¥ "'-lFIlI ICAR

cnfijq; !JI Rl ~ G ~ ANNUAL REPORT

2009-2010

~I~'Q 41C(4 3'l11cfWIf::h ~ ~ ("'"Hfit! ~ ~~) ~ 'Q'ftm', ~ ~-1 10012

TIO L BURE U OF PLA T GE ETIC RE OURCES (Indian Counci of Agricultural Research)

Pusa Campus, New Delhi -110 012

" ,.

...

,

'PIT.3R.1f.~ NBPGR

NBPGR q I flfC5fi 51 fa ~ C( ...

ANNUAL REPORT 2009-2010

¥ 1Q~ ICAR

·(l i~lI qlC(q at lliq~ICfi ~ ~ ("II(tflq ,rrtr ~ qRiSI<J 1@T qR'Et(, -.:rt ff{<R¥ft 110012

ISSN NO 0971-2572

NATIONAL BUREAU OF PLANT GENETIC RESOURCES (Indian Council of Agricultural Research)

Pusa Campus, New Delhi - 110 012

Citation

Compiled and Edited by

Anonymous (2010). Annual Report of the National Bureau of Plant Genetic Resources 2009-2010, NBPGR, Pusa Campus, New Delhi, India, 187 pp.

Dr. Arjun Lal, Principal Scientist

Dr. (Mrs.) Kavita Gupta, Senior Scientist Dr. (Mrs.) Vandana Tyagi, Senior Scientist

Dr. (Mrs.) Sangita Yadav, Senior Scientist

This report includes unprocessed or semi-processed data, which would form the basis of scientific papers in due course. The material contained in the report therefore may not be made use of without the written permission of the Director, National Bureau of Plant Genetic Resources, New Delhi except for quoting it for scientific reference.

Published by the Director, National Bureau of Plant Genetic Resources, Pusa Campus, New Delhi-lIO 012, and Printed at Alpha Printographics (India), New Delhi-II 0028. Tel.: 9999039940, 9811199620

CONTENTS Preface S1fd~G:1 ~ Executive Summary Introduction NBPGR Headquarters, New Delhi 1. Division of Plant Exploration and Germplasm Collection

2. Division of Germplasm Evaluation

3. Division of Germplasm Conservation

4. Division of Plant Quarantine 5. Germplasm Exchange Unit

6. Tissue Culture and Cryopreservation Unit

7. PGR Policy Planning Unit 8. NRC on DNA Fingerprinting

NBPGR Regional Stations! Exploration Base Centers 9. Regional Station, Akola

10

11. 12.

13. 14.

15.

16.

17.

18. 19.

Regional Station, Bhowali

Exploration Base Center, Cuttack Regional Station, Hyderabad

Regional Station, Jodhpur

Exploration Base Center, Ranchi

Regional Station, Shillong

Regional Station, Shimla Regional Station, Srinagar

Regional Station, Thrissur

General Information

19.1 19.2

19.3

19.4

19.5

19.6 19.7

19.8 19.9

19.10

19.11 19.12

19.13

19.14

19.15

Institute Management Committee

Research Advisory Committee Institute Research Council

Institute Joint Staff Council

Personnel Staff Reservations Staff Transferred! Retired! New Appointments

Promotions Awards/ Honours

Deputations/ Visits Abroad Library and Documentation Services

Field Days Organized

Wo~kshops/ Group Meetings/ Trainings Organized by NBPGR Participation of Staff in Workshops/ Trainings/ Seminars/ Symposia etc.

Publications

19.16 Empowerment of women 19.17 Budget Estimates and Expenditure Incurred (Rs. in lakhs) for 2009-2010

Annexure I : Meteorological Data of Regional Stations

v

1 6

12

16 25

33

39

48 59

64 67

80 86

98

106

119 125

130 133

139

142

152 152

153 153 153 158 158

159 159 160

161 162

163 165

168 179 179 180

,

PREFACE

It gi\e me immense pleasure to place before you the Annual Report (2009-10) of the National Bureau of Plant Genetic Resources (NBPGR), a nodal organization of the country mandated with planning, execution and coordination of all activities concerned with germplasm collection, introduction, quarantine, evaluation, con:,crvation and documentation at national leveL Since its establishment in 1976 by the Indian Council of AlIficultural Research (lCAR), NBPGR has played a pivotal role in the management and sustainable ut~lizat· on of plant genetic resources.

Considering the suggestions of the Germplasm Advisory Committees (GACs) on the various crop groups. plant explorations were undertaken to conect the trait specific germplasm and wild relatives of crop plants, which constituted 47% of the total collections made during the period under report. Similarly, trait specific germplasm for quality, biotic and abiotic stresses, etc., was introduced from abroad and made a\ ailable to indentorsl researchers after quarantine clearance. A large number of accessions of agri­horticultural crops were grown for characterization, evaluation, regeneration and maintenance at New Delhi and various regional stations of Bureau located in different agro-climatic zones of the country. Beside .. , multi-location evaluation of rice, wheat, chickpea and pigeonpea involving AlCRPI lCAR crop­based inf>titutesl SAUs resulted in the identification of promising accessions for yield, quality attributes and tolerance to biotic stresses.

A total of 8,284 accessions of orthodox seeds were added to the base collection raising the total germplasm holding to 3,75,702 accessions in the National Genebank. A total of 2,004 accessions of fruit crops, bulb and tuber crops, medicinal, aromatic and rarel endangered plants, spices, plantation and industrial crops were conserved as in vitro cultures. Significant progress was made in the development of protocols for cu Itiv ar identification in crops of national importance using molecular techniques like STMS, AFLP and ISSR. More than 2,500 varieties in different crops were fingerprinted and included in the database on DNA fingerprinting. Three M.Sc and one Ph.D students were awarded degrees in PGR during the year.

I take this opportunity to place on record my sincere thanks and gratitude to Dr S Ayyappan, Director General, ICAR and Secretary, DARE, Govt. of India and Dr S K Datta, DDG (Crop Science), ICAR for their continued guidance, encouragement and support in executing the mandate of NBPGR.

I thank all the scientists, technical, administrative and supporting staff ofNBPGR for their teamwork, efficiency and dedication.

Sincere efforts of Drs Arjun Lal, Kavita Gupta, Vandana Tyagi and Sangita Yadav in compilation, editing and bringing out the report are appreciated.

8 April 2010 New Delhi

PRE.. r I

SK Sharma Director

v

\

~<l ~ 3lIjcj~lCf) ~ ~ (c11~1q)1J1"13lR) ~ l{

qrGCf 3lljcj~ ICfl ~ "* ~ l{ ~ ~ ~ 3f!TUTt ~ f.'fl:rr XiTI ~ I crt 2009-10 "* ~ ~ ~ ~ \Jfi'l1S;>Cll ~, \J111S::Cll ~, ~ ~ ~1ffUT, ~ Cf}T ~ ~ \'ffi \J1rtr ~; i1IRI)Cfl ~:m,

~, 3PU qRl:I15ol c#r 1:ffii1R $ ~"* ~-~ ~ ~ l{ qRl:Igol'j Cf}T "fR1ffUT ~ ~ ~/ ,:Jq\l"IlAlil "* ~ fqjll,!&QII l{ crllil5C1:lg:oT ~ ~~ c#r ~ ~ x=fWr -iT fctcRur ~ ft1lT 'l<IT ~ :-

tfTGll ~ ~ \J111S;:6Q ~: ~ l{ <gc'T 43

~ ~ ~ ~ ~ ~ ~ ~ ~IIIClI..f1

~~, ~ c#r ~ \'l1l-~ ~ 3FT ~ ~ ~ ~~ 1:JTG1lt c#r 2,648 ~ ~ c#r ~ I ~ ~ 389

~ ~14'lq) \Jj13lR ~MIC'111 , ~ ~ Gffi ~ ~, 3l'(i)OI'i1C'1~, 7JTcrr, ~, ~~, ~,~ ~ \'mR~ ct~wIT~9 ~ct ~~ mrtml c#r ~ ~ I <gc'T 304 ~-~ ~, 57 ~ ~ ~ 25 ~ ~ cpT ~ fcRrr 7f<rr ~ % ~ cr-rm X"iW5lclq ~ 1JWT (\\!1\\!i1fflq)) l{ ~ fcl;<rr 7f<rr I

~ llfGttT ~ ~ ~1~I7lCfiY q;r ~ : ~ "* q~ I4lfil7l4>f ~ ~ 14\J1I~di ct ~ qx ~ \Jllx f0r l"f<.rr I ~ ct 31clCR, ~, ~, Rld'l'$'l(f,

-;wtR, ~, ~(jlqll~, ~, ffRltt ~ ~ ftrclT "* ~ m<IT ~ CRT ~\J1I~ljl ctr 45 ~ Cf)T ~ fcl5<:rr 11m m I \mR m "*~, C'1~(jg'!, ~ "RfR;IT; lWt m "* ~, 'ClI R111'!, ~, ~, e)Cfllill~, ~ ~ ~-IT1" "* 3WfCR, ~, ~ "RfR;IT "* ~ wIT ~ ~ ~ (~CflTT<l) -qrm c#r 35 ~ -<tJT ~ fclJ<:rr Tf<lT I ~ ~ XT\J'lf q') ~, ~, ~, ~,

IIlft1qltill~,~, cl~llig'!,~, ~'!I~ltill~, ~~ ~.ct <f1R ~ ~ ~ ~ (cr>q CflTT<l) -qrm c#r 36

~ cpT ~ ~ ~ 1"f<TT I

~ ~ ~ ~ om 3R:r ~ (>fI'l1 ~ "$:IT em ~ : ~ -c;q' ~ -qrm (30), ~ (1), tpc;IT (15), ffi (5), '{'1\J1ICle) (1) ~2TI ~-~ 14\J11R14\

(21) c#r cgc;r 72 mfum cpT ~ cB-~, 4>lC13lg'!.

WllfTl ~ ~ ~ ftrc;IT cB-~ wIT ~ ~ fclJ<:rr '17.lT I ~ -c;q' ~ 1ftm c#r ~ -iT ~ "£fTCT ctr ~,~~, ~l{~~~~ ~\J1I~qi ~ -g I ~ 3l~RCf)1li (5), 3lT. ~re~llili (i), 3lT. ~'(C'Tf (37), liNk'"! I l51<!1~1:!1 (1) ~ \\!'{'1q,!II'{'1 ~R:tIi'I'{'1'{'1 (1) A ~ 45 ~ em \mN ~ ct ~, ~

tI ptitll

gC'i~:!Il5,!, ~, ~, q)'(i)'{SIltill~, ~, ligllilllf1lI'!,

~, iRa, ~\J\J1q)'!111'!, '{'1l51'!1g'!, :!1ll5\J1gig'! "RfR;IT ~ I3m'!I'!!i;S cB-~ -c;q' ~ <f1R ~ cB-~ 1WIT ~ ~ ~ 'l<IT 2TI I ~ q') AA"l m ~ ~, ~ -c;q' ~ -ctIm ~ 3FT CRT ~ 1ftm cB-~ -ggGT~~~1

~ ~ ~ : GT ~-fclftr;c ~ ~ 'l'!" ~ ~ ~ ~ cB-~ I3ro'!I'!!i;s c#r ql5l~ljl -iT ~ ~ al?IT ~ ~ (11), ~ (07), ~ -c;q' ~ (27) ~ ~ ~1~fTl4>l (02) ~ ~ ~ ~ '1 ~\J11~1l'i ~ 116 ~ ~ c#r ~ I ~<.'11q)l~C'(fl cB­~ -gg ~3lR3lRorrt, q>CCf) q') "flT~ ~ 10P ~ ~ ~ ~ ~ 'l<IT ~ ~ q') ~C!CflACflI

~"*~al?IT~~~-iT~~~~ ctr 3fIO ~ "CflT ~ ~ 1"f<TT I 10P ~-fclftr;c

~ FcPm 7f<rr ~ ~ "* ~ ~ ~ RJrc;IT "* ~ af:;iI ~ ~ \J111S::Cll rfI ~ ~ G~ '1 ~ \ill ~lj'j ~ 11 0 ~ Cf}T ~ fcl5<:rr 'l<IT I

~u:r Pc! ~ "I {j

\J111S;:OQ awrnf : ~ ~ "* ~ 46 ~ ~ 36,076 ~ (76,381 ~) CliT ~ fclJ<:rr TI<TI ~ AA"l ~ -c;q' iSIPICllofl ~ c#r 30,589 \J111S::Cll ~

(32,317 ~) ~2TI "4fr1ffUT"flT1nfT rfI 5,487 !OIRlffe<1i (44,064

"11fr) Wi1c;r ~ I ~ Will ~ ~ Cf}T m ~ ~ ~ \J111S::ClI ctr ~IClNCfl(jI:m CliT ~ ~ TI<TI I ~

~ "* 1320 ~ 6 ~ "* ~MIC'1q, ~ ~ ~ ~ 44059 "11fr ~~'!liSll~ ~ ~ cpT f.1<:rh1 ~ 'l'!" I

3lW "TIT ~ ~ \J1'11~cm' em ~ :

"Gft : ~ (~ 657889) - iSIl£lllilfl ~ 3RT\Jl GT'1T -gg ~ ~, l1fC'C ~ ~ ~ 3RT\Jl jOIClml, ~ ~ "* ~ WflR Cf}T ~, "fl(ffi qx ffi ~ ~ -c;q' "ftllC ~"C!?1T;sT (~657888) - "IT: ~ l{ ~orrt ClTclT,

~ ~ G"CflT "S3TI. ~-~ ~ ~, ffWT ttT;s ~, ~ ~fu1*le:fl, ~ -qc;fq ~ Q'!fl1e\J1, ~ ~ -c;q'

1:!5TR1 ~ 'fll1C "* ~ I m1" : (~ 637732-35) ~ XT\J'lf ~; ~ \'l1l"\Jl

~ ~; (~ 659913-14) ~ XT\J'lf ~ ~~ ~~~~, ~<t€lRllC'1 ~~~~ ID\1'1" ~ We ~ ~ I (~ 637984) flh<.'11q)"f1:

'{'1iS1liJ"f1 ~ ~; (~ 638154-161 , 166-178)

flhcl)q)"f1 ~ ~fu1*le:c ~; ~ 639758-797, 820-822)

~-.=m: ("t~ 657109-118) 1!lT"fl"; "t~ 638162-165)

1

fi:hJ)q-)~ ~ ~~; ~ 659921) Fcl~d.iII+-3lCf>TC'f ~ fcR+r; (~ 639584-757, 798-819, 823-826)

~~~FcPf+r1

l){: (~-638278) ~ ~ ~ lll~JtR~1i ~ ~ cf; ~ cf; ~ ~ ;s1~fllf?lCfl ~ ~; (~ 638314) ~ ~ ~ ~dCflIC'l'l'1 ~ ~ u1cr EfI\JiIctlC'lI, ~ 'l0lctml qft xTiT ~ CffC'lT, 3ImT

~~ flffirojdl CffC'lT; (~ 638315) ~ ~ ~--3TTm ffl ~ ~ ~ ~ CffC'lT; (~ 641860) ~ ~ ~-FcPf+r morr 16432, ~

3RJ\Jf ~ ~, 00 ~ ~ CffC'lT, ~~JtR~1i ~ ~~, ~~, ~"ffi':"CflT 3ImT~, ~ ~ -c;ci ~ ~; (~ 665054) ~ ~dCflIC'11'1 "WfiR; (~ 664600) 3lcil";:il'11- "fR3J "('1"R>f ~dCflIC'1"1'i ~ 3T<UT ~ I3CtlIC;Cfldl, ~ ~"CflT~, ~3lR ~ 47

G"RT ~: ~ d'm 3T<UT xTiT fFTR qft ~ I

~ : (~ 659915-17) '11~\J11R~1 - "!lllc;j'lcIFcffi'1 "CflT

f.1kf~, ~ ~ TT~ ~cpA ~~, ~ cpA "ffi': -c;ci ~ xTc ~ f.1kf ~-'lWT -ij ffl ~ qft

3T<UT~1

tthwfJ'1 : ~"I31l\Jf ~ I (~ 638228) ~ ~ ~ fll~l~l'1 ~ crmffl, ~ ~, ~qi)R~C'l lNCcf -c;ci 1Jil<T ~ ~ ~ ~; (~ 638229)-~ ~ ~ fl)~I~I'1 ~ ClTlR"f1 ~ ~ X'lC "'ilC

~, lWT~ ~ ~ -c;ci ~qi)R~C'l ~ ~; (~ 644409) ~ ~ ~-~~, 100 1W1 ~ "CflT CT\iR 7.3 "W11, ~, fll~IEfI'1 ~~, lWT ~ ~ ~ -c;ci ~CftlR<lC'l ~~; <Rmtt ~ 8001 -

~ 'Wf, "lJ fl<lI'14'1, 1JCfR 1R "br "4ts qrc;r ~ ~ ~ ~ ~ cf; ~ illiCflC;lx ~~; (~ 644410) ~ ~ ~ - fll<llc{l'1 ~ cwm1 ~ ~ ~ "CflT

~; ~656640)~~~-~ I3CtlIC;Cfldl

~ ttl~l~l'1 fuR~, ~ X'lC ~ ~-c;ci

~ ~ "$t ClW1cf) ~; (~ 656641) ~ ~ ~-~ "I31l\Jf ~, tt'I~I~'1 fffi:c ~, ~ X'lC -;:ffc ~ -c;ci ~ ~ ~. "$t 'c1lTtfcl>

~; (~656642), ~ ~ ~-~ ~ ~, ttl ~ 1~1'1 fffi:c ~, ~ X'lC -;:ffc ~ -c;ci ~ ~ ~"$t C1:ITQ"Cf)" ~; ~ 656643) ~ ~ ~-~ "I31l\Jf ~ ~ ffl ~ ~ I

"Rfr <g~",Rfl : (~ 666214-952, 5016-5052) ~­~~~~I

~ ((>f1~CfilqxfflCfil'1 "!'t1<gcl·CIi) : (~ 637360--65)

~ - ~CftlR<lC'l fctc;?; ~ cPRT ~ ~ "$t ~ ~; (~ 664585-88) ~-~ 1JCfR ~

2

~; (~664589-599) ~ - <ts ~~; (~ 659266-71) ~ - ~ rftcr ~ "ffilRft cf; ~

cPRT~; (~ 657640) ~ - cPRT ~ ~ cr-m- 4illJtR<l1i fclc;c"$t ~ c'Mc)~; ~ 654694-99)

~ ~ CllTCX d'm ~CftlR<lC'l fctc;?;"$t ~~, (~ 654678-86) ~ 4i~JtR<l1i fctc;?; -c;ci cJfrcT ~ ~I

q>qffi : (~ 657081-108) ~'t1xl~C'l -~. ffix'§cli "$t ~ "CflT Rflc'lxx ~ ~a1cfl; ~ 653105-105) ~flxl~C'l - ~. iSllxOlI;Gfl "$t ~ "CflT Rflc'lxx I

\JiI'1'1~C4 ifiT f.nffir : ~ -c;ci iSll'IClI..fI ~ cf; ~ d'm

-qrq ~ em f.1kf 3lltIR 1R f.nnG fitm l"flIT :- (i) ~/lfT·Cfl·3T· ~ cf; ~&:II('1lli ~ ~ ~ cf; 3lltIR

1R (ii) ~ ~/lfT.Cfl.3T. ~ ~3lT cf; ~ ~ flli:H)dl ~ /~ ~ /fclfiR ~lc'ICflIC'l cf; ~ lfT'«f cf; ~ Fcl~ct~€lIC'lq'i /lfT.Cfl.3T. ~ "$t ~ -ij ~ ~ ~ ~$1If.'lCf)'i ~ ~ ~ cf; 3WlR 1R I f.'nmr"$t ~ ~ 1ITG1J ~ ~ cf; lfI'C1Pf ~ ~ ~ Wffi ~ ~"$t ~ ~ d'm ~ R~IIf.'l(hn cf; ~ Cfl.3T. m fcMT'T, lfT'«f ~ ~ ~ cf; <nG ~ cf; "4TG4"

~ >J1lT1T G"RT ~ 1ITG1J ~ WfTUT-"Q?f cf; ~ ~ -ij lii'ICfldf3lT em -.t:rrr l"flIT ~ I cgc;r 1320 ~ qft

"ffilRft 13 ~ -ij f.'nrtd" "$t ~ I

~ ~ : ~ 3KRur "CfIXR ~) cf; ~ ~3lT ~ ID"l:{f ~ cf; 3lltIR 1R ~ -ij ~ 1:pff('1" WlR CflI4w'1'i -ij wWr ~ ~ ~q'I'ICfldf3lT em fclfiR ~ cf; ~ 13,391 ~"$t ~ "$t ~ I

\JiI '1 '1 ~ dl qft- ~t:l \1f"i'q

~ ~: ~ \JiI'"1'"1~C4 ~ ~ fclfiR llR1C'1T "$t ~a1UT ~ ~~~q'i "$t ~ 36,076 ~ (76,381

~) em ~ fitm l"flIT ~ ~ 4,891 mf1{mt '"11~\lllq'i ~ ~ ~ ~ I ~ ~ -ij ctltdFclCfl ~, ~ ~, ~, xl~\il)JOfl, ~, <fiG, ~ -c;ci ~ ~ l{1icclcfl

wfi1c;r ~ I ~ ~ -ij ~ (175), f.'llilcl;qfl (1869),

Cf)qCf) / ~qi)R<l1 (2,645), crmffl (27), ~x4ctqlx (175) d'm

~ ~"$tc wfi1c;r ~I cgc;r 4743 ~/~/~ ~ -ij ~ 4,807 em ~, Tfll ~ "\3llT.JR NiI;S~t)), ~-~ ~~~'HlIt6l, c(»cl'j'"1I~ICfI tit;r -ij~, ~ ~ (J~ ~ ~a1UT cf; 1lJUIl'f ~ ~ Tfm I ,g~1 ~fi:h<ll '"1

qf.'lfflf(;j"!cli ~ ~ ~ ~ ~ ~ ~ ttl'1'11~XIi cf; 13 ~cr-m-~ IiI~ct;S~~ (tIx'1'11flcflxl ~'"1flsRCflI) ~ ~ ~ ~ ~ ~ 'C'lI~ffI'"1 if<m ~ ~ 84

~ en) ~ CflX ~ l"flIT, lfT'«f ~ ~ "$t ~ \JiI1'"1Cf1I~ ~ fi1c;fi ~ I 3RT Wl ~ ~ em ~XWR ~ cf; lfI'C1Pf ~ ~ Tfm I <gct 1405 "'"1'fIT "CflT f.'l<rto fitm l"flIT

~ H 7 ~d/~~Cf>T~fcp<lflTm~ 17

~ fi:ri[ffT Wf[UT-1f5f ~ ~ ~ I \.Tl'"l'"l~Cll "fRafUT lPlPT ~ 566 ~ <fr"\.Tl ~ ~ -gg ~ ~ ~ ~ 1) 2S6 ~..rr ~ ~-t ~~1I~!l1l#1 ~ 'Tt ~ 122 ~ em­~ 7fm I tgC1 6 ~ em- Xc\G Cj){ ~ 7J<lT ~ ~ ~ -;:ffiT . Jff ~ m I

'«ttiiiICi -~ ~ <6 WR <gc'f 61,495 ~ (17 436--3lTlITff ~ 44,059 f.1<:ltcf) wmc:r !>l'ti%xOI <6 ~ JINf~ 'ltl ~ ~~~~em-~<fu.T1~ ~~~~, ~~, ~t- ~~1I1!l1l#1, ~I~ ~ ~s:q'11~IX~oc; ~ ~) \Jltq, f1{'1~~l~I"1 ~ ~GiO ~ ~ lJ'.T1RT 7J<lT ~ ~ wmc:r lffi(q <6

fl ~ 'Ql~ ~ I <gc'f 2147 ~ ~ .q ~ (1988)

~.1\J1"11f)1 ~ ~/mfRr ~~, (70) cCrcT ~ ~ d1m

(89) ~31~~1I1 ~ mfRr ~ ~ I <gc'f 21,44 ~ em-~ ~ -1m om 3 ~ em- Xc\G CR ~ 7J<lT I ~ ~ cf, ~-wr <gc'f 172 llTGQ" ~ >r=fTUT-1f5f ~ ~

~I

~[. Ra1Vr, ~~ &Tx :r'R

~ ~ \ifA£PRt d1m ~C"!liCf>"1 -gg ~ <Wt - ~lllql4)

~ ~ cgR 6288 ~ em- \j7fl(IT 7J<lT ~ ~ ~

(303s), G~ (1306), ~ (689). ~ (637), 3WJ-~

~ (508), ~ ~ ~ ~ (110) ~ 61 ~ ~, -qffi>; ~ wmc:r ~ (41~Cf1~"1) .q 3ic1'<i~l1 ~m qft 2935 ~ em- '4T \j7fl(IT 7J<lT ~ ~ \ill, ~<1" ~ ~ ~ mfWrf wfiic;r 61 ~ ~ d1m

~ ~'<I4)c,<'i tg~, ~ tR ~ ~ ~ ~

(1l!fl 'fc 3l~ ~ \i1lft1 (633), ~'<\J1jcl) (194), ~ (358), 3:rc;f~ (180), ~ (20), ~ (40), ~ (37)

(1l!fl lffi'lTiffi ~ (17) <6 <gc'f 1497 \J1 "1 "1 ~afj Cf>T Fcl ~c)j tt 0 I

fit;m lfllT I 4J1~c~cf;~Cfl<"l ~C"lliCfl"1 .q, 392 RlFchct'1111 ~ ~ q)tTf .cf; ~ Cf>T Fcl~c)jttOI fct><n 'Tm d1m ~ ~

~ ~ \Jl1 "1Cf>I~ <6 ~ \YlCf>T ~C"ll i Cfl"1 fclJm 7J<lT I

~ ~ ~ tR \J1"1"1~Cll'i ~ ~3lT ~ \J11"1CflI~ ~ \Y'fCf>T fcpm 7J<lT ~C"ll iCf>"1 ~ >!cPR ~ :-

~ : XEfi 2008-09 <6 GRR <gc'f 2,997 ~ d1m

«~2009 <6 ~ 5,697 mfu<:IT Cf>T Fcl~c)jttOI ~ ~C"lliCfl"1 ~ 7fm m I Cf!f 2009 <6 G'RFr <gc'f 1 ,580 ~ Cf>T

\i1·F1~Cll ~3lT ~ \J11"1Cf>I~ ~ ~ 'Tt, ~ xij'r <6

~ 1,048 mfWlf ~ ~ <6 WR 532 ~ ~ ~ I \J1"1"1~Cll <gc'f 512 ~, ~ 176 l};, ~, 175

~, ~ 57 ~ ~ ~ 2 !>l\Jllfddi, 53 ~ ~ ~ TlR !>l\Jllfdm d1m ~ \Jl"1"1~Cll ~ clR !>Ol\Jllfdll'i

~ 51 mfWrf wrm ~, Cf>T TR fct><n 7J<lT d1m ~ ~ ~-l ,'en q ~ tg ~ Tf<lT I

~ : \1~, C'faiUJl ~ \J11"1Cf>I~ (f2lf ~ <6 ~

<gc'f 207 ~ IDl(f ~ 2\T I ~ c:gu-~ Cf1f <6 <fu.T1 ~d1m~~~~~~~~ ~ ~ 3lR ~~~~~~ «Rf ~ \Nlfrfi llTGQ"

l'l\i1lfdl1i), ~ ~lx6l1,g"1~-110 ~., ~ ~~-50 ..:> ..:>

FPm., ffI~41111"1 ~c)j~1t1~-267, ~ F.':IU"t<=lxlf.'lPhl1crn'1 (23196

~. + 10000 ~ ~), ~ (11816 ~. + 10000 ~ ~), ft ,g'1~fHI (552), '{l\J1~R"1~ 3l1fQ>ffI-i<"l~ 31757

3lR 15100 ~ ~, ~ ~6M~111"11 -176, EIffl-96,

~lllqlo:Yl ~-ctMT (2226), ~ ~ (227); ~ ~ ~ (~-208)-13 fcpm. ~ 3Wffit ~ ~/'1illCf>C1Y3IT em-~ 'Tt I <f)'Ccf) : Cfl<'tl<)[e;S £fA (2088), ~ l:f"1T (38), Cf>T<'1T l:f"1T (41)

~ <gc'f 2167 ~ ~ ~ ~ '1lx4JI<"IIIU"tCf><"I

~3ll em- \.TfI"Ff <6 ~ \YlCf>T ~C"lliCf>"1 fcpm 7J<lT I ~ ~ ~~ 35045, 22499, 26772 ~.q, lR ~ .q ~ 565287, 565226, 565225, 569058 (f2lf ~ ~

.q 3l$fr 565229,565220,568908,565276 Cf>T f.'lt4IG"1 ~

~~<6~~~~W~I~~,

