Site-Directed Mutagenesis of the Heterotrimeric Killer Toxin ZymocinIdentifies Residues Required for Early Steps in Toxin Action

Sabrina Wemhoff, Roland Klassen,* Friedhelm Meinhardt

Institut für Molekulare Mikrobiologie und Biotechnologie, Westfälische Wilhelms-Universität Münster, Münster, Germany

Zymocin is a Kluyveromyces lactis protein toxin composed of ��� subunits encoded by the cytoplasmic virus-like element k1and functions by ��-assisted delivery of the anticodon nuclease (ACNase) � into target cells. The toxin binds to cells’ chitin andexhibits chitinase activity in vitro that might be important during � import. Saccharomyces cerevisiae strains carrying k1-de-rived hybrid elements deficient in either �� (k1ORF2) or � (k1ORF4) were generated. Loss of either gene abrogates toxicity, andunexpectedly, Orf2 secretion depends on Orf4 cosecretion. Functional zymocin assembly can be restored by nuclear expressionof k1ORF2 or k1ORF4, providing an opportunity to conduct site-directed mutagenesis of holozymocin. Complementation re-quired active site residues of �’s chitinase domain and the sole cysteine residue of � (Cys250). Since �� are reportedly disulfidelinked, the requirement for the conserved � C231 was probed. Toxicity of intracellularly expressed � C231A indicated no majordefect in ACNase activity, while complementation of k1�ORF4 by � C231A was lost, consistent with a role of � C250 and � C231in zymocin assembly. To test the capability of �� to carry alternative cargos, the heterologous ACNase from Pichia acaciae (P.acaciae Orf2 [PaOrf2]) was expressed, along with its immunity gene, in k1�ORF4. While efficient secretion of PaOrf2 was de-tected, suppression of the k1�ORF4-derived k1Orf2 secretion defect was not observed. Thus, the dependency of k1Orf2 onk1Orf4 cosecretion needs to be overcome prior to studying ��’s capability to deliver other cargo proteins into target cells.

The protein toxin zymocin, produced by the yeast Kluyveromy-ces lactis, was identified as the first known anticodon nuclease

toxin from a eukaryote, selectively cleaving tRNA within the anti-codon loop due to highly specific anticodon nuclease (ACNase)activity (1). Zymocin production is correlated with the presence ofa pair of linear cytoplasmic genetic double-stranded DNA (ds-DNA) elements, termed pGKL1 (k1 in short) and pGKL2 (k2 inshort) (2). The larger k2 is required for cytoplasmic maintenanceof k1, which encodes the toxin as well as an immunity determinant(2, 3). k2 provides essential functions for cytoplasmic replication,transcription, and transcript processing, and several of these com-ponents show phylogenetic proximity to viruses (4, 5). Since theproposed mode of replication via protein priming is typicallyfound in viruses, the cytoplasmic linear dsDNA elements weretermed virus-like elements (VLE) (6). The zymocin toxin is a het-erotrimeric ��� complex, the smallest subunit of which (�) ex-hibits the cytotoxic ACNase activity (1, 7–9). The � and � subunitsare generated from the 128-kDa k1ORF2 gene product, which isfirst translocated to the endoplasmic reticulum (ER), where it be-comes glycosylated and cleaved by signal peptidase and then trav-els to the Golgi apparatus, where it is processed by the Kex1/2endopeptidase internally at the N-terminal end to produce ma-ture � (99-kDa) and � (30-kDa) subunits (7, 9–11). In the active,secreted holotoxin, � appears to be linked via a disulfide bond tothe toxic � subunit (7, 9). The latter is unable to act on target cellson its own since it relies on the chitin binding � subunit and thehydrophobic � subunit to transit into the target cell (8, 9). Theprocess of ACNase cargo dropoff by the �� carrier is poorly un-derstood, but it possibly involves chitin binding and degradationmediated by the chitinase active site located within the � subunit(12, 13). The existence of conserved ��-related carrier subunits inother VLE-encoded protein toxins, which shuttle cargo proteinsthat are dissimilar in primary sequence and/or target RNA, maysuggest a general protein translocase ability of �� (14–16). How-ever, mechanistic studies of zymocin action have been largely re-

stricted to the isolated � subunit, since no system to generate al-tered variants of holozymocin was available, which is in part dueto the complex genetic basis of cytoplasmic k1/k2 elements, whichcannot be manipulated by standard approaches applicable to nu-clear genes. To overcome this problem, we have now generatedk1/k2-carrying zymocin expression strains in which either thegene encoding the �� subunits (k1ORF2) or the gene encodingthe � subunit (k1ORF4) is deleted and altered variants of the miss-ing genes can be supplied from standard nuclear expression vec-tors. Since this system enables the rapid generation of holozymo-cin variants containing site-specific exchanges, functional studiescan be conducted. We demonstrate the usefulness of this mu-tagenesis system by analyzing the interdependence of �� and �subunits for efficient toxin secretion and the importance of chiti-nase active sites and potential disulfide bond-forming cysteineresidues for holotoxin function.

MATERIALS AND METHODSStrains and media. Yeast strains employed in this study are listed in Table1. Strains were grown in YPD (2% glucose, 2% peptone, and 1% yeastextract) or YNB (0.67% yeast nitrogen base without amino acids andcarbohydrate and with ammonium sulfate and 2% glucose) supple-mented with L-leucine (30 �g/ml), L-histidine (20 �g/ml), L-tryptophan(20 �g/ml), or uracil (20 �g/ml) at 30°C.

Received 3 July 2014 Accepted 9 August 2014

Published ahead of print 15 August 2014

Editor: D. Cullen

Address correspondence to Friedhelm Meinhardt, meinhar@uni-muenster.de.

* Present address: Roland Klassen, Institut für Biologie, Fachgebiet Mikrobiologie,Universität Kassel, Kassel, Germany.

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.02197-14

October 2014 Volume 80 Number 20 Applied and Environmental Microbiology p. 6549 – 6559 aem.asm.org 6549

on February 22, 2016 by guest

http://aem.asm

.org/D

ownloaded from

Isolation of DNA and linear plasmids. Bulk DNA and linear plasmidswere isolated as previously described (17) or by the minilysate method,which includes a proteinase K treatment (18).

DNA manipulation, cloning, and transformation. Restriction andDNA ligations were performed with enzymes obtained from New EnglandBioLabs GmbH (Frankfurt am Main, Germany) according to the suppli-er’s recommendations. Escherichia coli was transformed, following stan-dard procedures (19). Yeast transformation was performed following thepolyethylene glycol (PEG)/lithium acetate method (20).

Curing. Since yeast cells carrying linear cytoplasmic plasmids can ef-ficiently be cured by UV irradiation (21, 22), approximately 2 � 103 cellsof Saccharomyces cerevisiae 301 grown overnight in YPD at 30°C wereplated on YPD agar and exposed to UV light essentially as described pre-viously (23, 24). Following incubation for 24 h at 30°C, arising colonies ofS. cerevisiae 301 �pGKL were analyzed for the presence of linear elementsby gel electrophoresis and Southern analysis.

Killer toxin assays. For eclipse assays (25), killer strains were pointinoculated on YPD at pH 6.5. After incubation for 16 h at room temper-ature, an overnight culture of a sensitive yeast strain was diluted withsterile water to yield an optical density at 600 nm (OD600) of 0.1, fromwhich a 10-�l sample was spotted onto the medium directly at the rim ofthe colony of the putative killer strain. After incubation for 16 h at 30°C,growth inhibition became evident with the formation of clear halos.

Microtiter assays, which are more sensitive than the eclipse assays,were performed as described previously (26). Briefly, yeasts were culturedin 200 ml YPD at pH 6.5 and 30°C. Partial purification of toxins was doneby ultrafiltration using concentrators (Vivaspin 20; Sartorius Stedim Bio-tech GmbH, Göttingen, Germany). Since the calculated molecular massof the chitinases encoded by the VLEs is approximately 129 kDa, centrif-ugal units with a 30-kDa-cutoff membrane were used. In the case of the P.acaciae toxin (PaT) (�180 kDa), centrifugal concentrators with an exclu-sion size of 100 kDa were applied. Sterile toxin preparations were stored at4°C prior to use. The concentrated samples were diluted in YPD mediumto give final concentrations ranging from 0.1 up to 10-fold with respect tothe original supernatants. Thus, the relative concentration factor (RCF) of

1 corresponds to the toxin amount in nonconcentrated culture superna-tants (27, 28). After incubation for 16 h at 30°C, relative growth wasdetermined spectrometrically at 620 nm (Multiscan FC; Thermo FisherScientific Oy, Vantaa, Finland) and refers to the OD value of strains incu-bated in toxin-free YPD medium.

