Identification of Differentially Expressed ProstateGenes: Increased Expression of Transcription

Factor ETS-2 in Prostate Cancer

Alvin Y. Liu,1* Eva Corey,1 Robert L. Vessella,1 Paul H. Lange,1Lawrence D. True,2 G. Matthew Huang,3 Peter S. Nelson,3 and

Leroy Hood3

1Department of Urology, University of Washington, Seattle, Washington2Department of Pathology, University of Washington, Seattle, Washington

3Department of Molecular Biotechnology, University of Washington, Seattle, Washington

BACKGROUND. Little is known about the genetic events in the malignant transformationof prostatic cells. This is due in large measure to the cellular heterogeneity of the prostate.METHODS. An amplification method was devised to synthesize cDNA from small samplesof cancer and benign tissues of the same resected glands. Differential gene expression ofcandidate informative markers between cancer and benign was screened by the polymerasechain reaction with gene-specific oligonucleotide primers.RESULTS. The expression of a transcription factor, ETS-2, was shown to be elevated insome cancer specimens. Elevated expression was also noted for neuron-specific enolase(NSE) and another transcription factor, SEF2.CONCLUSIONS. Our method can be used to identify quickly genes that are differentiallyexpressed between benign and cancerous prostate cells. Transcription factors, such asETS-2, may play a significant role in cancer progression. Prostate 30:145-153, 1997.© 1997 Wiley-Liss, Inc.

KEY WORDS: prostate cancer; cDNA amplification; transcription factors; neuron-spe-cific enolase

INTRODUCTION

Prostate cancer (CaP) is the second leading causeof cancer death and has recently become the mostfrequently diagnosed cancer in males, in part becauseof the increased use of diagnostic strategies involvingthe tumor marker prostate-specific antigen (PSA). YetCaP sometimes grows very slowly, and nearly 40% ofolder men dying of other causes have this cancer intheir prostate [1]. Because there is no good way toassess the aggressiveness of CaP once diagnosed andno way to cure it once metastatic, it is important tounderstand better the molecular events in the pro-gression of this disease.

Our goal is to find the differences in gene expres-sion between normal and malignant prostatic epithe-lial cells in order to generate useful markers for diseasestratification and prognosis, and to develop new ther-apies. The approach we have chosen entails the con-

struction of prostate cDNA libraries and isolation ofmany clones, followed by an analysis of their expres-sion in various prostate specimens through serial hy-bridization. In this way a pool of candidate differen-tially expressed sequences is created, from whichindividual sequences are taken for further study.These studies involve the use of many pairs of normaland cancerous prostate tissue samples taken from pa-tients’ resected glands. With standard stained slides asa guide, prostate specimens of approximately 1 mm3

are cut out of frozen sections for RNA isolation. Atechnique of cDNA amplification, originally devel-oped for the construction of single-cell cDNA libraries[2], is then applied to synthesize enough cDNA from

*Correspondence to: Alvin Liu, Ph.D., Department of Urology,Mail Stop 356510, University of Washington, Seattle, WA 98195.Received 8 August 1995; Accepted 3 November 1995

The Prostate 30:145–153 (1997)

© 1997 Wiley-Liss, Inc.

the RNA for expression analysis. This analysis usespolymerase chain reaction (PCR) with gene-specificoligonucleotide primers to detect the presence of par-ticular transcripts in the cDNA population. In thecDNA amplification method, poly (A) RNA is con-verted to cDNA, and a short homopolymeric segmentof (C)n is added to the cDNA by the enzyme terminaltransferase. With the use of two DNA primers, onecontaining T residues, the other G residues, cDNAsequences in between can be amplified. In our design,we minimized the number of buffer changes for thevarious enzymatic reactions and chose oligonucle-otide sequences that allowed directional cloning of thePCR products.

We show here that the expression of transcriptionfactors ETS-2 and SEF2, together with neuron-specificenolase (NSE), appears to be elevated in cancer spec-imens. The dysregulation of transcription factors incancer cells is significant because these factors canactivate other genes, some of which are likely to con-fer growth advantages on the cancer cells.

MATERIALS AND METHODS

Large-Scale Prostate cDNA Sequence Analysis

One microgram of poly (A+) RNA isolated from anormal human prostate was used to construct acDNA library in lZapII (Stratagene, San Diego, CA)according to the protocol supplied by the vendor. Enmasse excision of the lZapII library was performed inEscherichia coli XL1BlueMRF‘ with ExAssist helperphage, and the rescued phagemid was plated on E.coli SOLR cells. Clones were picked randomly andplasmid DNA was extracted by a 96-sample alkalinelysis procedure [3]. Plasmid DNA was tested for in-serts by either restriction digestion or PCR. Single-pass fluorescence DNA sequencing was performedwith AmpliTaq polymerase and T7 fluorescent dyeprimers (Perkin Elmer, Norwalk, CT) with an Ap-plied Biosystems 373 automated sequencer. ThecDNA sequences were analyzed against public data-bases.

