regulation of plasminogen activators in human thyroid follicular cells and their relationship to...

ORIGINAL ARTICLE 643

Regulation of PlasminogenActivators in HumanThyroid Follicular Cells andtheir Relationship toDifferentiated Function
RADHIKA SUSARLA, JOHN C. WATKINSON, AND MARGARET C. EGGO*
Division of Medical Sciences, University of Birmingham, Birmingham, UK

Human thyroid cells in culture take up and organify 125I when cultured in TSH (acting through cAMP) and insulin. They also secreteurokinase (uPA) and tissue-type (tPA) plasminogen activators (5–100 IU/106cells/day). TSH and insulin both decreased secreted PAactivity (PAA), uPA and tPA protein and their mRNAs. Autocrine fibroblast growth factor increased secreted PAA and inhibited thyroidcell 125I uptake. Epidermal growth factor (EGF) and the protein kinase C (PKC) activator, TPA significantly increased PAA and inhibitedthyroid differentiated function, (TPA> EGF). For TPA, effects were rapid, increased PAA secretion and decreased 125I uptake being seenat 4 h whereas for EGF, a 24 h incubation was required. qRT-PCR showed significantly increased mRNA expression of uPA with lessereffects on tPA. Aprotinin, which inhibits PAA, increased 125I uptake but did not abrogate the effects of TPA and EGF. The MEKK inhibitor,PD98059 partially reversed the effects of EGF and TPA on PAA, and largely reversed the effects of EGF but not TPA on differentiatedfunction. PKC inhibitors bisindoylmaleimide 1, and the specific PKCb inhibitor, LY379196 completely reversed the effects of TPA on125I uptake and PAA whereas EGF effects were unaffected. TPA inhibited follicle formation and this effect was blocked by LY379196 butnot PD98059. We conclude that in thyroid cells, MAPK activation inversely correlates with 125I uptake and directly correlates with PAexpression, in contrast to the effects of cAMP. TPA effects on iodide metabolism, dissolution of follicles and uPA synthesis are mediatedpredominantly through PKCb whereas EGF exerts its effects through MAPK but not PKCb.

J. Cell. Physiol. 212: 643–654, 2007. � 2007 Wiley-Liss, Inc.

Contract grant sponsor: Get A-Head charity campaign, UnitedHospitals of Birmingham.

*Correspondence to: Dr. Margaret C. Eggo, The Medical School,University of Birmingham, Birmingham B15 2TT, UK.E-mail: [email protected]

Received 2 October 2006; Accepted 22 January 2007

DOI: 10.1002/jcp.21060

We recently reported that normal human thyroid follicular cellssecrete urokinase plasminogen activator (uPA) and tissue-typeplasminogen activator (tPA) (Ramsden et al., 2002; Eggo et al.,2003). These preliminary findings have been confirmed byUlisse et al. (2006) who extended the study to show thatthyroid cancer cell lines expressed even higher levels suggestinga role in malignancy (Ulisse et al., 2006). PAs are serineproteases known to have local effects in invasion of metastaticcells, in regulation of tissue remodeling (Vassalli et al., 1991) andin the activation of growth factors and proenzymes. Thecascade of proteolytic reactions triggered by the PAs is initiatedby conversion of the inactive proenzyme, plasminogen, into theactive enzyme plasmin, a serine protease that can directlydegrade many proteins (Saksela, 1985). The two PAs differ bothstructurally and functionally, are products of two differentgenes, but share the common substrate, plasminogen. At timesthey can execute the same function and replace each other(Parfyonova et al., 2002), but non-proteolytic processes such ascellular adhesion and chemotaxis are thought to be mediated byuPA (Blasi, 1996). Both tPA and uPA have cell surface receptorswhich can immobilise them and thus allow local effects. uPAR iscoupled to signaling through mitogen-activated protein kinase(MAPK) (Aguirre-Ghiso et al., 2001). The receptors for tPA arethe low density lipoprotein receptor related protein, LRP-1 andannexin II (Akkawi et al., 2006).

The regulation of uPA and tPA differs between systems andbetween species. In rat Sertoli cells, cAMP increases tPAsecretion and mRNA expression yet inhibits uPA expression(Tolli, 1995) but this finding is not universal to all systems. Acomparison of mouse and rat granulosa cells reveals that cAMPregulates uPA in one and tPA in the other (Canipari et al., 1987).In primary cultures of rat astrocytes, forskolin (via cAMP)increases tPA but inhibits uPA and activation of protein kinaseC (PKC) has the converse effect (Tranque et al., 1992). In HeLacells, PKC activation and epidermal growth factor (EGF)

� 2 0 0 7 W I L E Y - L I S S , I N C .

stimulate tPA expression and their effects were additivesuggesting induction through different pathways (Medcalf andSchleuning, 1991). In human thyroid cells, we showed that EGFor the PKC activator, 12-O-tetradecanoyl phorbol-13 acetate(TPA) increased uPA and tPA secretion by Western blottingbut measurements of activity, signaling pathways responsibleand transcriptional regulation were not attempted (Ramsdenet al., 2002). Fibroblast growth factor (FGF) also usuallystimulates PA production although it achieves this upregulationthrough a separate pathway than that promoting growth inendothelial cells (Presta et al., 1989). Members of serineprotease inhibitor (serpin) superfamily, PAI-1 and PAI-2 are theprimary inhibitors of both tPA and uPA. PAIs, like PAs, areregulated by growth factors (Hamilton et al., 1992; Zoellneret al., 1993).

The aim of our study was to understand the regulation of PA(uPA and tPA) production from normal, functional thyroid cells,by factors that control thyroid growth and function. We haveobserved that TSH inhibited secreted PAA in normal humanthyroid cells (Eggo et al., 2003) which is in contrast to our earlierwork with sheep thyroid cells (Mak et al., 1984). In this study,we have sought to clarify the roles of insulin and TSH, alone and

644 S U S A R L A E T A L .

together, on PAA, on uPA and tPA mRNA, and on proteinexpression. Both these hormones are necessary for expressionof differentiated function in thyroid cells in culture and neitheralone is sufficient for optimal induction of 125I metabolism orthyroid cell growth (Eggo et al., 1990, 1996). As we found quitevariable expression of PAA between cell cultures we postulatedthat FGFs which are produced by thyroid cells (Cocks et al.,2003) may regulate thyroidal PA production and 125I uptake.We also examined the signaling pathways activated byexogenous EGF and TPA which regulate PA production in othersystems. In thyroid cells both these agents inhibit thyroid celldifferentiated function and stimulate thyroid cell growth.

Materials

Bisindoylmaleimide 1, wortmannin, PD98059, TPA and forskolin wereobtained from Calbiochem (Merck Biosciences, Notts, UK). LY379179was a kind gift from Dr. K. Ways and Dr. J.R. Gillig of Lilly Research Labs,Indianapolis, USA. PD166866 was a kind gift from Parke Davis, Ann Arbor,USA. The monoclonal antibody to p42/44 MAPK was from New EnglandBiolabs, Hertfordshire, UK and to the phosphorylated form of pMAPK fromthe Sigma Chemical Corporation, Poole, UK. Sheep polyclonal antisera tohuman tPA and uPA was purchased from the Binding Site, Birmingham, UK.Lumi GloR chemiluminescent substrate was from KPL, Gaithersburg, USA.S2251 (H-D-valyl-L-leucyl-L-lysine-p-nitroanilide hydrochloride) was fromFluka, Sigma–Aldrich and urokinase standard was from Calbiochem. ThePlasminogen Activator-Inhibitor-1(PAI-1) ELISA kit was from Wak-ChemieMedical GMBH, Germany. Collagenase type 2 was purchased fromWorthington, USA Serum for cell culture was purchased from First LinkLtd, Birmingham, UK. EGF was purchased from Peprotech Inc. (New Jersey,USA) and bovine insulin and TSH from Sigma. The primers and probes forqRT-PCR for uPA, tPA and 18S were purchased from Applied Biosystems,Warrington, Lancs, UK.

MethodsPrimary cultures of human thyroid follicular cells

Human thyroid follicular cells were prepared from surgical specimensas described previously (Eggo et al., 1996). The appropriate approval toperform these studies was obtained and all institutional ethicalguidelines were followed. Normal thyroid tissues adjacent to thepathology requiring surgery, multi-nodular goitres or tissue fromtreated Graves’ disease were used. Tumor tissue was not knowinglyused. Only those cell cultures showing TSH-dependent iodide uptakeand organification are included in this study. This was approximately70% of the cultures. This selection criterion was used to eliminate coldnodules, which have no function and hot nodules, which may haveautonomous function.