Southern analysis. Bulk DNA preparations from S. cerevisiae 301, thek1�ORF4 mutant, and the VLE-cured �pGKL strain were separated on0.8% agarose gels. A probe was generated from k1ORF4 using the primersk1ORF4-for and k1ORF4-rev (see Table 3). Labeling was performed usingthe DIG-High Prime kit (Roche Diagnostics, Mannheim, Germany), fol-lowing the manufacturer’s recommendations.

Generation of a �-toxin-deficient k1�ORF4 mutant. For disruptionof k1ORF4 (� subunit) in S. cerevisiae 301 (F102-2 ura3) (29), the vectorpARS, which harbors a recombination cassette consisting of a LEU2* se-lectable marker gene (30) governed by a cytoplasmic promoter (UCS [up-stream conserved sequence]) and flanked by sequences of k1ORF3=and/or k1ORF4, respectively, was constructed. The recombination flank(k1ORF3=/k1ORF4) was amplified via PCR, applying primers RKF-pARS-fw-SacI and RKF-pARS-rv-KpnI/NheI. The flank was subclonedby making use of KpnI and SacI sites and ligated into the likewise-cutvector pBluescript SK(), resulting in vector pSK-RKF. By site-directedmutagenesis (31), a SacII restriction site was generated in k1ORF4 withthe primers pSK-RKF-SacII-fw and pSK-RKF-SacII-rv.

LEU2* was amplified from vector pAR3 (32) using the primers XbaI-stop-UCS-LEU2*-fw and LEU2*-rev-MCS-XbaI, along with the UCS.The PCR product was subcloned and ligated with EcoRV-linearizedpBluescript SK(), resulting in pSK-LEU2*. LEU2* was subsequentlycloned, by making use of SacII and XbaI sites, into pSK-RKF, resulting invector pARS (Table 2). Prior to transformation into S. cerevisiae 301 (2,29), harboring the K. lactis killer plasmids k1 and k2, the in vivo recombi-nation cassette was cut out of this last vector with SacI and NheI. Trans-formants were subcultivated on YNB uracil agar lacking L-leucine. Linearelements of S. cerevisiae 301 k1�ORF4 were verified by gel electrophoresisand Southern analysis.

TABLE 1 Strains used in this study

Strain Genotype Reference

Kluyveromyces lactis AWJ137 pGKL1 (k1), pGKL2 (k2) 37Pichia acaciae NRRL Y-18665 pPac1-1, pPac1-2 38Saccharomyces cerevisiae BY4741 MATa his3�1 leu2�0 met15�0 ura3�0 EUROSCARFSaccharomyces cerevisiae CEN.PK2-1c MATa ura3-52 leu2-3,112 his3�1 trp1-289 MAL-2-8c SUC2 39Saccharomyces cerevisiae CEN.PK2-1c pYEX-BX Like S. cerevisiae CEN.PK2-1c, with pYEX-BX This workSaccharomyces cerevisiae CEN.PK2-1c PGAL1::ORF4 Like S. cerevisiae CEN.PK2-1c, with pKL-BX This workSaccharomyces cerevisiae CEN.PK2-1c PGAL1::ORF4C231A Like S. cerevisiae CEN.PK2-1c, with pKL-BX-C231A This workSaccharomyces cerevisiae CEN.PK2-1c PGAL1::ORF4A231C Like S. cerevisiae CEN.PK2-1c, with pKL-BX-A231C This workSaccharomyces cerevisiae 301 (F102-2 ura3) MAT� his4-519 leu23,112 can1 ura3, k1 (pGKL1), k2 (pGKL2) 29Saccharomyces cerevisiae 301 �pGKL Like S. cerevisiae 301, plasmid cured, k1, k2 29Saccharomyces cerevisiae 301 k1�ORF4 Like S. cerevisiae 301, k1�ORF4, k2 This workSaccharomyces cerevisiae 301 k1�ORF4 YEplac195 Like S. cerevisiae 301 k1�ORF4, with YEplac195 This workSaccharomyces cerevisiae 301 k1�ORF4 PADH1::ORF4 Like S. cerevisiae 301 k1�ORF4, with p195-PADH1::ORF4 This workSaccharomyces cerevisiae 301 k1�ORF4 PADH1::ORF4C231A Like S. cerevisiae 301 k1�ORF4. with p195-PADH1::ORF4 –C231A This workSaccharomyces cerevisiae 301 k1�ORF4 PADH1::ORF4A231C Like S. cerevisiae 301 k1�ORF4, with p195-PADH1::ORF4 –A231C This workSaccharomyces cerevisiae 301 k1�ORF4 PO4PO2 Like S. cerevisiae 301 k1�ORF4, with TU-PO4PO2-T This workSaccharomyces cerevisiae 301 k1�ORF4 PO4PO2* Like S. cerevisiae 301 k1�ORF4, with TU-PO4PO2*-T This workSaccharomyces cerevisiae 301 k1�ORF2 (MS1608) Like S. cerevisiae 301, k1�ORF2, k2 29Saccharomyces cerevisiae 301 k1�ORF2 YEplac195 Like S. cerevisiae 301 k1�ORF2, with YEplac195 This workSaccharomyces cerevisiae 301 k1�ORF2 PADH1::ORF2 Like S. cerevisiae 301 k1�ORF2, with p195-PADH1::ORF2 This workSaccharomyces cerevisiae 301 k1�ORF2 PADH1::ORF2D462A Like S. cerevisiae 301 k1�ORF2, with p195-PADH1::ORF2–D462A This workSaccharomyces cerevisiae 301 k1�ORF2 PADH1::ORF2A462D Like S. cerevisiae 301 k1�ORF2, with p195-PADH1::ORF2–A462D This workSaccharomyces cerevisiae 301 k1�ORF2 PADH1::ORF2D464A Like S. cerevisiae 301 k1�ORF2, with p195-PADH1::ORF2–D464A This workSaccharomyces cerevisiae 301 k1�ORF2 PADH1::ORF2A464D Like S. cerevisiae 301 k1�ORF2, with p195-PADH1::ORF2–A464D This workSaccharomyces cerevisiae 301 k1�ORF2 PADH1::ORF2E466A Like S. cerevisiae 301 k1�ORF2, with p195-PADH1::ORF2–E466A This workSaccharomyces cerevisiae 301 k1�ORF2 PADH1::ORF2A466E Like S. cerevisiae 301 k1�ORF2, with p195-PADH1::ORF2–A466E This workSaccharomyces cerevisiae 301 k1�ORF2 PADH1::ORF2D464AE466A Like S. cerevisiae 301 k1�ORF2, with p195-PADH1::ORF2–D464A-E466A This workSaccharomyces cerevisiae 301 k1�ORF2 PADH1::ORF2A464D-A466E Like S. cerevisiae 301 k1�ORF2, with p195-PADH1::ORF2–A464D-A466E This workSaccharomyces cerevisiae 301 k1�ORF2 PADH1::ORF2C250A Like S. cerevisiae 301 �KO2, with p195-PADH1::ORF2–C250A This workSaccharomyces cerevisiae 301 k1�ORF2 PADH1::ORF2A250C Like S. cerevisiae 301 �KO2, with p195-PADH1::ORF2–A250C This work

Wemhoff et al.

6550 aem.asm.org Applied and Environmental Microbiology

on February 22, 2016 by guest

http://aem.asm

.org/D

ownloaded from

Construction of artificial linear elements. For complementation ofthe k1�ORF4 defect with a heterologous ACNase, the P. acaciae pPac1-2ORF2 (PO2) and ORF4 (PO4), encoding the toxic � subunit and immu-nity protein, respectively, were coexpressed in S. cerevisiae 301 k1�ORF4.Both genes were amplified by PCR using primers PO4-fw and PO2-rv,along with their UCS, as well as the signal peptide-encoding region ofORF2. The PCR product was ligated into the SmaI-linearized vectorpBluescript SK(), yielding pSK-PO4PO2. PO4PO2 was subsequentlysubcloned via SpeI and XhoI digests into pARS, resulting in pARS-PO4PO2, and finally cloned via PspXI and BamHI into pGTIRUTIR (33),yielding pGT-PO4PO2.