~~~~~~~~<6145~<6 10f> ~ d1m 27 ~ ~ ~ ~ \J1"1"1~Cll em­~3lR3lR~, Cf)Ccf) <6 ~ ~ ~C"lliCf>"1 tg ~ 2009

<6 G'RFr \j7fl(IT 7f<lT I

~G,(liilIG : ~ ~ ~lllql'11 ~ ~ Cf>Cq 629 ~ c. ..:>'

~ ~ (64), 3RYffir (88), fcR;r (89), m (62), fi1r.f (201), ;S1~Cf>~ ~ (77) (f2lf ClllCX (57) wfiic;r ~, em-~ 2009--10 <6 ~ \.T11"1Cf>I~ /~C"lliCf>"1 /TR -gg \3"IlTm Tf<lT I \J1"1"1~Cll ~ <gc'f 718~, ~ CflT<'1T l:f"1T (50), ~ ff[\iffi (164), ~ (70), ~ ~ (20), m (175),

fl1'cf (92), ~ ~ (76), ~ (22), ClllCX (49) d1m ~

m ~ (49) wfiic;r 6, em- 1C"lliCf>"1/TA/\J1I"1CfjI~ -gg ~ "\.T'ffq ~ ~ "ffiIT .q -mm 7J<lT I

~: ~ ~ ~ 2009 <6 G'RFr cplffl: ~ ~ ~ 125 ~ 1971 ~ Cf>T 3lqC'1~ICf>"1 fcpm 7J<lT d1m ~

~ ~fll"1lfi1Cfl TIT em-~ fcpm 7fm I ~ TIT "dR)

~ ~ <6 ~ ~ qRqCfqC11 (f2lf ~ wm3ll tR

lJ3lR ~ ~ ~ 3lR 'qffi 1T<PR <6 ~ EIT\.TR ~ ~ \jq\.Tf ~ ~ Tflo ~ ~ <6 3lIj<i~ICf> ~ Cf>T

~ 2009 <6 ~ 1C"lliCf>"1 fcpm 7fm (f2lf ~ \J11"1Cf>IRlli

~~'Ttl

~ : ~Ollfl"lCf> d1m '11'5llfl"lCfl TIT <6 ~ cg~ <6 362

~ (f2lf 38 ~ \J1"1"1~Cll'i Cf>T ~ fclJm 7J<lT I

~ : ~ Cf!f <6 G'RFr~, g<t\jcqIG"1 ~

TR ~ ~.q ~ $r ~ ~ \J1"1"1~Cll ~ Cf>T ~ fcti<n 11m I ~ qrcq ~-l{CfCflf, £fA ~

3

~ Cft'.lT ~ ~), ~ ~ - ~, ~, ~, , '~ffl "~ ~~ CJ'>1C'l1 <11, 'SllflfCt>1 <11 011'( q;c;r crrc;ft ~, ~

~-~, ~ Cft'.lT <fl q ~ ~-~ ~ ~ 1

firI1<1T : ~ (747), llCX (146), ~ (227), ~ (427), ~ (121), Cll..flql'S (25), ~ (25), ~ ~

(50), cmfl (243) ~ lflC'lGI~"1 ~ (59) ~ ~ 2070

~ CJ?T ~ '])011C"14> Cft'.lT 'i1'5lI("fiCfl TIT ~ TT f.'ltmuT Cft'.lT Jt~ i CfI"1 ~ IT<TI 1

~ : W ~ 2008-09 cf> c:'RR ~ ~ICJlR'1JtC'14> TIT cf> ~ ~ (330) Cft'.lT ~ (111) cf> 605 ~ CJ?T

TT ~ Cft'.lT Jt~ i4>"1 ~ TJ<lT 3lR TT ~ Cft'.lT

Jt~iCfl"1 cf> ~ ~ 2009-10 ~ ~ (303), ~ (145) Cft'.lT

~ (128) cf> 576 3lfiWR ~ l']I:[ I

~ : W 2008-09 cf> ~ trR (~ ~) cf> 111

~ C'Im 'i:f"IT cf> 116 ~ CJ?T Jt~i4>"1 ~ IT<TI 1

~ 2009 #, ~ ('I '<f1lf.H 1 ~) cf> 22 ~ CJ?T

TT ~/Jt~i4>"1 fcptn '1m I ~ 2009 cf> ~, ~ cf> 80, m (tilC'lI"1'i ~C'l'i'ft"1l) cf> 35 3lR 'i1C'lliill'<

~ ('I~PI<11 $kl1Ri1<1I) CJ?T TT ~/Jt~iCfl"1 ~ <mT1

~ClI' "fI'~a1UT

tfu;r ~ # 'ffilffUT : ~ ~ # c<l QCflI fc;J 4>

-m-eTUT ~ ~ ~ cf> ~ 10804 3lfiWR ~ ~ I ~ cf> 'i1"1G°;S1 cf> ~ ~ l'l fi%,< 01 fcIRrr TJ<lT 3lR ~ ~ # 8284 3lfiWR ~ ~ l']I:[ ~ "¢C'f

\i1"1"1~c4i <tT "ffis<rr 375702 ~ ~ 1 \TH"1~Cll ~ ~ ~ <gC1" 1977 3lfiWR ~ ~ 3lR 1082 em ~ ~ f.1Gm cf> ~ # ~ ~ ~ # ~ '1m I

~ ~, trR cf> 10052 ~ CfiT 3id'<l~<1 ~ ~ ~ ~ l'lc'lllqRtd ~ TJ<lT I ~ ~ cf> Jt~i4>"1/g;:f\3cqIG"1/-mtT/~tg~3tR~ \i1"1"1~c;ql (2416 ~) CJ?T ~eTUT ~ ~ ~

4>144><1141 # wf11c;f ~ I ~ i:'1Cl>lffllfllC'lI, ~ 5lfTCT 3lR ;sUP! <11 Fc1 %lfil cf> ~ ,§,§l{11 q'MT ~ ~ CfiT 'i1"1c61CJld fcptn TJ<lT I Wq l'l\i1IR'11i 31~ f)f"CH'Sfi

3l1~lfl'Ifc;J<1I, ~ ~~ffl<1l, 'R'<4>fc;J <1 1 ~ -q ~ ~lcl4>lC'l CfiT 'i1"1c61CJld ~ TJ<lT I ~ q'l~lfllfc;J<11 ~ ~fc;J<11{q,<q'i '11"C1"1'i # Cllq514dl tRTeTUT ~ CfiT 'i1"1c61Cf1d

~ TJ<lT I ~, ~, ~, lRX, 'i:f"IT, m ~ ~ cf> ~~I~tib ~ <tT c<lQ4>Ifc;JCfldl CJ?T Jt~i4>"1 "\rfRT xm TJ<lT I

~ ~/~ ~ ~ : lflC'lGI41 ~, ~ Cft'.lT ~ ~, ~, xg~lii~I'< Cft'.lT ~ /~ 1:ftm, ~m ~ ~ ~1tllf1lCfl ~ (JQIT 3RlT cf>

<gC1" 2004 mfQIT CfiT ~ CJ)ef ~ C'Im / 31~ f.1I1'f ffi1l1'I'R "4X ~ ~ 3m "4X ~ ~ TJ<lT I l'l\i11 R'1 <11 cf> 3m"4X 31'R1c1 B1l-~ ~ 4-24 11T6" ~ I fi$fc;J'll

311f¥<11~fi 11')tIT em tmTI C'Im ~c'<'il'SC'l 11')tIT ~ g"1fl~IG"1 fcRrr <mT 3lR ~ ~ -q ~ x)qr TJ<lT I ~ ~1fil>ffl;;)C'l

~ ~ 11')tIT em -wWr ~ fll'il ~4> 'J!Of ~ ~ !>\lclCflIC'l ~ f$m '1m I ~~cIR<1\ 4>~'11'1fi -q, ~ ~'1lg~~I"1 cf> ~ ~ ~ ~ ~ cf> ~-m "fReTUT CJ?T C'f~ ~ ~ TJ<lT I

Fc1~fil>~fi"1 ~ CJ?T ~«I'iIC'l ~ ~eTUT ~ ~ ~ ~ 3lR fflAjl'Sffl<11 ill~;;)"1fflfi -q ~ cf> \J'flR ~~3tR6I"!"G<tT~~3!l#~~sttl ~ CJ'>'I Ai 1Pifi -q mRl ~ "'i<1" "ffifr ~ ~ f.1cm;R -q "([C'1'

-cpr ~ cf> -mG" 40: <tT ~ st I ~~, CfJ1C'11~ffl<11 C:ficgc'icl C'Im t 4>1'STJ1\I'i'i # ~ ~ 3tR/<IT 3lJllTfclq;­

~ (31 1 '<C: 4lJ1, 311~C:fiC:f13lR <IT ~31T'<) 3ll"C:lTfur 31Ijqi~l4> ~ ~ ~ 1Rff "il'<1T t fclJ f%+f-~ ~ C'Im f.'\7.:Rur Lllm cfi ~ ~ 3l6"'i 3kR ~ :m- I CMf

.:>

66 ~ st ~ ~ ~ lfllflCfJ15C'1"1 (2), 'SI lrlf1 CJ'>1q) <1 1

~C'lcl~~<11 (4), ~, lflC'1'Iq)~1 (1 ), ~ x=q. (55) 3tR '~~lllC'lfi (4) wf1tc;r ~ ~ ~ 'ii, l4>dT3lT CfiT ~-~ cfi ~ #~<tT~2fi1

1%'1 qR'<a1 01 : <g<1" 460 ~ rt ~ ~, 31qRqCfCl

31eT, ~ ~ 3lR l:Rf'T CfiT ~ # ~ xm TJ<lT :m- I

~ crt cf> c:'RR ¢141\Jll"1~CfI -q <g<1" 9265 <tT ~ st I

C:C'l fClP!<1 1 'i1C'lIC:cffHfflfi, -C:-. ~, $f(1Cf1I,<ql ~, ~

~, ~, ~cplqe.'<I, ~. ~, ~, ~'IIC'l'I\i1I~4>I,<ql, ~, ~, ~~f1\lqfi ~ Cft'.lT ~ ~ cf> ~, 3lQRqCfCl

~ 3lR 3lQ~QCfCl 31aTI CJ?T filflC'ldlg:44> ~'iQ~'<e-rur ~ TJ<lT t I

~ f1p'l'f'<"fttfell

~ filj'I'<&~'1 ~ ~ ~ CJCP 3llUTfclcp ~ d4>"ilCJ'>1

~ C:f1t\~'iC:fi, C:C:lflC: C'l 4"1 ~ 3l1~C:fiC:f13ffi "¢T ~'«i'iIC'l ~ St::" ~ ~"c61" 33 ~ -q ~ ~ cf> ~ l>llclCfJ'IC'l Fc14>ffld ~ ~ I ~ ~ -q 3FTT\Jf (~, ~ ~), fi1cm1 (~~, \JqR, <n\Jffi), ~ ('i:f"IT, ~, ~,fc1c;r, ~), ffi (m, 1lC'<R), ~ (C1i'lCX, fli-El, ~), q;c;r 3lR ~ (cf>c;rr, 3Wf, ~ ~) 3lR ~ ~ (CfC'lVllfll~c'i, -;ffq, ~) ~ ~ I ~ 2008 CJCP ~ ~ # 2500 ~ ~ ~ CJ?T filj'lx&c

fRm TJ<lT :m- I 'i5cqg:ul ~ "GM ~, ~ 1'T, ~, jill ffl Cflf1 Cft'.lT C11TC"'<" ~ ~ ~ ~ cf> ~ 1 jci ~I 4>

3m#~~~tl~~~~ cr.m 3lljci~ICfI ~ ~ cf> ~ ~ ~ em

f1<.f ff q;~ CfiT 3lltIlX ~ ~ I

·s:Rrulf.1q) ~ ~ 1) ~ \JlR * ~ ~~ 31~r1 ~ ~lclq;'I'1 CfiT fctcpm fclRlT <p:[T t ~ if4(tcn ~ 3iR ~ \JlR ~ ~ ~ tRfRT 1)~, ~~CRi, ~¢I~CRi ~ 1) ~\SlJt;:Hl \JlR "it ~ >Jc.>t) ~CRi ~3TR CfiT ~ fclRlT <p:[T t I ~ ~ CfiT LRfT ~ * ~ 3W1 cfR 1R ~«9fil'1 ~ ~ u. IlleR ~ 31~ ~ I L ~, ~, ~3TR, -ctw.tT Cf\?IT <I~ * ~-~ fclm * ~ :q'lclCfi'I'1 "4iT

t1)-q5ffi ~ mfcp ~ ~ CfiT LRfT C'fllT<IT \JlT ~ I

~L~, 3l1~(!fi~'H3TR Cf\?IT 3l1'1~4"1~ ~ "4iT ~«9>JI'1 <Pm ~ 'flT¥ -fT, ~ ~ 3iR ~, fcrc;T, ~ it 3lljcj~ICfi fctfctmrr Fcl~<'lqol Cf\?lT ~ !>l1lj')1~~'1 m ~ ~ cill ~ Fcl~<'lqol ~ ~ it ~ 3lIjC1I~ICfi fcIfcmm CfiT ~ ~ Cf\?lT ~ Cfi'1R:C1f\ CfiT ~ fCl:j l l'1R\e

~ q ~ flic;fi t I

3T "-lI rnCflffi1l - ~ ~ ~, ~ '1i'1lgCfiI'1 ~ Cf\?IT

~ ~ ~ ~ W t'1~ CfiT >W<1 ~, fc1fiA CfiI44'>C1141 Cf\?lT G#r/~3lT CfiT ~ ~ Cf\?lT

~3fN ~tr"i 3iR ~ '1 ol<flffill'j ~ ~ <PT4 ~ ~~~a1T~*~~1R~~~ ~I

- j~«1IC1;q 3iR ~ ~ ~/~ ~ ~$1IP1Cfil, ~ figll'IR'llIl, dCfi~"I~ 3iR IHllfiPlCfi ~ ~

~ fili'l~lI'i. ~, fidj'1~'i. CfiI4~II'1I3lT Cf\?lT 1flu:r ~ it '}[T'T fWTT m fctrmT CfiT ~,~ m 3iR ~ C:-~ CfiT fctCfJ-rff m ~ I ~ ~ 1) '}[T'T

AA * ~ ~ ~$1IP1Cf)'i CfiT ~ ~ <p:[T \?IT I ~ ~CfiT~~~*~19it~'Tm tl

- ~ 'IOI>JI"'ll ~$1IP1l1lIHllfiCf)'i. of\ftr mTcn3lT, ~ ~uT~iA~~, ~ fCl)ll'{R1RlllP:i'III~IIC1lott '<'fic ~ 'C1lfigl\3fi, ~ ~ ~ R (m4

~) Cf\?IT ~MIC1;q it ~ ~ ~lI'jll~II'1I3IT 3iR

~, ~, ~, CfiC.Cf>, ~~'11<41~, ~, W, ~, ~ 3iR f3rw it ~ ~ CfiT GRr ~ I

- ~'1E1"14'hn3TR !:mT 1ll~ /<fil<fmc;rr /1JfiTarur /7f5'l ~ ~ 3l11llfGtd ~ ~:

- ~"fCSj"lqhJjl3TR, ~ ~ 1) 14 \if"fCRI-3 ~ 2009 Cf(f)

'~a1T 3iR ~a1T: ~, ~ 3iR ~" lR

fctcx ~I - \!"fCSj"Iq)~3fN, ~ ~ it 27-28 ~ 2009 Cf(f)

"~~ ~ 1) ~ WT-~" 1R ~ rrNI r of.:tr::n-uTT3lH, 4 ~ 1) 21 m 2009 "CfiT "ql'IC1I~l

~ 3lljci~ICfi ~"4iT~" ~ 1R ~ ~

1W"i ~I - ~"f,~l4"1\l113fN, ~ ~il4"lcBcll ·~ ~ 3iR fclm

R, ~, ~ (~ ~) 1) 23 ~ 2009 CfiT "q;;i4'11

'ld ~ ~ 3iR fcR+IT ~ ~ CfiT x:R!ffUT

3iR ~" ~ lR ~ ~ 1W"i ~ I

- ~"fCSj141\l113ffi, ~ ~ i:i 9-21 ~ 2009 cpT

"cfitr 3lljci~ICfi ~ * x:R!ffUT * ~ ~ fct¢T 3iR

~!ffUT ~" ~ 1R ~ 3id'1T~;q >!ftr!ffUT qld;qm>J I

- ~"f~t1lIJll3TR, ~ ~ it 10-19 ~ 2009 "CfiT "31ljcj~l4'> ~CfCfl~*~~~3iR~' ~ 1R ~ ~ QlcFlm>J I

- ~"fCSj14"1\.il)3fN, ~ ~ it 23-25 ~ 2009 cpT "m ~ ~ CfiT fctcpm Cf\?IT fil!:j\J1\1"l1" ~ 1R m Cfi14~II'11 I

- ~"fCSjlt1l\l113lR, ~ ~ 1) 17-18 ~ 2009 "CfiT

"-qm 3lljcj~ICfi ~ cfi ~ it ~ ~ fctcpm"

~lR~~1 ~"fCSjlq)\J?I3lR, ~ ~ it 19 ~ 2009"CfiT "~cfc;r

\J1"f"f~Cll cpr ~" ~ 1R ~ ~ I - ~"fCSj"It1l\.il)3lR, ~ R ~ it 23 ~ 2009 CfiT

"fcpcfr ~" ~ 1R ~ ~ ~ I

- 'lR1C1" ~ ail 1I1 l\iid : ~ ~ lI'l l ll Cl"1 Cfi ~ 3iR

~3fN~, ~ ~ it cfitr ];[\Jf"fq) /~ ~ $11 f.'lCfi'j

~ \J14~1\llj ~"CfiT ~ ~ * ~ ~lfMCfiI; ~ c;-rc;IT, ~ c;-rc;IT 3iR ~, <1t \JI'T, ~R:cBC1 3iR l1cf4'>T

* ~ ~ \J14~ 1 \i'{i f0rfiT "4iT ~ fclRlT <p:[T \?.IT I

~ ~ /~ ~ ~ ~ \J1+llC1I\llj '1iC1lbCfiI'1

~ ctr ~0CfiT CfiT 'lfi ~ FcP<:rr 'PTI m I ~3IT*t'1Pl*~~, ~C;'1lql~, ~ 3iR ~ \iffi ~ ~ it~ ~1R ~ ~ CfiT 'lfi ~ fcl>m 'Tm I

• ~: (!'1CSj"14"1\l1"I3TR ~. ~ Cf\?lT ~ ~\Jl~ e'1

cpT 1;JcpnFl [¢<H "PH Cf2-TT \J"'1'f cfTvft31H

~ ~ ~ ~ 1) fctdf«r fclRlT <mT I ~

31C1TC1T, ~ 3iR 3id'1T~;q ~3IT 1) fctfiA" ~ lR

~ cr:IT (84); fctfiA" ~ ~ / f.'l;qlilC1(>j"I/

~ -wlta1T/ fu!ffUT ~ filfiR!111 (10); ~ ~ \J1~~I\llj ~ (4); ~ ~ (7); ~ ~ ~ ~ (1)"d1m ~"f4)t1l~3lR* ~$1If.'lcN &RT~/~ 1) C11Cfifil;q dCfi<fl~ ~/C1Cfi~l~ ~ cpr ~

fclRlT 'Tm (~~ 19 it ~ 'Tm t) I • 1Jl4 ~ I \iii Cf>T q \l11 if) '1 ° I : lTTtT \J14 ~ 1 \T>J ri-cj ;-5\.il)btCfi='1TlTO I

~ ~ ~ B 29 ~ ~ ~ ~ 131 >ffiffCIT "CfiT 3lj~lRd fclRlT <mT I

~ 31jCfTG : m 3T"q{Of 'C1"TC1"

5

\ EXECUTIVE SUMMARY

National Bureau of Plant Genetic Resources (NBPGR) continued its role of leadership for the management of plant genetic resources in the country. Several significant achievements were made during the year 2009-10 in plant exploration and collection of germplasm; germplasm introduction, plant quarantine inspection, treatment and release of germplasm; characterization, evaluation, identification of promising accessions and maintenance; ex situ conservation of accessions in National Genebank and DNA Fingerprinting of crop cultivars and are summarized hereunder.

PLANT EXPLORATION AND COLLECTION OF GERMPLASM

A total of 43 explorations were undertaken across the country and 2,648 accessions of various agri-horticultural crops, wild relatives of crops and other economic plants were collected. Of these, 389 accessions were collected by NBPGR Headquarters, New Delhi through nine explorations from parts of Andhra Pradesh, Arunachal Pradesh, Goa, Karnataka, Madhya Pradesh, Maharashtra, Rajasthan and Uttar Pradesh. A total of 304 herbarium specimens, 57 seed samples and 25 economic products were processed and added to National Herbarium of Cultivated Plants (NHCP).

Wild relatives of crop plants collected: Major emphasis was given for collection of wild species including wild relatives of crops. Forty-five accessions of wild species were collected from parts of Alwar, Bhilwara, Bundi, Chittorgarh, Nagour, Pali, Pratapgarh, Sawaimadhopur, Sirohi and Udaipur districts in Rajasthan. Thirty-five accessions of cucurbitaceous vegetables were collected from parts of Jhansi, Lalitpur, Mathura districts in Uttar Pradesh; Chhatarpur, Gwalior, Morena, Shivpuri, Tikamgarh districts in Madhya Pradesh and Alwar, Bharatpur, Dho1pur districts in Rajasthan. Thirty­six accessiom of cucurbitaceous were collected from parts of Barabanki, Bahraich, Basti, Bareilly, Ghaziabad, Hardoi, Lakhimpur, Lucknow, Moradabad, Pilibhit, and S.K. Nagar districts in Uttar Pradesh.

Collection of M&AP and other economic plants: A total of 72 accessions comprising medicinal and aromatic plants (30), oilseeds (1), fruits (15), fibre (5), ornamentals (1) and agro-forestry species (21) were collected from parts of Karvel'1 Kolhapur, Ratnagiri and Sindhudurg

6

districts in Maharashtra. The accessions of medicinal and aromatic plants include rare, endangered, threatened and endemic species of Western Ghats. A total of 45 accessions comprising of Ocimum americanum (5), O. gratissimum (1), O. sanctum (37), Marjorana hortensis (1) and Asparagus racemosus (1) were collected from parts of Aligarh, Badaun, Bulandshahar, Bareilly, Bijnor, Farrukhabad, Hathras, Mahamayanagar, Mathura, Meerut, Muzaffarnagar, Saharanpur, Shahjahanpur districts in Uttar Pradesh and Haridwar and Udham Singh Nagar in Uttarakhand. Two explorations were undertaken for collection of niger, M&AP and other wild economic plants from different parts of Odisha.

Crop specific explorations: Two crop-specific explorations were undertaken and 116 accessions including landraces and primitive cultivars comprising cereals (69), pulses/grain legumes (11), oil seeds (07), M&AP (27) and wild relatives (02) were collected from remote areas of Uttarakhand hills under National Exploration Programme. One joint exploration mission with CRR!, Cuttack was executed for the collection of halophytes and a total of eight accessions comprising saline tolerant cultivated rice were collected from coastal areas and ~hitarakanika sanctuary in Odisha. One crop­specific exploration was undertaken and 110 accessions including landraces and primitive cultivars of rice germplasm were collected from remote areas of Champhai and Lunglei Districts of Mizoram.

EXCHANGE OF GERM PLASM

Introduction of germplasm: During the period under report 36,076 accessions (76,381 samples) were imported from 46 countries, which included 30,589 germplasm accessions (32,317 samples) as well as trial material 5,487 entries (44,064 samples) of different agricultural and horticultural crops. Requirements for germplasm from abroad were met by arranging material from different Indian sources and 1320 samples of different crops were exported to six countries.

Promising trait specific germplasm introduced:

Hordeum vulgare: High yielding for both grain and biomass, good grain quality for malting, resistant to the spot form of net blotch, surface borne smuts and spot

_______ A"OO..JALREPORT2009-10

blotch (EC657889) from Canada; Six rowed, hulled, smooth-awned, spring feed barley, lodging resistance, higher plump seed percentage, good resistance to covered smut and false loose smut (EC657888) from

Canada

Oryza sativa: High yielding lines (EC637732-35) from USA; Improved resistance to sheath blight , bacterial panicle blight, and narrow brown leaf spot (EC659913-14) from USA; Submergence tolerant variety (EC637984) from philippines; Blast resistant lines (EC638154 -161, 166-178) from Philippines, (EC639758 -797,820-822) from Kenya; (EC657109 -118) from France; Tungro tolerant lines (EC638162-165) from Philippines; Drought tolerant variety (EC659921) from Vietnam; Drought tolerant lines (EC639584-757, 798-819,823-826) from Kenya

Triticum aestivum: Alien Disomic addition line with resistance to fusarium head blight (EC638278) from USA; Winter wheat, white grained, excellent bread baking quality, good pre-harvest sprouting tolerance (EC638314) from USA; Good disease resistance and excellent yield potential (EC638315) from USA; Var. NEOl6432, superior grain yield performance, winter hardy, resistant to fusarium head blight, stem rust, moderately resistant to leaf rust, stripe result and Hessian fly (EC641860) from USA; Winter type (EC665054) from UK; Hard red winter wheat, excellent grain yield potential, resistance to leaf rust, conferred mainly by the Lr47 gene, and good bread making quality (EC664600) from Argentina

Zea mays: Lower levels of aflatoxin, good agronomic traits and resistance to important diseases in the lowlands, including southern com leaf blight, southern corn rust and ear rot (EC659915-17) from Nigeria.