Isolation of Candidate DifferentiallyExpressed cDNA

DNA from 49 clones with and 45 without homol-ogy to database sequences was probed in a dot-blotformat for their representation in the cDNA librariesof DU145 prostate adenocarcinoma cells, a humanprostatic adenocarcinoma, a human prostate adeno-carcinoma xenograft, and a normal prostate. DNA ofthe 94 clones was denatured in 0.4 M NaOH, 10 mMEDTA and replica blotted onto nylon membranes(Micron Separations, Westborough, MA). A 5 ml ali-quot of each cDNA library (titers >106 pfu/ml) was

subjected to PCR to amplify the insert sequences for40 cycles of 93°, 1 min; 55°, 1 min; and 72°, 2 min, witha 5-sec autoextension per cycle. The products wereanalyzed on a 0.7% agarose gel and DNA larger than0.5 kb was excised. The DNA was purified with Seph-aglas BP (Pharmacia, Piscataway, NJ) and labeledwith digoxigenin-11-dUTP (Boehringer Mannheim,Indianapolis, IN). The dot-blot replica membraneswere prehybridized in 5X SSC, 1% (w/v) blocking re-agent, 0.1% N-lauroylsarcosine, 0.02% SDS. Labeledprobes were added and hybridization was performedat 65° overnight. After hybridization, the membraneswere washed in 2X SSC, 0.1% SDS at room temper-ature followed by 0.5X SSC, 0.1% SDS at 65°. Themembranes were treated with blocking reagent, in-cubated with anti-digoxigenin alkaline phosphatase-conjugated Fab fragments, and reacted with Lumi-Phos 530 (Boehringer Mannheim). The membraneswere exposed for 16 hr, and the autoradiograms werevisually inspected for differential signal intensity.

Isolation of RNA From Prostate Tissue

Radical prostatectomy samples were frozen andsectioned according to standard practice. Several sec-tions of the gland were prepared. Slides were stainedwith hematoxylin and eosin (H&E). After cancer ar-eas were located and demarcated under the micro-scope, tissue samples were excised from the corre-sponding frozen sections using the H&E-stainedslides as a guide. The small pieces of prostate tissuewere placed into 0.5 ml STAT60 (Tel-Test ‘‘B,’’ Friends-wood, TX) and homogenized by vigorous shakingwith glass beads. After a 10-min incubation of thehomogenate at room temperature, 100 ml chloroformwas added to the homogenate. About 300 ml of su-pernatant was recovered after centrifugation in a mi-crofuge at 12,500 rpm for 15 min. Three hundred mi-croliter isopropanol and 15 ml 2 mg/ml glycogen wereadded to the supernatant to precipitate the nucleicacid at room temperature for 10 min. The precipitatewas rinsed with 1 ml 70% ethanol and resuspendedin 10 ml H2O. RNA of cultured LNCaP cells was sim-ilarly isolated with this procedure.

Synthesis of Amplified cDNA

Oligonucleotide sc3a, GGCCACAGCTGTGCACT-GCAGT18VN (V = G, A, C; N = G, A, T, C), wasused to prime first-strand cDNA synthesis. One mi-croliter of 2 pmol/ml primer sc3a was mixed with theRNA, and the solution was heated to 70° for 10 min.Standard reverse-transcriptase buffer and MMLV-RT(GIBCO-BRL, Gaithersburg, MD) were added, andthe reaction was incubated at 39° for 1 hr. The RNAwas degraded in 13 mM EDTA, 50 mM NaOH at 65°,1 hr. The solution was neutralized by the addition of

146 Liu et al.

Tris-HCl, pH 8.0, and HCl to 0.2 M. The single-stranded cDNA was cleaned of primer sc3a on Wiz-ard PCR Preps Minicolumn (Promega, Madison, WI)according to the manufacturer’s instructions. For theamplification step, the cDNA was resuspended instandard PCR buffer (20 mM Tris-HCl, pH 8.4, 50 mMKCl, 2 mM MgCl2) with 0.15 mM dCTP and 7 U TdT(US Biochemical, Cleveland, OH) at 37° for 5 min fol-lowed by inactivation at 94° for 4 min. The reactionvolume was brought up to 50 ml, and 5 pmol ofprimer sc5, (CUA)4GCGCACGCGTCGACTAGTAC-GGGIIGGGIIGGGIIG, and 2 U Taq DNA pol (GIBCO-BRL) were added. After 94°, 1 sec and 57°, 5 min, 5pmol primer sc3b, (CAU)4GGCCACAGCTGTGCAC-TGCAG, 10 mM of dATP, dGTP, dTTP and 1 mMdCTP were added and amplification was carried outfor 45 cycles of 94°, 1 sec; 69°, 2 min each. The PCRproducts were precipitated in ethanol and resus-pended in 50 ml dH2O. The cDNA, flanked by primersequences containing dU residues, can be cloned intosuitable vectors by the method of uracil DNA glyco-sylase treatment of DNA molecules for ligation [4].

