heterochromatic dna in triturus (amphibia, urodela)

Chromosoma (Berl) (1988) 97:204-211 CHROMOSOMA �9 Springer-Verlag 1988

Heterochromatic DNA in Triturus (Amphibia, Urodela) IL A centromeric satellite D N A

Federico Cremisi, Robert Vignali, Renata Batistoni, and Giuseppina Barsacchi Dipartimento di Fisiologia e Biochimica, Laboratori di Biologia Cellulare e dello Sviluppo, Via A. Volta 4, 1-56100 Pisa, Italy

Abstract. The MspI family of highly repeated sequences is a centromeric satellite DNA representing about 1% of the genome of the Italian smooth newt, Triturus vulgaris meridionalis. We have studied the structure, genomic organization, chromosomal localization and conservation across species of this family. MspI sequences are around 197 bp long, as shown by sequencing of three cloned units. The family is organized in large clusters of tandemly arrayed units, present at almost all the centromeres of T.v. meridionalis, and is well conserved in the T.v. vulgaris subspecies. Conserved MspI sequences are also present in the related species T. helveticus, where they appear to be clustered at the centromeres of only a few chromosomes. MspI sequences are not found in other Triturus species analysed. The correlation of these sequences with the overall distribution pattern of heterochromatin and the extent of their conservation within the genus Triturus, are discussed.

in both somatic and germinal tissues of Notophthalmus viridescens (Epstein et al. 1986; Epstein and Gall 1987). These latter data suggest new possibilities for the evolutionary origin and functional role of at least some repeated DNA families. In an attempt to explain the observed patterns of conservation and distribution within different genomes, data on satellite DNA in salamandrids have recently been reviewed in an evolutionary framework by Macgregor and Sessions (1986a, b).

We have previously characterized a typical satellite DNA in Triturus vulgaris meridionalis, localized in the pericentric (i.e., procentric-interstitial) C-band heterochromatin and conserved in other Triturus species (Barsacchi-Pilone et al. 1986).

In this work we report data on a second heterochromatic satellite DNA which is strictly located at centromeres and apparently limited to T. vulgaris and, to a minor extent, to T. helveticus.

Introduction

Although in recent years there has been much debate on highly repeated DNA, its function and evolutionary significance remain substantially unknown. Ideas and hypotheses that have been put forward to explain, at least in part, aspects of this sequence load of eukaryotic genomes have recently been reviewed by Lewin (1982) and Miklos (1985).

Urodele amphibians are a very well suited group for the study of repetitive DNA families and their possible correlation to heterochromatin; they possess high C-values (up to 80% of which can be ascribed to repeated DNA) and have relatively few, large and well-characterized mitotic chromosomes (Mancino 1977; Schmid 1980; Birstein 1982).

Newts of the family Salamandridae have provided new data for the characterization of repetitive DNA families. A varied distribution of such families has been revealed within the genomes of these species and also detectable transcription of satellite sequences during the lampbrush stage of oogenesis (Macgregor 1979; Varley et al. 1980a, b; Diaz et al. 1981 ; Macgregor et al. 1981 ; Baldwin and Macgregor 1985; Barsacchi-Pilone et al. 1986). The function of these lampbrush transcripts is unknown. Complementing this pic- ture is the recent demonstration of stable cytoplasmic transcripts from members of a highly repeated D N A family

Offprint requests to: G. Barsacchi

Materials and methods

Animals. Specimens of different Triturus species used in this study were collected in various places, as indicated: T.v. meridionalis, Pisa; T.v. vulgaris, Leicester, England; T. helvetieus, various localities in the F.R.G. ; T. italicus, Genzano di Lucania (Matera); T. aIpestris apuanus, Apuan Alps; T. eristatus carnifex, Pisa.

Genomic DNA isolation and cytological preparations. Whole degutted carcasses of newts from each species were used for the extraction and purification of high molecular weight DNA (Jeffreys and Flavell 1977). Mitotic chromosome preparations for in situ hybridization experiments were obtained from testis and/or gut. Lampbrush chromosome preparations were made from ovarian oocytes of T.v. meridionalis as described by Gall et al. (1981). All these proce- dures are reported in Barsacchi-Pilone et al. (1986).