Briefly, the human thyroid specimens were digested in 0.1%collagenase type 2 in Hank’s balanced salt solution (HBSS) 3 h at 378C.The suspension was filtered through a flamed wire mesh filter toremove undigested tissue and centrifuged for 10 min at 300g at 08C.Following several washes with HBSS with centrifugation for 2 min at300g until there was no visible erythrocyte contamination, isolatedfollicles were resuspended in Coon’s modified Ham’s F-12 medium(Ambesi-Impiombato et al., 1980) (Gibco BRL Life technologies,Paisley, UK) supplemented with TSH (300 mU/L), insulin (0.3 mg/L), 1%fetal bovine calf serum, 105 U/L penicillin and 100 mg/L streptomycin.The cells were plated at a density of 5� 104 cells per cm2 and incubatedat 378C in 5% CO2 in a humidified incubator. After 72 h, medium waschanged, insulin, TSH, and antibiotics were maintained and serum wasomitted. The cells were grown in this chemically-defined mediumwithout serum and containing insulin, TSH and antibiotics as notedabove with medium changes every 3.5 days. After the 2nd mediumchange when the cells were 7 days old, cells were not dividing.

Experiments where cells were challenged with TSH, EGF, TPA, theMEK inhibitor PD98059, the PI3K inhibitor wortmannin, the PKCinhibitors bisindoylmaleimide 1 (Bis1) or LY379196 (LY), the FGFR1inhibitor PD166866 and the recombinant adenovirus expressingdominant negative FGFR1 were added to 7 days old cells and continuedfor 96 h in the medium containing insulin, TSH and antibiotics asdescribed and cumulative PAA secreted over this time measured. TPA,PD98059, PD166866, Bis1, and LY379196 were dissolved indimethylsulfoxide (DMSO). DMSO was added to the control cells atthe same concentration, which did not exceed 0.1%.

JOURNAL OF CELLULAR PHYSIOLOGY DOI 10.1002/JCP

125I uptake study

125I uptake was measured as previously described (Eggo et al., 1996).125I (2.5–5� 104 cpm per well) and NaI to a final concentration of 10�7

M was added to the wells 2 h before termination of the experiments.Culture media was removed and stored in sealed microfuge tubes at�208C until use in PAA assays. The cell layer was washed once, rapidly,with HBSS and was dissolved in 100ml 2% sodium dodecyl sulfate (SDS)and counted in a gamma counter (1260 Multi gamma II, LKB, Wallac).All experiments were performed in quadruplicate and repeated at leastthree times with similar results.

Experiments with recombinant adenovirusexpressing dominant negative FGFR1

Replication-defective recombinant adenovirus (RAd) expressingdominant negative FGFR1 (RAd-DNFGFR1) and the control RAdexpressing b galactosidase were prepared as described previously(Davies et al., 2003) and used in experiments at a multiplicity ofinfection of 10:1. Cells were incubated in adenovirus for 90 min, themedium was removed and the cell layer washed with HBSS. Mediumwas replaced and cell-conditioned medium was collected 96 h later.

Plasminogen activator enzyme activity assay

Plasminogen activator activity in the cell-conditioned culture mediumwas measured by a kinetic study of the rate of plasminogen-dependentcleavage of the substrate S2251 (H-D-valyl-L-leucyl-L-lysine-p-nitroanilide hydrochloride) (Mak et al., 1984). Briefly, to each well of a96 well plate, 150 ml of 0.1 M Tris-HCl, pH 7.5, 50 ml of plasminogen(20mg/ml in 0.1 M Tris-HCl, pH 7.5) (Sigma), 50ml of S2251 (0.5 mg/mlin sterile water) and 50 ml cell-conditioned medium were added. Insome instances due to high activity in the samples, dilutions were made.The rate of plasminogen-dependent cleavage of the substrate S2251with known concentrations of the standard urokinase (1–10 IU/ml)(Calbiochem) was simultaneously measured with the samples bymeasuring the change in absorbance at 405 nm every 30 min over aperiod of 3–4 h. Rates of hydrolysis for standards and samples weredetermined graphically. A second graph was plotted for the standardsof rate against concentration (IU/ml) and the concentration of the PA inthe samples was calculated from this standard curve.

PAI assay

PAI-1 levels in the cell-conditioned medium of thyroid follicular cellswere estimated using the PAI-1 ELISA kit, following the manufacturer’s(Wak-Chemie Medical GMBH, Germany) protocol. Briefly, a suitabledilution of the cell-conditioned culture medium (1:10–1:30) in dilutionbuffer was made. Hundred microliters of this diluted medium wasloaded on pre-coated wells. Following overnight incubation at 48C, thewells were washed with wash buffer and subsequent steps werefollowed as per the manufacturer’s instructions.

Western blots

Following treatment, medium was harvested and the cell layers werelysed in 2% SDS. Protein content in the cell layer was measured byperforming Bio-Rad assay. There were no significant changes in proteinexpression with the treatment protocols. The lysates were boiled for10 min in SDS sample buffer (2% SDS, 2% 2-mercaptoethanol, 20%glycerol 62.5 mM Tris-HCl pH 6.8, bromophenol blue). Proteins in thecell-conditioned medium were precipitated with 3 volumes of ethanol,centrifuged and the protein pellet dissolved in SDS sample buffer.Proteins were resolved by electrophoresis on denaturing 10% or 12.5%SDS-polyacrylamide gels (SDS-PAGE) with 5% stacking gel andtransferred by electrophoresis to polyvinylidene difluoride membrane(GE Healthcare, Amersham, UK). Antigen-antibody complexes weredetected as described previously (Davies et al., 2003). Membraneswere stripped in 62.5 mM Tris-HCl, 2% SDS and 1.5%2-mercaptoethanol pH 6.8 at 608C for 30 min before reprobing.

Reverse-transcriptase polymerase chainreaction (RT-PCR)

Total RNA was extracted from the primary cultures of thyroidfollicular cells using TRIzol Reagent (Helena Biosciences) according tothe manufacturer’s recommendations and quantified by spectrometry(260 nm). RNA was heated at 708C for 10 min to denature thesecondary structure. Synthesis of cDNA was performed using 1 mg of

P L A S M I N O G E N A C T I V A T O R S I N T H Y R O I D C E L L S 645

total RNA in 5 mM MgCl2, 1 mM of each dNTP, 1 U recombinantRNAsin ribonuclease inhibitor, 15U avian myeloblastosis virus (AMV)reverse transcriptase and 0.5mg random hexamer primers made up toa total volume of 20 ml with RNAse-free water. The reaction mixturewas incubated at 428C for 45 min and then for 5 min at 958C.Primer design. Gene sequences for uPA, tPA and uPAR wereobtained from http://www.ensembl.org/Homo_sapiens/transcript(The Wellcome Trust Sanger Institute, Human genome data base). Theprimers were designed using Primer 3 software available on http://www-genome.wi.mit.edu/genome_software/other/primer3.html. Theprimers used to amplify the human uPA, uPAR, tPA,. PAI-1 and PAI-2are shown in Table 1.

PCR was performed with 100 ng of cDNA in 1 mM MgCl2, 0.2 mMdNTP, 2� PCR buffer, 50 pmol reverse and forward primers and thetotal volume made up to 50 ml with RNAse- free water. Hundredmicroliters of sterile mineral oil was layered onto the reaction mixtureto prevent evaporation. The samples were initially heated to 958C for5 min, 2.5U Taq DNA polymerase was added and then through35 cycles of 958C (1 min), 608C (1 min), and 728C (1 min), with a finalextension step of 728C for 5 min. The products of the PCR reactionwere analyzed on a 2% agarose gel in 1xTBE buffer (0.089 M Tris-base,0.089 M boric acid, 0.002 M EDTA, pH 8.3). DNA was stained withethidium bromide and visualized with UV light.

Quantitative RT-PCR

The regulation of uPA and tPA mRNA expression was studied using theABI PRISM 7700 sequence detection system. The real time RT-PCRwas carried on 96-well plates in 25 ml reaction mixture containing 1�TaqMan Universal PCR Master Mix (Applied Biosystems), 1� TaqManGene Expression assay mix (Applied Biosystems) which contains twounlabeled PCR primers at 900 nM each (final concentration) and oneFAMTM dye-labeled TaqMan1 MGB probe at a final concentration of250 nM and 10 ng of cDNA, diluted in RNase-free water. Multiplex PCRamplification was optimized and run in parallel with singleplex assay toconfirm that the Ct values are not affected by performing multiplexreactions. The endogenous control used in the assays is 18S rRNAwhich is VIC-labeled (Applied Biosystems). The thermal cyclingconditions used are 508C for 2 min and 958C for 10 min and then40 cycles of 958C for 15 sec and 608C for 1 min. The results wereanalyzed using the software recommended by the manufacturer andthe data were expressed as cycle threshold (Ct) values (the cyclenumber at which logarithmic plots cross a calculated threshold line)and is used to determine DCt values [DCt¼Ct of the target gene(e.g. uPA or tPA) minus Ct of the housekeeping gene (e.g. 18S)]. TheDDCt value is the difference in theDCt value of a particular sample withreference to the control (e.g. DCt of treated - DCt of control) and thefold change in the gene expression is calculated using theequation 2�DDCt. In an assay each triplicate or quadruplicate conditionwas run in duplicate and the experiments were repeated on at leastthree different patient samples.