Gene-Specific Oligonucleotide Primers

The sequences of the primers used to evaluate therepresentation of the amplified cDNA are shown inTable I. All oligonucleotide primers were purchasedfrom Integrated DNA Technologies (Coralville, IA).Most of the primer sequences were selected to givePCR product bands of 400-1,200 bp, with Tm-5around 73°-75° by the 4° GC, 2° AT formula, 40-60%GC content, no 6 bp palindromes or homopolymericstretches. Working solutions of the primers weremade at 5 pmol/ml. The markers included NSE [5];ETS-2 and ETS-1 [6]; SEF2 [7]; epithelial glycopro-tein (EGP) [8]; PSA [9]; prostate-specific membraneantigen (PSMA) [10]; CD44 [11]; Zn glycoprotein(Zna2GP) [12]; G protein activator of adenylate cy-clase (Gsa) [13]; fibronectin receptor (FNRb) [14];glyceraldehyde-3-phosphate dehydrogenase (G3PD)[15]; collagenase (COL) [16]; stromelysin (STROM)[17]; X-box binding protein (hXBP-1) [18]; prolactin-inducible protein (PIP) [19]; p53 [20]; FAU, a ubiqui-tin-like-S30 fusion protein [21]; AXL, receptor ty-rosine kinase [22]; proliferation-associated antigen(PAG) [23]; and BCL-2 [24]. PCR was carried out for45 cycles of 94°, 1 sec; 69°, 1 min each except for PSA,PSMA, G3PD, and BCL-2 (94°, 1 sec; 57°, 30 sec; 69°,1 min) in a volume of 50 ml with a Hybaid OmniGenethermocycler (Woodbridge, NJ). Ten microliters ofthe PCR products was analyzed by agarose gel elec-trophoresis.

RESULTS

Ninety-four cDNA clones from an NP library weresequenced and screened for differential expression.

Of the 94 cDNA clones that were probed, 13 ap-peared to show differential expression as defined byprobe hybridization signal-intensity differencesamong the prostate samples of cell line, xenograft,normal, and cancer tested. Ten of them were chosenfor this study: ETS-2, SEF2, Zna2GP, Gsa, FNRb,hXBP-1, PIP, FAU, AXL, and PAG. To follow up onthese observations, we investigated the expression ofthese genes in CaP specimens obtained from radicalprostatectomies. The cellular heterogeneity of theprostate gland and the small size of many cancers,however, presented obstacles to such an analysis.The technique of ‘‘single-cell’’ cDNA cloning wasused to surmount these problems. In a pilot experi-ment, RNA was isolated from LNCaP cells, andcDNA was synthesized and amplified separatelyfrom 1, 0.1, 0.01, 0.001, 0.0001 mg of this RNA, rep-resenting the amount present in 30,000, 3000, 300, 30,and 3 cells, respectively. This calculation was basedon the rough assumption that a eukaryotic cell has100,000-200,000 gene transcripts with a complexity of5,000-10,000. The amplified cDNA was tested forthe presence of several gene sequences. PSMA,which is a very abundant transcript in LNCaP, wasdetected by agarose gel electrophoresis in the cDNAamplified from a 30-cell equivalent of RNA, while amuch less abundant transcript, p53, was detected inthe cDNA amplified from a 3,000-cell equivalent ofRNA (Fig. 1).

This technique was next used to amplify cDNAfrom prostate specimens taken from resected glands.In Patient A, a piece of cancer tissue 1 mm3 in sizeand a similarly sized piece of normal tissue werescooped out of a frozen section for RNA isolationafter the cancer area was identified under the micro-scope. cDNA was synthesized and amplified. The re-spective PCR products, labeled CP and NP, weretested for the presence of relevant gene sequences.The results are shown in Figure 2. The gene-specificprimer sequences used and their PCR product sizesare listed in Table I. No differences in the intensityof the ethidium bromide-stained DNA bands weredetected for PSA, PSMA, CD44, Gsa, hXBP-1, PIP,FNRb, and Zna2GP. Failure to detect certain genesequences could be due either to their low abundanceor to the fact that they may not be prostate epithelialcell-specific genes. A somewhat higher level of G3PDwas evident in CP. Increased expression of this genehas been reported in cancer [15]. The increase in NSEwas pronounced. Presence of this neuroendocrinemarker in CaP correlates with a poor prognosis [25].Increases were also detected for SEF2 and ETS-2.