In parallel, to analyze protein secretion, 3-hemagglutinin (3-HA) and3-Myc epitopes were added to the C termini encoded by the respective P.acaciae ORF4 (PaORF4) and PaORF2 genes. First, single epitopes wereadded to these genes by PCR, amplifying from vector pSK-PO4PO2 usingthe primers PO4-HAsc-fw and PO2-MYCsc-rev. The PCR product wascloned and ligated (blunt end) into the SmaI-linearized vector pBluescriptSK(), resulting in vector pSK-PO4::HA-PO2::myc. In a second step, twofurther epitopes were added by PCR using the primers PO4-3HA-extend-er-for and PO2-3myc-extender-rev. The PCR product was again sub-cloned into a SmaI-linearized vector pBluescript SK(), yielding pSK-PO4PO2*. The tagged genes were subsequently cloned by PspXI andBamHI digestion into vector pGTIRUTIR (33), yielding pGT-PO4PO2*.

Prior to transformation into S. cerevisiae 301 k1�KORF4, the artificiallinear elements TU-PO4PO2-T and TU-PO4PO2*-T were amplified

from vectors pGT-PO4PO2 and pGT-PO4PO2*, respectively, using theprimer TIR2. Transformants were selected on YNB medium lacking L-leucine and uracil. Linear elements were verified by gel electrophoresisand Southern analysis.

Construction of nuclear expression vectors. For nuclear-based ex-pression of k1ORF4, the ADH1 promoter from S. cerevisiae BY4741 wasPCR amplified using the primers PADH1-fw and PADH1-NdeI-rv andsubcloned (blunt end) into SmaI-linearized pBluescript SK(), yieldingpSK-PADH1. k1ORF4 was amplified by PCR using the primers k1ORF4-NdeI-for and k1ORF4-EcoRI-rev and subsequently subcloned and ligatedvia NdeI and EcoRI restriction into the likewise-cut vector pSK-PADH1.The cassette PADH1::ORF4 was cloned and ligated via XmaI and EcoRIrestrictions sites into the yeast expression vector YEplac195, yieldingp195-PADH1::ORF4. The vector was transformed into S. cerevisiae 301k1�ORF4 and selected on YNB medium devoid of L-leucine and uracil.Transformants were verified by PCR analysis.

Site-directed mutagenesis. Amino acid exchanges in the genes encod-ing the �� (k1ORF2) or � subunit (k1ORF4) of zymocin were achieved bysite-directed mutagenesis using the Phusion site-directed mutagenesis kitfrom Thermo Fisher Scientific GmbH (Dreieich, Germany). Plasmidp195-PADH1::ORF4, p195-PADH1::ORF2, or pKL-BX was used as atemplate, and the corresponding primers are listed in Table 3. Sequencingof the mutated vectors (Table 2) was done with fluorescence-labeled dide-oxynucleotide triphosphates (ddNTPs) using the BigDye Terminator v3.1

TABLE 2 Plasmids used in this study

Plasmid Genotype Reference

pYEX-BX E. coli ori, 2�, Ampr, leu2-d URA3 15pKL-BX pYEX-BX with PGAL1::ORF4 15pKL-BX-C231A pKL-BX with PGAL1::ORF4C231A This workpKL-BX-A231A pKL-BX with PGAL1::ORF4A231C This workpGTIRUTIR E. coli ori, TIR, URA3 from S. cerevisiae, TIR, Ampr 33pGT-PO4PO2 pGTIRUTIR with P. acaciae pPac1-2 ORF2 and ORF4 This workpGT-PO4PO2* pGTIRUTIR with P. acaciae pPac1-2 ORF4::3HA and ORF2::3myc This workpBluescript SK() ColE1ori, Ampr, lacZ Stratagene, Heidelberg,

GermanypSK-RKF pBluescript SK() with recombination flank k1ORF3/k1ORF4 This workpSK-LEU2* pBluescript SK() with UCS::LEU2 from S. cerevisiae This workpSK-PADH1 pBluescript SK() with S. cerevisiaei ADH1 promoter This workpSK-PO4PO2 pBluescript SK() with P. acaciae pPac1-2 ORF2 and ORF4 This workpSK-PO4::HA-PO2::myc pBluescript SK() with P. acaciae pPac1-2 ORF4::HA and ORF2::myc This workpSK-PO4PO2* pBluescript SK() with P. acaciae pPac1-2 ORF4::3HA and ORF2::3myc This workpSK-PADH1::ORF2 pBluescript SK() with PADH1::ORF2 This workpSK-PADH1::ORF4 pBluescript SK() with PADH1::ORF4 This workYEplac195 2�, URA3, Ampr, E. coli ori 40p195-PADH1::ORF4 YEplac195 with PADH1::ORF4 This workp195-PADH1::ORF4C231A YEplac195 with PADH1::ORF4C231A This workp195-PADH1::ORF4A231C YEplac195 with PADH1::ORF4A231C This workp195-PADH1::ORF2 YEplac195 with PADH1::ORF2 This workp195-PADH1::ORF2D462A YEplac195 with PADH1::ORF2D462A This workp195-PADH1::ORF2A462D YEplac195 with PADH1::ORF2A462D This workp195-PADH1::ORF2E464A YEplac195 with PADH1::ORF2E464A This workp195-PADH1::ORF2A464E YEplac195 with PADH1::ORF2A464E This workp195-PADH1::ORF2E466A YEplac195 with PADH1::ORF2E466A This workp195-PADH1::ORF2A466E YEplac195 with PADH1::ORF2A466E This workp195-PADH1::ORF2D464–E466A YEplac195 with PADH1::ORF2D464–E466A This workp195-PADH1::ORF2A464D-A466E YEplac195 with PADH1::ORF2A464D-A466E This workp195-PADH1::ORF2C250A YEplac195 with PADH1::ORF2C250A This workp195-PADH1::ORF2A250C YEplac195 with PADH1::ORF2A250C This workpARS ColE1 ori, Ampr, k1ORF4-LEU2*-k1ORF4 This workpARS-PO4PO2 pARS with P. acaciae pPac1-2 ORF2 and ORF4 This workpAR3 k1ORF2=-LEU2*-k1ORF2�, Ampr, E. coli ori 32

Site-Directed Mutagenesis of Killer Toxin Zymocin

October 2014 Volume 80 Number 20 aem.asm.org 6551

on February 22, 2016 by guest

http://aem.asm

.org/D

ownloaded from

TABLE 3 Primers used in this study

Function and primer Sequence (5=–3=)a

Southern analysisk1ORF4-for TATATTTAGTGTTTGTTATCk1ORF4-rev AATTAAATCATCATGACCTTTATC

Construction of vector pARSRKF-pARS-fw-SacI GCTAGCATGTGAGCTCGGATCTTTTTCTAATAAATATATACRKF-pARS-rv-KpnI/NheI CGTACGATCGGGTACCGCTAGCCTGTAGATTATTCATACTATCpSK-RKF-SacII-fw GTATATAACAAAATAGCACCGCGGTCCAATGAAAGAAATAAATTTGpSK-RKF-SacII-rv CTTTCATTGGACCGCGGTGCTATTTTGTTATATACAAGTTCCATATACXbaI-stop-UCS-LEU2*-fw GCATGCTACGTCTAGATAAATATGATATTTTTATTTTAAATAATAATGCATGCCCCTAAGAAGATCGTCGLEU2*-rev-MCS-XbaI CGATCGTAATTCTAGACCGCGGGCGGCCGCACTAGTGGATCCCCCGGGCTGCAGAAGCTTATCGATCT

CGAGGGCCCGTGGTGCCCTCCTCCTTGTC

Expression of � subunits andimmunity protein

TIR2 AAAGTTGGGTTTTTAAGCTAATAAAAGTTGPADH1-fw CCGGGTGTACAATATGGACPADH1-NdeI-rv GGGATAGACATATGATATGAGATAGTTGATTGTATGCPO4-fw GACCTTAGTGATGTATCAAAATTGAATGGPO2-rv TCCAGGATTAACCGAACAAGk1ORF4-NdeI-for GAATTCATATGAAGATATATCATATATTTAGk1ORF4-EcoRI-rev TAAGTCGAATTCTTATACACATTTTCCATTCTGTAGATTATTCPO4-HAsc-fw CTAAGCATAATCTGGAACATCATAAGGATAAATATTGTTAAAATAAGGATTAAGCTCATCCCPO2-MYCsc-rev CTACAAATCTTCTTCAGAAATCAACTTTTGTTCAACCTTACATGTAATACTTTTGATTTTACTGTCPO4-3HA Extender for CTAGCCAGCATAATCAGGAACATCATAAGGATAGCCAGCATAATCTGGAACATCATAAGGATAAG