Glycine max: Excellent yield potential. Resistant to soybean mosaic virus, stem canker, bacterial pustule and frog eye leaf spot (EC638228) from USA; resistant to Soybean mosaic virus and peanut root knot nematode, frog eye leaf spot and bacterial pustule (EC638229) from USA; Small seeded, 100 seed weight is 7.3g, resistant fo shattering, Soybean mosaic virus, frog eye leaf spot and bacterial pustule (EC644409) from USA, variety N 8001 has purple flowers, gray pubescence, tan pod wall color at maturity, and shiny yellow seeds with imperfect black hila. Resistant to Soybean mosaic virus and stem canker (EC64441O) from USA; high yield potential and broad resistance to

E (UI1VESUMMARY __________ -

soybean cyst nematode, southern root knot nematode and reniform nematode (EC656640) from USA; high yield potential, broad resistance to soybean cyst nematode southern root knot nematode and sudden death syndrome (EC656641) from USA; high yield potential, higher seed protein and resistance to root knot nematode (EC656642) from USA; high yield potential and disease resistant type (EC656643) from USA

Lens culinaris: Early maturing lines (EC666214-952, 5016-5052) from Syria

Capsicum spp: Male sterile lines of C. annuum (EC63734 1-42) from Taiwan; Restorer lines of C. annum (EC656670 - 687) from Taiwan; Restorer lines of C. Jrutescens (EC656691) from Taiwan

Lycopersicon esculentum: Lines resistant to bacterial wilt and Tomato mosaic virus (EC637360-65) from Taiwan; early maturing lines (EC664585-88) from Canada; cold resistant lines (EC664589-599) from Canada; tomato line with high beta carotene content (EC659266-71) from Taiwan; tomato lines resistant to Tomato mosaic virus and fusarium wilt (EC657640) from Taiwan; heat tolerant tomato (EC654694-99) from Taiwan and lines resistant to bacterial wilt, fusarium wilt and Tomato mosaic virus (EC654678-86) from Taiwan

Gossypium spp.: Restorers and maintainer lines of G hirsutum (EC657081- 105) from Israel; restorer lines of G barbadense (EC653 106-108) from Israel

Export of Germplasm: The seed and plant material of agricultural and horticultural crops were exported on the basis of (i) requests received by the bureau/ IARI headquarters (ii) requests received from the scientists working in IARI institutes/agricultural universities in India under various protocols/ work plan! memoranda of understanding with different countries/ CGIAR institutions. The plant material intended for export were procured from known Indian sources through correspondence and the same were forwarded to the indentors in foreign countries alongwith phytosanitary certificates issued by the Plant Quarantine Division of the Bureau and import permit, if any after approval from ICARIDARE as per the guidelines. The material of 1320 accessions was exported to 13 countries

National Supply: A total of 13,391 samples of different crops were supplied to national users for utilization in various crop improvement programmes in the country

7

based on requests received from research workers under Material Transfer Agreement (MTA).

QUARANTINE OF GERM PLASM

At New Delhi, a total of 36,076 accessions (76,381 samples) of imported germplasm accessions as well as trial material entries of various crops were processed of which 4,891 were found infested. These samples included true seeds, rooted plants, cuttings, rhizomes, suckers, bulbs, nuts and tissue culture plantlets. The infested samples comprised insects (175), nematodes (1,869), fungi/ bacteria (2,645), viruses (27), weeds (175) and several exotic pests. Of the 4,743 infested/ infected/ contaminated samples, 4,807 were salvaged through fumigation, hot water treatment (HWT), X-ray radiography, pesticidal dip, mechanical cleaning and growing-on test. Eighty four samples were rejected including thirteen samples of Pavaver somniferum from

. Germany infected with Dendryphion penicillatwn and one sample of Glycine max from USA infected with downy mildew fungus (Peronospora manshurica), the pests not yet reported from India. The remaining infested samples were salvaged through physico-chemical methods. A total of 1,405 samples were processed for export of which 97 infested/ infected samples were salvaged and 17 Phytosanitary Certificates were issued. Five hundred and sixty six samples were received from Germplasm Conservation Division for seed health testing of which 265 samples were subjected to X ray radiography and 122 samples were salvaged. Six samples were rejected as they could not be salvaged.

At Hyderabad, a total number of 61,495 samples (l7,436-imports & 44,059-exports) were received for quarantine processing during the period under report. All the import samples were subjected to various seed health tests like visual examination, blotter test, X-ray radiography, Enzyme Linked Immunosorbent Assay (ELISA), centrifugation and microscopic examination and several pests of quarantine significance were intercepted. A total of 2147 imported samples were found infested/ infected with pathogens (1988), insects (70) and nematodes (89). A total of 2,144 samples were salvaged and 3 samples were rejected. In all, 172 phytosanitary certificates were issued during the reporting period.

GERMPLASM CHARACTERIZATION, EVALUATION AND MULTIPLICATION

A total of 6288 accessions of various agri-horticultural

8

crops comprising cereals (3038), pulses (1306), oil seeds (689), vegetables (637), underutilized crops (508), medicinal and aromatic plants (110) were grown for characterization and evaluation. In addition, 2935 accessions of international nurseries comprising of wheat, barley, triticale and exotic wheat accessions were also grown in Post Entry Quarantine Nursery (PEQN). A total of 1479 germplasm of the oilseeds, tree born oilseed and nuts namely, Cruciferae spp. (633), sunflower (194), niger (358), linseed (180) walnut (20), jatropha (40), kokkum (37) and malabar tamarind (17) was analysed for oil content and quality parameters. In phytochemical evaluation, 392 samples of medicinal and aromatic plants were analyzed and evaluated for their active compounds. The details of germplasm characterized and evaluated at the various regional stations are as follows:

Akola: A total of 2,997 accessions were raised during Rabi 2008-09 and 5,697 accessions were raised during Kharif 2009. A total of 1,580 accessions of germplasm were characterized during 2009, 1,048 accessions during Rabi and 532 accessions during Kharif. A total of 512 accessions of germplasm comprising 176 accessions of grain amaranth, 175 accessions of chick pea, 57 accessions of two species of Abelmoschus, 53 accessions in four species of Lathyrus and 51 accessions in three species of Linum germplasm were multiplied and sent for conservation in the NGB.

Bhowali: A total of 207 accessions were received for regeneration, characterization and maintenance. Some of the elite seed samples and live rooted plant material viz. M & AP and WEUPS (Wild Economically Useful Plant Species): Aloe barbadens-110 nos. , Curcuma zedoaria-50 Kg, Cymbopogon flexuosus-267 nos., Rose- Geranium (23196 nos. + 10000 stem cuttings), Lavender (11816 nos. + 10000 stem cuttings), Rosa damescena (552 nos.), Rosmarinus officinalis-31757 nos. and 15100 stem cuttings, Stevia rebaudiana - 176 nos., Bamboo- 96 log; Horticultural Plants: Kiwi (2226 nos.), Kagzi nimbu (227 nos.); Agricultural Crops: Wheat (HB-208)- 13 kg were supplied to different farmers / indentors.

Cuttack: A total of 2167 accessions comprising cultivated rice (2088), green gram (38), black gram (41) were characterized for various agro-morphologica1 traits. The accessions viz. IRGC35045, 22499, 26772 in rice, IC565287, 565226, 565255, 569058 in green gram and IC565229, 565220, 568908, 565276 in black gram were performed better than the best checks among the

A~l ALREPORT2009-IO

re pective crops. In addition, a set of 145 accs. of small and medium grained scented rice and 27 accs. of flood tolerant rice germplasm collected were grown during Kharif2009 for evaluation in collaboration with CRRI,

Cuttack

Hyderabad: A total of 629 accessions of different agri­horticultural crops consisting of sorghum (64), linseed (88). sesame (89), brinjal (62), chillies (201), dolichos bean (77) and tomato (57) were grown for characterization/evaluation/multiplication during Rabi 2009-10. A total of 718 accessions of germplasm of black gram (50), Italian millet (164), amaranths (70), bottle gourd (20), brinjal (175), chillies (92), field bean (76), omon (22), tomato (49) and wild edible legumes (49) were sown in the field along with appropriate checks for characterization/ evaluation/ multiplication.

Jodhpur: Observations were recorded on morpho­agronomic traits of 125 and 1971 accessions of different crops raised during Summer and Kharif 2009, respectively. Genetic stocks with unique traits like determinate habit with early maturity and branched all node bearing guar; bold seeded and early maturity with high yield accessions of mungbean and fodder type pearl mil1et and moth bean accessions were characterized evahmted during Kharif 2009.

Ranchi: A total of 362 accessions of kulthi and 38 of Mucuna germplasm were characterised for qualitative and quantitative traits.

Shillong: The germplasm accessions collected from NEB Region were grown at Shillong for characterization, regeneration and multiplication during the report. Field crop<;- maize, paddy (low land & upland), horticultural crops- chilli. turmeric, ginger, colocasia, dioscorea and fruit crops, oil seed crops- mustard, perilla and UU & UEP crops- buck wheat, coix, rice bean

Shimla: A total of 2070 accessions of kidney bean (747), pea (146), cowpea (227), amaranth (427), buckwheat (121), chenopod (25), adzuki bean (25), rice bean (50), garlic (243) and fruit crops (59) were characterized and evaluated for various qualitative and quantitative characters.

Srinagar: The 605 accessions of wheat (330), barley (164) and mustard (111) were characterized and evaluated for their morphological characters during rab; 200X-09 and the 576 accessions of wheat (303). barley

f('l TIVESUMMARY __________ _

(145) and sarson (128) were sown in Rabi 2009-10 for characterization and evaluation.

Thrissur: During Rabi 2008-09, 111 accessions of rice (Oryza sativa) and 116 of horsegram (Macrotyloma unifLorum) were evaluated. In summer 2009, 22 accessions of kokum (Garcinia indica) were characterised/ evaluated. During Kharif 2009, 80 accessions of rice. 35 of brinjal (Solanum melongena) and 34 of Malabar tamarind (Garcinia cambogia) were characterised! evaluated.

GERMPLASM CONSERVATION

Conservation in Seed Genebank: A total of 10,804 accessions of various crops were received for long-term conservatien in the National Genebank. These were processed following the genebank standards adding another 8,284 accessions to the base collections raising the total germplasmholding to 3, 75,702. A total of 1,977 accessions were received at the Germplasm Handling Unit (GHU) and 1,082 were stored in the medium-term storage module as reference samples. In addition, 10,052 accessions of paddy were repatriated from International Rice Research Institute (IRRI). Monitoring of stored germplasm (2,416 accessions) and supply (26,877) for evaluation/regeneration/research/restoration of active collections were the other pliority activities. Dormancy breaking methods were standardized for Leucaena leucocephala, Stylosanthes hamata and Dodaenia viscosa. Germination protocols were standardized in five species viz. Sap indus aurifolia, Samadera indica, Sterculia urens, Diospyros melanoxylol1 and Bambusa arundinacea. Viability testing method was standardized in Cassia angustifolia and Baliospermum montanulll. Assessment of longevity of ultra-dry seeds of castor, groundnut, sesame, pigeonpea, chickpea, cotton and Jatropha were continued.

In vitro/ Tissue Culture Conservation: A total of 2004 accessions belonging to fruit crops, bulb and tuber crops, medicinal, aromatic and rare/endangered plants, spices, plantation and industrial crops, and others were conserved as in vitro cultures under culture room conditions and/or at low temperature. The average subculture duration ranged from 4-24 months, depending on the species. In Curculigo orchioides, plantlets were regenerated from leaf and internodal explants and these were also established in pots. In Zingiber officinale, protocol was refined for induction of somatic embryos using leaf explants. In Elettaria cardamo1l1um, cost-

9

effective conservation of in vitro cultures was achieved follow'ing media manipulation. Cryopreservation experiments using vitrification technique, led to varying degree of pre-and post-freezing success in Allium sativum and Simmondsia chinensis. In Pyrus communis, shoot tips from cold-acclimated mother cultures, exhibited 40% regrowth following LN freezing. Genetic stability studies employing biochemical andlor molecular markers (RAPD, ISSR or SSR) in Bacopa monnieri, Colocasia esculenta and E. cardamomum revealed that there were no significant differences between in vitro-conserved accessions and the control plants. A total of 66 accessions comprising Coleus forskohlii (2), Dioscorea deltoidea (4), D. floribunda (1), Musa sp. (55) and Gladiolus (4) were supplied as in vitro cultures to various indentors.

Cryopreservation: A total of 460 accessions comprising seeds, embryonic axes, dormant buds and pollen were cryostored during the year totaling 9265 accessions in the cryogenebank. Successful cryopreservation was achieved in seeds, embryos and embryonic axes of Alpinia malaccensis, A. mutica, Callicarpa vestita, Citrus jhambiri, C. limetta, C. macroptera, C. medica" C. megaloxycarpa, C. reshni, Mimusops elengi and Piper nigrum.

DNA FINGERPRINTING

NRC on DNA Fingerprinting has so far developed protocols for cultivar identifications in 33 crops of national importance using the molecular marker techniques like STMS, AFLP and ISSR. The crops include cereals (rice, wheat, barley), millets (finger millet, sorghum, pearl millet), pulses (chickpea, French bean, horsegram, lentil, peas, pigeon pea, mungbean, ricebean, urdbean, soybean), oil seeds (mustard, safflower, sesame, niger), fibres (cotton,jute), vegetables (tomato, chillies, cucurbits) fruits and nuts (banana, mango, cashew, citrus) and medicinal plants (chlorophytum, neem, vetiver). More than 2500 varieties in different crops were fingerprinted till December 2008. The analysis of diversity in molecular markers of important crops like rice, mungbean, oilseed brassicas and tomato have provided insight into the genetic base of Indian crop varieties. Such information will form the basis for developing efficient strategies for their breeding and genetic resources management.

PCR-based detection protocols have been developed for the several genes in transgenic planting materials some using multiplex PCR for simultaneous detection of

promoter, terminator and marker gene along with endogenous genes in duplex, triplex, tetraplex formats in genetically modified crops. Developed protocol for simultaneous amplification of six commonly used marker genes, viz., nptlI, aadA, hpt, bar, pat and uidA for detection of GM crops.

Genetic diversity analyses and DNA profiling was conducted in mungbean, frngermillet, pearl millet, sesame, water melon using STMS, ISSR and RAPD markers. The analyses helped in the estimation of available genetic diversity in the collections and also in generating DNA fingerprints of these indigenous cultivars.

OTHER ACTIVITIES

• Meetings of the Institute Management Committee, Research Advisory Committee and Institute Research Council were held timely to review the progress of work related to PGR management and planning strategies for strengthening various activities and infrastructure / facilities to achieve the targets.

• The scientists, research associates, technical and administrative staff from the headquarters and its regional stations/ centres participated in a number of seminars, symposia, conferences, workshops, trainings and summer institutes to exchange ideas and upgrade their skills. Five scientists were sent abroad to participate in foreign meetings. Details of these participations are given in chapter 19 on General Information.

• Several distinguished scientists, administrators, policy makers, farmers and students visited the National genebank, DNA Fingerprinting labs, plant quarantine glasshouses, National Containment fadlity (C4Ievel) and tissue culture labs at the headquarters and field genebanks at Issapur, Akola, Bhowali, Cuttack, Hyderabad, Jodhpur, Ranchi, Shillong, Shimla and Thrissur.

• Symposia/ Workshops/ Trainings/ Brainstorming sessions Organized by NBPGR:

• Winter school on "Biosecurity and Biosafety: Policies, Procedures and Issues" from 14 January- 3 February 2009 at NBPGR, New Delhi

• National Symposium on "Plant Pathology in the Changing Global Scenario" from 27 -28 February 2009 at NBPGR, New Delhi

10 ------------- -- -- - --- ANNUAL REPORT 2009· 10

•

•

•

•

•

•

•

One-Day Brainstorming on "Management of Horticultural Crop Genetic Resources" on 21 April 2009 at NBPGR, New Delhi

Onc day brainstorming on "On Farm Conservation and Promotion of cultivation of rraditional Mountain Crops and varieties" on 23 May 2009 at NBPGR, RlS Shimla at CSK­HPKV Hill Agriculture and Extension Centre, Bajura, KuBu (HP)

An International training course on "In Vitro and C'ryopreservation Techniques for Conservation of Plant Genetic Resources" from 9-21 November 2009 at NBPGR, New Delhi

Short-term course on "Current Regulations and Policies for Access to Genetic Resources" from 10-19 November 2009 at NBPGR, New Delhi

SAARC Workshop on "Development and Harmonization of SAARC Quarantine Network" from 23-25 November 2009 at NBPGR, New Delhi

National Symposium on "Recent Global developments in the Management of Plant Genetic Resources" from 17-18 December 2009 at NBPGR, New Delhi

Group Meeting on "Quarantine of Oil Palm" on 19 December 2009 at NBPGR, New Delhi

• One day training programme on "Kiwi

production" on 23 December 2009 at NBPGR, RJS Bhowali

• Field days organized: At Issapur Experimental Farm and !ARl, New Delhi, five Germplasm field days for Brassica; Rabi pulses, Kharif pulses and okra, wheat, barley, triticale and maize were organized to promote germplasm utilization by the plant breeders/user scientists. The meetings of Germplasm Advisory Committee constituted for different crops/crop groups were also organized. Field days on various crops were also conducted at Regional Stations, Akola, Hyderabad, Jodhpur and Thrissur for the benefit of breeders.

• Publications: NBPGR Annual Report and quarterly Newsletter were published and distributed to all concerned with PGR management. Besides, research papers (84) on various subjects were published in national and international journals; book chapters/ review articles (62) in various edited books/ manuals/ annual review/ teaching aids (10); plant gerrnplasm reporter (4); crop catalogues (7); souvenir and abstracts book (1) and popular technical articles/ technical bulletins in Hindi/ English (41) were published by the scientists of the NBPGR (details are given in chapter 19).

• Germplasm Registered: A total of 131 proposals belonging to 29 crops were approved for registration in the Plant Gerrnplasm Registration Committee meeting.

EXI 1. TlVESUMMARY _____________ _ 11

\ INTRODUCTION

The National Bureau of Plant Genetic Resources, commonly known as NBPGR was established by the Indian Council of Agricultural Research (lCAR) in 1976 with its main campus at New Delhi. Being the nodal organization in India it has been given the national mandate to plan, conduct, promote and coordinate all activities concerning plant exploration and collection and also for safe conservation and distribution of both indigenous and introduced genetic variability in crop plants and their wild relatives. The Bureau is also vested with the authority to issue Import Permit and Phytosanitary Certificate and conduct quarantine checks on all seed materials and plant propagules (including transgenic material) introduced from abroad or exported for research purposes.

Besides having a 40 ha experimental farm at Issapur village (about 45 km west of Delhi), the Bureau also has a network of 10 regional stationslbase centres that provide access to representative agro-ecological situations in the country. It has strong linkages with leading crop-based Institutes, National Research Centers, All India Coordinated Crop Improvement Projects, State Agricultural Universities and other stakeholders. NBPGR also works in close collaboration with several international institutes/organizations through memoranda/workplans developed under bilateral/ multilateral agreements. The Bureau not only provides genetic resources to on-going crop improvement programmes to sustain continued advances in agricultural productivity and stabilize production, but also conserves them safely to meet needs of future generations.

Organizational set-up

The Director, NBPGR is overall in-charge of administration, research management and coordination. The Institute Management Committee, Research Advisory Committee, Crop Advisory Committees and the Institute Research Council play important roles. The Bureau functions through its four main Divisions, namely i) Plant Exp] orati on and Germplasm Collection, ii) Plant Quarantine, iii) Germplasm Evaluation, and iv) Germplasm Conservation. The Bureau has units of Germplasm Exchange, Tissue Culture and Cryopreservation (TC&CP), PGR and Policy Planning (PPU). A principal scientist/senior scientist heads each DivisionlUnit.

Other centralized services include units of Administration and Management, Purchase, Stores, Maintenance, Audit and Accounts, Security and Library. Regional Stations/ Base Centres, headed by a principal scientist/senior scientist, are located at Akola, Shirnla, Bhowali, Shillong, Jodhpur, Hyderabad, Thrissur, Srinagar, Ranchi and Cuttack. It also houses NRC on DNA Fingerprinting, and an All India Coordinated Network Research Project on Under-utilized Plants. The total sanctioned staff strength is 504 comprising 128 scientific, 127 technical, 78 administrative and 171 supporting staff.

National Genebank

The Indian National Genebank was established by the council at NBPGR to conserve national heritage of germplasm collections in the form of seeds, vegetative

MANDATE

To act as the nodal institute at national level for acquisition and management of indigenous and exotic plant genetiC resources (PGR) for agriculture, and to carry out related research and human resource development for sustainable growth of agriculture.

•

• •

• •

12

OBJECTIVES

To plan, organize, conduct and coordinate exploration and collection of indigenous and exotic plant genetic resources.

To undertake introduction, exchange and quarantine of plant genetiC resources.

To characterize, evaluate, document and conserve crop genetic resources and promote their use in collaboration with other national organizations.

To develop information network on plant genetiC resources.

To conduct research, undertake teaching and training, develop guidelines and create public awareness on plant genetic resources.

-~ - -- ------AN\fPALREPORT 2009 lO

I/) Q) (.) r: Q)

'(3 (J)

c.. E o .... o r: ,2 I/)

:~ c

) J(TIO~

..c ~ (I] Q) (/J '(3 Q) c a:: :J 2 0 2 u ~ c

Q) u Q) (.) c ro > Q)

~

c o til

.;;: til "0 Q)

<C:'§ E .­til E ro E

- 0 EU .... Q)

c.9

c ,g ~ ~c (/) Q)

U co Q) § (/J .- ro g'co

0:::

Cfl ..><: 0. .... 0 o .... ~u Q)=:> z=:>

-=:Ic 20 ro ... C (.) .- Q) -=:I.~ .... 0 o .... 00.. U_c roe 'Oro C Q)

- Cfl =Q) <CO:::

Cfl (1) (.)

.~

(1) (/)

~

.... (1) OJ C

u:::

c Q)

E ..c .~ :0 (I]

iii w

c Oc

:;::;, 0

"'oL-U - al ~'6 wu c-g $", a..

"0 CtIl (I]+-'

C Q):J (.)0 C(.) (1](.)

.~ « LL

C =:>

0.. U ~

U I-

"0(1) C til III III

05-5 Q) .... .... :J .80.. (/)

0::: 0..

E6 r.n~ roro a.C: EQ) .._Cfl al C (90

U

(/)

~ «

C .QIo­+-':J 190. (/)111

.en Cl,$ x

UJ

13

() It'\)

~o o b

o

14 ___ _

• • NEW DELHI

AKOLA

• HYDERABAD

• RANCHI

HEADQUARTERS

• REGIONAL STATIONS

• BASE CENTRES

QUARANTINE STATION

• EXPERIMENTAL FARM

l ALREPORT 2009 10

pr( pagules, tissue/cell cultures, embryos, gametes etc. Based on experiences gained from working with a built-in cold storage vault obtained from UK in 1983, four modules (two units of 100 m3 and two of 176 m3

capacity) were installed for long-term storage of seeds of orthodox species kept in laminated aluminium foils at -20°C after drying them to 5-7% moisture content. Stand-by diesel generator backs up the electricity ~upply. Vegetatively propagated clonal materials and recalcitrant seeds species are being maintained under field conditions backed up by tissue culture repositories. The Bureau has a strong programme on in vitro conservation and cryopreservation.

The National Genebank facility commissioned in 1997 ha.., 13 modules, each with a storage capacity of 50,000 to 76,000 samples depending upon the size of seeds. One of these modules is used for medium term storage of active germplasm collections and the rest for base collections for long-term storage. Its cryopreservation facility contains six liquid nitrogen tanks (cryo-tanks), each containing 1000 litres of liquid nitrogen. These six cryo-tanks have a total capacity to store 0.25 million samples. Thus the National Genebank has a total capacity to store 0.85 to 1.25 million samples. This is one of the most modern Genebanks in the world.

Indian National Plant Genetic Resources System (INPGRS)

NBPGR is gradually developing and strengthering the national plant genetic resources system by linking up the National Base Collection (kept under long-term 'itorage at NBPGR) with 57 National Active Germplasm Sites responsible for different crops where germplasm collections are evaluated and multiplied under field conditions, backed by medium-term storage facilities. The Research Advisory Committee and Germplasm Advisory Comrnittes for different crops advise the Bureau regarding improving the capability, efficiency and effectiveness of its services.

International Collaboration

NBPGR implements workplans developed under MoU between ICAR and IPGRI (now called as Bioversity International). FAO and IPGRI also sponsor regional training courses on conservation and utilization of genetic resources of local crops of agricultural

J r Jot 110N

importance in South Asia and adjoining regions to be conducted by NBPGR.

Besides working closely with IPGRI, NBPGR also collaborates actively with the International Agricultural Research Centers (IARCs) like ICRISAT, IRRI, ICARDA and CIMMYT. It exchanges plant germplasm with more than 80 countries and implements work plans developed under bilateral, regional and international agreements.

Training programmes and information services

The Bureau organizes advanced training programmes focusing on scientific procedures for collection, exchange, quarantine, biosafety, DNA Fingerprinting, evaluation, documentation and conservation linked to use of plant genetic resources. Major accomplishments of its staff are published in Annual Reports. NBPGR Newsletter is brought out quarterly. Crop Catalogues based on computerized data are also developed and published. Bureau's library at Headquarters specializes in information dealing with plant genetic resources and also subscribes to foreign and national journals.

Post-graduate teaching programme

Since academic session 1997, Bureau is undertaking teaching in plant genetic resources leading to M.Sc. degree linked with Post Graduate School, IAR!, New Delhi. From the academic session 2004-2005, a Ph.D. degree programme in plant genetic resources has also started in collaboration with the Post Graduate School, IARI, New Delhi.

Extension services for PGR awareness

Bureau organizes kisan diwas/field days for rabi and kharif crops and distributes seeds/planting material alongwith relevant literature on technical know-how for raising crops and management ofPGR. Special emphasis is given to create PGR awareness among grass root level workers, tribal people, and farmers (particularly women) by organizing biodiversity fairs in villages. Students on educational tours from State Agricultural Universities are invited to visit the National Genebank, DNA Fingerprinting, tissue culture and quarantine labs, plant quarantine glass .houses/ containment facilities at New Delhi.

15

1. DIVISION OF PLANT EXPLORATION AND GERMPLASM COLLECTION

Summary: A total of 43 explorations were undertaken across the country and 2,648 accessions of various agri-horticultural crops, wild relatives of crops and other economic plants were collected. Of these, 389 accessions were collected by NBPGR Headquarters, New Delhi through nine explorations from parts of Andhra Pradesh, Arunachal Pradesh, Goa, Kamataka, Madhya Pradesh, Maharashtra, Rajasthan and Uttar Pradesh. A total of 304 herbarium specimens. 57 seed samples and 25 economic products were processed and added to National Herbarium of Cultivated Plants (NHCP).

1.1 Plant Exploration and Germplasm Collection

A total of 43 explorations were undertaken and 2,648 accessions of different agri-horticultural crops comprising 1,412 accessions of cultivated and 1,236 of wild species

including wild relatives of crop plants were collected from parts of Andhra Pradesh, Arunachal Pradesh, Bihar, Chhattisgarh, Goa, Gujarat, Himachal Pradesh, Jammu & Kashmir, Jharkhand, Karnataka, Kerala, Lakshadweep, Maharashtra, Punjab, Rajasthan, Uttarakhand and Uttar Pradesh (Tables I and 2).