Statistics

Where possible data have been pooled from a minimum of threeexperiments using thyroid cell preparations from different patients andnormalized to control values. For statistical analyses ANOVA andTukey–Kramer multiple comparison post test were used. These aredescribed in the figure legends. There was considerable variation in125I uptake and PAA secreted between preparations of primarycultures. In some instances therefore a representative experiment,performed on quadruplicate wells, is shown and the statistics on thatexperiment reported. When a representative experiment is shown,the data on PAA and 125I uptake are from the same patient. AgainANOVA and Tukey–Kramer multiple comparison post test were used.

TABLE 1. Oligonucleotide sequences of PCR primers used

Gene Forward primer (5( to 3()

uPA GTCACCACCAAAATGCTGTGuPAR AGCTATCGGACTGGCTTGAAtPA ACATGCTGTGTGCTGGAGACPAI-1 CTCTCTCTGCCCTCACCAACPAI-2 GTTCATGCAGCAGATCCAGA


In these circumstances the experiment was repeated a minimum ofthree times with different patient samples and similar data obtained.

ResultsEffects of insulin, TSH or forskolin alone and incombination on PAA and 125I uptake in primarycultures of thyroid follicular cells

Figure 1a shows the effect of TSH, the adenylate cyclasestimulator, forskolin, insulin alone and in combination onsecreted PAA and 125I uptake. Basal medium (B) contains noadditions except antibiotics. Additions (TSH (300 mU per L),forskolin(10�5 M), insulin (0.3 mg per L) and the combination ofinsulin with TSH or forskolin) were made on day 4. The mediumwas changed on day 7 and the additions replaced. On day 11, thecells were radiolabeled for the final 2 h of the incubation and125I uptake into the cell layer and PAA in the medium weremeasured. Results are expressed relative to the values obtainedin cells cultured in basal medium and are pooled data from fourdifferent primary cell cultures.

PAA secretion was highest in cells cultured with nohormonal supplements (basal medium) whereas 125I uptake waslowest under these conditions. Secreted PAA decreasedsignificantly with insulin or TSH alone or their combination. Theeffect of the combination of insulin and TSH was significantlylower (P< 0.001) than insulin or TSH alone. 125I uptake on theother hand was highest when cells were incubated in theseconditions. TSH alone in all experiments produced a smallincrease in 125I uptake but when the data from the experimentswere pooled, the effect did not reach statistical significance.Forskolin, which like TSH stimulates cAMP, mimicked theeffects of TSH on 125I uptake and PAA secretion.

Effects of insulin, TSH or forskolin alone and incombination on uPA and tPA mRNA expression inprimary cultures of thyroid follicular cells

To examine the effects of TSH and forskolin alone and incombination with insulin on uPA and tPA mRNA levels, realtime RT-PCR was performed and the data are shown inFigure 1b. The protocol for cell culture was as described forFigure 1a. mRNA was extracted from thyroid cells culturedchronically for 7 days (with medium change at four days post setup) in basal medium, in TSH (300 mU per L), forskolin (10�5 M)alone and in combination with insulin (0.3 mg per L). Results areexpressed relative to the levels in cells cultured in basal mediumwith no supplements. The data shown in Figure 1b are pooledfrom 4 different thyroid preparations. Insulin and TSHindividually produced a statistically significant decrease in uPAmRNA expression. In combination their effects were additive.The inhibitory effects of TSH on uPA mRNA expression weremimicked by forskolin (P< 0.001). Steady state levels tPAmRNA were also decreased by incubation with insulin, TSH andforskolin but this only reached statistical significance when cellswere cultured with insulin and TSH (P< 0.05). The decrease inuPA and tPA mRNAs was seen in all the preparations examined(n¼ 4) but the magnitude of the inhibitory effect varied. Similareffects were seen at the protein level for uPA and tPA as shownin Figure 1c. The Western blot shows a decrease in the amountof uPA (53 kDa) secreted following addition of insulin, TSH and

Reverse primer (5( to 3() Product size (bp)

AGGCCATTCTCTTCCTTGGT 224CATGTCTGATGAGCCACAGG 144TGCACTCTTCCCTCTCCTGT 271GTGGAGAGGCTCTTGGTCTG 212CGCAGACTTCTCACCAAACA 166

Fig. 1. a. Effect of insulin (I), TSH (T) and forskolin (F) alone and incombination (IRT and IRF) on 125I uptake and secreted PAA inthyroid follicular cells. Open bars show fold change in PAA and closedbars fold change in 125I uptake. Pooled data from experiments on4 different patient samples are shown. 125I uptake for the final 2 h ofincubation was measured. PAA was that accumulated in the cell-conditionedmedium between 7–11 days after isolation. MeanWSEM,nU 4 MP<0.05, MMP<0.01, MMMP<0.001 and are compared with basal(B). b: Real time RT-CR showing the change in mRNA expressionof uPA and tPA in cells cultured in basal medium (B), insulin alone(I), TSH (T), forskolin (F), insulinRTSH (IRT) or insulinR forskolin(IRF). Fold change in uPA mRNA and tPA mRNA expressioncompared with basal level are shown. Pooled data from 4experiments on different patient samples are shown. MeanWSEM,nU 4. Statistics as in (a). c: Western blot of ethanol precipitatedthyroid cell-conditionedmedium from cells cultured in basalmedium(B), insulin alone (I), TSH (T), forskolin (F), insulinRTSH (IRT) orinsulinR forskolin (IRF) between 7 and 11 days and probed for uPAand tPA. A 53 and 70 kDa band corresponding to uPA and tPA,respectively, are labeled.

Fig. 2. RT-PCR showing mRNA expression of uPA (224 bp), uPAR(144 bp), tPA (271 bp), PAI-1 (212 bp) and PAI-2 (166 bp) in primaryhuman thyroid follicular cells. This experimentwas repeated on threeprimary cultures and these mRNAs were expressed in allpreparations.


their combination. The effects of cAMP (TSH or forskolin),alone or in combination with insulin, were much less inhibitoryon tPA expression.

mRNA expression of other components of PA system

Having confirmed uPA and tPA mRNA expression by real timeRT-PCR, we examined mRNA expression of other


components of PA system. RT-PCR reactions using primers touPA, uPAR, tPA, and the inhibitors of PAA, PAI-1, and PAI-2 areshown in Figure 2. This experiment was repeated on mRNAsisolated from three different primary cultures of human thyroidcells after 10 days in culture and in all experiments, mRNAs forall the components of the PA system were seen in all thesamples examined. We also examined secretion of PAI-1 intothe cell conditioned medium and its regulation by TSH.Amounts secreted over 3 days by 105 cells varied between75 and 460 ng. A TSH dose-response showed no consistentinhibitory or stimulatory effects on PAI-1 secretion (n¼ 3)(data not shown).

Effect of increasing concentrations ofTSH on uPA and tPA mRNA expression

Our earlier studies examining 125I uptake in thyroid cells show abell-shaped dose response to TSH (Eggo et al., 1996). Weexamined the effects of increasing TSH concentrations on uPAand tPA mRNA expression and the data are shown in Figure 3.RNA was extracted on day 11 following 96 h treatment withvarying doses of TSH added on day 7 to primary human thyroidfollicular cells cultured in presence of insulin (0.3 mg per L) topermit expression of differentiation. The data shown arepooled from three different patients. 125I uptake and secretedPAA were also measured on these samples and these data areshown in the inset graph. TSH at 0.01U/L and higher dosessignificantly inhibited uPA mRNA expression (P< 0.001).Unlike the effects of TSH on 125I uptake and PAA, shown in theinset graph, this curve was not bell-shaped and inhibitory effectson uPA mRNA levels were maintained across the TSH doseresponse. TSH also significantly inhibited tPA mRNA levels(P< 0.05). The maximum effect was seen at 0.01 U/L TSH andthis effect was sustained over the dose response curve.