SEF2 and ETS-2 are DNA-binding transcriptionfactors. Among the genes regulated by ETS-2 arethose that encode enzymes that degrade the extracel-lular matrix, such as STROM and COL [26]. These

ETS-2 in Prostate Cancer 147

enzymes play an important role in tumor metastasis[27]. Accordingly, primers were designed to detectstromelysin-1 and collagenase sequences in the NPand CP cDNA (Fig. 2, panels ‘‘STROM’’ and ‘‘COL’’).There was a detectable level of STROM RNA in CPand an elevated level of COL in CP. In addition, weexamined the expression of ETS-1, a close relative ofETS-2, which recognizes similar DNA elements [28].The presence of ETS-1 is associated with angiogenesis

[29]. Panel ‘‘ETS-1’’ of Figure 2 shows that expressionof ETS-1 was elevated in CP.

In Patient B, three small adjacent pieces of cancerand a piece of normal tissue were excised from frozensections after histological examination. The four tis-sue samples were processed as before and theircDNA after amplification was tested for EGP,Zna2GP, NSE, SEF2, ETS-1, ETS-2, STROM, andCOL. As shown in Figure 3 the band signal intensity

TABLE I. Gene-Specific Primers

Marker Primer pair sequenceMap

coordinatesPCR bandsize (bp)

NSE AAGTCTCCCACTGATCCTTCCCGATA 858–1864 1,010CTAAAGCCTTATTAGCCAGGCGTGATC

ETS-2 TCGGCTCAGCTCCGTCAGCGTCAC 1017–1870 850CAGCCTGGTCAAGAGGCGTGGTTTG

ETS-1 TCAGACGCTCCATCCCATCAGCTCG 833–1609 780TGCCATCACTCGTCGGCATCTGGCT

SEF2 CAGAGTGTCTCCTCTGGCAGCTCTG 982–1782 800GTTCAGTCTCTGGGCTGTGTCTCAG

EGP TTGCCGCAGCTCAGGAAGAATGTGTC 213–1098 890TATGCATTGAGTTCCCTATGCATCTCAC

PSA CTGGGAGTGCGAGAAGCATT 73–566 490TCACCTTCTGAGGGTGAACT

PSMA CAGATATGTCATTCTGGGAGGTC 1368–2015 650AACACCATCCCTCCTCGAACC

CD44 CAGATCGATTTGAATATAACCTGCCGC 89–688 600AGGGATTCTGTCTGTGCTGTCGGTGAT

Zna2GP CCCAGCAGCCCAGATAACCAAGCAG 471–1064 590GACAGGCATCCCAGTCTTCGGTCTC

Gsa AGAGGCGATTGAAACCATTGTGGCCG 376–1353 980GCCCTATGGTGGGTGATTAACTGCTTG

FNRb GCTCACCTTGTCCAGAAACTGAGTGAA 1061–2268 1,210TCTGGATTCTCCACAACATGAACCATGAC

G3PD CCATGGAGAAGGCTGGGGG 371–565 190CAAAGTTGTCATGGATGACC

COL ACAAATCCCTTCTACCCGGAAGTTGAG 981–1730 750CTCTGGCCTATATGAATCCATAAGCCAC

STROM ACTCTATCACTCACTCACAGACCTGAC 757–1612 860GCTCAAGTTCCCTTGAGTGTGACTCG

hXBP-1 CTTCCTGCCTACTGGATGCTACAGTGA 1021–1590 570CTAAAGGACCTAAAACTGGAGGCAAGCCA

PIP AGCATGCGCTTGCTCCAGCTCCTGTTCA 23–543 520TATAGACCACAGCAGAAATTCCAGCCA

p53 GCCCCTCCTCAGCATCTTATCCGAG 779–1465 690ACCCAAAATGGCAGGGGAGGGAGAG

FAU TTCCTCTTTCTCGACTCCATCTTCGCGG 1–416 420CACAACGTTGACAAAGCGCCGGTTGTA

AXL GCATCAGTGAAGAGCTGAAGGAGAAG 1682–2822 1,140GTTGTCTCAGGCACCATCCTCCTGC

PAG GTGGTTAGTTTCTGCGACTTGTGTTGG 18–787 770GCCTTGTAAGACACCACAATTCGGC

BCL-2 TGCACCTGACGCCCTTCAC 1814–2377 560TAGCTGATTCGACGTTTTGCCTGA

148 Liu et al.

for EGP and Zna2GP was equivalent in the fourcDNA-labeled NP, CP-1, CP-2, and CP-3. The expres-sion of NSE, ETS-2, and SEF2 was increased in can-cer, as was the case with the first cancer discussedabove. Expression of COL was also increased, butthat of STROM was not detected. Variation in bandintensity among the three CP samples was observedfor ETS-1, and to some extent for COL. This couldindicate cellular heterogeneity within the tumor nod-ule, which probably would have been obscured if the