Table 1: Explorations undertaken and germ plasm collected

Region Explorations Accessions undertaken collected

Jodhpur (Arid region) 2 64 Thrissur (South west coastal region) 5 251 Cuttack (Humid/ moist tropical east coastal region) 2 79 Shillong (North east hill region) 1 110 Bhowali (Central Himalayan region) 2 116 Shimla (Northwest Himalayas and high altitude region) 3 338 Srinagar (Northwest Himalayas and high altitude region) 1 70 New Delhi (North west plains) 9 389 Ranchi (Sub-tropical humid region) 4 322 Akola (Central Indian region) 2 141 Hyderabad (South east coastal region) 12 768

Total 43 2,648

Table 2: Details of crop diversity collected

Crop group (s) Crop(s) Acc.

Cereals Barley (25), maize (11), paddy (148), rye (2) and wheat (26) 212

Pseudocereals Amaranthus spp. (48), chenopods (21) and Fagopyrum spp. (24) 93

Millets and Finger millet (8), foxtail millet (11), proso millet (2), Setaria viridis (1) and 23 minor millets sorghum (1)

Pulses Adzuki bean (1), Aty/osia scarabaeoides (2) , black gram (3), Gajanus /ineatus (20), cowpea 288 (88), french bean (52), green gram (4), horse gram (1), lima bean (1), moth bean (4), pigeon pea (4), rice bean (1), Vigna da/zelliana (37), V hainiana (4), V khanda/ensis (1), V marina (3), V mungo var. si/vestris (4), V pi/osa (2), V radiata var. sub/obata (27), V sesquipeda/is (2), V stipu/acea (5), V trilobata (7), V trinervia var. bourneae (14) and V vexillata (1)

Oilseeds Brassica nigra (11), Ga/ophyllum inophyllum (2), castor (7), Lepidium sativum (5), linseed 232 (1), mustard (64), niger (37), Pongamia pinnata (94), safflower (1), sesame (1), Sesamum prostratum (1), sunflower (1) and toria (7)

Fibers and allied Geiba pentandra (1), Gorchorus tri/ocu/aris (1), Grota/aria juncea (2), G. pallida (2), Erinocarpus 10 crops nimmonii (1), Gossypium arboreum (1) Guazuma u/mifo/ia (1) and Hibiscus sp. (1)

16 _ ANNUAL REPORT 2009· 10

F uits

Vegetables

Ornamentals

MediclOal and aromatic plants spices and condiments

Aonla (4), bael (4), ber (1), Borassus flabellifer (9), Carissa carandas (2), C. inermis (1), Carissa sp. (1), Citrus aurantifolia (3), C. grandis (2), C. jambhiri (3), C. kama (1), C. latipes (1), C. limetta (1), C. limon (1), C. medica (2), C. reshni (1), C. reticulata (5), C. sinensis (8), C. taiwanica (1), Citrus sp. (2), C. volkameriana (1), Diospyros sp. (2), Flacourtia indica (1), Garcinia indica (29), G talbotii (1), Grewia abutilifolia (1), G tiliaefolia (1), mahua (1), mango (38), Meyna laxiflora (2), Musa balbisiana (2), M. rosacea (1), Musa spp. (23), Pithecellobium dulce (1) and tamarind (1)

Abelmoschus angulosus subsp. purpureus (2), A. ficulneus (6), A. manihot var. pungens (1), Abelmoschus sp. (3), A. tetraphyllus (3), A. tuberculatus (2), Alocasia macrorrhiza (13), Allium sp. (1), Amorphophallus campanulatus (1), A. paeonifolius (13), bitter gourd (2), bottle gourd (11), brinjal (2), Canavalia cathartica (6), C. ensiformis (1 0), C. virosa (1), Capsicum baccatum (1), chillies (54), Colocasia esculenta (25), Crescentia cujete (1), Cucumis callosus (9), c. melovar. agrestis (3), C. melovar. momordica (3), C. prophetarum (1), C. pubescens (1), C. sativus var. hardwickii (16), C. setosus (1), C. silentvalleyi (3), Cucumis sp. (1), cucumber (5), cluster bean (31), Dioscorea alata (19), D. bulbifera (3), D. oppositifolia (1), Dioscorea sp. (3), dolichos bean (4), drumstick (44), Gymnopetalum chinense (1), Kedrostis rostrata (1), Luffa graveolens (2), L. hermaphrodita (1), L. tuberosa (1), Luffa sp.(2), Melothria sp. (1), Momordica balsamina (1), M. charantia (6), M. charantia var. muricata (9), M. dioica (86), M. sahyadrica (1), Momordica sp. (2), Moringa concanensis (6), muskmelon (5), okra (2), onion (169), pea (3), pumpkin (8), ridged gourd (16), snake gourd (6), sponge gourd (13), Solanum incanum (2), S. indicum (1), S. verbascifolium (1), Solanum sp. (1), sweet potato (3), Tacca leontopetaloides (2), Trichosanthes bracteata (2), T. cucumerina (26), T. dioica (11), T. lobata (1), T. palmata (2), T. tricuspidata (1), Xanthosoma sagittifolia (4) and others (1)

Duranta erecta (1), Eranthemum roseum (1), Ipomoea quamoclit (1), Neodypsis decaryi (1), Ochna obtusata (1), Parkia biglandulosa (2), Pedilanthus tithymaloides (1), Peltophorum pterocarpum (1), Plumeria acutifolia (1), Scaveola sericea (1) and Synadenium grantii (1)

Abelmoschus moschatus (1), Abutilon indicum (1), Abrus precatorius (5), Acacia catechu (1), Acorus calamus (5), Aerva lanata (1), Allium sativum (43), Aloe barbadensis (2), Alpinia abundiflora (1), A. calcarata (12), A. galanga (18), A. malaccensis (2), A. mutica (1), Andrographis echioides (1), A. paniculata (2), Anethum graveolens (41), Anogeissus latifolia (1), Antidesma sp. (1), Ardisia sp. (1), Argyreia nervosa (1), Aristolochia indica (1), A. tagala (11), Aristolochia sp. (1), Asparagus racemosus (18), Atropa belladonna (1), Bacopa monnieri

158

704

12

808

(1), Bauhinia vahlii (1), Bixa orellana (3), Boswellia serrata (2), Bridelia scandens (4), Bryonopsis laciniosa (1), Buettneria herbacea (1), Caesalpinia bonduc (2), C. crista (1), Cardiospermum halicacabum (1), Cassia alata (3), C. fistula (1), C. mimosoides (1), C. occidentalis (2), Cassine glauca (1), Catunaregam spinosa (1), Cayratia pedata (4), Celastrus paniculatus (5), Chlorophytum borivilianum (2), C. glaucum (1), C. nimmonii (2), Chlorophytum sp. (2), Cissampelos pareira (3), Cleome viscosa (1), Cleome sp. (1), Clerodendron serratum (2), Clerodendron sp. (1), Clitoria tematea (6), Colchicum luteum (1), Coleus amboinicus (1), C. zeylanicus (1), Coriandrum sativum (83), Costus speciosus (2), Curculigo orchioides (20), Curcuma amada (1), C. angustifolia (1), C. caesia (1), C. longa (3), Curcuma sp.(6), Cycas beddomei (1), Cymbopogon citratus (2), C. martinii (2), Cymbopogon sp. (2), Cyminum cuminum (24), Cyperus scariosus (1), Desmodium sp. (2), Dioscorea deltoidea (1), D. pentaphylla (1), Dracocephalum heterophyllum (1), Eclipta alba (2), Entada rheedii (2), Ervatamia heyneana (1), Eupatorium odoratum (1), Evolvulus alsinoides (2), E. nummularius (1), Flemingia nana (3), F prostrata (1), Foeniculum vulgare (1), Gloriosa superba (1), Glossocardia bosvallia (1), Grewia hirsuta (1), Gymnema sylvestre (1), Hedychium spicatum (10), Helicteres isora (5), Hemidesmus indicus (36), Heracleum grande (1), Hiptage benghalensis (1), Hitchenia caulina (1), Holarrhena antidysenterica (3), Holostemma ada­kodien (2), Hygrophila auriculata (1), Hypericum perforatum (1), Hyptis suaveolens (1), Indigofera tinctoria (10), Iphigenia magnifica (3), Kaempferia elegans (1), K. galanga (20), Launaea sarmentosa (1), Lavandula bipinnata (1), Leea macrophylla (1), Lobelia nicotianaefolia (1), Luvunga eleutherandra (1), Lygodium flexuosum (3), Mallotus philippensis (1), Malvastrum coromandelianum (1), Mappia foetida (1), Marjoram hortensis (1), Memecylon umbellatum (1), Mimosa pudica (1), Morinda citrifolia (24), Mucuna pruriens (11), Naringi crenulata (1), Ocimum americanum (5), O. gratissimum (2), 0. sanctum (38), Ocimum sp.

~----______ L-____ ~~ ______________ ~ __ ~ ____________________________ ~ __ ~

I() Of< PI A!'lTtxPLORATlON A:-ID GERMPIASM COLLECTION __ 17

Fodder and grasses

Agro-forestry species

(1 ), Origanum vulgare (8), Pandanus sp. (1), Paramignya monophylla (1), Pholidota sp. (1), Pinda concanensis (1). Piper longum (2), Plectra nth us sp. (1), Plumbago zeylanica (7), Pogostemon benghalensis (1), Premna herlJacea (1), P. serratifolia (1), Pterocarpus marsupium (1), P. santa linus (1), Pueraria tuberosa (1), Putranjiva roxburghii (1), Randia dumetorum (1), Rauvol(ia canescens (1), R. serpentina (8), R. tetraphylla (2), Rhus sinuata (1), Rhynchospora wightiana (1), Salacia chinensis (1), Salvia sclarea (1), Sapindus mukorossi (1), Saraca asoca (2), Semecarpus anacardium (5), Senecio dalzellii (1), Sida acuta (1), S. cordifolia (1), Smilax macrophylla (1), Smilax sp. (1), S. zeylanica (3), Solanum surra tense (1), Sopubia delphinifolia (1), Sphaeranthus indicus (3), Stephania japonica (1), Sterculia sp.(3), Strychnos nux-vomica (2), S. wallichiana (1), Terminalia bellirica (1), T chebula (2), Thelepaepale ixiocephala (1), Thespesia lampas (3), Tinospora cordifolia (18), Trachyspermum ammi (11), Trewia polycarpa (1), Trigonella comiculata (3), T foenum-graecum (52), Thymus serphyllum (1), Tylophora asthmatica (1), Urginia indica (3), Uraria sp. (2), Utricularia purpurascens (1), Valeriana jatamansi (5), Vanda tessellata (1), Vanda sp. (1), Vanilla wightiana (1), Ventilago calyculata (3), v. maderaspatana (2), VerlJascum thapsus (1), Vernonia anthelmintica (2), Vernonia sp. (2), Vetiveria zizanioides (1), Withania somnifera (2), Xylia xylocarpa (1), Zingiber neesanum (1), Z. officinale (2) and others (14)

Avena fatua (7), A. sativa (5) Bromus catharticus (1), B. japonicus (2), Lathyrus aphaca (2), Lolium temulentum (7), Lotus comiculatus (2), Medicago lupulina (1), M. polymorpha (2), Melilotus indicus (2), Panicum antidotale (1), Pennisetum glaucum (2), P. orientale (2), Polypogon monspeliensis (1), Pseudarthria viscida (1), Trifolium campestre (1), T fragiferum (2), T pratense (1), T repens (2), T resupinatum (1), Vicia bithynica (2), V. hirsuta (1), V. sativa (1), V. sativa subsp. nigra (5) and Zea mexicana (1)

Acacia caesia (2), A. farnesiana (1), A. polyacantha (1), Acacia sp. (1), Ailanthus excelsa (1 ), Archidendron monoadelpha (1), Bauhinia racemosa (1), B. semla (3), Butea monosperma (1), Calamus pseudotenuis (1), Calycopteris floribunda (1), Cananga odorata (1), Careya arlJorea (1), Carvia callosa (3), Casearia graveolens (1), Cassia absus (1), C. auriculata (1), C. obtusa (1), C. renigera (1), Cassia sp. (2), C. sophera (1), Dillenia pentagyna (2), Diospyros montana (3), Erythrina fusca (2), E. suberosa (1), Gnidia glauca (1), Heterophragma quadriloculare (1), Hydnocarpus pentandra (1), Knema attenuata (1), Lagerostroemia lanceolata (1), Lepisanthes tetraphylla (1), Lophopetalum wightianum (1), Macaranga roxburghii (1), Mammea suriga (3), Pandanus furcatus (1), Pemphis stronga (1), Pittosporum wightii (1) and Terminalia paniculata (1), T tomentosa (2) and others (1)

• Cultivated (1412)

Wild (1236)

"100 < arJ() l'

"'Q "'~ '100 lrJ() -t

'00 100 100 ,

o +

I" Sl.

" -

TOTAL

,.,.

I ~=

I 1.,.. • ,.

" - -

008

I ..., -~

Germplasm collected in different crop groups Germplasm (%) collected in cultivated and wild species

5!

5~

2,648

.. -

18 ___________________________________________________ AN~UA1~)R12~lO

Table 3: Explorations undertaken by the Headquarters

S No. Collector( s)l Duration Diversity collected No. of accessions

collaborator( s) Cult. Wild Total

1 NBPGR (Hq), NBPGR, February Brassica juncea (22), B. nigra (7), 68 - 68 Hyderabad & NRC 21-28 coriander (21), fenugreek (8) , others (10) Seed Spices, Ajmer (Rajasthan)

2 NBPGR (Hq) May 11-19 Garcinia indica 23 - 23 & NBPGR, Thrissur

3 NBPGR (Hq) & May 18- M & AP (30), other economic plants (42) - 72 72 Shivaji University, June 5 Kolhapur

4. NBPGR (Hq) & Sept. 29- Vigna spp. (36), others (9) - 45 45 Shivaji University, Oct. 9 Kolhapur (MS)

5. NBPGR (Hq) Oct. 1-9 Momordica spp. (18), Trichosanthes spp. (17) 5 30 35 & IIVR, Reg. Stn., Kushinagar (UP)

6. NBPGR (Hq) & Oct. 2-7 M & AP (28), other economic plants (3) - 31 31 Shivaji University, Kolhapur

7. NBPGR (Hq) & Oct. 21-29 Luffa spp. (3), Momordica spp. (6), 12 24 36 IIVR, Reg. Stn. , Trichosanthes spp. (25), others (2) Kushinagar (UP)

8. NBPGR (Hq) & Oct. 19-30 Citrus spp. (33), other (1) 3 31 34 ICAR, Basar (Arunachal Pradesh)

9 NBPGR (Hq) Nov. 25- Ocimum spp. (43), others (2) 37 8 45 Dec. 5

1.1.1 Explorations undertaken br the Headquarters: Nine explorations were undertaken in parts of Andhra Pradesh, Arunachal Pradesh, Goa, Kamataka, Madhya Pradesh, Maharashtra, Rajasthan and Uttar Pradesh and a total of 389 accessions of different agri-horticultural crops were assembled (Table 3). The details of areas explored and germplasm collected during explorations are given below:

Collection of Brassica spp. and seed spices from parts of Andhra Pradesh: A total of 68 accessions comprising Brassica juncea (22), B. nigra (7), Helianthus annuus (1), Carthamus tinctorius (1), Guizotia abyssiflica (1), Coriandrum sativum (21), Trigonella foenum-graecum (8), Trachyspermum ammi (4), Vigna radiata (2) and Luffa acutangula (1) were collected from dry semi-arid parts of Adilabad, Karimnagar, Medak, Mehbubnagar, Nalgonda, Nizamdbad and Warangal districts in Andhra Pradesh. Farmer~ were growing mustard and black mustard (B.

Total 148 241 389

nigra) in small pockets along with coriander. However, due to short winter and low productivity in the latter species, it has been replaced by brown mustrard (B. juncea ). In B. juncea, small seeded types were being grown by the farmers.

Exploration for minor fruit (Garcinia indica) in parts of Konkan and Goa: Twenty-three accessions of Garcinia indica were collected from parts of north Goa in Goa and Ratnagiri and Sindhudurg districts in Maharashtra. Variability in tree canopy, fruit colour, size and taste of aril was observed. Dark maroon to black fruited, large fruits, early and profused bearing types were distinct collections from Konkan region of Maharashtra.

Collection of M&AP and other economic plants in parts of Konkan (Maharashtra): A total of 72 accessions comprising medicinal and aromatic plants (30), oil seeds (1), fruits (15), fibre (5), ornamentals (1) and agro-forestry species (21) were collected from parts of Karveer, Kolhapur, Ratnagiri and Sindhudurg districts

)1 10 Of< PLANT EXPLORATION AND GFRMPlASM COLlE('TIO~ ____________ _ 19

in Maharashtra . The accessions of medicinal and aromatic plants include rare, endangered, threatened and endemic species of Western Ghats.

Exploration for wild species of Abelmoschus, Cucumis and Vigna in parts of Rajasthan: Forty­five accessions of wild species comprising of Abelmoschus ficulneus (2), A. tuberculatus (2), Cucumis callosus (2), c. melD var. agrestis (1) , Melothria sp. (1) , Trichosanthes dioica 0), Vigna aconitifolia (4), V dalzelliana (1), v. hainiana (4), v. minima (2), v. mungo var. silvestris (3), V radiata var. sublobata (17) and V. stipulacea (5) were collected from parts of Alwar, Bhilwara, Bundi, Chittorgarh, Nagour, Pali, Pratapgarh, Sawaimadhopur, Sirohi and Udaipur districts in Rajasthan.

Collecting wild Vigna in Rajasthan

Vigna radiata var. sub/obata from Rajasthan

Collection of wild species of cucurbitaceous vegetables in parts of Madhya Pradesh, Rajasthan and Uttar P r adesh : Thirty-five accessions of cucurbitaceous vegetables comprising Trichosanthes

anguina (3), T dioica (2), T cucumerina ( 12) , Momordica charantia var. muricata (6), M. balsam ina (1) and M. dioica (11 ) were collected from parts of Jhansi, Lalitpur, Mathura districts in Uttar Pradesh; Chhatarpur, Gwalior, Morena, Shivpuri, Tikamgarh districts in Madhya Pradesh and Alwar, Bharatpur, Dholpur districts in Rajasthan. Variability in Trichosanthes cucumerina for fruit shape (ovoid to oblong), fruit length and stripes over fruits (greyish to greenish) and in Momordica charantia var. muricata for fruit size (2-5 cm), fruit shape (elliptic, round, ovoid) and seed size was observed.

Sites of germplasm collection

Variants of Momordica dioica

Collection of M&AP and other economic plants in parts of Western Ghats of Maharashtra: A total of 31 accessions comprising medicinal and aromatic plants (28), minor fruits (1), ornamentals (1) and spices (1) were collected from Karveer, Kolhapur, Mahabaleshwar, Satara and Sindhudurg districts of Maharashtra and Belgaum district of Karnataka. The accessions of medicinal and aromatic plants include rare, endangered, threatened and endemic species of Western Ghats.

20 _____________ ~ ______ AN:"JUAL REPORT 2009· IO

E ploration for wild species of cucurbitaceous ,eg tables in parts of North-eastern Uttar Pradesh: Thirty-six accessions of cucurbitaceous vegetables Cucumis melo var. agrestis 0), Gymnopetaium chincllse (I), Luffa graveolens (2), L. hermaphrodita (I). 1rtclzosanthes anguilla (3), T. dioica (8), T. ('uCllmerina (12), T. bracteata (2), Momordica dwronlia var. muricata (3), M. charantia (1) and M. dioica (2) were collected from parts of Barabanki, Bahraich, Basti. Bareilly, Ghaziabad, Hardoi, Lakhimpur, I uckno\-.., Moradabad, Pilibhit, and S.K. Nagar districts III t;ttar Pradesh. Variability in Trichosanthes 'ucllInerino for fruit shape (ovoid to oblong), fruit length

and stnpes over fruits (grayish to greenish) and in 1 ricllOwllthes dioica for fruit size (4.5-11 cm), fruit shape (ellIptic, spindle-shaped, ovoid) and stripes over fruit (ml, distinct and diffused) was observed.

Sites of germplasm collection

Trichosanthes cucumerina

Exploration for Citrus spp. in parts of Arunachal Pradesh: A total of 34 accessions of citrus comprising of Citrus (lurantijolia (3), c. grandis (2), c. jambhiri (3), C. kama (1), c. latipes (1), c. limetta (1), C. li-111012 (I). C. medica (2), c. reshni (I), C. reticulata (5),

C SlIlemis (8), C. sinensis x Poncitrus trifoliata (I),

C. taiwanica 0), C. volkameriana (1), Poncftrus trifoliata (1), Musa balbisiana (l) and Alpinia malaccensis (1) were collected from parts of Lower and Upper Subansiri, and West Siang districts in Arunachal Pradesh.

Citrus jambhiri-Iocal type from Arunachal Pradesh

Collection of Ocimum spp. in parts of North­western Uttar Pradesh: A total of 45 accessions comprising of Ocimum americanum (5), 0. gratissimum (l), O. sanctum (37), Marjorana hortensis (1) and Asparagus racemosus (1) were collected from parts of Aligarh, Badaun, Bulandshahar, Bareilly, Bijnor, Farrukhabad, Hathras, Mahamayanagar, Mathura, Meerut, Muzaffarnagar, Saharan pur, Shahjahanpur districts in Uttar Pradesh and Haridwar and Udham Singh Nagar in Uttarakhand. Variability was observed in number of branches and leaves (total biomass), In Mathura district tulsi (0. sanctum) was frequently grown as backyard plant as compared to other districts of Uttar Pradesh.

OF PLANTE XPLORATIOI\J AND GERM PLASM COUECTlO 21

,

Sites of germ plasm collection

1.2 National Herbarium of Cultivated Plants (NHCP)

A total of 304 herbarium specimens, 57 seed samples

and 25 economic products were processed and added to

the NHCP, taking the existing collection to 20,103

herbarium specimens, 2,873 seed samples and 573

economic products. These are representative of 3,824

species belonging to 1,438 genera and 263 families .

During the period 65 taxa, not earlier represented, were

added to the NHCP (Table 4).

Herbarium specimens/ samples were added through

collection trips from Andaman Islands, Andhra Pradesh,

Assam, Delhi, Haryana, Himachal Pradesh, Jammu &

Kashmir, Lakshadweep, Madhya Pradesh, Mizoram,

Rajasthan and Uttar Pradesh and from plants raised under

experimental conditions.

Table 4: Some important taxa added to NHCP Genus name Family

Gordyline fruticosa Goeppert Agavaceae

A/angium chinense (Lour.) Harms. Alangiaceae

Aster amellus L. Asteraceae

Helianthus tuberosus L. Asteraceae

Stereospermum suaveo/ens DC. Bignoniaceae

Viburnum opu/us L. Caprifoliaceae

Lychnis coranaria Desr. Caryophyllaceae

Gupressus sempervirens L. Cupressaceae

Ganava/ia cathartica Thouars. Fabaceae

Grata/aria micans Crep. Fabaceae

Ribes nigrum L. Grossulariaceae

22

Collecting Ocimum sanctum 'Tulsi' from Ashram garden in Mathura

Identification services of specimens/ samples were

provided to students and researchers (86) and

authentication certificates (32) were issued to students

for material taken up for experimental study. Short-term

training on herbarium preparation and identification was

provided to students (26), trainees (45) and visitors (9)

consulting the herbarium.

Uses

Rhizome medicinal

Wood used for furniture; leaves for fodder

Ornamental; roots medicinal

Edible tubers

Multipurpose use: wood for furniture, root, stem-bark and flowers of medicinal value; leaves for fodder

Bark diuretic; ornamental

Roots medicinal

Wood used for furniture/ building purposes

Wild relative of Ganava/ia ensiformis (sword bean)

Green manure, animal feed/forage

Fruits eaten raw, used in juices and wines; buds and leaves used as a flavouring

____ ANNUALREPORT2009-IO

~ a~h"us odoratissima Nees. Lauraceae Wood used for furniture/ building; leaves used for rearing silkworms

Ch/orophytum nepa/ense (Lindl.) Liliaceae Roots medicinal 8ak.er

Ced ala serrata M. Roem. Meliaceae Wood used for furniture and plywood manufacture Morns macroura Miq. Moraceae Ornamental and breeding stock Rosa alba L. Rosaceae Flowers refrigerant, also yield essential oil Rosa banksiae Ait. f. Rosaceae Root-bark for tanning; roots and leaves medicinal Rosa brunonii Lindl. Rosaceae Flowers used for preparation of rose water; wood for walking

sticks Salix wallichiana Anders. Salicaceae Leaves for fodder and twigs for basketry; bark source of tannin;

agro-forestry species Gestrum e/egans (8rongn.) Solanaceae Ornamental Schlect tend. Parthenocissus semicordata Vitaceae Wood for picture frames; leaves for fodder iWall.) Planch. Vitis parvifolia Roxb. Vitaceae Fruits edible and sweet

1.2.1 Digitization of taxa represented in the NHCP: Digitization of a total of 3,758 species belonging to 1,430 genera and representing 256 families was taken up. Seed samples represented in the NHCP were taken up for scanning and creating digital images. Digital scanS of seeds of 1,337 species belonging to 570 genera and 130 families were al<;o done.

1.2.2 axonomic studies: Systematic studies were carried out in Atylosial Cajanus and Flemingia/ Moghania for id~ntifying species belonging to crop genepool and in Crotalaria spp. on the basis of micro (trichome, stomata) and macro-morphological characters (seed, leaf, pollen, pod and seedling).

Cajanus albicans 2

Cajanus cajan 23

Cajanus elongatus 2

Cajanus lineatus 2

Cojanus mollis 2

Cajanus platycarpus 3

Cajanus rugosus 1

Cajanus scarabaeoides 23

Cajanus sericeus 1

Cajanus trinervius 1

[ I O~ OFPLMI EXPLORATION ANDGERMPLASM COLLECTION ______ _ 23

1.3 Documentation of diversity in different agri­horticultural crops of India

Mapping of diversity collected in over 400 accessions of cultivated and wild species of Crotalaria was done on the basis of germplasm collected through crop­specific and multi-crop explorations from diversity rich areas. Diversity was mainly represented from Haryana, Rajasthan and Madhya Pradesh. Sporadic collections were also made from north-western Himalaya, northwestern plains and arid eastern regions.

Germplasm collection sites of Grata/aria spp.

Research Programme (Programme Code: Title, Leader)

1.4 Documentation of Information during Explorations

During explorations and germplasm collection, documentation of information related to use of plant genetic resources was recorded from Arunachal Pradesh, parts of Madhya Pradesh and Uttar Pradesh.

• Momordica charantia var. muricata - locally known as morella, 'gol karela' cooked as vegetable and dehydrated for off-season use (Gwalior, MP)

• Trichosanthes tricuspidata - locally known as bermedua, fruits mixed with oil, onion and mustard is used for curing cough of cattle (Pilibhit, UP)

• Luffa graveolens - locally known as guslainth or guslaria, fruits are poisonous, used as medicine for fever (SK Nagar, UP)

• Musa balbisiana - seeded type of wild banana used to feed livestock (Daporijo, Upper Subansiri, Arunachal Pradesh)

PGRlPGC-BUR-01.00: Exploration for collection of germplasm of agri-horticultural crops, maintenance of herbarium and biosystematic and ethno-botanical studies (DC Bhandari)

Research Projects (Project Code: Title, PI, Co-Pis and Associates)

PGRlPGC-BUR-01.01: Exploration for collection of genetic resources of agricultural crops and their wild relatives (DC Bhandari, KC Bhatt, Anjula Pandey and NS Panwar)

PGRlPGC-BUR-01.02: Exploration for collection of genetic resources of horticultural crops and their wild relatives (Rakesh Srivastava, SK Malik, ER Nayar, Gunjeet Kumar, AK Singh and Rakesh Singh).