Effects of autocrine fibroblast growth factorsand their receptors on PAA and 125I uptake

Secreted PAA ranged from 2.5–50 U/ml (n¼ 10) when cellswere incubated in insulin and TSH. We observed that the morefunctional preparations, assessed by their ability to trap andorganify 125I, had lower PAA. We postulated that the variabilityin the levels of PAA secreted and the 125I uptake by differentthyroid cell preparations cultured under the same conditionscould be due to the secretion of growth factors. Previous workfrom our laboratory had identified FGF as an autocrine growthfactor that increases thyroid growth and inhibits thyroiddifferentiated function (Cocks et al., 2003; Davies et al., 2003).

We used two approaches to inhibit autocrine FGF effects:PD166866 a specific FGFR1 inhibitor (Patel et al., 2005) and

Fig. 3. Effect of increasing concentrations of TSH on uPA (solid line) and tPA (dashed line) mRNA levels after 96 h incubation between7 and 11 days after isolation. The inset shows the effects of TSH on 125I uptake (solid line) and PAA (dashed line) after 96 h incubation between7 and 11 days after isolation. Pooled data from three experiments on different patient samples are shown. MP<0.05, MMP<0.01, MMMP<0.001.


RAd- DN-FGFR1 which blocks signaling through all FGFRs inthyroid cells (Davies et al., 2003). Figure 4 shows the effects ofblocking autocrine FGF signaling on PAA and 125I uptake.PD166866 (100 nM) significantly increased 125I uptake anddecreased secreted PAA as shown in Figure 4a. The effects ofRAd-DNFGFR1 on PAA and 125I uptake are shown inFigure 4b. Cells from the same patient were used in Figures 4aand b. RAd-b-galactosidase was used as a control of nonspecificeffects of RAd. Incubation with control RAd-b-galactosidasehad no significant effects on either PAA or 125I uptake.Transduction with DNFGFR1 significantly decreased secretedPAA and increased 125I uptake by a similar amount (30%).

Effect of EGF and TPA with time on PAA, 125I uptake

Exogenous addition of EGF (3 nM) and the PKC activator, TPA(30 nM), both increased PAA in the culture medium butinhibited 125I uptake significantly and markedly in allpreparations. The fold stimulation in response to these agonistsvaried between preparation depending on the basal expressionof PA, but these significant stimulatory effects on PAA andinhibitory effects on 125I uptake were found in all preparations(n¼ 10). Figure 5a shows a representative experiment of theeffects of EGF and TPA on PAA and 125I uptake following 96 hincubation. Thyroid function, measured as 125I uptake in thefinal 2 h of incubation, showed dramatic and significantinhibition following incubation with TPA (30 nM) or EGF (3 nM)as reported previously (Eggo et al., 1996). The effects of EGF onincreasing secreted PA activity (1.3–5 fold) and on inhibition of125I uptake (20–70% inhibition) were less marked than those ofTPA which produced 2–20 fold increases in PA and 80–100%inhibition of 125I uptake.

We also found an increase in the amount of secreted PA,both uPA and tPA, by these agonists, as shown inFigure 5b which is a Western blot of cell conditioned mediumafter 96 h incubation. The principal band of 53 kDa for uPA, was


markedly increased by EGF and to an even greater extent byTPA. Both EGF and TPA markedly increased secreted tPAexpression. For tPA the principal band migrated at 70 kDaalthough a fragment of 60 kDa was also present in the TPA-treated cells.

Effects of EGF and TPA on mRNA and proteinexpression of uPA and tPA

To determine whether TPA and EGF altered uPA and tPAmRNA levels, a time course study of PA mRNA expression andPAA was performed. TPA or EGF was added to cells at differenttime points prior to termination. Real time qRT-PCR wasperformed on cells derived from four different patients. For thedifferent cell preparations there was a wide variation in the foldstimulation in mRNA induced by the agents but both hadstimulatory effects on uPA and tPA mRNAs and PAA. Arepresentative experiment is shown in Figure 6 where theeffects on uPA and tPA mRNAs and PAA are shown from thesame patient. With TPA, increases in uPA and tPA mRNAswere seen at 2 h reaching a maximum within 8 h wheresignificant differences were seen. mRNA levels then decreasedwith time. This time course for the mRNAs reflected thechanges in PAA shown in this figure. For EGF significantincreases in the expression of tPA and uPA mRNAs were alsoseen by 8 h and were modest as shown in Figure 6b.

For TPA statistically significant stimulatory effects insecreted PAA were seen at 8 h which continued to increaseeven at the end of 72 h. For EGF statistically significant effectswere not seen until 48 h after addition and showed a slowgradual increase with time. The time course of the effects ofTPA on uPA secretion is shown in Figure 6c. Protein incell-conditioned medium from one patient’s thyroid cells wereanalyzed by Western blotting. By 2 h of treatment, increasedexpression was seen. After 24 h a 35 kDa band was strongly

Fig. 4. a. Effect PD166866 (10S7 M) on PAA and 125I uptake,following 96h incubation. Open bars for PAA and closed bars for125I uptake. This experimentwas repeated on thyroid cells fromthreedifferent patients with similar findings. A representative experimentis shown. 125I uptake and PAA (from same patient) of the untreatedcontrol are compared with PD166866-treated cells for statisticalanalysis. MeanWSEM, nU 4. Student’s t-test was performed.MUP<0.05, MMMUP<0.001. b. Effect of RAd-DNFGFR1 (Fv) and RAdb-galactosidase (Cv) on PAA and 125I uptake. This experiment wasrepeated on thyroid cells from three different patients with similarfindings. A representative experiment is shown. 125I uptake and PAA(from same patient) of the untreated control is compared to Cv andFv treated cells for statistical analysis. MeanWSEM, nU 4. Cells fromthe same patient were used in (a and b). MUP<0.05, MMMUP<0.001.

Fig. 5. a. Effect of 96h challenge with TPA (3T10S8 M) and EGF(3T 10S9 M) on secreted PAA and 125I uptake by thyroid follicularcells. A representative experiment is shown. This experiment wasrepeatedoncells from10different patients and in all cases statisticallysignificant reductions in 125I uptake and increases in PAA were seen.Open bars show PAA and closed bars show 125I uptake. MeanWSEM,nU 4. MMUP<0.01, MMMUP<0.001. b:Western blot showing the effectof EGF (3T 10S9 M) and TPA (3T 10S8 M) on secreted uPA (upperpart) and tPA (lower part) following 96 h challenge.


expressed suggesting processing of uPA. Both forms possessproteolytic PA activity (Stump et al., 1986; Stepanova andTkachuk, 2002). This processing was seen over the rest of thetime course reflecting the effects on PAA shown in Figure 5a.

Effects of inhibition of PA on thyroid function

In order to determine whether the secreted PAA had anyeffects on thyroid function, cells were incubated the presenceof serine protease inhibitor, aprotinin for 96 h and its effects onthyroid function in the presence and absence of TPA andEGF examined. As shown in Table 2, in the presence ofaprotinin (2.8 mg per L) PAA was negligible in our assay even inthe presence of TPA or EGF confirming its effectiveness.Aprotinin significantly increased thyroid function in all thecontrol cultures. The magnitude of the effect varied betweenprimary cultures but the stimulatory effect was consistent.EGF and particularly TPA inhibited thyroid function andincreased PAA in the cell-conditioned medium. The inhibitoryeffects of EGF and TPA on 125I uptake and organification were


not however reversed by aprotinin although, as for theunstimulated control, 125I uptake was increased.

Role of p42/44 MAPK signaling pathways inmediating the effects of TPA and EGF

We have previously shown that TPA and EGF stimulate p42/44 MAPK in thyroid cells (Eggo et al., 2003). To examine theeffect of inhibiting MEK, which activates p42/44 MAPK, the MEKinhibitor PD98059 was used. Cells were pretreated with 0.02mM PD98059 for 30 min prior to the addition of TPA or EGFand incubated for 96 h. Figure 7a shows the effect of PD98059on 125I uptake in the presence and absence of TPA (left) and EGF(right) and Figure 7b shows their effects on PAA. The resultsshown are representative experiments.

TPA inhibited 125I uptake markedly and significantly(��P< 0.01) (Fig. 7a). PD98059 did not inhibit 125I uptake and inmost experiments, including those shown on this figure,PD98059 stimulated 125I uptake. PD98059 partially preventedthe effects of TPA on inhibition of 125I uptake. This effect washowever small and may be accounted for by the increased125I uptake in the PD98059-treated control. TPA significantlyinhibited 125I uptake both in the presence and absence ofPD98059. The decrease in the absolute values 125I taken upwhen TPA was present, were not significantly different in thepresence and absence of PD98059.