Restriction enzyme analysis, Southern DNA blot and dot blot hybridization experiments. All restriction enzymes were pur- chased from Boehringer-Mannheim Biochemicals and used according to the manufacturer's recommendations. Di- gested DNAs were electrophoresed under constant voltage (40-80 V) on horizontal agarose gels (1%-2% w/v) in TBE (0.089 M Tris-borate, 0.089 M boric acid, 0.002 M EDTA) running buffer and visualized on a UV transilluminator after staining with ethidium bromide (1 gg/ml in TBE). Fur-

205

ther technical details may be found in Barsacchi-Pilone et al. (1986). After electrophoresis, fractionated DNAs were transferred onto Hybond-N filters (Amersham) according to Southern (1975). Dot blot experiments were performed by spotting proportional amounts of undigested, alkali-denatured DNAs onto Hybond-N membranes. Plasmid pUCI 8 DNA was used as a control. For all hybridizations, DNA on filters was annealed to double-stranded probes labelled with 32p by nick translation (Maniatis et al. 1975; Rigby et al. 1977) according to the procedure described in Bar- sacchi-Pilone et al. (1986). Specific activities of the probes were in the range of 1-5 x 106 cpm/~tg; in the hybridization reactions 1-2 x 1 0 6 cpm/ml were added to the pre-incuba- tion mixture. After extensive washes (0.1 x SSC, 65 ~ C; I x S S C = 0 . 1 5 M NaC1, 0.015M sodium citrate), membranes were successively exposed on Agfa-Gevaert Curix RPI or on Kodak XAR-5 films using Dupont Lightning Plus intensifying screens at - 7 0 ~ (Laskey and Mills 1977).

Cloning of 200 bp Mspl fragments from T.v. meridionalis. Total genomic DNA (20 gg) was restricted with Msp! and loaded on a preparative agarose gel. After electrophoresis and ethidium bromide staining, slices of gel containing a 200 bp band were removed with a razor blade and equili- brated in 0.6 M sodium acetate, pH 7; the slices were then frozen and the DNA was immediately eluted through cen- trifugation in an Eppendorf microcentrifuge for 15 rain (Tautz and Renz 1983). The resulting DNA was ligated into the AccI site of the polylinker region ofplasmid pUC18 (Vieira and Messing 1982), using Escherichia coli strain 71.18 as a host. Recombinants were identified on selective plates containing 5-bromo-4-chloro-3-indolyl-fl-D-galacto- pyranoside (X-gal) and isopropyl-l-thio-fl-D-galatopyrano- side (IPTG).

DNA was prepared from eight of the recombinant clones following the rapid method of Holmes and Quigley (1981). The sizes of the inserts were measured by cleaving the polylinker regions using BamHI and HindlII. After gel electrophoresis and transfer onto Hybond-N filter, the DNA fragments were hybridized to 32P-labelled nick-translated DNA obtained from the 200 bp MspI band used for cloning, Three of the recombinant plasmids, each containing a 200 bp insert, were positive after hybridization. These three clones (pTvm5, pTvm6 and pTvm7) showed extensive cross-hybridization with each other; one of them (pTvm7) was used as a probe in all subsequent experiments.

Large scale preparation of recombinant plasmid DNA was accomplished following the procedure described in Maniatis et al. (1982).

In situ hybridization. DNA of both mitotic and lampbrush chromosome preparations was hybridized to 3H-labelled cRNA (complementary RNA), copied from pTvm7 DNA following the procedure ofDiaz et al. (1981). Specific activities of the probe were in the range of 3-8 x 1 0 6 cpm/gg.

Each slide was treated with 0.1 mg/ml RNase A and then denatured in 0.07 N NaOH for 2 min. Mitotic and lampbrush chromosome slides received 20 and 10 ~tl of hybridization mixture respectively, containing 3-5 x 103 cpm/ gl, following the procedure of Gall et al. (1981). Then slides were washed extensively in 2 x SSC and treated with 20 gg/ ml RNase A. Autoradiography of slides was performed with Kodak NTB 2 emulsion, diluted 1:1 with distilled

water. Mitotic and lampbrush preparations were left to ex- pose in the dark at 4 ~ C for periods from 1 to 3 months. After development, mitotic and lampbrush slides were stained with Giemsa and Coomassie Blue R, respectively.