CATAATCTGGAACATCPO2–3myc-Extender rev CTAGTTCAAGTCTTCTTCTGAGATTAATTTTTGTTCACCGTTCAAGTCTTCCTCGGAGATTAGCTTTT

GTTCACCGTTCAAATCTTCTTCAGAAATHA-extender TTAAGAAGCGTAATCTGGAACGTCATACGGATAGGATGCATAGTCCGGGACGTCATAGGGATAC

AAAGCATAATCTGGAACPO4-rev CCCCAACAGAGGGCAATCAAG

Expression of ��-like subunitsk1ORF2-NdeI-fw GCATCATATGAATATATTTTACATATTTTTGTTTTTGCTGTCATTCk1ORF2-PstI-rv ATACTGCAGAAAAAGAAGGAGGTATGTGTCAAC

Site-directed mutagenesisk1ORF2–D462A-for AATCTTGATGGTATAGCTTTAGATTGGGAATATCk1ORF2–D462A-rev CCAATCTAAAGCTATACCATCAAGATTATATTTAk1ORF2–E464A-for GATTTAGCTTGGGAATATCCAGGTGCTCCTGATATTCk1ORF2–E464A-rev CTGGATATTCCCAAGCTAAATCTATACCATCAAGk1ORF2–E466A-for GATTGGGCATATCCAGGTGCTCCTGATATTCk1ORF2–E466A-rev CTGGATATGCCCAATCTAAATCTATACCATCAAGk1ORF2–D464A-E466A-for GATTTAGCTTGGGCATATCCAGGTGCTCCTGATATTCk1ORF2–D464A-E466A-rev CTGGATATGCCCAAGCTAAATCTATACCATCAAGk1ORF2–A462D-A464D-A466E-for GATTTAGATTGGGAATATCCAGGTGCTCCTGATATTCk1ORF2–A462D-A464D-A466E-rev CTGGATATTCCCAATCTAAATCTATACCATCAAGk1ORF2–C250A-for GTTAAGATGGCTGGCTCTTAAAAGTAATGGk1ORF2–C250A-rev CTTTTAAGAGCCAGCCATCTTAACTTTCCCk1ORF2–A250C-for GTTAAGATGTGTGGCTCTTAAAAGTAATGGk1ORF2–A250C-rev CTTTTAAGAGCCACACATCTTAACTTTCCCk1ORF4–C231A-for GAATGGAAAAGCTGTATAAGAATTCACTGGk1ORF4–C231A-rev CTTATACAGCTTTTCCATTCTGTAGATTATTCk1ORF4–A231C-for GAATGGAAAATGTGTATAAGAATTCACTGGk1ORF4–A231C-rev CTTATACACATTTTCCATTCTGTAGATTATTC

RT-PCRk1ORF2s1-fw AAGGTTTGGAGCATACTCATCk1ORF2s1-rv ACATCCTTTCCATCCATAATTAC

a Underlining alone indicates restriction sites; boldface together with underlining indicates base changes.

Wemhoff et al.

6552 aem.asm.org Applied and Environmental Microbiology

on February 22, 2016 by guest

http://aem.asm

.org/D

ownloaded from

cycle sequencing kit and an ABI Prism 3730 capillary sequencer (AppliedBiosystems, Foster City, CA).

Western analysis. For analysis of protein secretion, cells grown inliquid YPD at 30°C were harvested, and toxin-containing supernatantswere concentrated 200-fold using ultrafiltration units with 30-kDa-cutoffmembranes (Sartorius Stedim Biotech GmbH, Göttingen, Germany).Concentrated supernatants were separated by discontinuous SDS-PAGEusing 4% stacking, and 10% polyacrylamide gels and proteins were blot-ted onto polyvinylidene difluoride (PVDF) membranes. Immunologicaldetection of the � subunit of zymocin was achieved by applying rabbitpolyclonal anti-�-specific antibodies (13), followed by an anti-rabbit IgG-alkaline phosphatase (AP) secondary antibody (Sigma, Munich, Ger-many). Detection of the � subunit of PaT (ORF2::3-Myc) was carried outusing mouse monoclonal anti-c-Myc (clone 9E10; Roche DiagnosticsDeutschland GmbH, Mannheim, Germany) and goat anti-mouse IgG-APsecondary antibody (Sigma, Munich, Germany).

RT-PCR. Transcription of k1ORF2 in the parental strain S. cerevisiae301, the k1�ORF4 mutant, and the PADH1::ORF4 complemented strainwas verified by reverse transcription-PCR (RT-PCR). Total RNA was iso-lated as described previously (34), and DNase I digestion was achievedemploying the RNase-Free DNase I set (New England BioLabs GmbH,Frankfurt am Main, Germany). Reverse transcription was accomplishedusing the RevertAid H Minus First Strand cDNA synthesis kit (Fermentas,St. Leon-Rot, Germany), following the manufacturer’s recommenda-tions. For this purpose, 1 �g RNA and random hexamer primers wereused. As a control, identical reactions were carried out without addingreverse transcriptase or with DNA. The cDNA of the 5= end of k1ORF2

was detected by PCR using the primers k1ORF2s1-fw and k1ORF2s1-rv(Table 3).

RESULTS AND DISCUSSIONDisruption of k1ORF4 prevents zymocin production and ��secretion. To generate a platform allowing for systematic mu-tagenesis of ��� holozymocin, we generated an S. cerevisiae 301strain carrying the cytoplasmic k1/k2 pair with a disruption ink1ORF4 (encoding the ACNase subunit � toxin). Disruption wasfacilitated by the use of an in vivo recombination vector (pARS)carrying a cytoplasmic expressible LEU2 gene (LEU2*) nested be-tween long recombination flanks (500 to 550 bp) targeting theselection marker to k1ORF4 (Fig. 1A and B). The recombinationcassette was removed from pARS and transformed into the k1/k2-carrying S. cerevisiae 301 strain (29). Correct integration and elim-ination of native k1 were verified by Southern analysis (Fig. 1C).

To investigate the consequence of k1ORF4 disruption for zy-mocin production, we partially purified and concentrated culturesupernatants from the k1/k2 S. cerevisiae parental strain, from thek1�ORF4 mutant, and from a VLE-cured strain by ultrafiltrationand analyzed these preparations for zymocin killer activity usingthe microdilution method. The supernatant of the parental strainproved growth inhibitory to the S. cerevisiae tester strain at dilu-tions equivalent to �1% of the original culture fluid (relative con-centration factor, 0.01). Consistent with the notion that zymocin

FIG 1 Disruption of k1ORF4 prevents zymocin activity. (A) Recombination vector pARS for k1ORF4 disruption: “ampR,” ampicillin resistance (Ampr) gene;ColE1 ori, E. coli origin of replication; ORF3, immunity gene of k1; ORF4, � toxin gene of k1; LEU2*, cytoplasmic expressible LEU2 gene of S. cerevisiae. (B)Scheme for targeted gene disruption of k1ORF4 by in vivo recombination. The genetic organization of k1 is represented prior to and after integration of therespective recombination cassette harboring the cytoplasmic LEU2* gene flanked by ORF3 and/or ORF4, ultimately yielding k1�ORF4. (C) Agarose gelelectrophoresis and Southern analysis performed with DNA from the parental strain (wt), the k1�ORF4 mutant, and the VLE-cured strain (cured) using ak1ORF4 probe. The linear elements k1 (8.9 kb), k2 (13.8 kb), and k1�ORF4 (10.3 kb), hmw (high-molecular-weight DNA), and dsRNA-L (4.6 kb) are indicated.M, GeneRuler 1-kb DNA ladder (Thermo Fisher Scientific, Dreieich, Germany). (D) Zymocin killer assay using partially purified and concentrated culturesupernatants of the above strains against the susceptible S. cerevisiae CEN.PK2-1c strain.