EGF significantly inhibited 125I uptake although in allexperiments its effects were not as great as those of TPA.PD98059 largely reversed the inhibitory effects of EGF on125I uptake and there was no significance difference in EGF-treated cells� PD98059. When MAPK was inhibited, pooled

Fig. 6. a. Time course of the effects of TPA (3T 10S8 M) on PAAsecretion (line graph), and mRNAs for uPA (solid bar in histogram)and tPA (openbar in histogram).Agonistswere addedat various timepoints after the start of the experiment and terminated at the sametime point. Control values of PAA (i.e no additions) were subtractedfrom the values. This experiment was repeated on thyroid cells fromfour different patients with similar findings. A representativeexperiment is shown. MeanWSEM, nU 4. MMP<0.01, MMMP<0.001.b: Time course of the effects of EGF (3T 10S9 M) on PAA secretion(line graph) and mRNAs for uPA (solid bar in histogram) and tPA(open bar in histogram). Agonists were added at various time pointsafter the start of the experiment and terminated at the same timepoint. Control values of PAA (i.e. no additions) were subtracted fromthe values. This experiment was repeated on thyroid cells fromfour different patients with similar findings. A representativeexperiment is shown. MeanW SEM, nU4. MP<0.05, MMP<0.01,MMMP<0.001. c: RepresentativeWestern blot showing the time courseof uPA secretion from cells challenged with TPA (3T 10S8 M).Samples from a different patient than that shown in (a and b) areshown.

TABLE 2. Effect of aprotinin on PA secretion and 125I uptake from cells treatedwith and without TPA or EGF

PA activity (U/ml) 125I Uptake (cpmT 10S2)

Control 63.4W 20.2 13.3W 4.1TPA 226.7W 6.8; P< 0.01 0.6W 0.1; P< 0.01EGF 102.5W 11.6; P< 0.01 7.3W 1.2; nsControl R 0W 0.02 45.7W 5.3TPA R 0.43W 0.4; ns 0.5W 0.2; P< 0.01EGF R 0W 0.2; ns 11.1W 0.8; P< 0.01

Effect of aprotinin (þ) on PAA and 125I uptake following treatment with EGF or TPA.Values¼mean� SEM n¼ 4. Statistical analysis was done with reference to relevantcontrol� aprotinin.

Fig. 7. a. Effect of the MEK inhibitor PD98059 (0.02 mM) on125I uptake following challenge with TPA (3T 10S8 M) and EGF(3T 10S9 M) for 96 h. This experiment was repeated on thyroid cellsfrom seven patients for TPA and four patients for EGF with similarfindings. A representative experiment is shown. MeanWSEM, nU 4,where each treatment is in quadruplicate. For statistical analysis, ‘M’ isthe % change in 125I uptake compared with untreated control (C-), ‘#’is compared with PD98059 control (PDS), and ‘R’ is compared withTPA/EGF treated control (CR). M, #, RP<0.05, MM, ##, RRP<0.01, MMM,###,RRRUP<0.001. b: Effect of theMEK inhibitor PD98059 onPAAfollowing challenge with TPA (3T 10S8 M) and EGF (3T 10S9 M) for96 h. This experiment was repeated on thyroid cells from seven andfour different patients for TPA and EGF group respectively, withsimilar findings. A representative experiment is shown. MeanWSEM,nU 4, where each treatment is in quadruplicate. For statisticalanalysis, ‘M’ is the % change in PAA compared with untreated control(CS), ‘#’ is comparedwithPD98059 control (PDS), and ‘R’ comparedwith TPA/EGF treated control (CR). M, # ,RP<0.05, MM, ##, RRP<0.01,MMM, ###,RRRUP<0.001. Cells from the same patient are shown in(a and b).


data from 4 separate experiments on four different thyroid cellpreparations, showed there was an 80� 9.6% (mean� SEM)inhibition of the inhibitory effects of EGF on 125I uptake. Thiswas calculated by determining the difference between controland EGF-treated values and comparing this with the differencein control and EGF-treated values in those samples incubatedwith PD98059.

TPA stimulated PAA markedly and significantly (P< 0.001)(Fig. 7b). PD98059 decreased PAA secretion from control wells



(P< 0.01) and also partially prevented the TPA-induced rise inPAA (P< 0.01,þþ). The unit increase in PA activity induced byTPA in the presence and absence of PD98059 was calculatedand the percentage change from control was compared in 7separate experiments. When the data were pooled, MAPKinhibition was found to reduce the effects of TPA on PAA by35.1� 9.5% (mean� SEM).

EGF stimulated PAA modestly but significantly (P< 0.01). Itseffects were partially reversed by PD98059. The unit increasein PA activity induced by EGF in the presence and absenceof PD98059 was calculated and the percentage changefrom control was compared in 3 separate experiments.When the data were pooled, MAPK inhibition was found toreduce the effects of EGF on PAA by 36.2� 6.0%(mean� SEM).

Fig. 8. a. Effect of varying doses of the PKCb inhibitor LY379196 on 125I uM).Closedbars for varyingdosesofLY379196aloneandhatched forLY379cells from three different patients with similar findings. A representativecomparedwithuntreated control (CS) and ‘R’ comparedwithTPA/EGF trRRRP<0.001. b: Effect of the PKCb inhibitor, LY379196, on PAA in presenbars for varying doses of LY379196 alone and hatched bars for LY379196 icells from three different patients with similar findings. A representative euntreated control (CS) and ‘R’ is compared with TPA/EGF treated contr(a and b). M, RP<0.05, MM, RRP<0.01, MMM, RRRP<0.001. c: Effect of PKC inh( 3T 10S8M)andEGF( 3T 10S9M) following72hchallenge.This expesimilar findings. A representative experiment is shownwhere the% 125I up‘M’ is % 125I uptake compared with untreated control (CS), ‘R’ is comparcontrol (BisIS).MeanWSEM,nU 4. M, #,RP<0.05, MM, # #,RRP<0.01, MMM, # # #,

presence or absence of TPA ( 3T 10S8 M) and EGF ( 3T 10S9 M) follofrom three different patients with similar findings where the % PAA is ca125I uptake compared with untreated control (CS), ‘R’ is compared with(BisIS). MeanWSEM, nU 4. M, #, RP<0.05, MM, # #, RRP<0.01, MMM, # # #, RR


Role of PKC activation in the effects of TPAand EGF on PA activity and 125I uptake

The effects of the specific PKC inhibitor LY379196 on125I uptake in cells treated with TPA or EGF are shown inFigure 8a and their effects on secreted PAA are shownin Figure 8b. A representative experiment is shown. Cellswere preincubated for 30 min in varying doses of LY379196before addition of TPA or EGF. TPA inhibited 125I uptakemarkedly (��P< 0.01) as shown in Figure 8a. LY379196 hadno inhibitory effects on 125I uptake and the small increases werenot significantly different from control. In this dose responseexperiment, 100 nM LY379196 partially reversed the effects ofTPA and at 300 nM and 1 mM complete reversal was effected(þþþP< 0.001). The effects of 100 nM LY379196 were

ptake in presence or absence of TPA (3T 10S8 M) and EGF (3T 10S9

196 inpresenceTPAorEGF.This experimentwas repeatedon thyroidexperiment is shown. For statistical analysis, ‘M’ is the 125I uptakeeated control (CR).MeanWSEM,nU 4. M,RP<0.05, MM,RRP<0.01, MMM,

ce or absence of TPA ( 3T 10S8 M) and EGF ( 3T 10S9 M). Openn presence of TPA or EGF. This experiment was repeated on thyroidxperiment is shown. For statistical analysis, ‘M’ is PAA compared withol (CR). MeanWSEM, nU 4. Cells from the same patient are shown inibitor BisI (3T 10S7 M) on 125I uptake in presence or absence of TPArimentwas repeatedon thyroidcells fromthreedifferent patientswithtake is calculated fromuntreated control (CS). For statistical analysis,ed with TPA/EGF treated control (CR) and ‘#’ is compared with BisIRRRP<0.001. d: Effect of panPKC inhibitorBisI (3T 10S7M)onPAA inwing 72 h challenge. The data shown are a representative experimentlculated from untreated control (CS). For statistical analysis, ‘M’ is %TPA/EGF treated control (CR) and ‘#’ is compared with BisI controlRP<0.001. Cells from the same patient were used in both (c and d).


repeated on four different cell preparations and in three of thefour there was significant and complete reversal of theinhibitory effects of TPA on 125I uptake. EGF significantlyinhibited 125I uptake and LY379196 had no significant effects onthis inhibition even at the highest dose of LY379196.

TPA stimulated secreted PAA markedly and significantly(��P< 0.001) as shown in Figure 8b. LY379196 (100 nM)completely reversed these stimulatory effects (P< 0.001,þþþ). At high doses (1 mM) LY379196 inhibited control PAAand on some occasions, this small reduction was statisticallysignificant. EGF also produced a significant increase in PAA(P< 0.05, �). This effect was not inhibited by LY379196 at anydose. Experiments using 100 nM LY379196 were repeated onfour different occasions and in all experiments, EGF effects onPAA were not significantly inhibited whereas the marked,stimulatory effects of TPA effects were reversed.