DNA sequencing. The nucleotide sequence of the insert contained in pTvm5, pTvm6 and pTvm7 was determined according to the chain termination method (Sanger et al. 1977). Supercoiled recombinant plasmid DNA was alkali denatured according to Chen and Seeburg (1985), and annealed to both M13 Universal and Reverse Sequencing Primers (New England Biolabs). Enzymatic extension was then carried out following Sanger et al. (1977); the reaction was prolonged for 15 min at room temperature using 5 U of DNA polymerase I Klenow fragment (Boehringer) for each reaction. Radiolabelling of the extended fragments was accomplished using [~32p]dATP (Amersham, 3000Ci/ mmol) in the reaction mixture. The reaction products were precipitated with ethanol, pelleted, dried and resuspended in 3 gl of formamide dye; 1.5 gl were loaded in each slot of a wedge-shaped denaturing gel (6% acrylamide, 8.3 M urea). Electrophoresis was performed at constant power (50 W), with voltage in the 1700-2200 V range. The gel was then fixed, dried and finally exposed overnight using Kodak XAR-5 film.

Results

Characterization of the MspI genomic famity of sequences

When total genomic DNA from T.v. meridionalis is digested with the restriction endonuclease MspI, two main bands can be observed in the ethidium bromide stained gel following electrophoresis. In addition to a clear band at 330 bp, a minor band is present at about 200 bp (Fig. 1). A series of recombinant plasmids representative of distinct repeated DNA families so far analysed in T.v. meridionalis (see Cremisi et al. 1988) were tested for cross-hybridization to 32p-labelled genomic fragments eluted from the 200 bp MspI band. No hybridization could be detected in this set of experiments (data not shown), indicating that this band could contain at least another independent repeated family.

Total genomic DNA from various species of Triturus was cleaved with MspI and similar amounts of digested DNAs were fractionated on an agarose gel; after staining, UV fluorescent bands were clearly visible at 200 bp in the T.v. meridionaIis and T. italicus lanes (Fig. 1). When analysed by the Southern DNA blotting hybridization procedure, probing with 3Zp-nick-translated pTvm7 (one of the clones obtained from the 200 bp MspI band), a ladder of hybridization could be observed only in the T.v. meridionalis lane (Fig. 2); this ladder is made up of multimers of a basic repeat unit about 200 bp long. The presence of a typical ladder shows that most of the units are tandemly repeated within the genome of T.v. meridionalis, constitut- ing a family of related sequences hereafter named the "MspI family". A minor hybridization band is also present within the ladder, suggesting that the family might be seg- mentally organized.

The hybridization pattern in Figure 2 shows that the cloned sequence is not conserved in the other Triturus species tested, with the exception of the closely related species T. helveticus, which however shows only faint hybridization. Thus it seems as if the MspI family is almost completely

206

Fig. 1. Ethidium bromide stained 1.2% agarose gel of MspI-digested genomic DNA from various species of Triturus: T. vulgaris meridionalis (vm) ; T. helveticus ( h ) ; T. italicus ( i) ; T. alpestris apuanus (a); T. cristatus carnifex (c); T. marmoratus (m). In addition to a clear 330 bp band, a fainter 200 bp band is visible in the vm lane

restricted to the species T.v. meridionalis. The extremely low degree of conservation of the family within the genus Triturus made us curious about the possibility of the MspI sequences being differently organized and/or conserved within the T. vulgaris group of subspecies. We thus analysed the hybridization pattern of the cloned repeat pTvm7 to genomic DNA of the separate subspecies T.v. vulgaris. MspI-digested DNA from this subspecies shows a hybridization pattern slightly different from that of T.v. meridionalis: the hybridization ladder does not extend to high molecular weight regions and there are no minor bands hybridiz- ing to the probe as if a certain degree of divergence had occurred between the MspI sequences of the two subspecies (Fig. 2).

Dot blot hybridization experiments were performed to establish the degree of repetitiveness of these sequences in the genome of both male and female T.v. meridionalis. The extent of hybridization of our probe to genomic DNA of T.v. meridionalis and to the control pUCI8 DNA (Fig. 3) allows us to estimate that these sequences represent about 1% of its genome; therefore the copy number of sequences that form the MspI family is in the order of 10 6 per haploid genome. MspI sequences are clearly present also in T. helvetieus, with about a tenfold weaker hybridization intensity, while T. italicus DNA does not exhibit any hybridization at all. The dot blot data are thus consistent with the South- ern blot results.