entire tumor were processed. In Patient C, multiplefoci of cancer and prostatic intraepithelial neoplasia(PIN), a putative premalignant lesion [30], were avail-able for study. The cDNA-PCR analysis revealed asubstantial increase in ETS-2 sequences again in allfive of the multifocal cancer samples, but not in PIN(Fig. 4). The increase of SEF2 was more modest, andETS-1 was detected in only one cancer sample. Thissuggests that the increase in ETS-2 and SEF2 expres-sion is associated with cancer and probably not withpreneoplastic abnormality. Note that while the fivecancer samples CP-1 to CP-5 were taken from differ-ent areas of the gland, all showed elevation in ETS-2expression but different expression patterns of SEF2and ETS-1. These findings argue for independent or-igins and strengthen the supposition that elevation ofETS-2 expression characterizes this cancer pheno-type.

After these initial three CaP cases we narrowedour analysis to ETS-2 and NSE. All samples were firstassayed for EGP (an epithelioid marker) and PSA (aprostatic marker) to monitor the amplified cDNAproducts. EGP and PSA were expressed in all sam-ples. The results for 16 specimens (including patientsA, B, and C) are shown in Table II. ETS-2 and NSEsequences were detected in 6 of the 16 CP samples.The combined Gleason’s scores of the cancers (pri-mary) in the radical prostatectomy specimens fromwhich the samples were obtained were between 6and 8. The Gleason grade of each sample that wasanalyzed was 3. The range of the tumor volumes wasbetween 0.3 and 4.1 cc. However, there appeared tobe no correlation between the presence of the twomarkers and any of the characteristics listed in TableII. Furthermore, ETS-2 was not detected in samplesof nodular hyperplasia, or in one of stromal elements,or one with inflammatory infiltrate (data not shown).

DISCUSSION

One of the most pressing issues in CaP is in ourinability to differentiate aggressive cancers from themore indolent ones. This is due in part to a lack ofunderstanding of neoplastic transformation of pros-tate cells. An understanding of the lineage relation-ship among the several component cellular types thatconstitute the prostatic epithelium could be of greathelp in deciphering this process. How do we goabout identifying the important genetic markers,which might be useful either for typing cancer behav-ior or for lineage analysis? One criterion these mark-ers must satisfy is that their expression differs in dis-tinct cell types. To search for such markers we haveperformed large-scale cDNA sequence determinationof clones isolated from a prostate cDNA library. The

Fig. 1. cDNA amplification by PCR. Various amounts of RNA areused to generate cDNA, and gene-specific primers are then usedto detect particular sequences. Top: Result for p53. Middle: Re-sult for PSMA. Bottom: Other gene sequences can also be de-tected in the amplified cDNA.

ETS-2 in Prostate Cancer 149

cDNA clones were then screened by serial hybridiza-tion with probes prepared from various sources ofprostate tissue such as cell lines, xenografts, and re-sected glands. One reservation about using cultured

cells and xenografts as a source of probes is that theyrepresent an artificially narrow spectrum of the can-cer progression pathway. Furthermore, only a fewcell lines and xenografts are available. Changes in

Fig. 2. Gene expression analysis of Patient A’s CaP. The genestested are identified at the top of the panels. lHindIII is the DNAsize marker. PCR products were resolved by 1% agarose gel elec-trophoresis in Tris-borate buffer and the DNA stained by ethidium

bromide. The lane labeled ‘‘H2O’’ in the G3PD panel represents anegative control for PCR in which cDNA was omitted in thereaction. NP is normal tissue and CP cancer tissue.

Fig. 3. Gene expression analysis of Patient B’s CaP. The genes tested are identified below thepanels. CP-1, CP-2, and CP-3 are pieces of the same tumor nodule.

150 Liu et al.

gene expression may also arise from in vitro growth.The problem with resected glands as a source ofprobes on the other hand is the heterogeneous cellu-lar composition of the tissue, as well as the small sizeof most tumors. To overcome tissue heterogeneityand small tumor size, we have devised a cDNA am-plification method, previously used to generate so-called single-cell cDNA libraries. By means of this

technique we can rapidly analyze expression of 50genes in pairs of NP and CP from the same gland.This method can also allow us to synthesize cDNAlibraries of purer populations of CaP cells prepared,for example, by cell sorting.