PGRlPGC-BUR-01.03: Exploration for collection of medicinal and aromatic plants diversity from different phyto-geographical regions (KC Bhatt, AK Singh, CS Raghav and NS Panwar).

PGRlPGC-BUR-01.04: National Herbarium of Cultivated Plants (NHCP), establishment, maintenance, build-up and taxonomic studies on crop plants (ER Nayar, Anjula Pandey, K Pradheep and Rita Gupta).

New Projects

PGRlPGC-BUR-01.05: Genetic resources and systematic study of Alliaceae in India: Allium (Anjula Pandey, K Pradheep, KS Negi and Rita Gupta)

PGRlPGC-BUR-01.06: Genetic resources and systematic studies of selected species: Asparagus, Tinospora and Withania (AK Singh, KC Bhatt and CS Raghav)

PGRlPGC-BUR-01.07: Genetic resources and systematic studies of Cucurbitaceae in India: Trichosanthes (K Pradheep, KC Bhatt, AK Singh and Rakesh Singh)

Externally funded ,,,oject

• New Millennium Indian Technology Leadership Initiative (NMITL) project on Genetic Improvement of Jatropha curcas for Adaptability and Oil Yield (SK Sharma, JB Tomar and KC Bhatt)

24 A.~ALREPORT2()09-10

2. DIVISION OF GERMPLASM EVALUATION

Summary: A total of 6288 accessions of various agri-horticultural crops comprising cereals (3038), pulses (1306), oilseeds {689), vegetables (637), underutilized crops (508), medicinal and aromatic plants (110) were grown for characterization and evaluation. In addition, 2935 accessions of international nurseries comprising of wheat, barley, triticale and exotic wheat accessIons were also grown in Post Entry Quarantine Nursery (PEQN). A total of 1479 germplasm of the oilseeds, tree born OIlseed and nuts namely, Cruciferae spp. (633), sunflower (194), niger (358), linseed (180) walnut (20), jatropha (40), kokkum (37) and Malabar tamarind (17) was analyzed for oil content and quality parameters. Similarly the germplasm of pea ( 62) and foxtail millet (62) were analyzed for total protein content. In phytochemical evaluation, 392 samples of medicinal and aromatic plants were analyzed and evaluated for their active compounds. Five Germplasm Field Days for Brassica; Rabi pulses; wheat, barley, triticale; maize and Kharif pulses and okra were organized to promote germplasm utilization by the plant breeders! user scientists. A total of 1607 accessions of different crops were supplied to 87 indenters belonging to different institutes for their use in crops improvement programmes. The meetings of Germplasm Advisory Committee constituted for different crops/crop groups were also organized.

2.1 Germplasm Evaluation

2.1.1 Characterization and preliminary evaluation for agro-morphological traits: . A total of 6288 acceS~lOns of various agri-horticultural crops comprising cereals (3038): wheat (2553), maize (485); pulses (1306): cowpea (365), urdbean (323), lentil (579) and pea (39); oilseeds (689): rapeseed-mustard (550), sunflower (50), linseed (89); vegetables (637): ashgourd (87), brinjal (60), bottle gourd (220), fenugreek (50), tomato (220), underutilized crops (508): fababean (281), rice bean (l00), amaranth (127) and medicinal and aromatic plants (110): aloe (30), mucuna (15), basil (45) and Abrus (20) were grown for characterization and evaluation. Besides,

2528 entries belonging to 21 nurseries of wheat, 6 of barley and 3 of triticale and 407 exotic wheat acceSSlOns were grown in Post Entry Quarantine Nursery (PEQN). In addition, 323 accessions of medicinal and aromatic plants comprising vetiver (131), palmarosa (55), giloe (25), aloe (50), asparagus (22) and other M&AP (40) were also maintained in the field gene bank.

Wide range of variability was observed in the germplasm of different crops. Based on characterization and preliminary evaluation, promising accessions for various attributes, viz., earliness, pod length, pods per plant, seeds per pod and 100 seed weight, yield per plant etc. have been identified in different crops (Table l).

Table 1: Promising germ plasm accessions for various traits identified in crops.

Crop Promising traits I Accession no.

Cereals

Wheat Days to maturity « 134) IC82191, IC532785, IC532366, IC532367

Spike length (> 22.0cm) IC63955, IC561216, IC63954

Spikelets per spike (> 38.00) IC63954, IC35072, IC63955

Grains per spike (> 80.00) IC82410, IC534794, IC78866

Yield per metre row length (> 200.0g) IC532054, IC75214, IC534878,

Exotic Wheat

Days to maturity « 1 08) EC633779

Spikelets per spike (> 40.00) EC635784, EC635778, EC635712, EC635711 Grains per spike (> 46.00) EC613056, EC613060

Yield per metre row length (> 345.0g) EC635569, EC633783, EC635748 . Biotic stress

Black, brown and yellow rusts IC138364, IC138426, IC138432, IC138438, IC138477, IC138478, IC138479, IC138504, IC138521, IC138524, IC138618, IC138625

Leaf blight, black and brown rusts IC138404, IC138408, IC138429

Leaf blight and yellow rust IC138512, IC138538, IC145871, IC145888, IC252785

I )f'.. OrGERMPIASMEVALUATIO~ ____________________ ~ 25

Salt stress , Days to 75% spike IC138642, IC252499, IC252953, IC252883, IC138411, emergence «80 days) IC252877, IC252840, IC252870

Grain weight per ear (>3.5 g) IC252839, IC138434, IC252841, IC253000, IC252865

Grains per ear (> 90) IC145913, IC145856, IC252865, IC252734

1000 grain weight(> 60 g) IC252456, IC138637, IC252352, IC252705, IC252938

Grain yield per metre row length(> 90 g) IC252813, IC252881, IC252799

Maize Early maturing types «80) days IC568224, IC568220, IC56822, EC620071, EC452284

Late maturing types (>100) days IC568254, IC568269, EC477306, EC477307, EC477311

Dual types IC568235, IC568251, IC568269, IC568282, EC477314, EC477320, EC477331

Pulse and legumes

Cowpea Early flowering « 44 days) EC390293, EC466882, IC390755, IC398755, EC517159

Long pods (> 22 cm) IC202803, IC528288, IC536543, IC 536637, IC202797

Pods per plant (> 80) IC398031, IC420836, IC521494, IC397983, IC398086, IC398828

Seeds per pod (> 18) EC390287, IC402161, IC536646, IC 249141.

Lentil Days to flowering « 66 days) IC560332, IC560126, IC560346, IC560331, IC560113

Days to maturity « 1 02 days) IC560341, IC560117, IC560125, IC560327, IC560211

Plant height (> 56 cm) IC559819, ET123570, ET123583

Pods per plant (> 159) IC559829, ET123640, IC560234

Seed yield per plant (> 16 g) IC559915, IC559744, IC559847, IC559613, IC559697

100-seed weight (4.60 g) IC560169, IC560222, IC560196, IC560195, ET123408

Urdbean Early flowering « 42 days) IPU-99-16, COBG-5, IPU 99-200, UPU 97-10

Clusters per plant (> 22) IC-106088, IPU-99-33, IPU-99-299, V-19-45

Pod length (> 4.5 cm) IC106088, IPU-99-2, IPU-99-232, DHB-7-3, STY-2801

Pods per plant (> 50) IPU-91-7, DUS-34, IPOI-391, NO 236818

Pea Early flowering « 70 days) EC538005, IC417880, IC417976, IC417586

Clusters per plant (> 39) IC208368, IC398604, IC424891, IC267181

Pod length (> 5.80 cm) IC418020, IC398604, IC356344

Pods per plant (> 68) IC208368, IC398604, IC417878, IC424891

Oilseed crops

Toria Plant height «80cm) IC262141, IC526326

Siliqua length (>5cm) IC526326, IC355401

Seeds/ Siliqua (>20) IC355480

Linseed Plant height «60cm) IC564667

No. of primary branches (>20) IC564600

Capsule diameter (>7mm) IC564655

Seeds/capsule (10) IC564620

Vegetable crops

Brinjal Plant spread (>170.0 cm) IC99686, IC261803

Plant height (>99.8 cm) IC90846, IC90851, IC249387, IC221782, IC112741, IC112347, IC136375, IC136248, IC144021, IC127063

Primary branches (11.4) IC13628-1

Ashgourd Node number at which first female flower appears «20) IC284752, IC544613, IC554693, IC548559

Fruit size (>25 Kg) IC544593, IC554672, IC554681

Tomato No. of primary branches (>20) EC388943, EC514129, EC514146

Fruit weight (>60g) EC320575, EC368023

26 ___ ANNUAL REPORT 2009-1 0

Fe'lugreek

Okra

Under Utilised crop

Pericarp thickness (> 4.5 mm)

Total soluble solids (>6.4)

1000 seed wt (>12.9 g)

Field resistance to yellow vein mosaic virus (YVMV)

Field resistance to Leaf hoppers

Field resistance to YVMV and leafhoppers

Faba bean Plant height (> 110.0 cm)

Pods per plant(> 65.00)

Seeds per pod (> 4.50)

M&A Plants

Abrus

Aloe

Basil

Seed yield per plant (> 160.0)

100 seed weight (> 75.00)

No. of primary branches/ plant (> 15)

No. of secondary branches/ plant

No. of pods cluster/ plant (> 12)

No. of pods per cluster(> 10)

No. of seeds per pod (>5)

Leaf length (>35.0 cm)

Leaf width (>9.0 cm)

No. of leaves per plant (> 15)

Plant height (>90.0 cm)

No. of primary branches/ plant (>25)

Leaf length (>7.0 cm)

Leaf width (>2.5 cm)

Herbage yield (> 700g on FWB)

EC305681 of Okra showing field resistance to Yellow vein mosaic virus

IC528871, IC523870, EC320575, EC 498372

IC469697, IC523858, IC523869, IC5281 00, EC3176, EC33117

IC332236, IC421923, IC398823, IC332188, IC144276, IC433589, IC143845

IC94848, ICll1547-A, ICl18150, IC 427655, EC305654, EC305736, EC 305771, EC306713A

ICl18151, ICl17269, IC433652 IC 427655, EC306731, EC316079, EC306713A

ICl18150, IC433652, IC427655, EC306722, EC305681, EC316079, EC305771, EC06713A

EC329679, EC329687, ECll7726, EC243608

IC371771, EC324677, IC332114, IC 544577

ET30325, ET30125, ET30319

ET30126, ET30116, ET30125, ET30127

IC30304, ET31030-A, IC32203, ET31213

IC392846, IC391364

IC382836, IC392859

IC391930, IC391984

IC382836, IC385698

IC392859, IC382836

IC520360, IC520364

IC326744, IC527343

IC527335, IC520360

IC326711, EC388895

IC333232, IC344681

IC326711, IC369247

IC382232, IC344681

IC326711, IC333232

2.1.2 Core Set Validation in Brinjal: The developed brinjal core set (181 aces.) is being validated at410cations.

2.1.3 Multi-Location Evaluation of Germplasm: A total of3256 accessions of wheat (1100), rice (750), maize (156), mustard (240), brinjal (100), okra (100), chickpea (250), pigeon pea (260), and lentil (300) were sent to different centers through respective AICRP for evaluation in respect of agronomic traits, biotic and abiotic stress resistance.

2.1.4 Registration of Germplasm:

2.1.4.1 Tomato germplasm for high TSS content (INGR 09065, IC564448).

Tomato (Lycopersican esculentum L.) is one of the important vegetable crops wedely grown all over India

DIVI~IONOFGERMPLASMEVALUATION _____________________ _ 27

during winter and spring season. For processing, high TSS (Total soluble solids) is an important character for crop improvement and there are not many lines/ varieties available to suitable for processing. The TSS of the said accession has been found 6.0" Brix which is much higher than the normal (3_4" B).The other parameters of this selection are Days to fIrst flowering- 44.0 days, Days to fIrst maturity- 79.0 days, Fruit length- 3.6 cm, Fruit width-3.4 cm, Fruit weight-130.0 gm,Numberoffruit per plant-60.0, Number of branches per plant 5.0 and fruit yield per plant 900 gm.

2.1.4.2 Brinjal germplasm for bacterial wilt resistance (INGR09122 and INGR09123).

Brinjal is important vegetable crop and the bacterial wilt disease cause huge losses in quality and productivity both.

Therefore there was great thrust to identify lines for this disease. Two accessions of brinjal INGR09122 and INGR09123 were identifIed for this disease.

2.2 Biochemical Evaluation of Field Crops

2.2.1 Oil content and fatty acid profiling in Oilseeds: A total of one thousand four hundred and seventy nine germplasm collections of various oil seeds crop, tree borne oil seeds and nuts namely, Cruciferae sp. (633), linseed (180), niger (358), sunflower (194), walnut (20), jatropha (40), kokum (37) and Malabar tamarind (17) were analyzed for total oil content. Range of variation, mean value of oil percentage and value rich accessions are given in Table-2 and fatty acid profiling of the promising genotypes is given in Table-3.

Table 2: Range of variation and mean value of oil percentage in oilseed

Crops (No. of Acc.) Oil(%) Value rich accessions

Range Mean

8. juncea (327) 22.95-37.61 31.34 EC151988, IC491307

8. rapa var. yellow sarson (19) 24.27-41.72 33.91 IC355412,EC491610

8. rapa var. brown sarson (13) 27.91-42.03 35.97 IC342989

8. rapa var taria (202) 31.91-45.09 39.03 IC343121, IC417890

8. chinensis (48) 26.7-42.27 35.92 EC182654, EC038888

8. rapa (9) 29.62-38.57 32.82 IC343127-A

Eruca sativa (8) 18.69-30.24 26.96 -

8. napus (4) 20.34-28.71 24.86 -L. sativa (3) 21.57-24.18 22.82 -Linseed (180) 29.33-45.88 40.88 IC-96707, IC-118886

Niger (358) 25.23-41.9 36.25 IC336461, IC372552

Sunflower (194) 24.53-36.63 30.58 EC559596, EC512681

Walnut (20) 63.09 -77.31 68.38 -

Jatropha (40) 23.43 - 43.93 34.69 -Kokkum (37) 29.51-46.98 40.56 IC342293-1, IC573483

Malabar tamarind (17) 20.12-44.11 30.14 IC2441 09-1 , IC210720-1

Table 3: Range of variation and mean value of fatty acid in Oilseeds

Fatty acids (%) Brassica sp. Linseed Sunflower Walnut

Range Mean Range Mean Range Mean Range Mean

Palmitic acid 1.9-3.4 2.49 6.1-7.2 6.67 4.5 -7 5.36 5.6-8.2 6.54

Stearic acid 0.6-6.2 1.24 6.9-9.0 7.61 1.7 -4.0 2.85 1.7-3.3 2.66

Oleic acid 1004-26.8 14.63 25.2-35.4 28.58 35.7-57.9 49.70 11.2-33.9 18.09

Linoleic acid 11.3-20 15.67 11.6-15.2 13.25 17.8-55.6 38.53 43.5-67.0 58.79

Linolenic acid 4.3-13.1 9.11 36.1-46.7 43.76 - - 9.5-1904 13.93

Ecocenoic acid 1.1-12.9 6.59 - - - - - -Erucic acid 37.8-56.3 50.25 - - - - - -

28 ANNUAL REPORT 2009-1 0

2.2.2 Protein content and amino acid profiling in Pea collections: A total of two hundred twenty four germplasm ~l\.'cessions consisting of pea (162) and foxtail millet (62) were analysed for total protein content. Range of variation, mean value of protein percentage and value rich accessions are given in table-4. Promising pea accessions having high protein content were analysed for the amino acid profile (Table -5).

Table 4: Range of variation and mean value of protein percentage in pulse and millet crop

Crops (No. of Acc.) Protein(%) Value rich accessions Range Mean

Pea (162) 18.81-26.76 22.62 IC556304 Foxtail millet (62) 9.86-16.94 13.85 IC436863, IC479684

Table 5: Essential Amino acids of pea Collections

Amino acids (g/16g N) Max. Min Mean

Arginine + Threonine 17.29 10.09 13.20 Half cystine 2.89 1.12 2.02 Tyrosine 5.04 1.98 3.51 Valine 5.21 3.62 4.35 Methionine 3.29 0.55 1.54 Lysine 10.30 7.71 8.85 Isoleucine 3.54 2.54 2.90 Leucine 12.81 4.73 9.34 Phenylalanine 4.94 3.27 4.21

2.3 Ph ochemical Evaluation of Medicinal and Aromatic Plants

A total of 392 samples of different medicinal and aromatic plants obtained from Issapur farm and NBPGR Regional Stations were analyzed for their active constituents. The details of major crops and range of active compounds present in them are given in the Table 6.

Table 6: Essential oil content in various aromatic plants

Plant Name (No. of Accessions) Plant part used Range (FWB %)

Ocimum basilicum (Ocimum) (23) i

Herbage 0.05- 0.27 Murraya koenigii (Curry patta) (3) Leaves 0.14-0.28 Murraya paniculata (Orange jasmine) (1) Leaves 0.29 Cinnamomum verum (Cinnamon) (1) Leaves and Stem bark 0.10 (Leaf)

0.80 (Bark) DWB Cinnamomum ma/abatrum (Cinnamon) (2) Leaves and Stem bark 0.05-0.14 (Leaf)

0.11-0.30 (Bark) DWB

2.3.1 Analysis of aroma constituents and physico-chemical constants in aromatic plants: The volatile essen­tial OIls of commercially important aromatic plants were analyzed to identify aroma constituents present in them by GLC. In addition, essential oils of fifty samples of different aromatic plants were analyzed for their physico-chemical constants (specific gravity, refractive index, acid value and ester value) to determine the oil quality (Table 7).

Table 7: Chemical composition of essential oil from aromatic plants

Plant Species Major Aroma Physico-chemical constants

(No. of Accessions) Constituents (%) Specific Refractive Acid Ester gravity index Value Value

Sa/via officina/is a-thujone, a-thujone, camphor, 0.8389 1.4640 0.73 28.22 (Sage) (5) virdiflorol

Rosmarinus officina/is a-pinene, camphene, 1,8-cineole, 0.8638 1.6705 6.51 38.91 (Rosemary)(2) Camphor, Borneol .__

II I () OFGERMPLASMEVALl'ATION_ 29

Zanthoxylum armatum Linalool, limonene, terpinene-4-ol, (Tej phal) (2) a-pinene

Lavendula angustifolia Linalool, Linalyl acetate, myrcene, (Lavender) (8) 1,8-cineole

Pogostemon cablin Patchouli alcohol (Patchouli)(1 )

Cymbopogon flexuosus Citral a, citral b (Lemon grass) (4)

Murraya koenigii a-Pheliandrene, a-ocimene, (Curry patta) (3) a-caryophyliene, aromadendrene,

b-carene

Ocimum basilicum (Ocimum) (45)

Oregano vulgare ( Oregano)

Cymbopogon flexuosus (Lemon Grass)

Hedychium spicatum 1,8-Cineole, linalool, (Kapur Kachri)(8) a-pinene, a-terpineol

Lavendula stoechas (Camphor lavender) (1) Camphor, 1,8-cineole,

Fenchone, linalool

Cymbopogon Citronellol, citral b winterianus (Java Grass) (1)

Murraya paniculata Sabinene, a-pinene, 8-carene (Orange jasmine)(1)

Acorus calamus a-Asarone, methyl isoeugenol ( Sweet flag) (2)

2.3.2 Medicinal plants: 15 accs. of Tinospora cordifolia (Giloe) for total bitters (0.21-0.92) on dry weight basis and 45 accs. of Aloe barbadensis (Ghrit kumari) for aloe gel (0.29-1.12) on fresh weight basis were also analysed. Based on chemical composition promising accessions were identified for quality traits. Lavendula stoechas collection IC449512 grown at temperate climate of NBPGR Bhowali was identified as a camphor rich chemotype consecutively for two years. Salvia officinalis accessions EC403008 and EC 403037 were found to contain high thujone content while Hedychium spicatum collections were found cineole rich chemotype

2.3.3 Standardization of analytical technique for L-DOPA content in Mucuna pruriens seeds: Analytical technique was standardized for estimation of L- DOPA (3,4-dihydroxy phenyl alanine) content in seeds of Mucuna pruriens by HPTLc. Spectra of pure L­DOPA showed maximum absorption peak at 280 nm

0.8562 1.6705 2.67 40.80

0.9422 1.6890 3.00 27.23

0.9562 1.5020 2.10 21.1

0.8763 1.4800 7.3

0.8545 1.4900 5.89 50.07

0.8824- 0.9071 1.4720-1.5215 1.23-23.07

0.8763 1.4800 7.3

0.8763 1.4800 7.3

under uv. Ten accessions of Mucuna pruriens were analyzed and L- DOPA content was found to range from 3.16 % to 5.23%.

2.4 Documentation of information of PGR

Computerisation and statistical analysis of data was competed for 7125 accessions, 3895 accessions and 1372 accessions for kharif (2007), rabi (2008-09) and horticultural crops (2008) respectively.

Annual Reports on Germplasm Characterisation & evaluation of Field Crops for kharif 2008, Rabi 2007-08 and horticultural crops 2007-08 were brought out.

2.5 Germplasm AdviSOry Committee Meetings

The Germplasm Advisory Committee meetings were organized for different crop/ crop groups at NBPGR Headquarters, N. Delhi (Table 8).

30 ______________ ANNUALREPORf2009· IO

Table 8: Germplasm Advisory Committee Meetings Held

Crop/Crop group Date

Medicinal & Aromatic Plants 26-6-09

Vegetable & Horticultural Crops 25-7-09

2.7 Distribution of Germplasm for Utilization

Utilization of germplasm of various crops by breeders and other scientists in the country for crop improvement programmes is an important aspect in sustainability of crop production. During the period, a total of 1607 seed samples of various crop groups namely, cereals (391), pulses (481), oil seeds (98), vegetables (442), millets and minor millet (25), under utilized crops (50) and medicinal and aromatic plants (167) were supplied to 87 research workers ofICAR Institute, State Agricultural Universities and other research centers engaged in crop improvement programmes (Table 9).

Table 9: Distribution of Germplasm of different crops

Crop group/ crop No. of samples

Cereals 391 (11)

Wheat 20 (1)

Barley 371 (10)

Pulses 481 (22)

Cowpea 146 (12)

Pea 214 (5)

Lentil 76 (3)

Urd 15i (1)

Chickpea 30(1 )

Oilseeds 51(8)

Rapeseed mustard 39(5)

Sunflower 3(1 )

Sesamum 5(1 )

Lepidium 4(1 )

Vegetables 442 (16)

Brinjal 14 (4)

Tomato 93 (4)

Bottlegourd 76(2)

Ridgegourd 51 (1)

Spongegourd 51 (1)

Okra 157 (4)

Millets and minor millet 25 (1)

Underutilized Crops 50(2)

Medicinal and aromatic plants 167 (27)

Grand total 1607 (87)

2.8 Germplasm Holdings in Medium Term Storage (MTS)

A total of 23,047 accessions of various filed crops comprising cereals (5250), millets and minor millets (250), pulse (5025), oilseeds (5807), vegetables (5081), forages (187), underutilized crops (1227) and medicinal and aromatic plants (220) were maintained in medium term storage during the period under report (Table 10).

Table 10: Active Germplasm Holdings in MTS as on 31.12.2009

Cereals 5250 Maize 1900 Wheat 1650 Barley 1700 Pulses 5025 Cowpea 1500 Pea 775 Urd 535 Lentil 470 Mung 645 Chickpea 1100 Oilseeds 5807 Rapeseed mustard 4500 Safflower 350 Sunflower 310 Sesame 510 Crambe 22 Linseed 100 Taramira 4 Vegetables 5081 Brinjal 2250 Tomato 1100 Bottle gourd 360 Ridge gourd 310 Sponge gourd 325 Ash gourd 100 Onion 90 Fenugreek 368 Palak 50 Coriander 118 Pumpkin 10 Forages 187 Oat 187 Underutilized crop 1227 Fababean 400 Rice bean 103 Amaranthus 124 Sesbania 400 Crotolaria 200 Medicinal & Aromatic Plants 220 Ocimum 50 Mucuna 55 Poppy 53 Andrographis 23 Psoralia 11 Ashwagandha 4 Hyaocymus 6 Catharanthus 15 Silibum 3

Total 23047

DIVISIOl\i OFGERMPLASM EVALUATION __________________ _ 31

R~rch Programme (Programme Code: Title and PI)

PGR/GEV-BUR-DEL-01.00: Characterization, Evaluation, Maintenance, Regeneration and Documentation of Germplasm Resources of Various Crops (SK Mishra)

Research Projects (Code, Title, PI, Co-Pis and Associates)

PGR/GEV-BUR-DEL-01.01: Characterization, Evaluation, Maintenance, Regeneration and Documentation of Germplasm Resources of Wheat, Barley and Triticale (BS Phogat, TPSingh, MC Singh and YS Rathi)

PGR/GEV-BUR-DEL-01.02: Characterization, evaluation, maintenance, regeneration and documentation of germplasm resources of maize (Ashok Kumar and Harender Singh)

PGR/GEV-BUR-DEL-01.03: Characterization, evaluation, maintenance, regeneration and documentation of germplasm resources of pulse crops (NK Gautam, SK Mishra, Sangita Yadav, Mohar Singh, A Roy, Z Khan, TV Prasad and Babu Ram)

PGR/GEV-BUR-DEL-01.04: Characterization, evaluation, maintenance, regeneration and documentation of Germplasm Resources of oil seeds (Ranbir Singh, Sangita Yadav and Poonam Suneja)

PGR/GEV-BUR-DEL-01.0S: Characterization, evaluation, maintenance, regeneration and documentation of germplasm resources of Rabi vegetable crops (Gunjeet Kumar, KK Gangopadhyay, A Roy, Z Khan, T V Prasad, M Arivalagan and BL Meena)

PGR/GEV-BUR-DEL-01.06: Characterization, evaluation, maintenance, regeneration and documentation of germplasm resources of Kharifvegetable crops (K.K. Gangopadhyay, Gunjeet Kumar, SK Yadav, A Roy, Z Khan, TV Prasad, M Arivalagan and BL Meena)

PGR/GEV-BUR-DEL-01.07: Characterization, evaluation, maintenance, regeneration and documentation of germplasm resources of medicinal plants (Ashok Kumar, S.K. Pareek, Archana Raina, A Roy, Z Khan, TV Prasad, M Arivalagan, Harender Singh and Ombir Singh)

PGR/GEV-BUR-DEL-01.08: Biochemical evaluation of germplasm resources of various field crops (Sangita Yadav, SK Mishra, Ranbir Singh, NK Gautam, Zakir Hussain and Poonam Suneja)

PGR/GEV-BUR-DEL-01.09: Characterization, evaluation, maintenance, regeneration and documentation of germplasm resources of under-utilized crops (BS Phogat, RP Dua, Hanuman Lal and Ranbir Singh)

PGR/GEV-BUR-DEL -01.10: Studies on Statistical Techniques for Efficient Management of Plant Genetic Resources (Hanuman Lal and RK Mahajan)

PGR/GEV-BUR-DEL-01.11: Genetic Resources Information Programme (RK Mahajan, RC Agarwal, Hanuman Lal, Madhu Bala and Rajiv Gambhir)

PGR/GEV-BUR-DEL-01.12: Characterization, Evaluation, Maintenance, Regeneration and Documentation of Germplasm Resources of Aromatic Plants (Archana Raina, SK Pareek, Ashoka Kumar, Jitendra Mohan, and Ombir Singh)

PGR/GEV-BUR-DEL-01.13: Development of Core set in Brinjal (Solanum melongena L.) (KK Gangopadhyay, SK Yadav, RK Mahajan, IS Bisht and Gunjeet Kumar)

PGR/GEV-BUR-DEL-01.14: Genetic enhancement lentil and chickpea germ plasm resources (Mohar Singh, TP Singh, SK Mishra and IS Bisht)

PGR/GEV-BUR-DEL-01.1S: Evaluation for abiotic stress (terminal heat tolerance) in wheat germplasm (TP Singh, Mohar Singh, SK Mishra and OP Dahiya)

PGR/GEV-BUR-DEL-01.16: Standardization of agro-techniques of elite medicinal plants (Giloe and Shatavary (MC Singh, BS Phogat, SK Pareek, Archana Raina, M Arivalagan and BS Panwar)

32 -----________ ANNUAl REPORT2009 to

3. DIVISION OF GERMPLASM CONSERVATION

Summary: A total of 10,804 accessions of various crops were received for long-term conservation in the National Genebank. These were processed following the genebank standards adding another 8,284 accessions to the base collections raising the total germplasm holding to 3,75,702. A total of 1,977 accessions were received at the Germplasm Handling Unit (GHU) and 1 ,082 were stored in the medium-term storage module as reference samples. In addition, 10,052 accessions of paddy were repatriated from Intemational Rice Research Institute (IRRI). Monitoring of stored germplasm (2,416 accessions) and supply (26,877) for evaluation/regeneration/research/restoration of active collections were the other priority activities. Dormancy breaking methods were standardized for Leucaena leucocephala, Stylosanthes hamata and Dodaenia viscosa. Germination protocols were standardized in five species viz. Sapindus aurifolia, Samadera indica, Sterculia urens, Diospyros melanoxylon and Bambusa arundinacea. Viability testing method was standardized in Cassia angustifolia and Baliospermum montanum. Assessment of longevity of ultra-dry seeds of castor, groundnut, sesame, pigeon pea, chickpea, cotton and Jatropha were continued. A total of 131 proposals belonging to 29 crops were approved for registration.