Chromosomal location o f the M s p I f a m i l y

In order to determine the chromosomal distribution of the MspI family we performed in situ hybridization experi-

Fig. 2a, b. a Southern DNA blot hybridization performed on the gel shown in Figure 1, probing with 32P-nick-translated pTvm7. Triturus vulgaris meridionalis (vm) shows a typical ladder of 200 bp multimeric units, with a minor hybridization band (arrow). In T. helveticus (h) fainter hybridization is observed, b Southern blot of MspI-digested DNA from T.v. vulgaris (vv) hybridized to 32p_ labelled pTvm7

Fig. 3. Dot blot hybridization to 32P-labelled pTvm7 of alkali- denatured genomic DNA from Triturus vulgaris meridionalis (vm ;

and c~), T. helveticus (h) and T. italicus (i). pUC18 DNA was used as a control. Amounts of DNA used are indicated

ments on T.v. meridionaIis mitotic metaphase chromosomes and oocyte lampbrush chromosomes, probing with 3H- cRNA copied from pTvm7. The results show that these sequences are clustered at the centromeres of all the mitotic chromosomes, except for pair XII (Fig. 4a). The amount of labelling is about the same on each chromosome. Inter- phase nuclei show several clusters of autoradiographic grains that tend to be preferentially grouped in a restricted area (Fig. 4 b).

207

Fig. 4a--d. In situ hybridization of 3H-labelled pTvm7 to mitotic metaphase chromosomes of Triturus vulgaris meridionalis (a), T.v. vulgaris (d), T. hetveticus (e), and to an interphase nucleus of T.v. meridionalis (b). Bars represent 10/am

In situ hybridization to DNA of lampbrush chromosome preparations shows that only two sites per bivalent contain significant clustering of these sequences, with the exception of chromosome pair XII, where no hybridization is detected. The labelled sites are in a position compatible with that of centromeres, and correspond to loopless gran- ules (Fig. 5 a, b).

When tested for chromosomal distribution in the subspecies T.v. vulgaris, MspI sequences reveal a strictly centromeric location, following exactly the pattern already seen for T.v. meridionalis (Fig. 4d). The centromeric regions of all the chromosomes have similar autoradiographic grain

densities, with the exception of chromosome pair XII, which is completely unlabelled in all the four individuals examined.

To obtain the cytological counterpart of the Southern DNA blot hybridization data, we performed in situ hybridization experiments in other Triturus species. T. helvetieus metaphase chromosomes showed greatly reduced autoradiographic labelling compared with T. vulgaris; only centromeres of four or five large chromosome pairs were labelled, while the others did not show clusters of autoradiographic grains even in overexposed slides (Fig. 4c). Negative results were obtained when in situ hybridization experiments were

208

Fig. 5 a, b. In Situ hybridization of 3H- labelled pTvm7 to the DNA of lampbrush chromosomes of Triturus vulgaris meridionalis, a A bivalent shows two clusters of autoradiographic grains in positions consistent with presumptive centromeres (arrows). b The labelled regions are shown at higher magnification (arrows). Bars represent l0 gm

1 1 0 2 0 3 0 4 0 5 0

pTvm5 CCGGGTCAGCTGAGCAGCGAATTTCTATTTAACCACCTGCTTI'CATGAGA pTvm6 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G . . . . . . . . . . G . . pTvm7 . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . . . A . . . . . . . .

51 60 70 80 90 100 * * * * *

pTvm5 GACCTCAGGGCTGCATGTTTTGAGCCCAGTACTGAGCCTGAAAAGCATTT p T v m 6 . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

i01 110 120 130 140 150 * $ * * *

p T v m 5 C C A A C C C C A C T T A C A A G T A A A A C T A G C T A A A A T G T G C C T G G C T ~ I I 2 T C T T C

p T v m 6 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . p T v m 7 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G . . A . . .

151 160 170 180 190 200

p T v m 5 A C ' I G A A A A G C T C A T T C T G A G T A C A T T T T T A G C A T A C G T T T G C T C C T G

p T v m 6 . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . p T v m 7 . . . . . . . . . . . A . . . . . . T . . . . . . . . . . G . . T . . . . . . . . . . . . . .

Fig. 6. Nucleotide sequences of the three MspI clones pTvm5, pTvm6 and pTvm7 Dots are corresponding nucleotides; substitu- tions are shown at corresponding positions

performed in other Triturus species, such as T. italicus, T.c. carnifex and T.a. apuanus, thus confirming the Southern DNA blot hybridization data.