Initially, two candidate cDNA, ETS-2 and SEF2,showed evidence of differential expression. Both aretranscription factors. ETS sequences were first iden-tified in the chicken E26 retrovirus, and they werelater shown to be members of a sizeable family [28].The transcription factor ETS-2 can bring about cellulartransformation when overexpressed [31]. Reciprocaltranslocations involving ETS-2 have been found inacute myelogenous leukemia [28]. ETS-2 recognizesDNA sequence elements containing a GGA core andcooperates with the AP-1 factor and others in activat-ing transcription [32]. Hence, deregulation of ETS-2will in turn affect the expression of other genes con-trolled through ETS recognition sequences such asCOL, the gene product which can degrade the extra-cellular matrix. Given the fact that ETS proteins areespecially effective in activating promoters of genesinvolved in the early response to growth stimuli,their own activation appears to be a key event in cel-lular transformation [32]. Since the specimens stud-ied by us, though small, could still have containedmore than one cell type, we cannot formally rule outthe possibility that these genetic changes might occurin nonepithelial cells. However, unlike normal glan-dular structures, CaP specimens usually contain pre-dominantly cancer epithelial cells. It is likely, there-fore, that expression of ETS-2 is localized to epithelialcells. Support for this claim comes from the finding ofETS-2 in the human CaP cell lines LNCaP and PC3, aswell as in prostate xenografts (unpublished results).The other transcription factor, SEF2, contains a basichelix-loop-helix motif and recognizes enhancer ele-ments first identified in the mouse leukemia virusSL3-3 [7]. The recognition sequence is related to ele-ments found in the immunoglobulin heavy chain andinsulin gene enhancers. SEF2 is nearly identical to theimmunoglobulin transcription factor ITF2 [33]. Theinvolvement of transcription factors in cancer cells isnoteworthy because these factors can by themselvesorchestrate an altered gene expression program fa-vorable for the neoplastic cells.

To date, we have detected overexpression of ETS-2in seven CaP specimens (Table II), while no expres-sion was observed in the normal prostate tissue ob-tained from a 19-year-old man. Nine other cancercases did not exhibit detectable expression of ETS-2(Table II). These cases, perhaps not coincidentally,also did not show expression of NSE. Positive immu-nohistochemical staining for NSE is often encoun-tered in CaP. Its presence in CaP has been associated

Fig. 4. Gene expression analysis of Patient C’s CaP. The genestested are identified below the panels. NP-1 and NP-2 are samplesof normal tissue while CP-1, CP-2, CP-3, CP-4, and CP-5 aresamples of cancer tissue taken from different areas of the resectedgland. ‘‘PIN’’ represents PIN tissue of grades II and III from onearea. The last lane in each panel represents a negative control forPCR.

ETS-2 in Prostate Cancer 151

with a poor prognosis [25]. It is possible that the ex-pression of NSE and the transcription factors are in-terconnected, and their dual presence in CaP mayindicate a more aggressive type of cancer. No corre-lation is, however, evident between ETS-2/NSE ex-pression and the other observable characteristics(e.g., cancer volume) listed in Table II. Complicationsin our analysis may come from the presence of lym-phocytes, which may express ETS-2, in our sam-plings. Moreover, a minority of normal prostatic ep-ithelial cells express NSE in the intact prostate.Interestingly, both ETS-2 and NSE were consistentlydetected in cells from short-term cultures of NP sam-ples, which were ETS-2− when taken from the gland.The culture medium was chosen to suppress selec-tively the outgrowth of fibroblastic cells. The result-ant cells appeared epithelioid. Upon analysis, thesecells were shown to be EGP+, CD44+ (most similar tothe basilar epithelioid phenotype), but PSA−. Fur-thermore, NSE and ETS-2 sequences were detected inxenograft LuCaP23.1 harvested from castrated hosts,and a brain metastasis from a patient at the late stagesof his disease.

From these observations, we propose that the ac-tivation of the NSE program in CaP cells could lead tothe appearance of aggressive variants of the cancercells. It is suggestive that the 58 regulatory sequencesof NSE contain an SEF2 site at −500 CAGAGAACA-

GAGGATGCCTG (matching nucleotide residues areunderlined) [7]. The following questions are raised byour findings. Could up-regulation of NSE be medi-ated by SEF2? How are ETS-2 and SEF2 themselvesactivated? Sequences upstream of SEF2 have not beencharacterized, but those of ETS-2 have been in somedetail [34]. In future experiments, the upstream se-quences of NSE, ETS-2, and SEF2 will be used toidentify factors that control their expression in pros-tatic cells.

We are currently using in situ hybridization toevaluate the expression pattern of ETS-2 and others.If the expression of ETS-2, SEF2, and NSE is linkedand plays an important role, the localization of theirexpression to specific cells needs to be determined.The in situ study may succeed in settling this ques-tion. Our first in situ results have localized ETS-2 ex-pression to the basal cells in the prostatic epitheliumwith little or no expression in the luminal cells. Ex-pression was detected in cancers with combinedGleason’s scores from 6 to 9 (M. Tennant and S. Ply-mate, personal communication).