The Division continued its efforts to support the national repository with long-term storage of seeds of various agncultural and horticultural crops in the National Genebank (-18°C), and reference samples of introduced and collected accessions in the medium-term storage (MTS) at 8°C. In addition, the registration of potentially valuable germplasm and conservation of released varieties and genetic stocks identified under the National Agricultural Research System have been the other important"activities to facilitate their use in crop improvement programmes. Supportive research directed towards understanding the storage behaviour of hitherto un-explored and under-explored species, identification and manipulation of factors that prolong the storage life of seeds, maintaining the genetic integrity of conserved germplasm in a cost-effective manner and overcoming seed germination problems continued.

3.1 Germplasm Augmentation

A total of 10,804 germplasm accessions of various agri­horticultural crops were received for long-term conservation at the National Genebank; out of which 8,284 accessions qualified for conservation as per the genebank standards and were added to the base collections conserved at -18°C. These included cereals (2, O~ 7), pseudo-cereals (457), millets and forages, (1333), legumes (771), oilseeds (1,675), fibers (984), vegetables (427), medicinal and aromatic plants and narcotics (194), spices and condiments (326), and agro-forestry plant species (30). These also include released varieties (222) and genetic stocks (191). Thirty-one new species were added to the gene bank during the period. The crop-wise details of the various accessions added to the National Genebank are listed in Table 1. The total germplasm holdmgs in the National Genebank has increased to 3,75,702 representing 1,547 species. In addition, a total l,f 3,863 exotic accessions of different crops were kept as reference sa~ples in the medium-term storage module.

The Germplasm Handling Unit (GHU) received a total of 1,977 seed accessions out of which 797 (646 cultivated and 151 wild) were sent for long-term conservation, one accession for cryopreservation and 1,049 accessions were maintained in MTS as reference samples. Twenty-

DI II;)IO~ OFGERMPIASM CONSERVATION __

five accessions were rejected due to insect infestation. Thirty three accessions collected in 2008, were also maintained in MTS as reference specimens and 130 accessions (125 cultivated and 4 wild) were sent for long-term conservation. A total of 1,288 accessions were sent to Plant Quarantine Division for pest-free conservation of which 1,268 accessions were received after salvaging and 20 were rejected. Information of about 3,200 accessions (2008 and 2009 collections) was updated.

3.2 Physical Verification of the Germplasm

Physical verification of the germplasm present in the long-term storage was continued. The details of the accessions verified in various crop groups are as follows: cereals (68,271), fibers and forages (15,512), oilseeds (25,000), legumes (25,000) medicinal and aromatic plants (10,981) and pseudo-cereals (6,406).

3.3 Documentation and Database Management

Efforts were continued to update passport data of conserved germplasm. Passport data was updated for a total of 782 accessions comprising vegetables (302), fibers (470) and pulses (110). In addition, data on 216 varietal germplasm comprising 45 crops were updated and validated for 9 fields (crop name, botanical name,

33

national identity, variety name, other identity, and year of release, pedigree, breeding methods and unique characters).

3.4 Monitoring of Germplasm

Germplasm stored in the long-term storage module for> .10 years (2,416 accs.) were monitored for seed viability, seed quantity and seed health to identify accessions that may require regeneration as per the genebank standards. This included accessions of cereals (565), millets (167), fibers (328), forages (64) oil seeds (600), pulses (125), vegetables (213), medicinal plants (176), and spices (178). About 200 accessions of soybean germplasm stored in LTS facility during 1986-1990, were monitored

3.6 Supportive Research

Storage studies in faba bean and cowpea were conducted; accelerated ageing of seeds was done for various durations and several physiological and biochemical parameters were investigated. Electrical conductivity of seed leachates before and after ageing correlated well with the seed quality in both the crops. Tetrazolium test and dehydrogenase activity were found to be good indicators of viability in both cowpea and faba bean. Storage studies conducted in five varieties of each of wheat and barley revealed varietal differences in seed longevity. In both the crops seed leachate conductivity did not increase significantly enough to be used as a reliable indicator of seed deterioration whereas

Table 2: Supply of germplasm of different crops for various purposes

Purpose of supply Total no. of accessions

Regeneration and evaluation 5,639

.

Multiplication of exotic 4,895 reference samples

Multiplication of registered 139

germplasm

Taxonomic (species) 3,002

identification

Research 13,202

Total 26, an

for their germination. The accessions exhibiting < 80% germination will be regenerated to conserve these accessions as per genebank standards. The black seed coat accessions showed good viability and survival compared to the yellow seed coat accessions. Various biochemical tests such as electrical conductivity of seed leachate, lipid peroxidation, changes in seed protein content, sugars were performed and compared with the fresh seeds which showed significant differences. Forty­two accessions of Psoralea corylifolia which registered low germination were sent for regeneration.

3.5 Supply of Germplasm

A total of 26,877 accessions were supplied for various purposes. The details are given in Table 2.

Crops

paddy (3916), kodo millet (1000), sorghum (200), lentil (217), pea (9) cucumber (24), ash gourd (123), bottle gourd (24), sponge gourd (26) and methi (100),

wheat (1053), maize (1391), chilli (640), chickpea (30), pea (445), french bean (24), faba bean (243), tomato (859), brassica (210)

wheat (57), maize (57), pearl millet (11),

chickpea (9), lentil (2), pea (3)

cotton (387), wheat (2553), little millet (8),

proso millet (11), sorghum (43)

seven Cucumis spp. (88), rice (13,114)

dehydrogenase activity correlated well with viability. Also, lipid peroxidation which is generally used as a good indicator of loss of viability in many crop seeds did not show any specific trend.

3.6.1 Standardization of germination/viability testing protocols: Germination protocols were standardized in five species viz. Sapindus aurifolia, Samadera indica, Sterculia urens, Diospyros melanoxylon and Bambusa arundinacea.

Dormancy breaking methods were standardized for Leucaena leucocephala, Stylosanthes hamata and Dodaenia viscosa. In L. leucocephala and S. hamata concentrated sulphuric acid treatment for various durations was effective in breaking the dormancy to

34 __________________________ ANNUAL REPORT 2009· 10

\' arious extents while in D. viscosa subjecting the seeds to accelerated ageing conditions (45°C and 100% RH) resulted in 60% germination and acid treatment was the mo~t effective resulting in 100% germination. Hot water treatment at 80°C for 5 minutes which resulted in 90% germination in the seeds was also equally effective for thiS ~pecies. Tetrazolium test for viability of the seeds was standardized in Cassia angustifolia and Baliospermum montanum.

3.6.2 Effect of ultr a-desiccation: To develop protocols for cost-effective conservation, observations on storability ot seeds dried to ultra-low moisture contents were continued in several crops. In cotton, sesame and chickpea ultra-desiccated seeds have been monitored after 13-14 years of storage at ambient conditions. Significantly higher germination was observed in seeds with lowest moisture content (i.e. 2-3%) than in those with higher level of moisture content (4.5-5.0%). Seeds of safflower, niger, castor and groundnut were monitored after 11-12 years (depending on the crop). In these crops also highest germination was observed in seeds with lower moisture (1.7-2%) than those stored with 3.2-4.8% moisture content. Of the 12 accessions of Jatropha (3.8% moisture content) eight showed good viability of 80-100% with triphenyl tetrazolium chloride (TIC), at

ambient temperature for 20 months whereas 4 accessions received from the tropical region showed a decrease in the viability.

Studies on the effect of drying methods in three accessions of soybean revealed that the highest viability and vigour index was recorded in seeds dried at 15 °C and 15% RH followed by silica gel drying and equilibration over lithium chloride. While greatest reduction in physiological quality of seeds was observed over sulphuric acid.

3.7 Germplasm Registration

With the objective of giving credit to scientists who have developed or identified promising germplasm (including parent or inbred lines), to safeguard the national resources with respect to intellectual property rights and to facilitate flow of germplasm among the scientist working in the crop improvement programmes, promising germplasm are registered. A total of 131 proposals received for germ plasm registration belonging to 29 crops were approved for registration in the Plant Germplasm Registration Committee meeting. The details of registered germplasm are given in table-3.

Table 3: Summary list of germplasm registered with unique traits in various crop groups I crops

Crop No. Unique traits for which registered

of Acc.

Cereals 44 ,

Paddy 21 Resistant to Rice gall midge biotype 1,2,3,4 & 4M; As a source of multiple resistance to Gall midge, Brown plant hopper White backed plant hopper and Green leaf hopper ; As a source of cytoplasmic male sterility with higher rate of stigma exsertion; MS grain type and high head rice recovery; semi dwarf stature

Wheat 10 As a source of resistant against all the pathotypes of leaf rust; Bold seed; High 1000 grain weight; High bread loaf volume and good quality bread; Diverse source of chapatti quality

Maize 13 Good pollen shedder, attractive grain color, resistant to rust; Late maturing with dark green leaves with orange grain; Tall, dark green broad leaves, resistant to MLB and rust and late maturing; Very long cobs, with attractive orange grain, good combiner with late maturity; Dark green leaves, orange grain, good combiner, medium maturing; Dark green leaves, white bold grains, resistance to common rust, late maturing; White shining grains, resistant to rust and MLB, and late maturing; Yellow grain QPM, late maturing and good combiner.

Millets 28

Pearl millet 2 Maintainer of TetraA4 MS line; Tetraploid male sterile line with A4 cytotype

Sorghum 25 Good foti and dough making qualities; As a source of male sterility; As a source of resistance to multiple foliar diseases; As a new medium dwarf MS line with high ash (%) in stalk; As a medium duration sorghum MS line with superior stover quality.; As a medium tall male sterile line with good quality of stalk; As a new medium early duration male sterile line with high stalk protein; As a dwarf MS line with high crude protein As a source of early duration grain mould resistance.; As a source of grain mould resistance with long primary branches; As a source of ..__

) 1 ION OFGERMPLASM CONSERVATION ___ _ 35

late duration grain mould resistance; As a source of grain mould resistance with tall plant type and long panicles; As a source of grain mould resistance with yellow white grain.; As a source of grain mould resistance with tall plant type; As a source of grain mould resistance with greyed yellow grain.; As a source of grain mould resistance and round grain; As a source of high grain yield and high biomass under rabi conditions and shallow soil As a source of shoot fly toler-ance with multiple resistance to leaf diseases and also agronomic superiority and yield.

Barnyard millet 1 As easy de-hulling type

Forages 7

Berseem 1 Pentafoliate mutant

Guinea grass 6 Triploid cytotype; High production progenitor of ploidy series; Pentaploid cytotype; Hexaploid cytotype; Octoploid cytotype; Nonoploid cytotype

Grain legumes 20

Pigeon pea 10 As a stable CGMS line; As a fertility restorer

Urd bean 2 Shining yellow seed

Green gram 7 As a source of high iron (Fe) (8.29 mg/100g), zinc (Zn) (4.19 mg/100g) and protein (25.8%) content with high resistance to MYM

Chickpea I As a source of high yield (24.9g per plant) and dwarf and bushy plant type

Oilseeds 7

Castor 1 As a source of multiple resistance

Safflower 1 As a dwarf plant type with basal branching starting at elongation

Physic Nut 2 Brownish purple color fruit; Oblong fruit

Groundnut 3 Source of tolerance to Iron chlorosis; As a multiple phenotypic marker stock with crinkle leaf and white testa color. It is a near-isogenic line of crinkle leaf with rose testa mutant; As a multiple phenotypic marker stock with crinkle leaf and red testa color. It is a near-isogenic line of crinkle leaf with rose testa mutant

Fibers 3

Cotton 3 As a source of immunity to grey mildew (Ramularia areola)

Vegetables 7

Chilli 1 For erect cluster bearing de-stalking nature of fruits, low pungency and bright colour

Tomato 1 High TSS (6.0B)

Brinjal 2 As a source of resistance to Bacterial Wilt in different genetic background

Okra 1 For thin (0.9 cm) and long fruit (26cm)

Palak 1 As a terminal flower, thick leaf, big seed mutant of palak

Ivy Gourd 1 For fruit length (8.5-9cm), uniform cylindrical shape

Medicinal and 2 aromatic

Greater 1 Source of high 1,8-Cineole content (37.21 %) and alpha fenchyl acetate (19.87%) content in galanga rhizome essential oil

Kwanch 1 High L-DOPA content (6.30%)

Commercial 5 crops

Sugarcane 5 Source of high cane yield and sugar yield and tolerance to water-logging, salinity and drought; Source of high levels of juice sucrose at 240 days of crop age: High sugar content and utility as a female parent; As a high quality clone with good sugar accumulation (300 days of age, AVT) for both peninsular and east coast regions , with resistance to smut and drought; As a rare commercial hybrid with high juice quality early in the season (in 240 days) and high sugar recovery

Tuber Crops 5

Potato 5 As male fertile androgenic dihaploid of tetraploid potato flowering; Highly resistant to late blight Horizontal resistant to late blight and early blight, high yield under early (75 days) and medium (90 days) crop duration;. As a source of higher frost tolerance introduced through a wild

36 A~ALREPORT2009-10

species clone (SS-1725-22) of Solanum spegazzinii; As a source higher frost tolerance intro duced through ssp andigena a cultivated clone

Ornamentals 3

Rose 2 Ideal rootstock resistant to powdery mildew

Canna 1 Unique new flower color, flowers in cluster form

Total 131

Technical assistance to NAGS/ NBPGR regional stations for maintenance of MTS facilities:

Technical support for maintenance ofMTS facilities was provided to Regional Stations Bhowali, Shillong and Hyderabad. Technical support was also provided to AICRP on Small Millets, U AS, Bengaluru for smooth functioning of the MTS facility. Arrangements for the standby electrical supply to LTS during any unexpected breakdown were made and re­insulation on suction line of all LTS and MTS in new building was completed. Proper wiring of old building MTS was also accomplished. Technical support was provided to Directorate of Sorghum Research, Hyderabad for designing and preparing specifications for installation of MTS facility.

Table 4: Status of base collections in National Genebank Conserved at -18°C

Crop Group No. of Accessions Present status Others 3 2,171 stored (1.1.09 to as on 31.12.2009 Fibre Crops 984 11,486

31.12.09) Brinjal 59 4,003

Paddy 1,775 87,985 Chilli 2 2,011 Wheat 146 39,043 Others 366 18,098 Maize 116 7,653 Vegetables 427 24,112 Others 50 11,235 Custard apple 59 Cereals 2,087 1,45,916 Papaya 23 Sorghum 431 19,861 Others 300 Pearl millet 129 8,118 Fruits 382 Minor millet 683 21,141 Opium poppy 350 Others 90 ;4,474 Ocimum 3 402 Millets and forages 1,333 53,594 Tobacco 5 1,466 Amaranth 404 5,438 Others 186 4,099 Buckwheat 52 853 Medicinal & Aromatic Others 336 Plants & Narcotics 194 6,317 Pseudo Cereals 457 6,627 Coriander 80 573 Chickpea 183 16,867 Sowa 59 Pigeonpea 11 11,103 Others 246 2,104 Mung bean 44 3,636 Spices & Condiments 326 2,736 Others 533 25,264

Pongam oil tree 395 Grain legumes 771 56,870

others 30 2,038 Groundnut 70 14,346

Agro-forestry 30 2,433 Brassica 31 10,153

Lentil Safflower

7,712 239 7,605

Others Pigeon pea 2,523

1,335 22,890 Oilseeds

Duplicate Safety 10,235 1,675 54,994

Cotton 978 6,409 Samples

Jute 3 2,906 Total 8,284 3,75,702

I J OF GERMPIASM CO\lSFRVAfIO~ 37

Re;"arch Programme (Programme Code: Title and PI)

PGRJGCN-BUR-DEL-01.00:Ex situ conservation of Plant Genetic Resources of Agricultural and Horticultural Crops using Conventional Methods (Kalyani Srinivasan, up to 29.4.2009, RK Tyagi, w.e.f. 30.4.2009)

Research Projects (Code, Title, PI, Co-Pis and Associates)

PGRJGCN-BUR-DEL-01.01: Management of Information and National Germplasm Conservation Network (RC Agarwal, R K Tyagi (w.e.f. 30.4.2009), Anjali Kak, B P Dahiya, Rajvir Singh, Rita Rani, Smita Jain and Rajiv Gambhir)

PGRJGCN-BUR-DEL-01-02:Conservation of grain legume germplasm using conventional seed storage methods (Neeta Singh, Chitra Pandey)

PGR/GCN-BUR-DEL-01-03: Conservation of paddy germplasm using conventional seed storage methods (Kalyani Srinivasan; RK Tyagi (w.e.f. 30.4.2009), AD Sharma)

PGRJGCN-BUR-DEL-01-04: Conservation of oilseed and fruit crops germplasm using conventional seed storage methods (J Radhamani, Neeta Singh)

PGR/GCN-BUR-DEL-01-05: Conservation of cereal germplasm excluding paddy and agro-forestry species, using conventional seed storage methods (K Srinivasan, J Radhamani, Manju Uprety)

PGRJGCN-BUR-DEL-01-06: Conservation of spices, medicinal and aromatic plant, and pseudo-cereals germ plasm using conventional seed storage methods (Veena Gupta, Anjali kak)

PGRJGCN-BUR-DEL-01-07: Conservation of millets germplasm using conventional seed storage methods (Sushil Pandey, Chitra Pandey)

PGR/GCN-BUR-DEL-01-08: Conservation of forage and fibre germplasm using conventional seed storage methods (Anjali Kak, Veena Gupta)

PGRJGCN-BUR-DEL-01-09: Conservation of vegetable germplasm using conventional seed storage methods (Chitra Pandey; Neeta Singh, Sushil Pandey)

PGR/GCN-BUR-DEL-01-10: Investigating seed dormancy, seed storage behaviour, and physiological and biochemical changes during storage. (J Radhamani; Kalyani Srinivasan Neeta Singh, Veena Gupta, Anjali Kak, Chitra Pandey, Sushil Pandey)

Externally-funded projects

• Biodiversity conservation of targeted rare and endangered medicinal plants of Western Ghats (Veena Gupta)

• Collection, assembly and conservation of genetic resources of physic nut (Jatropha Linn.) (J Radhamani )

• National Plant Variety Repository (Kalyani Srinivasan)

• Establishment of national rice resources database (w.e.f. July, 2009) (SK Sharma, Kalyani Srinivasan, Rakesh Singh, RC Agrawal)

38 ANNUAL REPORT 2009-IO

4. DIVISION OF PLANT QUARANTINE

Summary: A total of 36,076 accessions (76,381 samples) of imported germplasm accessions as well as trial material entries of various crops were processed of which 4,891 were found infested. These samples included true seeds, rooted plants, cuttings, rhizomes, suckers, bulbs, nuts and tissue culture plantlets. The infested samples comprised insects (1 75), nematodes (1,869), fungi! bacteria (2,645), viruses (27), weeds (175) and several exotic pests. Of the 4,891 infested! infected! contaminated samples, 4,807 were salvaged through fumigation, hot water treatment (HWT), X-ray radiography, pesticidal dip, mechanical cleaning and growing-on test. Eighty four samples were rejected including thirteen samples of Pavaver somniferum from Germany infected with Dendryphion penicillatum and one sample of Glycine max from USA infected with downy mildew fungus (Peronospora manshurica) , the pests not yet reported from India. The remaining infested samples were salvaged through physico-chemical methods. A total of 1,405 samples were processed for export of which 97 infested! infected samples were salvaged and 17 Phytosanitary Certificates were issued. Five hundred and sixty six samples were received from Germplasm Conservation Division for seed health testing of which 265 samples were subjected to X ray radiography and 122 samples were salvaged. Six samples were rejected as they could not be salvaged. A total of 136 samples of exotic germplasm of different legume crops imported from different countries! sources were grown in post-entry quarantine (PEQ) greenhouses and the harvest of the plants free from viral symptoms only was released to the indenters. Plants showing virus symptoms tested by electron microscopy and using 25 specific available antisera to various seed-transmitted viruses in ELISA. Quarantine processing of imported transgenic planting material, 205 samples for research revealed, fungi and insect infestation in maize and rice; absence of terminator gene was ensured and all samples were salvaged prior to release.

4.1 Import Quarantine

4.1.1 Quarantine examination: A total of 36,076 accessions (76,381 samples) comprising germplasm accessions, nurseries/ trial breeding material of various crops including both true seed and vegetative propagules were processed for the detection of associated exotic insect pests, and mites, plant parasitic nematodes, plant pathogens (fungi, bacteria, viruses) and weed seeds by various detection techniques. Of the import samples, 566 samples were exposed to X-ray radiography for detection of hidden infestation of bruchids and chalcids. A total of 4 ,891 samples were found infested/ lnfected/ contaminated. Of these, 210 samples were found infested with insects/ mite including 38 with hidden infestation; 1,408 samples infected with nematodes, 2,658 found infected with fungi! bacteria, 27 with viruses and 175 .. "ith weeds. A number of pests of major quarantine importance were intercepted (Table 1).

4.1.2 Salvaging of infested! infected! contaminated germplasm: Of the total 4,891 infested/ infected/ contaminated samples, 4,807 were salvaged by various disinfestation techniques/ treatments like mechanical cleaning to remove damaged! abnormal seeds, soil clods (31 6), plant debris etc., fumigation with ethylene dichloride-carbon tetrachloride (EDCT) mixture @ 320 mg! litre for 48 h at 300C under normal air pressure against insect infestation and hot water treatment (HWT) at 52°C for 30 minutes for various seed-borne pathogens and nematodes and X-ray screening for hidden infestation, pesticidal dip/ spray for vegetative propagules. Samples

DI\tISION OF PLANT QUARANTINE ____ _

infested with insects/ mites (192) were salvaged through fumigation (50), seed dressing (2), X-ray radiography (38) and pesticidal dips (120); 1,408 samples infected with nematodes were salvaged by hot water and 468 by nematicidal dip treatments; 2574 samples infected with fungi/ bacteria were salvaged by fungicidal seed treatment (740) and ethyl alcohol wash (1834); and samples infected with viruses were salvaged through grow-out test. Thirteen samples of Papaver somniferum (from Germany) and one sample of soybean (from USA) infected with Dendryphion penicillatum and Peronospora manshurica, respectively were rejected as these pathogens are not yet reported from India; Five samples of Musa spp. and 65 samples of maize were also rejected as these were received in highly contaminated and rotten conditions.

Prophylactic treatments: A total of 48,434 seed samples were subjected to fumigation, 923 samples of vegetative propagules were given pesticidal dip/ spray treatment, 115 samples of mango seed were given pesticidal seed dressing and 11,089 samples of paddy were given mandatory hot water treatment. In order to prevent the introduction of new strains of tobamo viruses through seeds, all the introduced germplasm samples of chilli (156), and tomato (136) were subjected to prophylactic seed treatment with 10% tri-sodium orthophosphate.

4.1.3 Grow-out test in post-entry quarantine nursery (PEQN)! Greenhouses: International nurseries trial material (4,302 entries) comprising wheat

39

(2,43{) from ClMMYT (Mexico), ICARDA (Syria) and Nepal, barley (591) from ICARDA (Syria) and triticale (100) from ClMMYT (Mexico), exotic wheat (1,129) from CIMMYT (Mexico) and ICARDA (Syria) and. registered germplasm of wheat (51) were grown in PEQN at NBPGR.

. A total of 136 samples of exotic germplasm comprising Glycine max (41), Phaseolus vulgaris (2), Pisum salivum (7), P. fulvum (2), Vicia faba (55), v. hyaeniscyamus (1), V. hybrida (2), V. johann is (1), V. johann is var. johannis 0), v. kalakhensis (1), v. melanops (2), v. norbonensis (2), v. sativa (1), v. sativa subsp. amphicarpa (2), v. sativa subsp. cordata (2), v. sativa subsp. marcocarpa (2), v. sativa sub sp. Nigra (2), V. serratifolia (2), Vigna mungo (4) and Vigna radiata (4) were grown in Post-entry Quarantine Greenhouses. The plants showing virus-like symptoms

. were tested by electron microscopy and using specific antiserum against various seed-transmitted viruses using enzyme-linked immunosorbent assay. The harvest from only healthy plants of different accessions was released to the indenters. The interceptions made are presented in Table-I.