Nucleotide sequence analysis

All of the three cloned repeats are 197 bp long (Fig. 6) with about 55% A + T. The sequences are clearly very homoge- neous, differing less than 10% between each other. Some

short direct and inverted repeats are present; stop codons are found in all six reading frames. No homology to other sequenced units of repeated DNA from newts (Diaz et al. 1981 ; Barsacchi-Pilone et al. 1986; Epstein et al. 1986) was found. Similarly, a search withinthe GenBank/EMBL Data Bank in Heidelberg did not yield any homologous sequence apart from a stretch of 13 nucleotides (positions 3 to 15) within the MspI sequence which is very similar to the cen- tral part of the CDE I consensus sequence of Saccharo- myces cerevisiae (Hieter et al. 1985; Brain and Kornberg 1987).

Discussion

In newts heterochromatin can be easily demonstrated by the C-banding technique as dark bands which are mainly located at centromeres, telomeres and pericentric regions. Previous papers have contributed to the elucidation of the relationship between heterochromatin and highly repeated DNA families in various species (Diaz et al. 1981 ; Baldwin and Macgregor 1985; Barsacchi-Pilone et al. 1986). Now we have characterized another heterochromatic DNA family, the MspI family of sequences, which is clustered in large blocks of tandemly repeated units at the centromeres of T.v. meridionalis.

Three recombinant clones (pTvm5, pTvm6, pTvm7) were selected that contained the basic repeat of this family, previously identified, after gel electrophoresis, as a 200 bp UV fluorescent band in MspI-digested genomic DNA.

209

These three inserts extensively cross-hybridize; sequence analysis shows that the three cloned repeats are largely conserved and that their degree of divergence is less than 10% overall. It is difficult, at present, to attribute any functional significance to the 13 bp similarity of the cloned sequences to the core consensus sequence of CDE I, an important element of the yeast centromere (Hieter et al. 1985). The possibility that this sequence might represent a binding site for a specific protein, such as is the case for CPi of yeast (Bram and Kornberg 1987), is suggestive although remains to be proved.

In T.v. meridionalis heterochromatic centromeric regions have been demonstrated by the Giemsa procedure as dark spots present in all the chromosomes and particular- ly conspicuous on chromosome pair VII (Nardi et al. 1973). As shown by our in situ hybridization experiments, MspI sequences are clearly associated with these heterochromatic regions. However, no detectable MspI sequences correspond to the centromeric C-bands on chromosome pair XII and there was not a significantly greater number of autoradiographic grains on the centromeres of chromosome VII. The discrepancies observed between the intensity of centromeric C-bands and the amount of detectable MspI sequences suggest that these sequences may account for only a part of the centromeric heterochromatin. This also applies to the subspecies T.v. vulgaris, where both the pattern of distribution of cloned MspI sequences (present experiments) and the pattern of centromeric C-banding (Schmid et al. 1979) are the same as those observed in T.v. meridionalis.

Interestingly, in situ hybridized MspI satellite DNA ap- pears to have a limited chromosomal distribution in T. helveticus. Only a few chromosomes show large clusters of grains on their centromeres, while no label can be detected on the other elements of the set. Therefore, on the whole our in situ hybridization data agree with the hypothesis of a segmental pattern of heterochromatin (Peacock et al. 1978) and recall the situation already observed in T.v. meridionalis for the organization of the pericentric heterochromatin (Barsacchi-Pilone et al. 1986).

Lampbrush chromosome centromeres of T.v. meridionalis have not been located on the relative working maps (Barsacchi et al. 1970). Our in situ hybridization experiments with the MspI sequences, on lampbrush chromosome DNA, show clusters of autoradiographic grains at chromosomal positions consistent with putative centromeric regions (see Results). No clustering of grains occurs on chromosome XII, reinforcing the possibility that large blocks of MspI sequences are absent f rom this chromosome.

An interesting feature of the MspI family is its low degree of conservation within the genus Triturus. Apart from the subspecies T.v. vulgaris which displays a hybridization pattern very similar to that of T.v. meridionalis, only the closely related species T. helveticus exhibits some degree of hybridization to the probe. All other species tested, with different degrees of relatedness to T.v. meridionalis (see Mancino 1988), do not seem to contain MspI sequences in their genome.