ACKNOWLEDGMENTS

Our research is supported by the Lucas Founda-tion, O’Brien Center, CaPCURE, and the Departmentof Veterans Affairs through the VA Merit Review. Wethank Lisha Brown for cultured cells and Dr. MichaelCorey for valuable comments.

REFERENCES

1. Carter HB, Coffey DS: The prostate: An increasingmedical problem. Prostate 16:39–48, 1990.

2. Belyavsky A, Vinogradova T, Rajewsky K: PCR-basedcDNA library construction: General cDNA libraries atthe level of a few cells. Nucleic Acids Res 17:2919–2932,1989.

3. Huang GM, Wang K, Kuo C, Paeper B, Hood L: A highthroughput plasmid DNA preparation method. AnalBiochem 223:35–38, 1994.

4. Rashtchian A, Buchman GW, Schuster DM, BerningerMS: Uracil DNA glycosylase-mediated cloning of poly-merase chain reaction-amplified DNA: Application togenomic and cDNA cloning. Anal Biochem 206:91–97,1992.

5. Oliva D, Calı L, Feo S, Giallongo A: Complete structureof the human gene encoding neuron-specific enolase.Genomics 10:157–165, 1991.

6. Watson DK, McWilliams MJ, Lapis P, Lautenberger JA,Schweinfest CW, Papas TS: Mammalian ets-1 and ets-2genes encode highly conserved proteins. Proc NatlAcad Sci USA 85:7862–7866, 1988.

7. Corneliussen B, Thornell A, Hallberg B, Grundstrom T:Helix-loop-helix transcriptional activators bind to a se-quence in glucocorticoid response elements of retrovi-rus enhancers. J Virol 65:6084–6093, 1991.

8. Simon B, Podolsky DK, Moldenhauer G, IsselbacherKJ, Gattoni-Celli S, Brand SJ: Epithelial glycoprotein is

TABLE II. Frequency of ETS-2 in Prostate Cancer*

Patient Age Weight Grade Score Vol ETS2 NSE PSA

CB 60 58 3 3 + 3 0.6 + + 3.15RG 66 47 3 3 + 3 0.7 + + 7.48AB 52 20 3 3 + 4 0.8 + + 5.43RB 69 44 3 3 + 4 3 + + 8.15JS 59 54 3 3 + 3 1.3 − + 5.39RA 63 53 3 3 + 3 4.1 − − 20.08JB 63 29 3 3 + 5 0.8 − − 11.01JF 61 31 3 3 + 3 0.3 − − 2.66RH 51 36 3 3 + 3 0.3 − − 0.44a

TM 64 23 3 3 + 3 2.2 − − 6.46KS 62 100 3 3 + 3 0.6 + + 4.84JBe 72 79 3 3 + 4 3 + + 3.17RBr 55 38 3 3 + 4 2.25 − − 6.64WH 59 51 3 3 + 4 0.25 − − 4.62JBa 61 53 3 3 + 3 1 + − 2.49FD 48 47 3 3 + 3 1.7 − − 4.48

*Weight is the weight of the resected prostate in grams; grade is theGleason grade of the sample of cancer that was analyzed; score isthe combined Gleason’s score of each cancer; Vol is the estimatedvolume of the cancer in cubic centimeters. Preoperative serum PSAvalues are reported in ng/ml.aPatient RH was on LUPRON-Flutamide therapy a month beforesurgery, his original PSA value was 4.7.

152 Liu et al.

a member of a family of epithelial cell surface antigenshomologous to nidogen, a matrix adhesion protein.Proc Natl Acad Sci USA 87:2755–2759, 1990.

9. Lundwall A, Lilja H: Molecular cloning of human pros-tate specific antigen cDNA. FEBS Lett 214:317–322,1987.

10. Israeli RS, Powell CT, Fair WR, Heston WDW: Molec-ular cloning of a complementary DNA encoding a pros-tate-specific membrane antigen. Cancer Res 53:227–230, 1993.

11. Screaton GR, Bell MV, Jackson DG, Cornelis FB, GerthU, Bell JI: Genomic structure of DNA encoding the lym-phocyte homing receptor CD44 reveals at least 12 alter-natively spliced exons. Proc Natl Acad Sci USA 89:12160–12164, 1992.

12. Ueyama H, Niwa M, Tada T, Sasaki M, Ohkubo I:Cloning and nucleotide sequence of a human Zn-a2-glycoprotein cDNA and chromosomal assignment of itsgene. Biochem Biophys Res Commun 177:696–703,1991.

13. Kozasa T, Itoh H, Tsukamoto T, Kaziro Y: Isolation andcharacterization of the human Gsa gene. Proc NatlAcad Sci USA 85:2081–2085, 1988.