4.2 Export Quarantine

A total of 493 accessions (1405 samples) of various crops intended for export to various countries were processed for detection of associated pests. Of these, 91 samples were found infected and all were salvaged. The interceptions include Callosobruchus chinensis in Lathyrus sativus, Alternaria padwickii, Drechslera oryzae, Fusarium moniliforme, Rhizoctonia bataticola, Ustilaginoides virens, Sitophilus oryzae, Sitotroga cereallela, Rhizopertha dominica, Cryptolestes pusillus, Lophocaterus sp. in Oryza sativa; C. maculates in Phaseolus vulgaris; D. sorokiniana, F moniliforme, Tilletia indica, R. dominica, S. oryzae in Triticum aestivum and Callosobruchus cizinensis, C. rnaculates in Vigna radiata. Seventeen Phytosanitary Certificates were

issued

4.3 Detection of Viruses in In vitro Cultures of Germplasm Meant for Conservation

A total of 54 Allium accessions in vitro conserved at TCCU were tested by ELISA against six commercially available Allium antisera (kits) including Carnation latent l irus (eLV). Garlic common latent virus

~(I

(GCLV), Leek yellow stripe I'ints (LYSV), Onion yellow dwarf virus (OYDV), Shallot latent virus (SLV) and Shallot yellow stripe virus (SYSV). Results indicated that out of 54 in vitro cultures tested by ELISA, CLV was detected in 12 accessions, GCLV in 14 accessions, LYSV in one accession, OYDV in 19 accessions, SLY in two accessions and SYSV in 17 accessions. Electron microscopy revealed the presence of flexuous particles of different size belonging to Carlavirus and Potyvirus groups. Allium sativum in vitro accessions found to be free from the six viruses tested by ELISA are, IC334846, IC49376-A, IC374979, IC48562, IC35231, IC48051, IC274944, IC32680, IC374978, IC375039, IC375005, IC4938l-1, IC141246, IC374963, IC212352.

Pre-testing of field grown 27 exotic garlic accessions meant for conservation undertaken against six viruses viz. CLV, GCLV, Garlic virus C, LYSV, OYDV and SYSV by DAS ELISA. Viruses detected include GCLV in four accessions and Garlic virus C in 18 accessions. Garlic virus C is not reported from India and is therefore of quarantine importance. Garlic accessions imported from USA are withheld from further multiplication and in vitro conservation.

Twenty strawberry in vitro accessions were tested against six viruses viz. Arabis mosaic virus, Raspberry ring spot virus, Strawberry latent ring spot virus, Tabacco necrosis virus, Tomato ring spot virus and Tomato black ring virus. None of the accessions were found to be infected with any of the 6 viruses tested by DAS-ELISA.

4.4 Supportive Research

4.4.1 Efficacy of microwave radiation treatment: Paddy seeds infested with "white tip nematode" of rice were treated with microwave radiations at 1.35 kW and 2,450 MHz frequencies in the domestic microwave. Seeds (25g in each packet) with 10% moisture content in yellow colored paper packets required an exposure of 50 seconds, while seeds (25g, 3% moisture) in open Petri dish required less time exposure (30 seconds) for complete control of nematodes.

4.4.2 Potential quarantine pests for India in grain legumes: Information on pests of grain legumes (39 crops of 19 genera were compiled on the parameters viz., scientific name of the pest! synonym(s), Order/

AANUAL RFPORT 2009- 10

Family, pathway of introduction, host range, geographical di tribution, economic losses/ physiological variation and phytosanitary risk. There are about 146 insects/ mites,

40 nematodes, 36 fungi, 12 bacteria and 42 viruses of quarantine significance in grain legumes not yet reported from India.

Table 1: Pests Intercepted in the Exotic Germplasm during the Period under Report

Pest Host Sourcel Country

Insects and mites

*Blapstinus histrichus Carthamus tinctorius USA

Bruchus emarginatus Pisum sativum Spain

"B. ervi Lens culinaris ICARDA (Syria)

B. lentis L. culinaris ICARDA (Syria)

Callosobruchus maculatus Vigna mungo, V. radiata Nepal

Carpophilus hemipterus Zea mays USA

Mango stones Israel

Coccus hesperidium Theobroma cacao UK

Parlatoria blanchardi Phoenix dactylifera Egypt

Polyphagotarsonemus latus T. cacao UK

Silophilus zeamais Z. mays Argentina, Philippines, Thailand, USA

SItotroga cerealella Z. mays Philippines

Systole coriandri Coriandrum sativum UAE

Tribolium castaneum Z. mays Thailand

*Typhaea stercorea Mango stones Israel

Nematodes

Aphelenchoides besseyi Paddy Philippines, USA Tylenchorhynchus sp. Phoenix dactylifera Egypt Tylenchorhynchus sp. Citrus sp. Brazil Helicotylenchus sp. Citrus sp. Brazil

Fungi

Alternaria brassicae Brassica juncea Belgium A. brassicicola B. juncea Belgium A. cucumerina Cucumis melo USA A. raphani Camelina sativa Australia A sesame Sesamum indicum USA Botryt;s cinerea Aegilops spp. USA

Brassica juncea Belgium Colletotrichum dematium Jatropha curcas Mexico

Cicer arietinum Canada C. gloeosporioides Capsicum annuum Taiwan ·Dendryphion penicillatum Papaver somniferum Germany

sub. sp. setigerum Papaver bracteatum Germany

Drechslera maydis Zea mays Indonesia, Philippines D. sorghicola Zea mays Thailand D. sorokiniana Hordeum VUlgare Syria

Aegilops spp. USA

Triticum aestivum Mexico Fusarium moniliforme Aegilops spp. USA

.__~ Brassica juncea Belgium

r ()f< PLA"I'fQUARA."'ITINE 41

\

Fusarium solani Macrophomina phaseolina Melanospora sp.

' Peronospora manshurica Puccinia carthami

Puccinia helianthi Sclerotinia sc/erotiorum Tolyposporium penicillariae

Capsicum annuum

Capsicum sativus Cicer arietinum Citrullus vulgaris Cucumis melo Cucumis sativus Cucurbita maxima

Cumin spp.

Foeniculum vulgare Geranium robestianum Gossypium hirsutum Helianthus annuus Hordeum vulgare Impatiens spp.

Jatropha curcas

Lycopersicon esculentum Oryza sativa Papaver bracteatum Papaver somniferum sub. sp. setigerum Pennisetum glaucum Sesamum indicum

Solanum aethiopicum Solanum melon gena Trifolium prantense Trigonel/a foenum-graecum Triticum aestivum Zea mays

Brassica juncea

Lycopersicon esculentum Zea mays

Glycine max

Carthamus tinctorius Helianthus annuus Brassica juncea Pennisetum glaucum

Xanthomonas campestris pv. campestris Brassica juncea Viruses

Alfalfa mosaic virus

Bean yellow mosac virus

Broad bean stain virus' Broad bean wilt virus

Cowpea mild mottle virus

Grapevine fan leaf virus

Pea enation mosaic virus' Pea seed-borne mosaic virus

42

Glycine max Vicia faba Vigna mungo?

II. faba II. faba G max?

II. faba II. faba G max?

II. mungo?

II. faba II. fpba?

Czech Republic, France, Spain, Taiwan, USA

Czech Republic

Canada, USA

Thailand

Italy, USA

Czech Republic, Korea

Spain

UAE

UAE

UK

Israel

France

Canada

UK

Mexico

Italy, France, Taiwan

Philippines

Germany

Germany

USA

USA

France

USA

Japan

UAE

Australia, Mexico, USA

Netherland, Nigeria, Philippines, South Africa, Thailand USA

Belgium

France

USA

USA

USA

France, USA

Belgium

USA

Belgium

AVRDC (Taiwan)

ICARDA, Syria

Bhutan

ICARDA, Syria

ICARDA, Syria

USA

ICARDA, Syria

ICARDA, Syria

USA

Bhutan

ICARDA, Syria

ICARDA, Syria

ANNUAL REPORT 2009-10

Weed seeds

'Anthemis cotula Barley ICARDA (Syria)

• Carrichtera annua

Cenchrus pauciflorus 'Galium boreale

'G. trifidum 'Ostrya virginiana 'Phalaris arundinacea 'polygonum cilinode Linseed Switzerland

p. convolvulus Barley ICARDA (Syria)

Wheat USA

P hydropiper Lentil ICARDA (Syria)

*P hydropiperoides .p /apathifolium Linseed Switzerland

*Ranunculus bulbosus Barley ICARDA (Syria)

"Taraxacum otticinale

* Pest not yet reported from India

'? Pest present in India but not recorded on the host on which intercepted

Table 2: Pests intercepted in material meant for pest free conservation in NGB

Pests

Insects

Callosobruchus ana/is C. cajanus C. chinensis C. macu/atus C. phaseoli

C. theobromae

Lasioderma serricorne Rhizopertha dominica Sitophilus oryzae Tribolium castanium S. oryzae

S. zeamais Sitotroga ceralella Systole coriandri

Spermophagus albospersus S. albiofagiatus Spermophagus sp.

Larval forms

Pathogens

Colletotrichum gloeosporioides

Drechs/era oryzae

Fusarium moniliforme

Host

Vigna morina Cajanus cajan Macrotyloma unit/orum Vigna radiata, V. mungo Lablab purpureus,

'v. unguiculata 'Glycine max

V. unguiculata Coriandrum sativum Pennisetum glaucum

Oryza sativa

Zea mays

0. Sativa Coriandrum sativum Hibiscus subdarilfa Abelmoscus spp.

Abelmoscus spp.

'Ziziphus numularia

V. mungo

Oryza sativa

O. sativa

Indigofera tinctoria, V. vexillata

Dolichus bean, Foeniculum vulgare, Pillispara bean, Trigonella

DI\110'\lOFPLANTQUARANTINE _______ _

Lakshadweep

Orissa

Source

Andhra Pradesh, Srinagar

Uttarakhand

Andhra Pradesh

Karnataka, Rajasthan

Sri nagar

Uttarakhand

Andhra Pradesh, Srinagar

Andhra Pradesh

Karnataka, Rajasthan

Andhra Pradesh

Uttarakhand

Thrissur

Rajasthan

NBPGR Cuttack

NBPGR Bhowali, VPKAS Almora

NBPGR Bhowali, VPKAS, Almora

NBPGR Thrissur

NBPGR Hyderabad

43

foenum·graecum, V. unguiculata

Coriandrum sativum, Fenugreek, Hot pepper

NRC Seed Spices, Ajmer

F. solani Macrophomina phaseolina

Glycine max

V. radiata, V. mungQ

Sesamum indicum

V. radiata Bauhinia semla

'Glycine max

Pithoragarh, Uttarakhand

NBPGR Cuttack

NBPGR, New Delhi & Hyderabad NBPGR Hyderabad

Uttarakhand PeronosPQra manschurica

Phoma herbarum

Phomopsis spp.

Rhizoctania spp.

Sclerotina sclerotiorum

Ustilaginoidea virens

Coriandrum sativum, V. unguiculata

Indigofera tinctoria

NRC Spices, Ajmer

NBPGR Thrissur

NBPGR Thrissur 0. sativa

0. sativa

* Samples rejected

4.6 Achievements in Externally- funded Projects

4.6.1 National Containment! Quarantine Facility for Transgenic Planting Material (DBT): With the

approval of RCGM, 482 samples of imported transgenic

planting material comprising Arabidopsis tlzaliana (48) from USA for Dupont India, Hyderabad; Gossypium Izirslltum (29) "iz., 10 from Israel for Monsanto Genetics,

Mumbai,5 from USA for Ankur Seeds, Nagpur and 14

from USA for Monsanto, Mumbai; Oryza sativa (392)

viz., 68 from Belgium and 5 from USA for Bayer

Bioscience, Hyderabad, 296 from Belgium for Dupont

India, Hyderabad, 14 from Australia for Tamil Nadu

Agriculture University and 9 from China for Pioneer

Overseas Corporation, Hyderabad; Zea mays (13) viz., I from Argentina, 2 from Philippines and I from Puerto

Rico for Syngenta India, Mumbai, 6 from USA for

Pioneer Overseas Corporation, Hyderabad, I from USA

for Dow Agro Sciences, Mumbai and 2 from USA for

Dupont India, Hyderabad were received during the period

for quarantine processing.

The transgenes present in these crops included, CaM!' 35S in Arabidopsis tlzalimw; Silencing gene for the

rice Myc gene and rice Phytochrome & Flowering Time

(PFTI) by RNA interference (RNAi) in rice; cr ..... JAb ill maize and rice, crylCa, cryJC, cryJAc, cry2A in

rice, cryJ F & Pat in maize for imparting resistance

against insect-pests; Bar in rice for resistance to

glufosinate amonium herbicides; lIlep!'ps, Cp4ep.\ps in

maize for tolerance to glyphosate herbicides.

44

NBPGR Bhowali, VPKAS Almora

Seeds of transgenic material were subjected to various tests in containment for detection of insects, mites, nematodes, bacteria, fungi and viruses. Important pests intercepted included a fungus , Fusarium lI1oniliforme in rice from Australia and Belgium and in maize from the Philippines and an insect, Rlzizopertlza dominica in rice from China.

A total of 38 samples viz., Arabidopsis tlwliallCl (10), rice (25) and maize (3) were found infected/ infested with various pathogens/ pests were salvaged. Rice (392) samples were given mandatory hot water treatment at 52°C for 30 min. against various seed-borne pests. Besides, infected samples of maize were salvaged by giving fungicidal treatment with bavistin and thiram.

DNA was extracted from the seedlings of all the transgenic lines received and were tested for the terminator gene using primers designed for ere recombinase gene. All these lines showed negative results for the terminator gene. The transgenic planting material was also tested for specific transgenes. Multiplex PCR protocols for simultaneous detection of two or more genes have also been standardized.

In all eight post-entry quarantine inspections were undertaken viz., one for cotton at Ankur Seeds, Nagpur, three for maize one each at Dupont, Hyderabad Monsanto, Bangalore and Syngenta, Aurangabad and four for transgenic rice at Bayer Bioscience, Medak District, Hyderabad. The crops were visually inspected for symptoms of pests/ diseases and suspected infected samples (k af, stem, <,oi l etc) Wert: tested at NBPGR.

A"J l AL RE PORT2009·10

The viruses intercepted in transgenic maize grown at Syn enta, Aurangabad are Maize chlorotic mottle virus (MC MV) from Puerto Rico, Maize dwarf mosaic virus (MDMV) from the Philippines and Wheat streak mosaic pin \ (WSMV) from the Philippines and Puerto Rico. MCMV and WSMV are not yet reported from India ane are of quarantine significance.

4.6 2 Network Project on Diagnostics of Emerging Plant Viruses (ICAR): Double Antibody Sandwich­ELISA and RT-PCR protocols developed for detection of BCMV and SMV were further tested and confirmed that the protocols are reproducible.

4.6.1 Development of Technology for Detecting Pre 'ence of GMOs in an Unknown Sample and its Utilization in dealing with Bulk Samples (DAC): The polyclonal antisera was obtained after immunization of rabbits with recombinant protein o{npt-II and IgG of Bpt-II was purified. DAS-ELISA was performed using IgG and enzyme conjugate at 1: 100, 1 :200 and 1:500. The optical density values of Bt cotton seeds were found to be twice that of negative control. However, the expE riments are in progress to check the repeatability/ repre ducibility of the results obtained.

The recombinant protein for pat/ bar and hpt was produced. The polyclonal antisera was obtained after immunization of rabbits with recombinant protein of pat! bar and hpt.

l

The npt-II was successfully detected in Jai Bt seeds known to have npt-II using dip sticks of Agdia Inc., USA. Non Bt seeds were found to be free from npt-II. Dip sticlrs developed by CICR for detection of npt-II did not give the anticipated results.

4.6.4 Studies on the Potential of Electron Beam Irradiation as Quarantine Disinfestation Treatment against Insect-pests in Seeds (BRNS, DAE): Seeds of green gram, soybean and gram! chana uninfested and infested with different developmental stages and adults were irradiated with different EB doses at RRCAT, Indore. Irradiatio~ of infested green gram seeds revealed dosc/ energy level dependent insect mortality response. Irradiation of uninfested green gram seeds with EB doses have no significant effect on percent seed germination. Highcr doses affected seedling vigour and vigour index. Irradiated seeds of green gram were also grown in Containment Facility for observing chlorophyll mutations.

1'1 IO~OrPlANTQUARA"I'n~E ______ _

Irradiation of infested soybean seeds revealed upto 85% reduction in adult emergence at different doses. Electrical conductivity and tetrazolil,lm test for viability conformed to germination and vigour parameters. Irradiation of chickpea seeds infested with C. chinensis stages revealed a declining trend in adult emergence with increase in EB doses in all treatments. These doses have no negative effect on % germination but affect the vigour index of seeds.

4.6.5 Preparation of digitized keys for quick and reliable identification of insect pests of Family Brucbidae of quarantine significance (DAC): The annotated checklist of insect pests belonging to Family Bruchidae of quarantine significance to India was updated with the information collected from various sources like databases and libraries in IAR!, New Delhi. ZSI, Jabalpur and the internet. Collected literature from various sources to develop the database on the Genera of quarantine significance viz., Acanthoscelides, Bruchus, Bruchidius and Callosobruchus. Compiled and collated the relevant information of bruchid of quarantine significance under the heads: Scientific name - Genus and species, Synonyms, Host Plants/ species, Morphology/ key characters, Comparative notes­comparison with other known species, Geographical distribution! reported from, Habitats, storage records and biology - life cycles, generations per year, developmental phases, diapause etc., Symptoms of damage, Economic impacts, Control measures. Phytosanitary significance and References. A pictorial identification key has been developed for identification of fifty one bruchid genera.

View of photographs in the database

45

K,'~ to thr 'p,,,,irs or Cu//altlbrudlll\

1, l.utl'r t~,c'lh l,r hind (tlUll( (un'IJl(:lIIuU..Jl 1011£« thaa thl" "'1 bh,al oiatrr loo[b, 8Gck talk ... bbd.,. "'illl II ru.lltl III or I"" . 1,1 ... 1;. aad br,"~\ \11'1. aa Ih< dUllWJI I taglb. ~ "''LJ 0 mm _ ••••• • •• ••• ..,.... ._ • .If*"'.J!I"~

IGatr l(Molh or iliad rtmur ".IUI ulIl~ ai lona lI\, or ,luutu 1111111. Olll('r lVOI": i( ' •• 1'1 1001. 1\ I(laln IU. .. ", .. , Ib ... coioul 1\ Dul _1.10"" 80dl calkl" lad ~I_ .1.11 ., "boll' ; If Uludt h bbd •• Ibra ~uJ pallen! 011

::~.~ ,,'.\ Ift~.i:.'.i.ra:~:. I~.~:~ :::Ol~. h .. ~~~'( .. ~ti'h~:. IODen , ... (Juln 1<IOlb ... d l .. nJlh h moJ~ Ib.~ .. ;

! Boch (UIur,l "ub tlull1\bll .. or uDif(Jmlll hl,u~ .... ult-"s..c ""tat lattr'IOC'n .. d ",th !tohl,n OOh, .. I ... I:ugr. bulboa,. prolmlwlIl; aatnl'l.wIl"Kr 11.1111 10 Iburu. ,.b ""tnlt Itll"ft .... Ioal vt.mt.l~ rtddhh r", b$ack hiad (tI'lUII' biurj •• u'. II Lu-er I.(alr ,",III prf'""a' "II .1I1t« uriaa. 10ft(1II of •• '~r (aria" ~1i1i:"lh ,maUtf" afttl bl.... .. , __ , .. 1I1/o'tf1ICltlI ..

lh .. h ",>1<1, .~\tf lI\ !tbo~f'_ rlillClf u,ual~ \\lIh "alC' marl..~ (Rfd, \C'IIo\\hh·,w. (It' b. ""''). IhfW and thr \tla .. Oft ,h .. dun of tualUfT "1k~Urk'11\ (ormia, a d"narl and ((luIU,h.S (1, .. 101' pattffll. It"lI¥th lI"u:;alh k,' Ihall "

.l

3. \I:du •• d rrDlA., mu!'\' urlC',~ \lIrul.u; :ulcn ... C' 'UDII;II'jaIM tH>tb "'''flo; lattrid blac:k ~JlOh o. ucla d~tr"n u·paull·t!ln a band or " hit(' wt.ll' ; P\l;iriiolllhtdian bu,l uf "hilt ~('fU I' .... ~nf ill blJCIII ~t\t'\; \a(CII~ pro' idc'd \,"h JIIlllur l:ah·r.llftlulu:d liI .. I1;,: p.IIr.mIC' .. allllh 'poatl-\hlll"·,1 _ _ _ ~..... ..... ... ..- "./"

Inner 100Ib of hilld r"mul tn.,r(' .lIaIlIuM;h 1""1 .. , oul", I_fill, on ... eqllal 'II It",,'" Ullin toolh MDUI,,_, , .. nK,t'f Ih~n •• Itl, Pmaolvm 11\11 .. 11\ \\llb. dl'ljDCI plIItltr. •• _.. .. .... • "

Identification Keys

4.6.6 Development of Quarantine Disinfestation Treatments (Thermal! Modified Atmosphere) against Storage Insect-pests Infesting Walnut (DAC): Modified atmosphere (MA) with elevated CO

2

has emerged as a potential alternative to chemicals for postharvest disinfestation of dried fruits and nuts. Modi­fied atmospheres were created either by depletion of oxygen "to asphyxiate organisms or the addition of car­bon dioxide or to act directly and kill them. The efficacy of modified atmosphere (different combinations of CO

2

and N) treatments to adults of four important storage pests of walnut viz., Ephestia cautella (almond moth), Oryzaephilus mercator (saw-toothed beetle), TriboLium castaneum (red flour beetle) and Trogoderma granarium (khapra beetle) infesting kernel was investi­gated using Pusa Controlled Atmosphere generation System. The bioassay was conducted in specially de­signed airtight glass containers and was monitored regu­larly for CO, retention using a CO, and 0 2 gas analyzer. LT50 values- for these insects E. c""auteLLa, 0. mercator, T. castaneum and T. granarium were 3.96, 6.68, 12.15 and 8.12 hrs, respectively. The results revealed that E. cautella is the most susceptible to all the MA treatments.

Research Programme (Programme Code: Title, Leader)

The potential of modified atmosphere as an efficient dis­infestation technique for the post harvest management of pests in walnut kernel is being further exploited.

4.6.7 Development of Farmer Friendly Diagnostic Kits for Transgenic Event Seed Purity: ELISA-based diagnostic kits developed by CICR, Nagpur for detec­tion of Cryl F and Vip 3 did not give the anticipated results.

The npt-II was detected in Bt cotton seeds (Jai Bt) us­ing ELISA-based diagnostic kit (Agdia Inc., USA) and non-Bt seeds were found to be free from npt-II . The crylF was successfully detected using ELISA-based diagnostic kit (Envirologix Inc., USA).

4.6.8 ICAR-CABI collaborative project on the study of biological control of invasive plant spe­cies and Indian natural enemies Component A: Hi­malayan balsam (Impatiens gLandulifera): Undertook two surveys at various sites in Kullu region for collec­tion of fungal pathogens infecting Himalayan balsam. Collected balsam seedlings infected with stem rust (Puccinia sp.) and Septoria sp. Experiments were con­ducted using various parameters to inoculate balsam seedlings with these two pathogens.

4.6.9 ICAR-CABI collaborative project on the study of biological control of invasive plant spe­cies and Indian natural enemies Component B: Hedychium spp. complex (H. gardneriarum, H. flavescens, H. coronarium): Two surveys were under­taken in Sikkim areas for collection of fungal pathogens and insect pests infecting! infesting wild ginger. Collected plant material as well as infected! infested samples for studying their potential as natural enemies under con­trolled conditions at NBPGR. Insect specimens submit­ted to National Pusa Collection at Division of Entomol­ogy, IARI for identification and pathogens submitted to Herbarium Cryptogamae Indiae Orientalis (HCIO) at Division of Plant Pathology, IARI

PGRlPQR- BUR-DEL-01.00 Quarantine Processing of Plant Germplasm Under Exchange and Supportive Research (RK Khetarpal)

Research Projects (Code, Title, PI, CoPls and Associates)

PGRlPQR- BUR-DEL-01.01 Quarantine processing of Germplasm for Joint inspection (PC Agarwal, Usha Dev, Shashi Bhalla, DB Parakh , Kavita Gupta, Charan Singh, Dinesh Chand, Ashok Maurya and KD Joshi)

PGR/PQR- BUR-DEL-01.02 Post-entry Quarantine Processing of Exotic Germplasm (RK Khetarpal, Arjun Lal, PC Agarwal, B. Lal, DB Parakh, V Celia Chalam, Charan Singh and Ashok Maurya)

46 ________________ ANNUAl,REPORT2009-IO

PGRlPQR- BUR-DEL-01.03 Quarantine Processing of Imported Transgenic Germplasm and Supportive Research (Manju Lata Kapur, Rajan, Gurinder Jit Randhawa, Shashi Bhalla, Baleshwar Singh, V Celia Chalam and Ashok Maurya)

PGR/PQR- BUR-DEL-01.04 Detection and Identification of Insect and Mite Pests in Quarantine and Supportive Research (Kavita Gupta, B Lal, Manju Lata Kapur, Shashi Bhalla and Charan Singh)

PGRlPQR- BUR-DEL-01.05 Detection and Identification of Nematode Pests in Quarantine and Supportive Research (Arjun Lal, Rajan and KD Joshi)

PGRlPQR- BUR-DEL-01.06 Detection and Identification of Fungi and Bacteria in Quarantine and Supportive Research (Usha Dev, PC Agarwal, Baleshwar Singh and Dinesh Chand)

PGRlPQR-BUR-DEL-01.07 Detection and Identification of Viruses in Quarantine and Supportive Research. (V Celia Chalam, DB Parakh and Ashok Maurya)

PGR/PQR-BUR-DEL-01.08 Quarantine Treatments for Disinfestation of Germplasm Under Exchange against Insect and Mite Pests and Supportive Research (Shashi Bhalla, B. Lal, Manju Lata Kapur, Kavita Gupta, TV Prasad (w.e.f August, 2009),Charan Singh)

PGR/PQR-BUR-DEL-01.09 Quarantine Treatments for Disinfection of Germplasm Under Exchange against Nematodes and Supportive Research (Rajan, Arjun Lal, Z Khan (w.e.f August, 2009), K.D. Joshi)

PGRlPQR-BUR-DEL-01.10 Quarantine Treatments for Disinfection of Germplasm Under Exchange against Pathogenic Fungi and Bacteria and Supportive Research (Baleshwar Singh, PC Agarwal, Usha Dev, Dinesh Chand, KD Joshi)

PGRlPQR-BUR-DEL-01.11 Seed-health Testing for Conservation of Indigenous Germplasm Free from Pests (B Lal, Arjun Lal, Usha Dev, Manju Lata Ka,pur, Veena Gupta, Baleshwar Singh, Sushi! Pandey, Charan Singh, Dinesh Chand, Ashok Maurya, Smita Jain and KD Joshi)

PGR/PQR-BUR-DEL-01.12 Detection of Viruses in In vitro Cultures of Germplasm Meant for Conservation (DB Parakh, V Celia Chalam, Sandhya Gupta and Ashok Maurya)

PGRlPQR-BUR-DEL-01.13 Identification of weed seeds intercepted in quarantine and supportive research (Mool Chand Singh, Anjula Pandey and KD Joshi)

Externally Funded Projects

• National Containment! Quarantine Facility for Transgenic Planting Material (DBT) (RK Khetarpal, Gurinder Jit Randhawa, Manju Lata Kapur, V Celia Chalam and Kavita Gupta).