The chromosomal distribution and pattern of conservation of the MspI family might be explained in either of two ways. First, MspI sequences may be thought of as evo- lutionarily "young" sequences, which arose after the sepa- ration of the vulgaris-helveticus line from the rest of the Triturus phyletic tree. Although little sequence divergence

may have occurred, this family could be relatively well conserved between the two species, and a lesser amount of it in T. helveticus would account for the limited hybridization seen in this species compared with T. vulgaris. This is consistent with the point of view expressed by Macgregor and Sessions (1986a, b). According to their model satellite DNA sequences would arise at centromere positions from where they would be dispersed throughout the genome by successive chromosomal rearrangements; centromeric families would thus be young, while dispersed ones may be con- sidered as ancient families. This model is consistent with the observation that, in salamandrids, dispersed families are shared by distantly related species even outside the genus boundaries (Batistoni et al. 1986; Macgregor and Ses- sions 1986b), while centromeric ones are limited to few, very closely related species. In addition to the MspI family of T.v. meridionalis (present work), two highly repeated DNA families located at strictly centromeric positions on all the chromosomes of the set have recently been demonstrated in T. c. kareIinii; they are limited to the closely related forms T. c. cristatus, T. c. carnifex and T. marmoratus (Baldwin and Macgregor 1985). Moreover, among salamandrids, a third centromeric family (satellite 1) has been characterized in N. viridescens (Diaz et al. 1981).

A second explanation for the observed pattern of distribution of MspI sequences would be that of an ancestral sequence family present in the ancient progenitor of, let us say, all the Triturus species; this family would have been diverging in the various species that were separating over long evolutionary periods so that T. vulgaris and T. helveticus might still be sufficiently close to each other to allow detection of a pattern of sequence cross-hybridization. Ab- sence of cross-hybridization in more distantly related species would thus be the result of extensive sequence changes at the nucleotide level, even in the extreme case of the family remaining at strictly centromeric locations. Genomic turnover events have been implicated in concerted evolution of sequence families in eukar3~otes (Arnheim et al. 1980; Krystal et al. 1981 ; Coen et al. 1982; Strachan et al. 1982; reviewed in Dover 1982). These mechanisms could also account for the intraspecific distribution pattern of MspI sequences and their degree of within-species homogeneity. I f the extensive conservation observed among the three cloned repeats is valid for the family as a whole, then such a within-species homogeneity would suggest either a limited possibility of sequences diverging or a high rate of activity of turnover mechanisms. Heterochromatic DNA families do not seem to have any functions requiring strict selective control so as to limit sequence divergence at the nucleotide level; thus MspI sequences might have been free to diverge rapidly once they were separated from a common ancestor into two or more species. Rapid concerted changes in sequence families are known to occur in eukaryotic genomes (see Coen et al. 1982; Strachan et al. 1982; Lendahl et al. 1987).

Dispersed repetitive families in Salamandridae would instead be subjected to selective control for functional rea- sons; they would be largely conserved even outside the genus. In this context recent data on satellite 2 in N. viridescens seem to point towards a functional role of these dispersed sequences: stable, strand-specific cytoplasmic transcripts are copied from satellite 2 repeats both in somatic and germinal tissues and reveal peculiar self-cleavage properties (Epstein et al. 1986; Epstein and Gall 1987). Although these

210

transcripts are likely to be copied from only a small subset of the satellite 2 family, the homogenei ty of the whole family could be mainta ined through processes of concerted molecular evolution such as those p roposed by Dover (1982). Selective constraints acting on the possible function(s) o f these small transcripts would greatly reduce sequence divergence across different species. In addi t ion to satellite 2 in N. viridescens, other dispersed and widely conserved families have been isolated in Triturus (Macgregor and Sessions 1986b; Cremisi et al. 1988).

A possible difficulty for this lat ter hypothesis stems from the H ind I I I family of T.v. meridionalis: these sequences have a pericentric chromosomal posit ion, being located within the pericentric heterochromatic C-bands, but they show a fairly significant degree of conservation within the genus Triturus (Barsacchi-Pilone et al. 1986), though not as high as the dispersed families. F o r the H ind I I I repeats a rate of evolut ionary change intermediate between that of the centromeric and the dispersed families must be allowed.