These effects were also found with the specific inhibitor Bis 1as shown in Figures 8c and d. Bis I completely reversed theeffects of TPA on 125I uptake and there was no significantdifference between the BisI-treated samples�TPA. EGFeffects were unaffected (Fig. 8c), significant inhibition remainingwhen BisI was present (# #, P< 0.01). Similarly for PAA, BisIcompletely reversed the potent significant stimulatory effectsof TPA but not those of EGF (Fig. 8d). The small but significantreduction in the BisIþ EGF- treated cells is due to the significantreduction by BisI alone.

Effect of TPA and EGF on follicular structures inthyroid cell cultures and the role of signaling throughPKC and MAPK on these effects

Since the effects of PKC activation on 125I uptake and PAA couldbe blocked by incubation with LY379196 we examined whether

Fig. 9. Effect of TPA and EGF on thyroid follicular structures and the abPhotomicrographs of 7 day old thyroid follicular cells cultured insulin and(3T 10S8 M) for 24 h are shown. A 30min pretreatment with LY379196 (1Pretreatment with PD98059 (0.02 mM) had little effect. Arrows indicate


the ability of TPA to abolish thyroid follicle structures was alsomediated through PKC activation. 7 day old cultures of thyroidcells incubated in insulin and TSH without serum (control) weretreated with EGF and TPA in the presence and absence of eitherLY379196 (100 nM) or with PD98059 (0.02 mM) for 24 h.Photomicrographs are shown in Figure 9. Follicles are indicatedby arrows. In EGF-treated cultures, there were no noticeableeffects on the number of follicles seen in the control cultures. InTPA-treated cultures, virtually all follicles had disappeared by24 h of treatment. Both LY379196 and PD98059 enhancedfollicle formation although this effect was not marked.LY379196 pretreatment for 30 min prior to TPA prevented theinhibitory effects of TPA on follicular structures. Pretreatmentin PD98059 in contrast did not prevent TPA effects. For EGF-treated cells, neither LY379196 nor PD98059 pretreatmentproduced noticeable or quantifiable effects on the number offollicles present.

MAPK regulation by specific signaling inhibitorsin presence or absence of TPA

Figure 10 shows the effect of 96 h stimulation with TPA on p42/44 MAPK and its unphosphorylated form (beneath) in cellstreated chronically with and without 0.02 mM PD98059 toinhibit MEK. Chronic treatment with TPA, which is shown inbold lettering with (þ), resulted in increased p42/44 MAPKexpression in most conditions. At these long time points therewas therefore no noticeable increase in specificphosphorylation of MAPK. Chronic treatment of cells withLY379196 (100 nM) and TPA resulted in reduced expression ofphosphorylated MAPK. Long term repression of PKCb mayhave interfered with MAPK activation by TPA. PD98059, asexpected, inhibited MAPK phosphorylation and also decreased

ility of LY379196 and PD98059 to influence follicle formation.TSH without serum and challenged with EGF (3T 10S9 M) and TPA0S7 M) abolished the inhibitory effects of TPA on follicular structures.a 3D follicle.

Fig. 10. Western blot showing the regulation of MAPK,phosphorylated (upper panel) andunphosphorylated (lower panel) byinhibitors of MAPK, PI3K and PKC in presence (R) or absence of TPA(3T 10S8M) treated for 96h.The inhibitor used forMAPK isPD98059(0.02 mM) (PD), for PI3K is wortmannin (10S7 M) (W), and for PKCbis LY379196 (10S7 M) (Ly).


the level of MAPK per se. Coincubation with TPA prevented thereduction in MAPK but the stimulation of MAPKphosphorylation was minimal under these conditions.Wortmannin, a specific inhibitor of phosphatidylinositol3-kinase (PI3K) alone enhanced the phosphorylation of MAPK.Wortmannin however had no consistent effects on 125I uptakeor PAA suggesting little involvement of PI3K. The combinationof wortmannin and PD98059 was similar to that of PD98059alone and the combination of wortmannin andLY379196�TPA gave similar results to that of LY379196 alonealthough as noted previously, wortmannin increased levels ofphosphorylated MAPK. The combination of PD98059 withLY379196 was additive and all phosphorylation of MAPK wasabolished.

Discussion

In this study, we have shown that primary cultures of humanthyroid follicular cells secrete large amounts of active PAs, bothuPA and tPA. The amount secreted by differentiated cellscultured in insulin and TSH is 5–100 IU/106 cells/day. Thisincreases when cells are less functional. The variability is likelyrelated to the tissue from which the cultures were isolated. It isnot impossible that thyroid cells with genetic aberrations areincluded in some of our preparations. Occult thyroidmalignancies (usually papillary) are found in up to 36% of thepopulation in unselected routine autopsy cases (Nasir et al.,2000), and in up to 19% of surgical thyroidectomy specimens(Bramley and Harrison, 1996). It is for this reason that the cellsare selected for function and for TSH responsiveness which areoften absent in thyroid malignancies and solitary nodules. Theproduction of PAA is likely to be from thyroid follicular cellsrather than a contamination by endothelial cells because we donot find positive staining for factor VIII-related antigen on thesecells whereas thyroid endothelial cells do express this marker(Patel et al., 2003). In addition, cells are cultured in serum-freemedium without a matrix, conditions that do not support thegrowth of endothelial cells.

We showed in an earlier study that TSH inhibited secretedPAA (Eggo et al., 2003) and in this study we show that insulin byitself and TSH, through cAMP inhibits PAA and PA proteinlevels. These effects were marked for uPA. There wereinhibitory effects on uPA mRNA levels, consistent with thechanges in PAA and uPA protein. Insulin, TSH, and forskolinindependently reduced uPA mRNA and the combination ofinsulin with TSH or with forskolin was additive. For tPA mRNAsignificant inhibitory effects were only seen with thecombination of TSH with insulin. Individually there were nosignificant effects. tPA mRNA levels were lower than those ofuPA. Our data show that PAA is decreased with differentiationprimarily through changes in uPA mRNA and protein. When


cultured in insulin and TSH (or forskolin), the cells aredifferentiated and have thus initiated a programme leading tofollicle formation and thyroid hormone synthesis (Eggo et al.,1996). They thus differ markedly from their untreatedcompanions.

The inhibitory effect of TSH and cAMP on PAA is in contrastto our work with sheep thyroid cells where TSH and IGF-Iincreased PAA (Mak et al., 1984). For tPA this species differencemay be related to differences in the human cAMP responseelement reported by Holmberg et al. (1995) where theyshowed that the mouse promoter for tPA was functional butthat a nucleotide substitution in the human sequence renderedit unresponsive (Holmberg et al., 1995). We also examined theeffect of increasing TSH concentrations on mRNA levels foruPA and tPA. Both genes were very sensitive to TSH andinhibition of mRNA expression was seen at concentrationslower than that required to stimulate iodide uptake andorganification. The effects on uPA mRNA were more profoundthan those on tPA mRNA. In contrast to TSH effects on PAAand 125I, a bell-shaped dose response was not found but bothcurves plateaued at 0.1–0.3 U/L TSH and at high concentrations,where function is lower and PAA higher, no reversal of theinhibitory effects on uPA and tPA mRNA expression was found.This would argue against high concentrations of TSH activatinginositol lipid hydrolysis in human thyroid cells as recentlyreported by Van Sande et al. (2006) because this would elevatePA mRNAs. It should be remembered however that themRNA levels, unlike the protein and PAA levels, provide asnapshot at one time point (96 h in this case) and it is notpossible to know whether there were transient elevations atearlier time points. We did not find that TSH regulated PAI-1 atany concentration but we do not know whether PAI-2, whosemRNA was present in these cells, or other serpins are regulatedby TSH.

This correlation of increased PAA with decreased function issubstantiated by our observations of increased PAA with EGFand with PKC activation with TPA. The agents both profoundlydepress 125I uptake by the cells. To investigate this relationshipfurther we used aprotinin, which inhibits serine proteases suchas PA. Although treatment with aprotinin increased thyroidfunction modestly, the inhibitory effects of EGF and TPA on125I uptake were not abrogated by aprotinin suggesting nocausal link between PAA and the effects of TPA or EGF onthyroid function. The reason for the increased 125I uptake withserine protease inhibition may be due to inhibition of therelease of growth factors, such as FGF-2 from the extracellularmatrix which may inhibit thyroid function (Cocks et al., 2003).PAs may work in concert with other proteases, for examplesheddases, known to play a role in growth and development(Kheradmand and Werb, 2002) and with matrixmetalloproteases. In this regard we showed that long termincubation with TPA resulted in processing of uPA to a 35 kDaform. Both forms of PA are active enzymatically (Stump et al.,1986; Stepanova and Tkachuk, 2002). This could be mediatedthrough MMPs which are known to be secreted in these cells(Ramsden et al., 2002) or through plasmin itself, although ourbackground controls in the PAA assays would not support theconcept of endogenous plasminogen production.