Site-Directed Mutagenesis of Killer Toxin Zymocin

October 2014 Volume 80 Number 20 aem.asm.org 6553

on February 22, 2016 by guest

http://aem.asm

.org/D

ownloaded from

toxicity relies on the cytotoxic ACNase Orf4, we found that dele-tion of k1ORF4 results in a complete loss of toxin activity in thestrains’ supernatant (Fig. 1D).

To analyze whether removal of k1ORF4 from the zymocin-encoding plasmid system affects secretion or processing of k1Orf2(encoding � and � subunits of zymocin), we checked superna-tants from the k1/k2 parental strain and the k1�ORF4 strain forthe presence of protein bands detectable by a polyclonal antibody

raised against the � subunit (13). The 129-kDa k1Orf2 protein isprocessed in the original host, K. lactis, by the KEX protease dur-ing secretion, which generates the 99-kDa � and 30-kDa � subunitfrom the precursor (7, 9–11). The size of the protein species de-tectable with anti-� sera therefore allows conclusions aboutwhether or not Orf2 is processed correctly. We detected an �100-kDa signal in the supernatant of the k1/k2-carrying S. cerevisiaestrain, showing that Orf2 secretion and processing occur similarly

FIG 2 Compromised secretion of k1Orf2 in the absence of k1Orf4. (A) Concentrated supernatants of the parental strain S. cerevisiae 301 (wt), the k1�ORF4mutant, and the PADH1::ORF4 complemented strain (k1�ORF4 ORF4) were tested by Western analysis using polyclonal antibodies raised against the � subunitand anti-rabbit secondary antibodies. Loading control, Coomassie-stained supernatants used for detection of anti-�. (B) RT-PCR analysis of k1ORF2 transcrip-tion. Reverse transcription of the 5= end of k1ORF2 mRNA and detection of cDNA by PCR were carried out. DNA, genomic DNA used as the template; RT orRT, reaction with DNA-free RNA and without or with reverse transcriptase. (C) Microtiter assay with partially purified and concentrated supernatants of theabove strains tested against S. cerevisiae CEN.PK2-1c.

FIG 3 Cys231 mutational effects on holotoxin and primary ACNase function. (A) Multiple sequence alignments of VLE-encoded � toxin subunits. Blackshading with reverse lettering, 100% conserved; gray shading with reverse lettering, 80% or more conserved; gray shading with black lettering, 60% or moreconserved; no shading, less than 60% conserved. GenBank accession numbers: Kluyveromyces lactis pGKL1 ORF4, YP_001648060; Pichia inositovora pPin1-3ORF4, CAD91887.1; Pichia acaciae pPac1-2 ORF2, CAE84960.1; Debaryomyces robertsiae pWR1A ORF3, CAE84956.1. The conserved Cys231 is boxed. (B)Effects of Cys231 mutations on holotoxin function. Microtiter assays were performed with partially purified and concentrated supernatants of k1�ORF4, thePADH1::ORF4 complemented strain (PADH1::ORF4), and the PADH1::ORF4C231A (C231A) or PADH1::ORF4A231C (A231C) mutant. Killer assays wereexecuted against S. cerevisiae CEN.PK2-1c. (C) Effects of Cys231 mutations on intracellular � toxin activity. Ten-fold serial dilutions of S. cerevisiae CEN.PK2-1ccells expressing intracellularly the wild-type � toxin (PGAL1::ORF4) or the C231A and A231C toxin mutants under a galactose-inducible promoter were testedon YNB supplemented with glucose or galactose for induction. As a control, a strain harboring an empty vector (control) was used.

Wemhoff et al.

6554 aem.asm.org Applied and Environmental Microbiology

on February 22, 2016 by guest

http://aem.asm

.org/D

ownloaded from

to those for K. lactis, which is consistent with earlier reports (9).However, upon removal of k1ORF4, not only is the ACNase-de-pendent killer activity lost, but also the k1Orf2 gene product, ei-ther unprocessed (129 kDa) or processed (99 kDa), is undetect-able (Fig. 2A). This suggests that k1Orf2 secretion itself or thestability of the protein in the supernatant is severely compromised

in the absence of k1Orf4. To check whether the obtained resultsare due to a possible coregulation of k1Orf2 and k1Orf4 expres-sion, transcription of k1ORF2 was analyzed by RT-PCR. As de-picted in Fig. 2B, transcription of the 5= end of k1ORF2 takes placein the k1/k2 parental S. cerevisiae strain and in the k1�ORF4strain. Such results suggest a cosecretion dependency of k1Orf2 onk1Orf4, rather than a coregulation to ensure the equimolecularproduction of �� and � subunits.

In trans complementation of k1�ORF4 requires Orf4C231.We utilized the established k1�ORF4 strain to check if (i) func-tional zymocin production can be restored by providing wild-typek1ORF4 in trans and (ii) whether this can be exploited to identifyfunctional regions of � toxin that are essential for ��� holotoxinassembly but dispensable for the primary ACNase function. First,k1ORF4 was uncoupled from the cytoplasmic promoter, fused tothe constitutive ADH1 promoter, and subsequently expressedfrom a standard nuclear vector (YEplac195). Since transcriptionof k1ORF2 from the cytoplasm was verified by RT-PCR (Fig. 2B),we then analyzed whether the k1Orf2 secretion defect could berestored by nuclear expression of k1ORF4. Indeed, a band of�100 kDa is detected by the anti-� antibody in the k1�ORF4strain carrying a nuclear PADH1::ORF4 construct (Fig. 2A). Thus,the secretion or stability defect of k1Orf2 associated with the lossof k1Orf4 could be restored by introduction of a nuclear expres-sion construct for k1Orf4. In parallel, microtiter assays indicatedan efficient restoration of zymocin presence in the supernatant

FIG 4 Functional complementation of k1�ORF2 and k1�ORF4 mutations.Microtiter assays were carried out on YPD with partially purified and concen-trated supernatants of the k1/k2 parental strain S. cerevisiae 301 (wt), thek1�ORF4 mutant, the PADH1::ORF4 complemented strain (k1�ORF4ORF4), the k1�ORF2 mutant, and the PADH1::ORF2 complemented strain(k1�ORF2 ORF2). Eclipse assays were performed on YPD with the abovestrains against S. cerevisiae CEN.PK2-1c.

FIG 5 Cys250 mutational effects on holotoxin function. (A) Multiple sequence alignments of VLE-encoded �-like subunits. Black shading with reverse lettering,100% conserved; gray shading with reverse lettering, 80% or more conserved; gray shading with black lettering, 60% or more conserved;, no shading, less than60% conserved. GenBank accession numbers are as follows: K. lactis pGKL1 ORF2, YP_001648058; P. inositovora pPin1-3 ORF3, CAD91890.1; P. acaciae pPac1-2ORF1, CAE84958.1; D. robertsiae pWR1A ORF2, CAE84954.1. The conserved Cys250 is boxed. (B) Effects of Cys250 mutations on holotoxin function. Microtiterassays were performed with partially purified and concentrated supernatants of k1�ORF2, the PADH1::ORF2 complemented strain (PADH1::ORF2), and thePADH1::ORF4C250A (C250A) or PADH1::ORF4A250C (A250C) mutant. Killer assays were executed against S. cerevisiae CEN.PK2-1c. (C) Scheme of theheterotrimeric killer toxin zymocin. Structural integrity is maintained by intramolecular disulfide bonds within the � subunit and intermolecular disulfide bondsbetween � C250 and � C231. The active center of the chitinase is indicated. LysM, chitin binding, and glycosyl hydrolase family 18 motifs are differently grayshaded. Transmembrane domains are depicted as hatched boxes.

Site-Directed Mutagenesis of Killer Toxin Zymocin

October 2014 Volume 80 Number 20 aem.asm.org 6555

on February 22, 2016 by guest

http://aem.asm

.org/D

ownloaded from

(Fig. 2C). Hence, Orf4 can be provided in trans by nuclear expressionof the corresponding gene, which efficiently restores functional zy-mocin production; therefore, such system can be utilized to identifyresidues in � toxin that are essential for holotoxin function.