Start ing from the two above-ment ioned hypotheses it should be possible to predict the degree o f similarity at the nucleotide level between repeats independent ly cloned from different species sharing a given centromeric family. According to the model o f Macgregor and Sessions (1986 a, b) we would expect such repeat sequences to be fairly similar between different species. These sequences would then mainta in a high degree of similarity for long evolut ionary times, during their progressive dispersion throughout the chromosome set by successive rearrangements. I f dispersed families do really derive from centromeric ones, and assum- ing a similar rate of sequence divergence in different chromosomal locations, then we would expect a closer inter- species homology between repeats of a centromeric family than between repeats of a dispersed one.

According to the alternative hypothesis, repeats of the same centromeric family taken from different species would show extensive sequence variat ion, even if they still had sufficient homology to allow cross-hybridizat ion between closely related species. Repeats from dispersed families would instead display a relatively high degree of homology.

Sequencing of repeats of the same centromeric family cloned from different species should help in elucidating the evolut ionary rates o f change of these highly repeated D N A families in Salamandr idae and thus in determining i f they are stable enough over long periods to be found ult imately as well-conserved dispersed families.

Acknowledgements. We wish to express our thanks to Prof. H.C. Macgregor for providing us with the specimens of T.v. vulgaris used in this work. We also thank Dr. Francesca Andronico for her critical reading of the manuscript. This work was supported by grants from the National Research Council (CNR) and the Department of Education (MPI), Italy.

References

Arnheim N, Krystal M, Schmickel R, Wilson G, Ryder O, Zimmer E (1980) Molecular evidence for genetic exchanges among ribosomal genes on nonhomologous chromosomes in man and apes. Proc Natl Acad Sci USA 77 : 7323-7327

Baldwin L, Macgregor HC (1985) Centromeric satellite DNA in the newt Triturus cristatus karelinii and related species: its distribution and transcription on lampbrush chromosomes. Chro- mosoma 92:100-107

Barsacchi G, Bussotti L, Mancino G (1970) The maps of the lampbrush chromosomes of Triturus (Amphibia Urodela). IV. Tri- turus vulgaris rneridionalis. Chromosoma 31:255-279

Barsacchi-Pilone G, Batistoni R, Andronico F, Vitelli L, Nardi I (1986) Heterochromatic DNA in Triturus (Amphibia, Uro- dela). I. A satellite DNA component of the pericentric C-bands. Chromosoma 93:435-446

Batistoni R, Vignali R, Negroni A, Cremisi F, Barsacchi-Pilone G (1986) A highly repetitive DNA family is dispersed in small clusters throughout the Triturus genome. Cell Biol Int Rep 10: 486

Birstein VJ (1982) Structural characteristics of genome organization in Amphibians: differential staining of chromosomes and DNA structure. J Mol Evol 18:73-91

Bram RJ, Kornberg RD (1987) Isolation of a Saccharomyces cerevisiae centromere DNA-binding protein, its human homo- log, and its possible role as a transcription factor. Mol Cell Biol 7 : 403-409

Chen EJ, Seeburg PH (1985) Supercoil sequencing: a fast simple method for sequencing plasmid DNA. DNA 4:165-170

Coen E, Strachan T, Dover G (1982) Dynamics of concerted evolution of ribosomal DNA and histone gene families in the melanogaster species subgroup of Drosophila. J Mol Biol 158:17-35

Cremisi F, Vignali R, Batistoni R, Barsacchi G (1988) Evolution of highly repeated DNA within the genus Triturus (Amphibia, Urodela). Cytotechnology 1 : 185-188

Diaz MO, Barsacchi-Pilone G, Mahon KA, Gall JG (1981) Tran- scripts from both strands of a satellite DNA occur on lampbrush chromosome loops of the newt Notophthalmus. Cell 24: 649-659

Dover GA (1982) Molecular drive: a cohesive mode of species evolution. Nature 299:111-117

Epstein LM, Gall JG (1987) Self-cleaving transcripts of satellite DNA from the newt. Cell 48:535-543

Epstein LM, Mahon KA, Gall JG (1986) Transcription of a satellite DNA in the newt. J Cell Biol 103:1137-1144

Gall JG, Stephenson EC, Erba HP, Diaz MO, Barsacchi-Pilone G (1981) Histone genes are located at the sphere loci of newt lampbrush chromosomes. Chromosoma 84:159-171

Hieter P, Pridmore D, Hegemann JH, Thomas M, Davis RW, Philippsen P (1985) Functional selection and analysis of yeast centromeric DNA. Cell 42: 913-921

Holmes DS, Quigley M (1981) A rapid boiling method for the preparation of bacterial plasmids. Anal Biochem 114:193-197