14. Argraves WS, Suzuki S, Arai H, Thompson K, Piersch-bacher MD, Ruoslahti E: Amino acid sequence of thehuman fibronectin receptor. J Cell Biol 105:1183–1190,1987.

15. Arcari P, Martinelli R, Salvatore F: The complete se-quence of a full length cDNA for human liver glyceral-dehyde-3-phosphate dehydrogenase: Evidence for mul-tiple mRNA species. Nucleic Acids Res 12:9179–9189,1984.

16. Muller D, Quantin B, Gesnel MC, Millon-Collard R,Abecassis J, Breathnach R: The collagenase gene familyin humans consists of at least four members. Biochem J253:187–192, 1988.

17. Whitham SE, Murphy G, Angel P, Rahmsdorf HJ,Smith BJ, Lyons A, Harris TJR, Reynolds JJ, Herrlich P,Docherty AJP: Comparison of human stromelysin andcollagenase by cloning and sequence analysis. BiochemJ 240:913–916, 1986.

18. Liou HC, Boothby MR, Finn PW, Davidon R, NabaviN, Zeleznik-Le NJ, Ting JPY, Glimcher LH: A newmember of the leucine zipper class of proteins thatbinds to the HLA DR promoter. Science 247:1581–1584,1990.

19. Murphy LC, Tsuyuki D, Myal Y, Shiu RPC: Isolationand sequencing of a cDNA clone for a prolactin-induc-ible protein (PIP). J Biol Chem 262:15236–15241, 1987.

20. Iggo R, Gatter K, Bartek J, Lane D, Harris AL: Increasedexpression of mutant forms of p53 oncogene in primarylung cancer. Lancet 335:675–679, 1990.

21. Michiels L, van der Rauwelaert E, van Hassett F, Kas K,Merregaert J: fau cDNA encodes a ubiquitin-like-S30 fu-sion protein and is expressed as an antisense sequencein the Finkel-Biskis-Reilly murine sarcoma virus. Onco-gene 8:2537–2546, 1993.

22. O’Bryan JP, Frye RA, Cogswell PC, Neubauer A, KitchB, Prokop C, Espinosa R, Le Beau MM, Earp HS, LiuET: ax1, a transforming gene isolated from primary hu-man myeloid leukemia cells, encodes a novel receptortyrosine kinase. Mol Cell Biol 11:5016–5031, 1991.

23. Prosperi MT, Ferbus D, Karczinski I, Goubin G: A hu-man cDNA corresponding to a gene overexpressedduring cell proliferation encodes a product sharing ho-mology with amoebic and bacterial proteins. J BiolChem 268:11050–11056, 1993.

24. Seto M, Jaeger U, Hockett RD, Graninger W, Bennett S,Goldman P, Korsmeyer SJ: Alternative promoters andexons, somatic mutation and deregulation of the Bcl-2-Ig fusion gene in lymphoma. EMBO J 7:123–131,1988.

25. di Sant’Agnese PA: Neuroendocrine differentiation inhuman prostatic carcinoma. Hum Pathol 23:287–296,1992.

26. Buttice G, Kurkinen M: Oncogenes control stromelysinand collagenase gene expression. Contrib Nephrol 107:101–107, 1994.

27. Matrisian LM: Metalloproteinases and their inhibitorsin matrix remodeling. Trends Genet 6:121–125, 1990.

28. Wasylyk B, Hahn SL, Giovane A: The ets family oftranscription factors. Eur J Biochem 211:7–18, 1993.

29. Wernert N, Raes MB, Lassalle P, Dehouck MP, Gosse-lin B, Vandenbunder B, Stehelin D: c-ets1 proto-onco-gene is a transcription factor expressed in endothelialcells during tumor vascularization and other forms ofangiogenesis in humans. Am J Pathol 140:119–127,1992.

30. Bostwick DG: Prostatic intraepithelial neoplasia (PIN).Urology 34:16–22, 1989.

31. Seth A, Watson DK, Blair DG, Papas TS: c-ets-2 pro-tooncogene has mitogenic and oncogenic activity. ProcNatl Acad Sci USA 86:7833–7837, 1989.

32. Wasylyk B, Wasylyk C, Flores P, Begue A, Leprince D,Stehelin D: The c-ets proto-oncogenes encode transcrip-tion factors that cooperate with c-Fos and c-Jun for tran-scriptional activation. Nature 346:191–193, 1990.

33. Henthorn P, Kiledjian M, Kadesch T: Two distinct tran-scription factors that bind the immunoglobulin en-hancer mE5/kE2 motif. Science 247:467–470, 1990.

34. Mavrothalassitis GJ, Papas TS: Positive and negativefactors regulate the transcription of the ETS-2 gene viaan oncogene-responsive-like unit within the ETS-2 pro-moter region. Cell Growth Diff 2:215–224, 1991.

ETS-2 in Prostate Cancer 153