Multiple sequence alignments of VLE-encoded yeast killer tox-ins PaT, PiT, and DrT, which use a cargo import complex similarto that for zymocin (14–16, 29), revealed the presence of a singleconserved Cys residue close to the C terminus of the cargo subunit(Fig. 3A). Since it was shown previously that �� are disulfidelinked and treatment of zymocin preparations with disulfide re-ducing agents abolishes activity, we chose to analyze the impor-tance of this residue for both ACNase and holotoxin function. Wecreated a k1ORF4C231A allele including the signal peptide codingregion and expressed it under the control of the ADH1 promoterin the nucleus of the k1�ORF4 strain. As controls, we included theempty vector, unmodified PADH1::ORF4, and also a back muta-tion of PADH1::ORF4A231C. Culture supernatants were partiallypurified and analyzed for the presence of killer activity. Whilewild-type Orf4 provided in trans again restored zymocin produc-tion, Orf4C231A completely lost this ability (Fig. 3B). Since zy-mocin production could also be restored by back mutation ofA231 to C, loss of activity in Orf4C231A is due only to the ex-change of C231 (Fig. 3B). To check whether the same exchangeaffects the killing efficiency of the intracellular form of � toxin, weexpressed k1ORF4 and its variant, constructed by replacing itspromoter with the conditional GAL1 promoter of S. cerevisiae andby excluding the signal peptide coding region to achieve intracel-lular accumulation in order to mimic the � toxin imported fromoutside the cell. Induced intracellular expression of k1ORF4,k1ORF4C231A, or k1ORF4A231C indistinguishably induced fullgrowth arrest (Fig. 3C), in agreement with a previous study (35),thereby proving that the mutated variant of Orf4 is indeed trans-lated. Thus, C231 is essential for functional zymocin secretion, butit does not affect the growth-inhibitory competency of the intra-cellular form of � toxin (Fig. 3).

Role of the sole cysteine residue in zymocin’s � subunit. Totest whether, similar to k1ORF4, k1ORF2 (encoding � and � sub-units of zymocin) can also be deleted in the cytoplasmic k1 andsubsequently provided in trans from the nucleus, we utilized astrain carrying k1�ORF2 that is unable to form active zymocin(29). For complementation, we removed the cytoplasmic pro-moter from the k1ORF2 gene, replaced it with the ADH1 pro-moter, and introduced the PADH1::ORF2 fusion in the nuclearvector YEplac195. The k1�ORF2 strain carrying nuclear PADH1::ORF2 regained the ability to secrete zymocin (Fig. 4), demonstrat-ing the usefulness of such a system to analyze the requirement ofindividual sites of k1ORF2 encoding � and � subunits for holo-toxin function. It should be noted, however, that the complemen-tation efficiency of PADH1::ORF2 is reduced compared to that ofPADH1::ORF4 (Fig. 4), which is due to transcript instability in theformer case and is accompanied by the lack of detection of alphawhen expressed from the nucleus in k1�ORF2 complementedwith PADH1::ORF2 (data not shown).

Our above-described results revealed an essential function ofthe conserved � C231 in the holotoxin context but not for theintracellular active form of the tRNase, suggesting that C231 couldbe involved in the formation of the disulfide bridge reported toexist between � and � (7, 9). Interestingly, � contains only onecysteine residue, located at the very C terminus of the protein(Orf2C250), which is also conserved among other VLE-encoded

killer toxins (Fig. 5A). Assuming a general requirement for cova-lent attachment of the cargo subunit (�) to one of the carriersubunits (�), we predicted an absolute requirement for Orf2C250to form active zymocin. To test this, we replaced Orf2C250 via anOrf2C250A change, expressed the PADH1::ORF2C250A gene inparallel to PADH1::ORF2 from the nucleus of the k1�ORF2strain, and analyzed supernatants for the presence of functionalzymocin. As shown in Fig. 5B, the PADH1::ORF2 wild type andthe A250C back mutant but not the C250A mutant could restorezymocin production in k1�ORF2, indeed revealing an essentialrole of C250, the sole cysteine in the � subunit. These data under-score the assumption that the covalent attachment of the cargosubunit � to the carrier subunit � is essential for functionality ofthe complex. This assumption is further supported by previous evi-dence that treatment of purified zymocin with disulfide reducingagents completely abolishes its activity (9, 13). In the C250A mutant,no such disulfide bridge can be formed since � becomes entirely de-void of cysteine, and consistently, loss of zymocin function is ob-served (Fig. 5B). Since � C231 is similar to � C250 in locating at the Cterminus of the protein, conserved among other VLE-encoded toxinsand required for holotoxin function (Fig. 4), it appears likely that thecargo subunit is linked to � C250 via � C231 (Fig. 5C) and such acovalent junction is key for secretion and/or toxicity.

The chitinase active site is essential for zymocin function.The � subunit of zymocin carries a chitinase domain equippedwith a chitinase family 18 active site (Fig. 6A). It was shown pre-

FIG 6 Chitinase active site residues are essential for zymocin function. (A)Multiple sequence alignments of VLE-encoded chitinase like subunits. Blackshading with reverse lettering, 100% conserved; gray shading with reverselettering, 80% or more conserved; gray shading with black lettering, 60% ormore conserved; no shading, less than 60% conserved. GenBank accessionnumbers are as follows: K. lactis pGKL1 ORF2, YP_001648058; P. inositovorapPin1-3 ORF3, CAD91890.1; P. acaciae pPac1-2 ORF1, CAE84958.1; D. rob-ertsiae pWR1A ORF2, CAE84954.1. Family 18 chitinase active sites (DXXDX-DXE; [DN]-G-[LIVMF]-[DN]-[LIVMF]-[DN]-X-E) are highlighted byboxes and shown above in bold letters. (B) Microtiter assays were performed inYPD with partially purified and concentrated supernatants of the k1�ORF2mutant, the PADH1::ORF2 complemented strain, and the D462A, D464A,E466A, and D464A-E466A toxin mutants. Eclipse assays were done on YPDagar. Killer assays were executed against S. cerevisiae CEN.PK2-1c. Mutationsof D462, D464, and E466 in the chitinase active site (DXDXE motif, � subunit)completely abolished killing activities.

Wemhoff et al.

6556 aem.asm.org Applied and Environmental Microbiology

on February 22, 2016 by guest

http://aem.asm

.org/D

ownloaded from

viously that the � subunit exhibits chitinase activity, which can beinhibited by allosamidin (12). Since increased allosamidin dosesin bioassays with zymocin led to decreased toxin activity, the in-volvement of chitin degradation in the process of cargo (�) importwas assumed (12). However, even at the highest concentration ofallosamidin, which led to the complete inhibition of the chitinaseactivity in vitro, some growth-inhibitory activity in vivo was ob-served, leaving some doubt on the essentiality of the chitinaseactivity for toxin function. Since our in trans complementationsystem for k1�ORF2 provides a very sensitive readout for thefunctionality of mutated variants of � and � and since the chiti-nase family 18 active site is well characterized, we checked therelevance of chitinase catalytic residues within the � subunit forfunctionality of the complex. Thus, the three highly conservedresidues of the chitinase active site motif (DXDXE) of the � sub-unit were converted to alanine (D462A, D464A, E466A, andD464A-E466A), and the genes were expressed by fusion to theADH1 promoter in the k1�ORF2 mutant. Supernatants from thestrain complemented with the wild-type k1ORF2 gene and all ac-tive site substitutions were concentrated and analyzed for zymo-cin activity. Only the wild-type control displayed detectable zy-

mocin activity in the supernatant, whereas all substitutionsanalyzed were unable to produce functional zymocin, as also ver-ified by eclipse assays (Fig. 6B). Thus, rather than contributing tothe toxin’s efficiency, the chitinase active site of the � subunit isessential for toxin function. Since zymocin activity could be restoredby back mutations, loss of activity only is due to the exchange of thecorresponding residues (data not shown). However, it cannot be ex-cluded that the chitinase active site mutations may affect the stabilityof the protein. The results support the assumption that chitin degra-dation is a prerequisite for import of the toxic � subunit. Interest-ingly, chitin is localized as a thin layer on top of the plasma mem-brane, suggesting that its degradation could be intimately linked tomembrane perforation and passage of � into the cytoplasm. Thecomplementation system established in this work will provide a valu-able tool to further study early steps in zymocin action, for example,by generating immunologically detectable or fluorescently taggedversions of individual zymocin subunit.

