand has allowed the2 1125larger prospective study will be required to determine demonstration of high affinity binding of I-SS in both14

whether down regulation of sst contributes to tumor transiently transfected COS-7 cells and in stably transfect-2

progression. ed SKNSH cells. Expression of sst protein is demon-1

Our results differ somewhat from earlier observations by strated here using specific antisera. The expression of sst1

Reubi [38]; these investigators examined a smaller number and sst appears to be predominantly in neuroblastic type2

(six) of neuroblastoma tumors by in situ hybridization and cells. However, endothelial cells on vessels in the tumorautoradiography. No sst mRNA was observed in any of also clearly demonstrate expression of sst and sst . This1 1 2

the six tumors examined, in contrast to our finding of sst latter observation confirms the results of Reubi and1

mRNA in 32/32 tumors. The lack of sst mRNA as colleagues who detected sst expression in angiogenic1 2

demonstrated by in situ hybridization may be the result of vessels of several tumor types, including neuroblastomainsensitivity of this technique compared to RT-RCR. The [44].inability to detect sst protein by autoradiography may Positive sst mRNA expression has been demonstrated1 2

reflect the low affinity of radiolabeled Octreotide for sst in neuroendocrine tumors, which were negative by Oc-1

and the susceptibility of radiolabeled somatostatin to treoScan scintigraphy [45]. The in vitro binding ofprotease digestion [39]. somatostatin analogues to viable neuroblastoma cells con-

Reubi and colleagues observed sst by autoradiography stitutively expressing a specific receptor subtype has2125using I-octreotide as the ligand. The small number of provided an effective means for studying the pharmacolog-

tumors examined and the ability of octreotide to bind to ic characteristics of each sst in vitro in neuroblastomasst and sst , albeit with lower affinity than to sst , may cells. The effect of upregulation of each sst on tumor3 5 2

explain their observation that 6 /6 neuroblastomas express formation in vivo demonstrated the cytostatic potential ofsst . The long-acting analogue currently exploited in somatostatin. Delayed formation of both SKNSH/sst and2 1

somatostatin receptor based imaging is octreotide; it binds SKNSH/sst xenografts was observed in the absence of2

with high affinity to sst , with intermediate affinity to sst added somatostatin, suggesting that endogenous ligand was2 3

and sst , but with low affinity to sst and sst [40]. available to initiate the signal transduction pathway. The5 1 4

Expression of sst in 100% of neuroblastoma tumor tumors, which did develop, continued to express mRNA1

samples both at diagnosis and at relapse suggests an for sst or sst thus, while somatostatin may exert a1 2

analogue with high affinity to sst would image 100% of cytostatic effect, it is not cytocidal. Similar observations1

neuroblastoma tumors. have been made in neuroendocrine tumors such as car-Expression of sst in several other human tumors has cinoid, and in breast cancer [46]. Somatostatin analogues1

been recently reported. Kubota et al. studied glucagonoma, appear to alleviate symptomatology and may slow tumorinsulinoma, pheochromocytoma and carcinoid tumor types progression, but do not kill the tumor.[41] using RT-PCR analysis and found sst expression in These studies demonstrate the expression of somatos-1

all 12 tumors. Vikiv-Topic et al. reported sst expression in tatin and two somatostatin receptors in the majority of1

73% of 55 human breast tumor specimens, as well as in primary neuroblastomas in children. The physiologic anal-85% of 28 human carcinoid and renal cell tumor speci- ysis of somatostatin receptor expression in neuroblastomamens analyzed by RT-PCR [42]. While expression of sst cell lines and xenografts demonstrate a potential role for2

in Vikiv-Topic’s study was higher than the expression of somatostatin in tumor prevention and also in control ofsst , these combined results suggest an analogue that tumor progression. Taken together, these studies offer1

recognizes both sst and sst would offer more effective exciting prospects in understanding the biology and im-1 2

receptor based imaging. CH275 binds to human sst with proving the clinical management of neuroblastoma.1

high affinity [30], but has low affinity (K . 200 nM) forD

sst . Several analogues, including octreotide, lanreotide2

and octatide bind to sst with high affinity, but do not2 Referencesrecognize sst . Thus, a single ligand with dual specificity1

or a combination of sst and sst specific ligands may1 2[1] Anderson DJ. Molecular control of cell fate in the neural crest: theimprove the sensitivity of somatostatin receptor scintig-

sympathoadrenal lineage. Annu Rev Neurosci 1993;16:129–58.raphy in neuroblastoma. A multi-tyrosinated analogue with [2] Ambros IM, Zellner A, Roald B, Amann G, Ladenstein R, Printz Dintermediate affinity for both sst and sst has recently et al. Role of ploidy, chromosome 1p, and schwann cells in the1 2

been described by our group [43]. maturation of neuroblastoma. N Engl J Med 1996;334:1505–11.