Jeffreys AJ, Flavell RA (1977) A physical map of the DNA flank- ing the rabbit fl-globin gene. Cell 12:429-439

Krystal M, D'Eustachio P, Ruddle FH, Arnheim N (1981) Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants. Proc Natl Acad Sci USA 78 : 5744-5748

Laskey RA, Mills AD (1977) Enhanced autoradiographic detection of 32p and 125I using intensifying screens and hypersensitized films. FEBS Lett 82:314-316

Lendahl U, Saiga H, H66g C, Edstr6m J-E, Wieslander L (1987) Rapid and concerted evolution of repeat units in a Balbiani ring gene. Genetics 117:43-49

Lewin R (1982) Repeated DNA still in search of a function. Science 217:621-623

Macgregor HC (1979) In situ hybridisation of highly repetitive DNA to chromosomes of Triturus cristatus. Chromosoma 71 : 57-64

Macgregor HC, Sessions SK (1986a) Models for evolution in large genomes and karyotypes of Urodeles. Verh Dtsch Zool Ges 79:137-148

Macgregor HC, Sessions SK (1986b) The biological significance of variation in satellite DNA and heterochromatin in newts of the genus Triturus: an evolutionary perspective. Philos Trans R Soc London Set B 312:243-259

Macgregor HC, Varley JM, Morgan GT (1981) The transcription of satellite and ribosomal DNA sequences on lampbrush chro-

211

mosomes of crested newts. In: Schweiger HG (ed) International cell biology 198~81. Springer, Berlin Heidelberg New York, pp 33-46

Mancino G (1988) Barriere riproduttive e speciazione nel genere Triturus (Anfibi, Urodeli). In: Omodeo P (ed) I1 problema bio- logico della specie. Mucchi, Modena, pp 201-226

Mancino G, Ragghianti M, Bucci-Innocenti S (1977) Cytotaxon- omy and cytogenetics in European newt species. In: Taylor DH, Guttman SI (eds) The reproductive biology of Amphibi- ans. Plenum, New York, pp 411-447

Maniatis T, Jeffrey A, Kleid DG (1975) Nucleotide sequence of the rightward operator of phage 2. Proc Natl Acad Sci USA 72:1184-1188

Mauiatis T, Fritsch EF, Sambrook J (1982) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, NY

Miklos GLG (1985) Localized highly repetitive DNA sequences in vertebrate and invertebrate genomes. In: Maclntyre RJ (ed) Molecular evolutionary genetics. Plenum Press, New York, pp 241 321

Nardi I, Ragghianti M, Mancino G (1973) Banding patterns in newt chromosomes by the Giemsa stain. Chromosoma 40:321-331

Peacock WJ, Lohe AR, Gerlach WL, Dunsmuir P, Dennis ES, Appels R (1978) Fine structure and evolution of DNA in heterochromatin. Cold Spring Harbor Symp Quant Biol 42:1121-1135

Rigby PWJ, Dieckmann M, Rhodes C, Berg P (1977) Labeling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase I. J Mol Biol 113:237-251

Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with

chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 5463-5467

Schmid M (1980) Chromosome evolution in Amphibia. In: Mfiller H (ed) Cytogenetics of vertebrates. Birkhfiuser, Basel, pp 4- 27

Schmid M, Olert J, Klett C (1979) Chromosome banding in Am- phibia. III. Sex chromosomes in Triturus. Chromosoma 71 : 29-55

Southern EM (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 98 : 503-517

Strachan T, Coen E, Webb D, Dover G (1982) Modes and rates of change of complex DNA families of Drosophila. J Mol Biol 158 : 37-54

Tautz D, Renz M (1983) An optimized freeze-squeeze method for the recovery of DNA fragments from agarose gels. Anal Bio- chem 132:14-19

Varley JM, Macgregor HC, Erba HP (1980a) Satellite DNA is transcribed on lampbrush Chromosomes. Nature 283 : 686-688

Varley JM, Macgregor HC, Nardi I, Andrews C, Erba HP (1980b) Cytological evidence Of transcription of highly repeated DNA sequences during the lampbrush stage in Triturus cristatus carnifex. Chromosoma 80: 289-307

Vieira J, Messing J (1982) The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19:259-268

Received May 27, 1988 Accepted by H.C. Macgregor

heterochromatic dna in triturus (amphibia, urodela)

Documents