The k1Orf2 secretion defect in k1�ORF4 cannot be restoredby a heterologous ACNase. Since the ��-like subunits of theknown killer VLEs are highly conserved with respect to their chitinbinding and chitinase domains (Fig. 6A), as well as the conserved

FIG 7 The k1�ORF4 defect cannot be restored by a heterologous ACNase from P. acaciae. (A) Schematic diagram of the in vitro-constructed TU-PO4PO2-Telement encoding the � toxin and immunity factor from P. acaciae. ScURA3*, cytoplasmic expressible URA3 gene of S. cerevisiae; TIR, terminal inverted repeats;�, 5=-terminal protein. Agarose gel electrophoresis showing different genetic materials in the k1/k2 parental strain S. cerevisiae 301 (wt), the k1�ORF4 mutant,and the k1�ORF4 PO4PO2 strain expressing the �� subunits from K. lactis and the � toxin and immunity protein from P. acaciae. hmw, high-molecular-weightDNA. (B) Microtiter assays were performed on YPD with partially purified and concentrated supernatants of the above strains. As a sensitive test strain, S.cerevisiae CEN.PK2-1c was applied. (C) In parallel, the strains were tested against the P. acaciae toxin (PaT). (D) Concentrated supernatants of k1�ORF4, thePADH1::ORF4 complemented mutant, the k1�ORF4 PO4PO2* strain, the k1�ORF2 mutant, and the k1�ORF2 PO4PO2* strain were tested by Western analysisusing antibodies raised against the � subunit of zymocin or the 3-Myc epitope of the tagged � toxin of PaT (� PaT-Myc). Anti-rabbit or anti-mouse secondaryantibodies were used. Loading control, Coomassie-stained concentrated supernatants.

Site-Directed Mutagenesis of Killer Toxin Zymocin

October 2014 Volume 80 Number 20 aem.asm.org 6557

on February 22, 2016 by guest

http://aem.asm

.org/D

ownloaded from

cysteine residues at the C terminus of the interacting � and �subunits (Fig. 3A and 5A), we wondered if the �� subunits carryand deliver not only their cognate cargo protein but a heterolo-gous subunit of another known killer system. We utilized thek1�ORF4 strain to introduce the toxic ACNase subunit (PaOrf2)from the related Pichia acaciae killer system along with its immu-nity gene (PaOrf4) (15, 36). The last two were expressed cytoplas-mically using the in vitro-constructed element TU-PO4PO2-T(see Materials and Methods), and the presence of the linear ele-ments was verified by gel electrophoresis (Fig. 7A). In addition,PaOrf2 was expressed as a C-terminal 3-Myc-tagged variant tofollow secretion of the protein in the k1�ORF4 and k1�ORF2strains. Western analysis of concentrated supernatants revealedthat PaOrf2-Myc was efficiently secreted in the k1�ORF4 strain(Fig. 7D); however, no toxin activity could be detected (Fig. 7B),while PaOrf4 provided immunity toward exogenously appliedPaT (Fig. 7C). Since we have shown that k1Orf2 normally requiresk1Orf4 for efficient secretion, lack of toxicity might be attributedto an inability to form an active hybrid toxin complex or to theabsence of k1Orf2 secretion. To test these two alternatives, weanalyzed whether PaOrf2-Myc is capable of restoring k1Orf2 se-cretion in the k1�ORF4 strain. As a control, we introduced thePADH1::ORF4 construct, shown before to restore k1Orf2 secre-tion. As shown in Fig. 7D, k1Orf4 but not PaOrf2-Myc is capableof restoring k1Orf2 secretion. Thus, absence of functional hybridtoxin activity can likely be attributed to the complete absence ofk1Orf2 secretion and is not necessarily due to a general inability toform such a hybrid toxin. However, it cannot be excluded that thelack of proper assembly renders secretion interdependent.

Future work will be required to define the dependency ofk1Orf2 secretion on k1Orf4 cosecretion. It has also been shownthat k1Orf4 secretion is severely impaired in the absence of k1Orf2(10), which might suggest that an interaction between k1Orf2 andk1Orf4 is required at a specific step during the secretory pathwayfor efficient secretion of either protein. Final zymocin assembly,however, is apparently dispensable for subunit secretion, sincekex1/kex2 mutations inhibit k1Orf2 processing in the Golgi appa-ratus and secretion of �� but do not affect the secretion of the �subunit (8). The ACNase subunit PaOrf2 apparently differs fromk1Orf4 in that it is secreted efficiently in the k1�ORF2 strain with-out the need for an �� precursor (Fig. 7D). It remains to be stud-ied, however, whether the ��-like PaOrf1 depends on PaOrf2 forcosecretion. Interestingly, fusion of the � mating factor pre-prosequence, which harbors a Kex1/2 processing site, to the N termi-nus of k1Orf4 enabled secretion of the � toxin independently ofk1Orf2 cosecretion (8). Thus, modification of the k1Orf2 N ter-minus may represent an analogous strategy to overcome the se-cretion blockade of k1Orf2 in the absence of k1Orf4. Restoringk1Orf4-independent secretion of the �� subunits will likely be arequirement to further investigate the specificity of the carriersubunit for cognate or alternative cargo proteins.

REFERENCES1. Lu J, Huang B, Esberg A, Johansson MJ, Byström AS. 2005. The

Kluyveromyces lactis �-toxin targets tRNA anticodons. RNA 11:1648 –1654. http://dx.doi.org/10.1261/rna.2172105.

2. Gunge N, Sakaguchi K. 1981. Intergeneric transfer of deoxyribonucleicacid killer plasmids, pGKl1 and pGKl2, from Kluyveromyces lactis intoSaccharomyces cerevisiae by cell fusion. J. Bacteriol. 147:155–160.

3. Tokunaga M, Wada N, Hishinuma F. 1987. A novel yeast secretionvector utilizing secretion signal of killer toxin encoded on the yeast linear

DNA plasmid pGKL1. Biochem. Biophys. Res. Commun. 144:613– 619.http://dx.doi.org/10.1016/S0006-291X(87)80010-4.

4. Meinhardt F, Klassen R. 2007. Microbial linear plasmids. In Meinhardt F,Klassen R (ed), Microbiology monographs, vol 7. Springer-Verlag, Berlin,Germany.

5. Satwika D, Klassen R, Meinhardt F. 2012. Anticodon nuclease encodingvirus-like elements in yeast. Appl. Microbiol. Biotechnol. 96:345–356.http://dx.doi.org/10.1007/s00253-012-4349-9.

6. Jeske S, Meinhardt F, Klassen R. 2007. Extranuclear inheritance: virus-like DNA-elements in yeast, p 98 –129. In Esser K, Lüttge U, Beyschlag W,Murata J. (ed), Progress in botany, vol 68. Springer, Berlin, Germany.

7. Stark MJR, Boyd A. 1986. The killer toxin of Kluyveromyces lactis—characterization of the toxin subunits and identification of the geneswhich encode them. EMBO J. 5:1995–2002.

8. Tokunaga M, Kawamura A, Hishinuma F. 1989. Expression of pGKLkiller 28K subunit in Saccharomyces cerevisiae: identification of 28K sub-unit as a killer protein. Nucleic Acids Res. 17:3435–3446. http://dx.doi.org/10.1093/nar/17.9.3435.

9. Stark MJ, Boyd A, Mileham AJ, Romanos MA. 1990. The plasmid-encoded killer system of Kluyveromyces lactis: a review. Yeast 6:1–29. http://dx.doi.org/10.1002/yea.320060102.

10. Tokunaga M, Kawamura A, Kitada K, Hishinuma F. 1990. Secretion ofkiller toxin encoded on the linear DNA plasmid pGKL1 from Saccharo-myces cerevisiae. J. Biol. Chem. 265:17274 –17280.

11. Wesolowski-Louvel M, Tanguy-Rougeau C, Fukuhara H. 1988. A nu-clear gene required for the expression of the linear DNA-associated killersystem in the yeast Kluyveromyces lactis. Yeast 4:71– 81. http://dx.doi.org/10.1002/yea.320040108.

12. Butler AR, O’Donnell RW, Martin VJ, Gooday GW, Stark MJ. 1991. Kluyvero-myces lactis toxin has an essential chitinase activity. Eur. J. Biochem. 199:483– 488. http://dx.doi.org/10.1111/j.1432-1033.1991.tb16147.x.

13. Jablonowski D, Fichtner L, Martin VJ, Klassen R, Meinhardt F, StarkMJ, Schaffrath R. 2001. Saccharomyces cerevisiae cell wall chitin, theKluyveromyces lactis zymocin receptor. Yeast 18:1285–1299. http://dx.doi.org/10.1002/yea.776.