[3] Shimada H, Chatten J, Newton Jr. WA, Sachs N, Hamoudi AB, acid guanidinium thiocyanatephenol–chloroform extraction. AnalChiba T et al. Histopathologic prognostic factors in neuroblastic Biochem 1987;62:156–9.tumors: definition of subtypes of ganglioneuroblastoma and an [23] Chomczynski P. Biotechniques 1993;15:532.age-linked classification of neuroblastomas. J Natl Cancer Inst [24] Chirgwin JJ, Przbyla AE, MacDonald RJ, Rutter WJ. Isolation of1984;73:405–16. biologically active ribonucleic acid from sources enriched in ribonu-

clease. Biochemistry 1979;18:5294.[4] Brodeur GM, Castleberry RP. In: Neuroblastoma. principles and[25] Sambrook J, Fritsch EF, Maniatis T. In: Nolan C, Ferguson M,practice of pediatric oncology, Third Edition:, 1997, pp. 761–97.

editors, Molecular cloning a laboratory manual, New York: Cold[5] Qualman SJ, O’Dorisio MS, Fleshman DJ, Labanowski J, ShimadaSpring Harbor Laboratory Press, 1989.H, O’Dorisio TM. Neuroblastoma: correlation of neuropeptide

[26] Purification and renaturation of recombinant proteins produced inexpression in tumor tissue with other prognostic factors. CancerEscherichia coli as inclusion bodies. Amersham Pharmacia Biotech.1992;70:2005–12.1999;18:1112–33.[6] Rascher W, Kremens B, Wagner S, Feth F, Hunneman DH, Lang

[27] Colangeli R, Heijbel A, Williams AM, Manca C, Chan J,RE. Serial measurements of neuropeptide Y in plasma for moni-Lyashchenko K et al. Three-step purification of lipopolysaccharide-toring neuroblastoma in children. J Pediatr 1993;122:914–6.free polyhistidine-tagged recombinant antigens of Myobacterium[7] Cohen PS, Cooper MJ, Helman U, Thiele CJ, Seeger RC, Israeltuberculosis. J Chromatogr B 1998;714:223–35.MA. Neuropeptide Y expression in the developing adrenal gland and

[28] Rapid and efficient purification and refolding of a (His)6-taggedin childhood neuroblastoma tumors. Cancer Res 1990;50:6055–61.recombinant protein produced in E. coli as inclusion bodies.[8] Tyrrell S, Landis SC. The appearance of NPY and VIP in sympa-Amersham Pharmacia Biotech. 1999;18:1134–1137.thetic neuroblasts and subsequent alterations in their expression. J

[29] Biswas NM, Ghosh PK, Neuhaus OW. Effect of corticosterone onNeurosci 1994;14:4529–47.serum concentration of a2 globulin and on spermatogenesis in[9] O’Dorisio MS, Chen F, O’Dorisio TM, Wray D, Qualman S. u

estrogen-treated rats. J Endocrinol 1982;92:309–14.Characterization of somatostatin receptors on human neuroblastoma[30] Liapakis G, Hoeger C, Rivier J, Reisine T. Development of atumors. Cell Growth Differ 1994;5:1–8.

selective agonist at the somatostatin receptor subtype SSTR1. J[10] Sautter-Bihl ML, Dorr U, Schilling F, Treuner J, Bihl H. Somatos-Pharmacol Exp Therapeut 1996;276:1089–94.tatin receptor imaging: a new horizon in the diagnostic management

[31] McPherson GA. Analysis of radioligand binding experiments: Aof neuroblastoma. Semin Oncol 1994;21:38–41.collection of computer programs for the IBM PC. J Pharmacol Meth[11] Maggi M, Baldi B, Finetti G, Franceschelli F, Brocchi A, Lanzillotti1985;14:213–28.R et al. Identification, characterization, and biological activity of

[32] Munson PJ, Rodbard D. LIGAND: A versatile computerized approachsomatostatin receptors in human neuroblastoma cell lines. Cancerfor the characterization of ligand binding systems. Anal BiochemRes 1994;54:124–33.1980;107:220–39.[12] Moertel CL, Reubi JC, Scheithauer BS, Schaid DJ, Kvols LK.

[33] Martinez DA, Kahwash S, O’Dorisio MS, Lloyd TV, McGhee RB,Expression of somatostatin receptors in childhood neuroblastoma.Qualman SJ. Disseminated neuroblastoma in the nude rat: aAm J Clin Path 1994;102:752–6.xenograft model of human malignancy. Cancer 1996;77:409–19.[13] Martinez DA, O’Dorisio MS, O’Dorisio TM, Qualman SJ, Caniano

[34] Murad AL, deCock J, Brown DK, Smerdon MJ. Variations inDA, Teich S et al. Intraoperative detection and resection of occulttranscription-repair coupling in mouse cells. J Biol Chemneuroblastoma: a technique exploiting somatostatin receptor expres-1995;270:3949–57.sion. J Pediat Surg 1995;30:1580–9.