We addressed the role of autocrine FGF in regulating thyroidPA production and 125I uptake and found that inhibition of FGFRsignaling inhibited PA production and increased 125I uptake. Wepostulate that autocrine growth factor activity may beresponsible for the variable thyroid function and PA productionwe have observed throughout our studies. Other autocrinegrowth factors could further contribute to PA production andinhibition of expression of differentiation for example PAs arealso central to processing of VEGF (Plouet et al., 1997).Whether the VEGFRs we recently showed to be expressed onthyroid follicular cells (Susarla et al., 2005) also mediate PA


production is an interesting possibility. We hypothesize thatthyroid cell secretion of PAs may serve a function in thyroidfollicle remodeling and in the processing of growth factors suchas vascular endothelial growth factor (VEGF) (Plouet et al.,1997; Neufeld et al., 1999) and FGF. Growth factors may havean autocrine/paracrine role in the thyroid and thus aberrantthyroid growth (Eggo et al., 1995; Thompson et al., 1998; Cockset al., 2003; Davies et al., 2003).

We confirmed that the increase in secreted PAA activity wasdue to increased synthesis of both uPA and tPA and not due torelease of stored PAs, by examining protein and mRNA levels ofuPA and tPA. We found that both TPA and EGF increasedsecretion of uPA and tPA protein into the medium. The effectsof TPA were greater than those of EGF. We found very widedifferences in the fold differences of different cell preparationsto the effects of EGF and TPA on PA mRNA levels. Again thismay be related to the time points chosen for analysis as mRNAexpression is transient and does not accumulate, unlike changesin protein expression.

The high affinity receptor for uPA, uPAR, exists on the cellsurface of leukocytes (Ploug et al., 1991), various epithelioidtumor cell types (McCabe et al., 2000), on human thyroid celllines (Ragno et al., 1999) and on the primary cultures of thyroidcells used here. Binding of uPA to uPAR activates severalsignaling pathways including that of p42/44 MAPK (Ma et al.,2001) and also increases expression of uPAR (Montuori et al.,2000). This potential autocrine stimulation would be inhibitedby PD98059 in our studies. We found that PD98059significantly stimulated iodide uptake in most thyroidpreparations and inhibited PA production. The role of MAPK inregulating uPA is described in several systems (Smith et al.,2004). We found by Western blotting that the levels ofphosphorylated MAPK correlated directly with PA production.Also of interest in this long term study was the regulation of theexpression of the unphosphorylated form of MAPK by theseagents. Inhibition of MAPK phosphorylation with PD98059reduced MAPK expression suggesting positive feedback ofMAPK activation on MAPK expression. Consistent with this,TPA treatment increased MAPK expression.

While the MAPK pathway clearly contributed to increases inPAA seen with EGF and TPA in thyroid cells, other signalingpathways are also important. For TPA, the effects werecompletely reversed by inhibiting PKCb. Both Bis1 andLY396196 are specific inhibitors of PKC and both, at theconcentrations used in this study (100 nM), preferentially inhibitPKCb (Slosberg et al., 2000) although BisI may also inhibitPKCb (Martiny-Baron et al., 1993). Our earlier work withsheep thyroid cells (Eggo et al., 1994) and human thyroid cells(Eggo et al., 1996) using a putative specific activator of PKCbhad implicated this PKC isoenzyme as the one responsible forinhibition of iodide uptake in thyroid cells. Data presented hereconfirm this and also show that this isoenzyme is important instimulating PA production. It is also important in the disruptionof thyroid follicular architecture. Effects of PKCb inhibition onEGF-stimulated PA activity were surprisingly small. These datamay explain why EGF is less potent than TPA in assays of thyroidfunction, PA production and IGFBP-3 synthesis and secretion(Eggo et al., 1996). In assays of growth on the other hand, EGF isthe more potent. We conclude that TPA treatment activatesPKCb and MAPK whereas EGF activates MAPK and that PKCbactivation is not involved. Although the possibility of EGFRdown regulation exists in these long term studies, PAAdeterminations were cumulative and an initial change in PKCactivation status should have resulted in elevations of PAA thatcould be inhibited by the PKC inhibitors. This was not seen.

Recent studies have shown that thyroid uPA mRNA can beupregulated markedly by transfection of the RET/PTC1oncogene into normal thyroid cells. Consistent with this, tissuesamples of papillary tumors with this oncogene also showed


relative increases in uPA mRNA (Borrello et al., 2005). Ulisseet al. (2006) also found changes in thyroid cancer of the mRNAsof the uPA axis. These studies are compatible with our ownwork which shows the inverse correlation of PAs withexpression of differentiation in thyroid cells. The finalconsideration is that thyroid cells can secrete large amounts ofactive PAAs. Whether this plays an important contribution tocirculating levels is not known but Erem et al. (2002) showedthat hyperthyroid patients have decreased fibrinolytic activity inblood and that circulating tPA was decreased (Erem et al.,2002). A recent study from Dundee found that patients withtreated hypothyroidism also had increased risk ofcardiovascular morbidity (Flynn et al., 2006). While remainingto be proven, these clinical studies would support a role forthyroidal production of PAs in fibrinolysis.

Acknowledgments

We are grateful to the patients who donated their thyroidtissue. We also acknowledge the kindness and generosity ofDr EC Toescu and Professor AS Ahmed of BirminghamUniversity in permitting us to use their plate readers. We thankMr. Dale Taylor for his help with qRT-PCR.

Literature Cited

Aguirre-Ghiso JA, Liu D, Mignatti A, Kovalski K, Ossowski L. 2001. Urokinase receptor andfibronectin regulate the ERK(MAPK) to p38(MAPK) activity ratios that determinecarcinoma cell proliferation or dormancy in vivo. Mol Biol Cell 12:863–879.

Akkawi S, Nassar T, Tarshis M, Cines DB, Higazi AA. 2006. LRP and {alpha}vbeta3 mediatetPA activation of smooth muscle cells. Am J Physiol Heart Circ Physiol 291:H1351–1359.

Ambesi-Impiombato FS, Parks LA, Coon HG. 1980. Culture of hormone-dependentfunctional epithelial cells from rat thyroids. Proc Natl Acad Sci USA 77:3455–3459.

Blasi F. 1996. The urokinase receptor and cell migration. Semin Thromb Hemost 22:513–516.Borrello MG, Alberti L, Fischer A, Degl’innocenti D, Ferrario C, Gariboldi M, Marchesi F,

Allavena P, Greco A, Collini P, Pilotti S, Cassinelli G, Bressan P, Fugazzola L, Mantovani A,Pierotti MA. 2005. Induction of a proinflammatory program in normal human thyrocytes bythe RET/PTC1 oncogene. Proc Natl Acad Sci USA 102:14825–14830.

Bramley MD, Harrison BJ. 1996. Papillary microcarcinoma of the thyroid gland. Br J Surg83:1674–1683.

Canipari R, O’Connell ML, Meyer G, Strickland S. 1987. Mouse ovarian granulosa cellsproduce urokinase-type plasminogen activator, whereas the corresponding rat cellsproduce tissue-type plasminogen activator. J Cell Biol 105:977–981.

Cocks HC, Thompson S, Turner FE, Logan A, Franklyn JA, Watkinson JC, Eggo MC. 2003.Role and regulation of the fibroblast growth factor axis in human thyroid follicular cells.Am J Physiol Endocrinol Metab 285:E460–469.

Davies EL, Ramsden JD, Cocks H, Searle PF, Watkinson JC, Ueno H, Logan A, Franklyn JA,Mautner V, Eggo MC. 2003. Adenovirus-mediated expression of dominant negativefibroblast growth factor (FGF) receptor 1 in thyroid cells blocks FGF effects and reducesgoitrogenesis in mice. J Clin Endocrinol Metab 88:4472–4480.

Eggo MC, Bachrach LK, Burrow GN. 1990. Interaction of TSH, insulin and insulin-like growthfactors in regulating thyroid growth and function. Growth Factors 2:99–109.

Eggo MC, Sheppard MC, Evans FJ, Lord JM. 1994. Phorbol esters showing selective activationof PKC isozymes in vitro regulate thyroid function and insulin-like growth factor bindingprotein secretion. Cell Signal 6:439–448.