14. Kast A, Klassen R, Meinhardt F. 2014. rRNA fragmentation induced bya yeast killer toxin. Mol. Microbiol. 91:606 – 617. http://dx.doi.org/10.1111/mmi.12481.

15. Klassen R, Paluszynski JP, Wemhoff S, Pfeiffer A, Fricke J, MeinhardtF. 2008. The primary target of the killer toxin from Pichia acaciae is tRNA-(Gln). Mol. Microbiol. 69:681– 697. http://dx.doi.org/10.1111/j.1365-2958.2008.06319.x.

16. Klassen R, Teichert S, Meinhardt F. 2004. Novel yeast killer toxins provokeS-phase arrest and DNA damage checkpoint activation. Mol. Microbiol. 53:263–273. http://dx.doi.org/10.1111/j.1365-2958.2004.04119.x.

17. Stam JC, Kwakman J, Meijer M, Stuitje AR. 1986. Efficient isolation ofthe linear DNA killer plasmid of Kluyveromyces lactis: evidence for loca-tion and expression in the cytoplasm and characterization of their termi-nally bound proteins. Nucleic Acids Res. 14:6871– 6884. http://dx.doi.org/10.1093/nar/14.17.6871.

18. Schaffrath R, Stark MJ, Gunge N, Meinhardt F. 1992. Kluyveromyceslactis killer system: ORF1 of pGKL2 has no function in immunity expres-sion and is dispensable for killer plasmid replication and maintenance.Curr. Genet. 21:357–363. http://dx.doi.org/10.1007/BF00351695.

19. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratorymanual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

20. Gietz RD, Schiestl RH, Willems AR, Woods RA. 1995. Studies on thetransformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure.Yeast 11:355–360. http://dx.doi.org/10.1002/yea.320110408.

21. Gunge N, Takahashi S, Fukuda K, Ohnishi T, Meinhardt F. 1994. UVhypersensitivity of yeast linear plasmids. Curr. Genet. 26:369 –373. http://dx.doi.org/10.1007/BF00310503.

22. Niwa O, Sakaguchi K, Gunge N. 1981. Curing of the killer deoxyribonu-cleic acid plasmids of Kluyveromyces lactis. J. Bacteriol. 148:988 –990.

23. Klassen R, Jablonowski D, Schaffrath R, Meinhardt F. 2002. Genomeorganization of the linear Pichia etchellsii plasmid pPE1A: evidence forexpression of an extracellular chitin-binding protein homologous to the�-subunit of the Kluyveromyces lactis killer toxin. Plasmid 47:224 –233.http://dx.doi.org/10.1016/S0147-619X(02)00014-8.

24. Klassen R, Meinhardt F. 2002. Linear plasmids pWR1A and pWR1B ofthe yeast Wingea robertsiae are associated with a killer phenotype. Plasmid48:142–148. http://dx.doi.org/10.1016/S0147-619X(02)00101-4.

25. Kishida M, Tokunaga M, Katayose Y, Yajima H, Kawamura-Watabe A,

Wemhoff et al.

6558 aem.asm.org Applied and Environmental Microbiology

on February 22, 2016 by guest

http://aem.asm

.org/D

ownloaded from

Hishinuma F. 1996. Isolation and genetic characterization of pGKL killer-insensitive mutants (iki) from Saccharomyces cerevisiae. Biosci. Biotech-nol. Biochem. 60:798 – 801. http://dx.doi.org/10.1271/bbb.60.798.

26. Klassen R, Meinhardt F. 2007. Linear protein-primed replicating plas-mids in eukaryotic microbes, p 187–226. In Meinhardt F, Klassen R (ed),Microbiology monographs, vol 7. Springer, Berlin, Germany.

27. Muccilli S, Wemhoff S, Restuccia C, Meinhardt F. 2013. Exoglucanaseencoding genes from three Wickerhamomyces anomalus killer strains iso-lated from olive brine. Yeast 30:33– 43. http://dx.doi.org/10.1002/yea.2935.

28. Klassen R, Wemhoff S, Krause J, Meinhardt F. 2011. DNA repair defectssensitize cells to anticodon nuclease yeast killer toxins. Mol. Genet.Genomics 285:185–195. http://dx.doi.org/10.1007/s00438-010-0597-5.

29. Paluszynski JP, Klassen R, Meinhardt F. 2007. Pichia acaciae killersystem: genetic analysis of toxin immunity. Appl. Environ. Microbiol.73:4373– 4378. http://dx.doi.org/10.1128/AEM.00271-07.

30. Kämper J, Meinhardt F, Gunge N, Esser K. 1989. New recombinantlinear DNA-elements derived from Kluyveromyces lactis killer plasmids.Nucleic Acids Res. 17:1781. http://dx.doi.org/10.1093/nar/17.4.1781.

31. Weiner MP, Costa GL, Schoettlin W, Cline J, Mathur E, Bauer JC. 1994.Site-directed mutagenesis of double-stranded DNA by the polymerasechain reaction. Gene 151:119 –123. http://dx.doi.org/10.1016/0378-1119(94)90641-6.

32. Schickel J, Helmig C, Meinhardt F. 1996. Kluyveromyces lactis killersystem: analysis of cytoplasmic promoters of the linear plasmids. NucleicAcids Res. 24:1879 –1886. http://dx.doi.org/10.1093/nar/24.10.1879.

33. Bennett AM, Norris AR, Limnander de Nieuwenhove A, Russell PJ.2002. Replication of a linear mini-chromosome with terminal invertedrepeats from the Kluyveromyces lactis linear DNA plasmid k2 in the cyto-

plasm of Saccharomyces cerevisiae. Plasmid 48:13–23. http://dx.doi.org/10.1016/S0147-619X(02)00019-7.

34. Klassen R, Fricke J, Pfeiffer A, Meinhardt F. 2008. A modified DNAisolation protocol for obtaining pure RT-PCR grade RNA. Biotechnol.Lett. 30:1041–1044. http://dx.doi.org/10.1007/s10529-008-9648-y.

35. Keppetipola N, Jain R, Meineke B, Diver M, Shuman S. 2009. Structure-activity relationships in Kluyveromyces lactis gamma-toxin, a eukaryaltRNA anticodon nuclease. RNA 15:1036 –1044. http://dx.doi.org/10.1261/rna.1637809.

36. Klassen R, Kast A, Wünsche G, Paluszynski JP, Wemhoff S, MeinhardtF. 2014. Immunity factors for two related tRNA(Gln) targeting killer tox-ins distinguish cognate and non-cognate toxic subunits. Curr. Genet. 60:213–222. http://dx.doi.org/10.1007/s00294-014-0426-1.

37. Kämper J, Esser K, Gunge N, Meinhardt F. 1991. Heterologous geneexpression on the linear DNA killer plasmid from Kluyveromyces lactis.Curr. Genet. 19:109 –118. http://dx.doi.org/10.1007/BF00326291.

38. Worsham PL, Bolen PL. 1990. Killer toxin production in Pichia acaciae isassociated with linear DNA plasmids. Curr. Genet. 18:77– 80. http://dx.doi.org/10.1007/BF00321119.

39. van Dijken JP, Bauer J, Brambilla L, Duboc P, Francois JM, Gancedo C,Giuseppin ML, Heijnen JJ, Hoare M, Lange HC, Madden EA, Nieder-berger P, Nielsen J, Parrou JL, Petit T, Porro D, Reuss M, van Riel N,Rizzi M, Steensma HY, Verrips CT, Vindelov J, Pronk JT. 2000. Aninterlaboratory comparison of physiological and genetic properties offour Saccharomyces cerevisiae strains. Enzyme Microb. Technol. 26:706 –714. http://dx.doi.org/10.1016/S0141-0229(00)00162-9.

40. Gietz RD, Sugino A. 1988. New yeast-Escherichia coli shuttle vectorsconstructed with in vitro mutagenized yeast genes lacking six-base pairrestriction sites. Gene 74:527–534. http://dx.doi.org/10.1016/0378-1119(88)90185-0.

Site-Directed Mutagenesis of Killer Toxin Zymocin

October 2014 Volume 80 Number 20 aem.asm.org 6559

on February 22, 2016 by guest

http://aem.asm

.org/D

ownloaded from