[35] Woltering EA, O’Dorisio MS, O’Dorisio TM. The role of radio-[14] Yamada Y, Post SR, Wang K, Tager HS, Bell GI, Seino S. Cloninglabelled somatostatin analogs in the management of cancer patients.and functional characterization of a family of human and mouseIn: DeVita VT, Hellman S, Rosenberg SA, editors, Principles andsomatostatin receptors expressed in brain, gastrointestinal tract, andprogress in oncology: updates, J.B. Lippincott, 1995, pp. 1–16.kidney. Proc Natl Acad Sci 1992;89:251–5.

[36] O’Dorisio MS, Hauger MA, Cecalupo AJ. Somatostatin receptors in[15] Yamada Y, Reisine T, Law SF, Ihara Y, Kubota A, Kagimoto S et al.neuroblastoma: diagnostic and therapeutic implications. SeminSomatostatin receptors, an expanding gene family: cloning andOncol 1994;21:33–7.functional characterization of human SSTR3, a protein coupled to

adenylyl cyclase. Mol Cell Endocrinol 1992;6:2136–42. [37] Krenning EP, Kwekkeboom DJ, Bakker WH, Breeman WAP, Kooij111PPM, Oei HY et al. Somatostatin receptor scintigraphy with [ In-[16] Rohrer L, Raulf F, Bruns C, Buettner R, Hofstaedter F, Schule R.

123 3DTPA-d-Phe]- and p I-Tyr ]-octreotide: the Rotterdam experienceCloning and characterization of a fourth human somatostatin re-with more than 1000 patients. Eur J Nucl Med 1993;20:716–31.ceptor. Proc Natl Acad Sci USA 1993;90:4196–200.

[38] Reubi JC, Schaer J, Waser B, Mengod G. Expression and localiza-[17] Xu Y, Song J, Bruno JF, Berelowitz M. Molecular cloning andtion of somatostatin receptor SSTR1, SSTR2, and SSTR3 messengersequencing of a human somatostatin receptor, hSSTR4. BiochemRNAs in primary human tumors using in situ hybridization. CancerBiophys Res Commun 1993;193:648–52.Res 1994;54:3455–9.[18] Yamada Y, Kagimoto S, Kubota A, Yasuda K, Masuda K, Someya Y

[39] Pless J, Bauer W, Briner U, Doepfner W, Marbach P, Maurer R et al.et al. Cloning, functional expression and pharmacological characteri-Chemistry and pharmacology of SMS 201-995, a long-actingzation of a fourth (hSSTR4) and a fifth (hSSTR5) human somatos-octapeptide analogue of somatostatin. Scand J Gastroenteroltatin receptor subtype. Biochem Biophys Res Commun1986;21:54–64.1993;195:844–52.

[40] Patel YC, Srikant CB. Subtype selectivity of peptide analogs for all[19] Raynor K, Murphy W, Coy D, Taylor J, Moreau J-P, Yasuda K et al.five cloned human somatostatin receptors (hsstr 1–5). Endocrinolo-Cloned somatostatin receptors: identification of subtype-selectivegy 1994;135:2814–7.peptides and demonstration of high affinity binding of linear

peptides. Mol Pharmacol 1993;43:838–44. [41] Kubota A, Yamada Y, Kagimoto S, Shimatsu A, Imamura M, TsudaK et al. Identification of somatostatin receptor subtypes and an[20] Tumilowicz JJ, Nichols WW, Cholon JJ, Greene AE. Definition of aimplication for the efficacy of somatostatin analogue SMS 201-995continuous human cell line derived from neuroblastoma. Cancer Resin treatment of human endocrine tumors. J Clin Invest1970;30:2110–8.1994;93:1321–5.[21] Biedler JI, Nelson I, Spengler BA. Morphology and growth,

[42] Vikic-Topic S, Raisch KP, Kvols LK, Vuk-Pavolvic S. Expression oftumorgenicity and cytogenetics of human neuroblastoma cells insomatostatin receptor subtypes in breast carcinoma, carcinoid tumor,continuous culture. Cancer Res 1973;33:2643–52.and renal cell carcinoma. J Clin Endocrinol Metab 1995;80:2974–9.[22] Chomczynski P, Sacchi N. Single-step method of RNA isolation by


[43] Woltering BA, O’Dorisio MS, Murphy WA, Chen F, Drouant GJ, et al. Positive somatostatin receptor scintigraphy correlates with theEspenan GD et al. Synthesis and characterization of multiply- presence of somatostatin receptor subtype 2. Gut 1996;38:33–9.tyrosinated, multiply-iodinated somatostatin analogs. J Peptide Res [46] Weckbecker G, Tolcsvai L, Stolz B, Pollak M, Bruns C. Somatos-1999;53:201–13. tatin analogue octreotide enhances the antineoplastic effects of

[44] Denzler B, Reubi J-C. Expression of somatostatin receptors in tamoxifen and ovariectomy on 7,12-dimethylbenz(a)anthracene-in-peritumoral veins of human tumors. Cancer 1999;85:188–98. duced rat mammary carcinomas. Cancer Res 1994;54:6334–7.

[45] John M, Meyerhof W, Richter D, Waser B, Schaer J-C, Scherubl H

somatostatin receptor gene expression in neuroblastoma

Documents