Eggo MC, Hopkins JM, Franklyn JA, Johnson GD, Sanders DS, Sheppard MC. 1995. Expressionof fibroblast growth factors in thyroid cancer. J Clin Endocrinol Metab 80:1006–1011.

Eggo MC, King WJ, Black EG, Sheppard MC. 1996. Functional human thyroid cells and theirinsulin-like growth factor-binding proteins: regulation by thyrotropin, cyclic 30 ,50

adenosine monophosphate, and growth factors. J Clin Endocrinol Metab 81:3056–3062.Eggo MC, Quiney VM, Campbell S. 2003. Local factors regulating growth and function of

human thyroid cells in vitro and in vivo. Mol Cell Endocrinol 213:47–58.Erem C, Ersoz HO, Karti SS, Ukinc K, Hacihasanoglu A, Deger O, Telatar M. 2002. Blood

coagulation and fibrinolysis in patients with hyperthyroidism. J Endocrinol Invest 25:345–350.

Flynn RW, Macdonald TM, Jung RT, Morris AD, Leese GP. 2006. Mortality and vascularoutcomes in patients treated for thyroid dysfunction. J Clin Endocrinol Metab 91:2159–2164.

Hamilton JA, Cheung D, Filonzi EL, Piccoli DS, Wojta J, Gallichio M, McGrath K, Last K. 1992.Independent regulation of plasminogen activator inhibitor 2 and plasminogen activatorinhibitor 1 in human synovial fibroblasts. Arthritis Rheum 35:1526–1534.

Holmberg M, Leonardsson G, Ny T. 1995. The species-specific differences in the cAMPregulation of the tissue-type plasminogen activator gene between rat, mouse and human iscaused by a one-nucleotide substitution in the cAMP-responsive element of thepromoters. Eur J Biochem 231:466–474.

Kheradmand F, Werb Z. 2002. Shedding light on sheddases: role in growth and development.Bioessays 24:8–12.

Ma Z, Webb DJ, Jo M, Gonias SL. 2001. Endogenously produced urokinase-type plasminogenactivator is a major determinant of the basal level of activated ERK/MAP kinase andprevents apoptosis in MDA-MB-231 breast cancer cells. J Cell Sci 114:3387–3396.

Mak WW, Eggo MC, Burrow GN. 1984. Thyrotropin regulation of plasminogenactivator activity in primary cultures of ovine thyroid cells. Biochem Biophys Res Commun123:633–640.

Martiny-Baron G, Kazanietz MG, Mischak H, Blumberg PM, Kochs G, Hug H, Marme D,Schachtele C. 1993. Selective inhibition of protein kinase C isozymes by theindolocarbazole Go 6976. J Biol Chem 268:9194–9197.


McCabe NP, Angwafo FF3rd, Zaher A, Selman SH, Kouinche A, Jankun J. 2000. Expression ofsoluble urokinase plasminogen activator receptor may be related to outcome in prostatecancer patients. Oncol Rep 7:879–882.

Medcalf RL, Schleuning WD. 1991. Regulation of human tissue-type plasminogen activatorgene transcription by epidermal growth factor and 30 ,50-cyclic adenosine monophosphate.Mol Endocrinol 5:1773–1779.

Montuori N, Salzano S, Rossi G, Ragno P. 2000. Urokinase-type plasminogen activatorup-regulates the expression of its cellular receptor. FEBS Lett 476:166–170.

Nasir A, Chaudhry AZ, Gillespie J, Kaiser HE. 2000. Papillary microcarcinoma of the thyroid: aclinico-pathologic and prognostic review. In Vivo 14:367–376.

Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z. 1999. Vascular endothelial growth factor(VEGF) and its receptors. Faseb J 13:9–22.

Parfyonova YV, Plekhanova OS, Tkachuk VA. 2002. Plasminogen activators in vascularremodeling and angiogenesis. Biochemistry (Mosc) 67:119–134.

Patel VA, Logan A, Watkinson JC, Uz-Zaman S, Sheppard MC, Ramsden JD, Eggo MC. 2003.Isolation and characterization of human thyroid endothelial cells. Am J Physiol EndocrinolMetab 284:E168–E176.

Patel NG, Kumar S, Eggo MC. 2005. Essential role of fibroblast growth factor signaling inpreadipoctye differentiation. J Clin Endocrinol Metab 90:1226–1232.

Plouet J, Moro F, Bertagnolli S, Coldeboeuf N, Mazarguil H, Clamens S, Bayard F. 1997.Extracellular cleavage of the vascular endothelial growth factor 189-amino acid form byurokinase is required for its mitogenic effect. J Biol Chem 272:13390–13396.

Ploug M, Behrendt N, Lober D, Dano K. 1991. Protein structure and membrane anchorage ofthe cellular receptor for urokinase-type plasminogen activator. Semin Thromb Hemost17:183–193.

Presta M, Maier JA, Ragnotti G. 1989. The mitogenic signaling pathway but not theplasminogen activator-inducing pathway of basic fibroblast growth factor ismediatedthrough protein kinase C in fetal bovine aortic endothelial cells. J Cell Biol109:1877–1884.

Ragno P, Montuori N, Salzano S, Rossi G. 1999. Urokinase-type plasminogen-activatorand normal thyroid cell adhesion to the extracellular matrix. Biochimie81:355–358.

Ramsden JD, Yarram S, Mathews E, Watkinson JC, Eggo MC. 2002. Thyroid follicular cellssecrete plasminogen activators and can form angiostatin from plasminogen. J Endocrinol173:475–481.

Saksela O. 1985. Plasminogen activation and regulation of pericellular proteolysis. BiochimBiophys Acta 823:35–65.


Slosberg ED, Yao Y, Xing F, Ikui A, Jirousek MR, Weinstein IB. 2000. The protein kinase Cbeta-specific inhibitor LY379196 blocks TPA-induced monocytic differentiation of HL60cells the protein kinase C beta-specific inhibitor LY379196 blocks TPA-induced monocyticdifferentiation of HL60 cells. Mol Carcinog 27:166–176.

Smith PC, Santibanez JF, Morales JP, Martinez J. 2004. Epidermal growth factorstimulates urokinase-type plasminogen activator expression in human gingivalfibroblasts. Possible modulation by genistein and curcumin. J Periodontal Res 39:380–387.

Stepanova VV, Tkachuk VA. 2002. Urokinase as a multidomain protein and polyfunctional cellregulator. Biochemistry (Mosc) 67:109–118.

Stump DC, Lijnen HR, Collen D. 1986. Purification and characterization of a novel lowmolecular weight form of single-chain urokinase-type plasminogen activator. J Biol Chem261:17120–17126.

Susarla R, Watkinson JC, Eggo MC. 2005. Functional Significance of expression of thereceptors for Vascular endothelial growth factors on thyroid follicular cells. EndocrineAbstracts 15: Abstract no: P152.

Thompson SD, Franklyn JA, Watkinson JC, Verhaeg JM, Sheppard MC, Eggo MC. 1998.Fibroblast growth factors 1 and 2 and fibroblast growth factor receptor 1 are elevated inthyroid hyperplasia. J Clin Endocrinol Metab 83:1336–1341.

Tolli R, Monaco L, Di Bonito P, Canipari R. 1995. Hormonal regulation of urokinase- andtissue- type plasminogen activator in rat Sertoli cells. Biol Reprod 53:193–200.

Tranque P, Robbins R, Naftolin F, Andrade-Gordon P. 1992. Regulation of plasminogenactivators and type-1 plasminogen activator inhibitor by cyclic AMP and phorbol ester inrat astrocytes. Glia 6:163–171.

Ulisse S, Baldini E, Toller M, Marchioni E, Giacomelli L, De Antoni E, Ferretti E, Marzullo A,Graziano FM, Trimboli P, Biordi L, Curcio F, Gulino A, Ambesi-Impiombato FS,D’Armiento M. 2006. Differential expression of the components of the plasminogenactivating system in human thyroid tumour derived cell lines and papillary carcinomas. Eur JCancer 42:2631–2638.

Van Sande J, Dequanter D, Lothaire P, Massart C, Dumont JE, Erneux C. 2006. Thyrotropinstimulates the generation of inositol 1,4,5-trisphosphate in human thyroid cells. J ClinEndocrinol Metab 91:1099–1107.

Vassalli JD, Sappino AP, Belin D. 1991. The plasminogen activator/plasmin system. J Clin Invest88:1067–1072.

Zoellner H, Wojta J, Gallicchio M, McGrath K, Hamilton JA. 1993. Cytokine regulationof the synthesis of plasminogen activator inhibitor-2 by human vascular endothelial cells.Comparison with plasminogen activator inhibitor-1 synthesis. Thromb Haemost 69:135–140.

regulation of plasminogen activators in human thyroid follicular cells and their relationship to...

Documents