• Network Project on Diagnostics of Emerging Plant Viruses (ICAR) (RK Khetarpal, D.B. Parakh and V. Celia Chalam) upto 31.1.2009

• Development of Technology for Detecting Presence of GMOs in an Unknown Sample and its Utilization in dealing with Bulk Samples (DAC) (RK Khetarpal, Gurinder Jit Randhawa, V. Celia Chalam and Kavita Gupta)

• Studies on the Potential of Electron Beam Irradiation as Quarantine Disinfestation Treatment against Insect-pests in Seeds (BRNS, DAE) (Shashi Bhalla, SK Sharma, B Lal, Kalyani Srinivasan and Kavita Gupta)

• Preparation of Digitized Keys for Quick and Reliable Identification of Insect Pests of Family Bruchidae of Quarantine Significance (DAC) (Kavita Gupta, B Lal, Manju Lata Kapur, Shashi Bhalla)

• Development of Quarantine Disinfestation Treatments (Thermall Modified Atmosphere) against Storage Insect­pests Infesting Walnut (DAC) (Shashi Bhalla, B Lal, Manju Lata Kapur and Kavita Gupta)

• Development of Farmer Friendly Diagnostic Kits for Transgenic Event Seed Purity (ICAR) (RK Khetarpal and V Celia Chalam)

• Study of biological control of invasive plant species and Indian natural enemies viz., Component A: Himalayan balsam (Impatiens glandulifera) (ICAR-CABI collaborative project) (Usha Dev)

• Study of biological control of invasive plant species and Indian natural enemies viz., Component B: Hedychium spp. complex (H. gardneriarum, H. f/avescens, H. coronarium) (I CAR-CAB I collaborative project) (Kavita Gupta)

r 1\1 If) Of'PLA"JTQUARA"ITINF ______ _ 47

5. GERMPLASM EXCHANGE UNIT ,

Su..._y: During the period under report 36.076 accessions (76.381 samples) were imported from 46 countries. which included 30,589 germplasm accessions (32.317 samples) as well as trial material 5.487 entries (44.064 samples) of different agricultural and horticultural crops. Requirements for germplasm from abroad were met by arranging material from different Indian sources and 1320 samples of different crops were exported to six countries. A to1aI of 13.391 samples of different ClOpS were supplied to national users for utilization in various crop improvement programmes in the country based on requests received from research workers under Material Transfer Agreement (MTA)

5.1 Import of Plant Genetic Resources

The unit continued its efforts for germplasm introduction to meet the specific requirements of scientists working in ICAR research institutes, State Agricultural Universities (SAUs) other public organizations and private sector with R&D and non-governmental organizations (NGOs). Plant Genetic Resources introduction comprised material obtained on request from the scientists as well as collaborators for international trials to be conducted in India. Introductions of seed/plant propagules made during the year were as follows.

Accessions procured and processed

Germplasm

Trial

Transgenic material imported (samples)

No. of countries involved

36,076 accessions (76,381 samples)

30,589 accessions (32,317) samples

5,487 accessions (44,064 samples)

170

46

No. of Import Permit issued 605

5.1.1 Cereals: Aegilops comosa (43), A. geniculata

(53), A. markgrafii (53) , A. neglecta (50), A. peregrine(50), A. searsii (24), A. speltoides (112), A.

tauschii (147), A. triuncialis (66), A. umbellulata (54)

all from USA; Hordeum vulgare (2) from Canada, (600)

from Syria; Oryza alata (4), O. australiensis (5), O. barthii (1), O. glumaepatula (6) O. grandiglumis (1),

O. granulate (6), O. latifolia (6), O. longiglumis (3) ,

O. longistaminata (8), O. meridionalis (5,) O. minuta

(9), O. nivara (6), 0. officinalis (10), O. punctata (1),

O. rhizomatis (1), and O. rufipogon (25) all from

Philippines, O. sativa (3) from Bangladesh, (164) from

Belgium, (43) from China, (10) from France, (65) from

Indonesia, (980) from Kenya, (8229) from Philippines,

(39) from Singapore, (79) from USA, (31) from Vietnam

, Oryza sativa ssp. Japonica (13) from Australia, (2)

from Germany; Triticum aestivum (1) from Argentina,

(545) from Australia, (713) from Mexico, (4) from UK,

(324) from USA, (190) from Mexico, Triticum monococcum (300), T. turgidum (1) both from USA, T.

turgidum ssp. dicoccum (406) from Mexico; Zea mays

(36) from Argentina, (313) from Brazil, (1) from Chile,

(4) from Egypt, (8) from France, (1) from Germany, (10)

48

from Hungary, (250) from Indonesia, (6) from

Nigeria,(346) from Mexico, (103) from Philippines, (1)

from Puerto Rico, (90) from South Africa, (2081) from

Thailand, (39) from Turkey, (4669) from USA, (801) from

Zimbabwe. (Trials: Oryza sp 1190 entries,12,957

samples; Triticum sp. 2683 entries, 21,771 samples; Zea mays 124 entries, 663 samples)

5.1.2 Millets: Pennisetum glaucum (11) from Mali,

(1) from USA; Sorghum bicolor (51) from Australia, (924) from USA;

5.1.3 Grain legumes: Cicer arietinum (163) from

Australia, (3) from Canada, (15) from Ethiopia, (125)

from USA, (199) from Syria, C. echinospermum (2),

C. reticulatum (2) both from Syria; Lens culinaris (2)

from Syria, (3) from Nepal, Lens culinaris subsp.

odemensis (4), L culinaris subsp. orientalis (117), L

ervoides (16), L. Lamottei (1), L. nigricans (12) al1

from Syria; Lathyrus sativus (l) from Nepal;

Phaseolus vuLgaris (1) from Bhutan, (1) from Nepal;

Pisum sativum (1) from Canada, (6) Pisum sp. (2) from

Spain; Vigna mungo (2) from Nepal, V. mungo var.

mungo (2) from Bhutan, V. radiata (2) from Bhutan,

ANNUALREPORf2009- to

(2) from Nepal, (38) from Taiwan, (10) from Japan, V

unguiculata (44) from USA, V unguiculata subsp. III guiculata (11) from Taiwan, V unguiculata subsp. Sl ~'quipedaLis (16) V umbellata (1) from Japan. (Trials: Cicer sp. 382 entries; 3668 samples; Lathyrus sp. 54 to: tries, 486 samples; Lens sp. 277 entries, 1732 samples; Vida sp. 55 entries 249 samples all from ICARDA,

Syria)

5 1.4 Oilseed crops: Arachis hypogaea (4) from Niger, (230) from USA; Brassica barreLieri (3),

E;'assica cretica (2), B. elongata (5), B. gravinae (2)

at from Japan, B. juncea (1017) from Belgium, (40) from Canada, B. maurorum (3) from Japan, B. napus

(10) from Germany, (42) from Canada, B. nigra (48)

from Australia, (3) from Canada; Carthamus tinctorius

( 538) from USA; Helianthus dnnuus (51) from Argentina, (l71) from Australia, (1) from Canada, (62) from France, (l1) from Serbia, (1) from Turkey, (196); Glycine max (33) from Taiwan (9) from USA; Helianthus anomalus (2) H. atrorubens (2) H.

bolanderi (1) H. debilis subsp. cucumerifolius (2) H.

debilis subsp. debilis (1) H. debilis subsp. silvestris

(2) H. debilis subsp. tardiflorus (2) H. debilis subsp. vestitus (2) H. decapetaLus (2) H. deserticola (2) H.

exilis (3) H. gigantecus (1) H. hybrid (1) H.

maximilianii (1) H. moLlis (1) H. niveus subsp. canescens (3) H. niveus subsp. tephrodes (1) H.

occidentalis subsp. plantagineus (1) H. pauciflorus

(3) H. pauciflorus subsp. subrhomboideus (4) H.

petiolaris subsp. petiolaris (2) H. praecox (1) H.

praecox subsp. hirtus (2) H. praecox subsp. praecox

(1) H. praecox subsp. runyonii (2) H. strumosus (3)

all from USA; Ricinus cummunis (59) from USA; Sesamum indicum (31) from USA.

5.1.5 Fibre crops: Gossypium barbadense (4) from Israel, G hirsutum (312) from Israel and (19) from USA; Hibiscus sabdariffa var. sabdariffa (16) from USA; Unum usitatissimum (3) from Switzerland.

5.1.6 Forages: Avena sativa (4) from Bulgaria; Erachypodium distachyon (83) from USA; Trifolium

pratense (3) from Japan; Vicia hyaeniscyamus (l), V

/zybrida (2), V johann is (1), V johann is var. johannis

(I) , V kaLakhensis 0), V melanops (2), V narbonensis

(2), V sativa (1), V sativa subsp. amphicarpa (2), V

sativa subsp. cordata (2), V sativa subsp. marcocarpa

(2), V sativa subsp. nigra (2), V serratifolia (2) all from Syria.

5.1.7 Vegetables: Brassica oLeracea var botrytis (244)

from Netherlands; B. oleracea var capitata (344) from Netherlands, (5) from USA; B. souliei (2) from Japan; Capsicum annum (71) from Taiwan, (34) from USA, (1) from Czech Republic, (4) from France, (8) from Korea, (4) from Spain, (2) from USA; C. annuum var. grossum

(10) from Taiwan; C. lanatus (53) from USA, C. vulgaris (2) from China,(43) from Thailand; Cucumis

melo (4) from Italy, (9) from Netherlands, (5) from USA, C. melD subsp. meLo (33), C. melD var conomon (2), C. melD var. cantaloupensis (3) all from USA, C. sativus

(8) from Czech Republic, (62) from USA, C. sativus (2)

from Czech Republic, (13) from Korea, (4) from Thailand, (l4) from USA, Cucurbita maxima (3) from USA, C. maxima (2) from Spain; Luffa acutangula (6)

from USA; Lycopersicon cheesmaniae (1) from Taiwan, L. esculentum (5) from Bulgaria, (15) from Canada, (3) from Czech Republic, (6) from France, (6) from Italy, (3) from Spain, (344) from Taiwan, (1) from Turkey, (58) from USA, L. hirsutum (2), L. peruvianum

(6), L. pimpinellifolium (2) from Taiwan, L.

pimpinellifolium (2) from USA; Momordica charantia

(2) from USA; Solamum meLongena (11) from USA;

Citrus variety Tangerina Cleopatra (EC660562) from Brazil

( I RMPLAS\1EXf'HA;'~GE _______________ _ 4C)

,

Date palm variety Siwi (EC636502) from Egypt

S. aethiopicum (4) from France, S. chilense (2) from

Taiwan, S. lycopersicon (1) from UK, S. pennellii (1)

from Taiwan; Trichosanthes cucumerina (1) from USA.

5.1.8 Fruit crops: Citrus sinensis (8) from Brazil;

Phoenix dactylifera (2) from Egypt; Malus domestica

(4) from Italy, (14) from Switzerland; Mangifera sp. (117) from Israel; Musa sp. (88) from Belgium; Prunus

sp. (28) from USA; Punica granatum. (96) from USA;

Vaccinium corymbosum (6) from USA; Vaccinium

oxycoccos (1) from UK; Vitis vinifera (31) from France, (4) from South Africa.

5.1.9 Ornamentals: Gladiolus alatus (1), G.

brevifolius 0), G cardinalis (1), G carneus (1), G caryophyUaceus (1), G crassifolius (1), G dalenii (1),

G floribundus (1), G gracilis (1), G hollandii (1), G longicolis (1), G maculatus (1), G. oppositifLorus

ssp salmoneus (1), G orchidiflorus (1), G pritzellii 0), G quadrangulus (l), G recurvus (1), G saccatus

(1), G scullyi (I), G sp. (1), G trichonemifolius (1), G tristis (1), G uysiae (1), G watermeyeri (1) all from

South Africa; Primula veris (2) from UK; Primula vul­

garis (2) from UK; Ranunculus repens (1) from UK.

5.1.10 Medicinal and Aromatic crops: Galium

aparine (1) from UK; Geranium robertianum (1) from

UK; Impatiens arguta (1), Impatiens autiecoma (1), .

balfourii (l), I. balsomina (l), I. capensis (l), 1.

glandulifera (1), 1. hawkeri (2), l. namchabarwensis

(1), I. noli-tangere (1), I. omeiana (1), l. tillctoria (1), l. wallerana (1); Urtica dioica (1) all from UK.

5.1.11 Spices and condiments: Anethum sowa (1)

from UAE; Apium graveolens (1) from Vietnam; Bunicum persicum (2) from USA; Carum carvi (1);

Coriandrum sativum (1); Cuminum cyminum (1);

Foeniculum vulgare (I) all from UAE; Papaver

sominiferum (17) from Germany; Pimpinella anisum

(1); Trachyspermum ammi (1); Trigonella foenum­graceum (1); Nigella sativa (1) all from UAE.

5.1.12 Tubers: Ipomea batatas (225) from Peru; Solanum tuberosum (9) from Bangladesh, (2) from Canada, (3) from China and (22) from Peru.

5.1.13 Under-utilized crops: Amaranthus caudatus (4), A. dubius (14), A. hypochondriacus (13), A.

retroflexus (4), A. sp. (5), A. spinosus (6), A. tricolor

(20), A. viridis (8) all from Taiwan; Arabidopsis thaliana (4) from UK, (48) from USA; Camelina sa­

tiva (2) from Austria; Jatropha curcas (3) from Mexico;

Vigna umbellata (1) from Japan.

5.1.14 Plantation crops: Cocos nucifera (1) from Sri

Lanka; Theobroma cacao (2) from Philippines, (115) from UK.

5.1.15 Agro-forestry: Diplotaxis assurgens (2), D. catholica (2), D. erucoides (2), D. virgata (2) all from

Japan; Eucalyptus camaldulensis var. camaltereti (1),

E. cameldulensis var.cameldulensis (1), E.

gomphocephala (1), E. pellita 0), E. pellita x brassiana (1), E. smithii (1), E. tereticornis var.

camaltereti (1), E. tereticornis ssp. tereticornis (1),

E. tereticornis ssp.mediana (1), E. urophylla (2) all from Australia.

5.1.16 Sugar yielding: Saccharum spontaneum (1)

from Nepal.

50 _____________ ANNUALREPORT2009-IO

Table 1: Trait specific germplasm introduced

CroplEC NoJCountry

Hordeum vulgare EC657889 Canada

H. vulgare EC657888 Canada

Oryza sativa EC637732-35 USA

0. sativa EC659913-14 USA

0. sativa EC637984 Philippines

0. sativa EC638154 -161, 166-178 Philippines

EC639758 -797, 820-822 Kenya

EC657109 -118 France

O. sativa EC638162-165 Philippines

O. sativa EC659921 Vietnam

EC639584-757, 798-819, 823-826 Kenya

Triticum aestivum EC638278 USA

T. aestivum EC638314 USA

T. aestivum EC638315 USA

T. aestivum EC641860 USA

T. aestivum EC665054 UK

T. aestivum EC664600 Argentina

Zea mays EC659915-17 Nigeria

Specific Traits

High yielding for both grain and biomass, good grain quality for malting , resistant to the spot form of net blotch, surface borne smuts and spot blotch

Six rowed, hulled, smooth-awned, spring feed barley, lodging resistance, higher plump seed percentage, good resistance to covered smut and false loose smut.

High yielding lines

Improved resistance to sheath blight , bacterial panicle blight, and narrow brown leaf spot

Submergence tolerant variety

Blast resistant lines

Tungro tolerant lines

Drought tolerant lines

Drought tolerant variety

Alien Disomic addition line with resistance to fusarium head blight

Winter wheat, white grained, excellent bread .baking quality, good pre-harvest sprouting tolerance

Good disease resistance and excellent yield potential

Var. NE016432, superior grain yield performance, winter hardy, resistant to fusarium head blight, tem rust, moderately resistant to leaf rust, stripe result and Hessian fly

Winter type

Hard red winter wheat, excellent grain yield potential, resistance to leaf rust, conferred mainly by the Lr 47 gene, and good bread making quality

Lower levels of aflatoxin, good agronomic traits and resistance to important diseases in the lowlands, including southern corn leaf blight., southern corn rust and ear rot

Distribution

DWR, Karnal

DWR, Kamal

BASF India Limited

NBPGR Regional Station, Cuttack

Annamalai University, Annamalainagar

Rice Research Station, Chinsurah

Devgen Seeds and Crop Technology Pvt. Ltd

TNAU, Coimbatore

Rice Research Station

NBPGR Regional Station, Cuttack

Devgen Seeds and Crop Technology Pvt. Ltd

DWR, Kamal

DWR, Kamal

DWR, Karnal

DWR, Kamal

Bidhan Chandra Krishi Viswavidyalaya, Kolkata

DWR, Kamal

DMR, New Delhi

NRC Soybean, Indore Glycine max EC638228 USA

Excellent yield potential. Resistant to soybean mosaic virus stem canker, bacterial pustule ~. __________________ ~ ________________________________________ -L ______________________ -J

( RMPLASM EXC1-IA"lGE 51

-, and frog eye leaf spot

Gmax Resistant to Soybean mosaic virus and peanut root NRC Soybean, Indore EC638229 USA knot nematode, frog eye leaf spot and bacterial pustule

Gmax Small seeded, 100 seed weight is 7.3g, resistant to NRC Soybean, Indore EC644409 USA shattering, Soybean mosaic virus, frog eye leaf

spot and bacterial pustule

Gmax Variety N 8001 has purple flowers, gray pubescence, NRC Soybean, Indore EC644410 USA tan pod wall color at maturity, and shiny yellow seeds

with imperfect black hila. Resistant to Soybean mosaic virus and stem canker

G max High yield potential and broad resistance to soybean NRC Soybean, Indore EC656640 USA cyst nematode, southern root knot nematode and

reniform nematode.

Gmax High yield potential, broad resistance to soybean cyst NRC Soybean, Indore EC656641 USA nematode southern root knot nematode and

sudden death syndrome

Gmax High yield potential, higher seed protein and NRC Soybean, Indore EC656642 USA resistance to root knot nematode.

Gmax High yield potential and disease resistant type NRC Soybean, Indore EC656643 USA

Lens culinaris Early maturing lines International Crop Reseach EC666214-952, Institute For Semi-arid 5016-5052, Syria Tropics, Patancheru, AP

C. annuum Male sterile lines College of Horticulture, KAU EC637341-42 Taiwan

C. annum Restorer lines MIs VNR Seed Pvt. Ltd, Raipur EC656670 - 687 Taiwan

C. frutescens Restorer lines Mis VNR Seed Pvt. Ltd, Raipur EC656691 Taiwan

Lycopersicon esculentum Lines resistant to bacterial wilt and Advanta India Limited, Bangalore EC637360-65 Taiwan Tomato mosaic virus

L. esculentum Early maturing lines Defence Agriculture Research EC664585-88 Canada Laboratory-DRDO, Pithoragarh

L. esculantum Cold resistant lines Defence Agriculture Research EC664589-599 Canada Laboratory-DRDO, Pithoragarh

L. esculentum Tomato line with high beta carotene content Ankur Seeds Pvt. Ltd., Pune EC659266-71 Taiwan

L. esculentum Tomato lines resistant to Tomato mosaic Metahelix Life Sciences, EC657640 Taiwan virus and fusarium wilt Bangalore

L. esculentum Heat tolerant tomato Punjab Agricultural University, EC654694-99 Taiwan Ludhiana

L. esculentum Lines resistant to bacterial wilt, fusarium wilt Punjab Agricultural University, EC654678-86 Taiwan and Tomato mosaic virus Ludhiana

Gossypium hirsutun Restorers and maintainer Bayer Bioscience Pvt.Ltd, EC657081-105 Israel Hydrabad

G barbadense Restorer lines Bayer Bioscience Pvt. Ltd, EC653106-108 Israel Hydrabad

52 ANNUALREPORT2009· 10

Table 2: Details of transgenic seed material introduced

CroplECNoJ Specific Traits Distribution Source Country

Gossypium hirsutum Coker 312 with 35S promoter and npt II Ankur Seeds Pvt. Ltd. EC654298-303 as selectable marker Aurangabad Texas Tech University USA

G hirsutum Containing stacked traits bollgard II and Monsanto India Limited, EC640276-285 Roundup Ready flex (Event MON 88913 New Delhi Hazera Seeds Limited, X Event MON 15985) gene Israel

Oryza sativa Containing Cry lAb, CrylCa and bar genes Bayer Bioscience Pvt., Gurgaon EC660466- 660500 EC636963-637009 Bayer Bio Science, Belgium

0. sativa Bt rice lines containing Crylc, Cry lAc Pioneer Overseas Corporation, EC659713-721 and Cry 2A genes to conduct efficacy evaluation Bangalore Huazhong Agricultural against rice stem borers and rice leaf folder University, China

0. sativa ssp. Variety Nipponbare silenced for the rice Myc gene TNAU, Coimbatore Japonica and rice Phytochrome and Flowering Time 1 (PFTI) EC657644-656 gene by RNA interference (RNAi) conferring resistance

to sheath blight, rice fungal diseases and other pathogens

O. sativa Transgenic rice of event LLRICE62 containing Bayer Bioscience Pvt. Ltd, EC660501-505 bar gene. Gurgaon Bayer Crop Science USA

Zea mays Transgenic seed material expressing stacked Pioneer Overseas Corporation, EC643857-62 event IARI1507 (cry IF & PAT gene) and NK 603 Bangalore Pioneer Hi Bred (CP4EPSPS gene)

, Z mays Seeds containing Cry lAb gene Sygenta India Limited, Pune EC648319, (Bt 11event EC661295-96 Syngenta, Philippines

Z mays Containing CrylAb gene (Bt 11 event) Sygenta India Ltd, Pune EC664605 and MEPSPS gene GA21 event Syngenta Agro SA, Argentina

5.2 Export of Plant Genetic Resources

The seed and plant material of agricultural and horticultural crops were exported on the basis of Ci) requests received by the bureaulIARI headquarters (ii) requests received from the scientists working in IARI inslltutes/agricultural universities in India under various protocol s! work plan! memoranda of understanding with different countries! CGlAR institutions. The plant material intended for export were procured from known

Indian sources through correspondence and the same were forwarded to the indentors in foreign countries alongwith phytosanitary certificates issued by the Plant Quarantine Division of the Bureau and import permit, if any after approval from lCAR/DARE as per the guidelines. The details of export of seed! planting material during 2009 is indicated below.

Number of countries to which material exported: 13

GIRMPLASM EXCHANGE_ 53

Number of accessions exported: 1320 5.3 Country-wise export of PGR

Cereals: Hordeum vulgare (35) to Kenya, (35) to Ethiopia, ( 18) to Syria; Oryza sativa (90) to Philippines; Triticum aestivum (385) to Kenya, (385) to Ethiopia, (I) to Iran, (280) to Mexico

Bangladesh (6) SoLanum tuberosum; Bhutan (6) Vigna aureus, (8) Vigna radiata, (5) Phaselous vulgaris; Kenya (35) Hordeum vulgare (385) Triticum aestivum; Ethiopia (35) Hordeum vulgare (385) Triticum aestivum; Iran (1) Triticum aestivum; Mexico (280) Triticum sp.; Myanmar (4) Helianthus annuus; Nepal (5) Phaselous vulgaris (2) Lathyrus sp. (5) Lens culinaris (6) Vigna aureus, (8) Vigna radiata; Oman (1) Jatropha curcas; Pakistan (22) Gossypium hirsutum; Philippines (90) Oryza sativa; Syria (18) Hordeum vulgare; USA (10) Arachis hypogaea (3) Cyamopsis tetragonoloba

Oilseeds: Arachis hypogaea (10) to USA; Helianthus annuus (4) to Myanmar

Grain legumes: Lathyrus sp. (2) to Nepal; Lens culinaris (5) to Nepal; Phaselous vulgaris (5) to Nepal, (5) to Bhutan; Vigna aureus (6) Bhutan, (6) to Nepal; Vigna radiate (8) to Bhutan, (8) to Nepal

5.4 Inland supply of PGR Fibres: Gossypium hirsutum (22) to Monsanto, Pakistan (transgenic) The seed and planting material of diverse-agri-horticultural

crops were supplied to JART institutes/coordinated projects, agricultural universities and other users in India. Based on specific requests received 13,391 samples were supplied by the Bureau as per details given below under the Material Transfer Agreement (MTA).

, TUbers: Solanum tuberosum (6) to Bangladesh

Under-utilised Crops: Cyamopsis tetragonoloba (3) to USA; Jatropha curcas (1) to Oman

Crop I Sample I Supplied to

Cereals (10,060)

Oryza sativa 5070 ANGRAU, Hyderabad; SVBPUAT, Meerut; NBRI, Lucknow; IARI, New Delhi; BHU, Varanasi

Triticum aestivum 30 BHU, Varanasi; MDU Rohtak; BCKV,NP, J&AF, Kalyani; Directorate of Seed Research, MAU; NRC Biotechnology, Delhi; IARI, Hyderabad; IGAU, Raipur; CRRI, Cuttack;CSSRI, Kamal

4,572 For different locations (Trials)

Zea mays 388 SKUAST, Kashmir; , BAU, Ranchi; Krishidhan, Jalna; CSKHPKV, Palampur; KD Research Farm. Sri nagar; Kaveri Seeds, Secunderabad ; IARI, New Delhi

Oil seeds (259)

Arachis hypogaea 30 Annamalai University

Brassica juncea 32 CG MCP, Delhi University; SP Mandai's, Ram Narain Rui College, Zakir Hussain College, Delhi; Jamia Hamdard, Delhi

Brassica nigra 4 SP. Mandai's, Ram Narain Rui College; IARI, New Delhi

Brassica rapa 3 IARI, New Delhi

Carthamus tinctorius 3 ARS, Dharwad

I Received from

NBPGR, RS Cuttack, NBPGR, RS Thrissur CRRI, Cuttack, GCD, NBPGR GBPUAT, Pantnagar

DRW, Kamal, GED, NBPGR,ND GCD, NBPGR,ND NRC, DNAFP ,ND NBPGR,ND

GED, NBPGR, NO

GED,NBPGR,NO

NRC Groundnut, Gujarat

GED, NBPGR, ND

GED, NBPGR ,ND

GED,NBPGR,ND

NBPGR RS, Akola

54 ----------------- ~------_______ AN\lUAl.REPORT2(0)- IO

Helianthus annuus

Sesamum indicum

Grain Legumes (768)

Cicer arietinum

Lathyrus sativus

Lens culinaris

3

184

30

14

61

Macrotyloma unit/orum 25

Phaseolus vulgaris 80

Pisum sativum 214

Vigna aconitifolia

Vigna angularis

Vigna mungo

Vigna radiata

Vigna unguiculata

Vigna unguiculata ssp. unguiculata

Vegetables (1,131)

Abelmoschus esculentus

Allium cepa

Capsicum sp.

Citrullus vulgaris

Cucumis sativus

Lycopersicon esculentum

Luffa cylindrica

Momordica charantia

9

1

44

50

44

146

402

8

215

24

18

80

162

90

GI<RMPLASMEXCHANGE

MMH College Ghaziabad

Hyderabad University ; Pratisthan, Mahavidyalya, Aurangabad; Pulses Research Station Berthin, Bilaspur; Biology School, Hyderabad

Calcutta University

Dr. Punjab Rao Deshmukh Krishi Vidyapeeth, Akola

Calcutta University; SVBPUAT, Meerut

Dayalbagh Educational Institute, Deemed University, Agra

UAS GKVK, Bungalore; QUAT, Bhubaneswar; SKUAST (J&K)

IARI, New Delhi; GBPUAT, Pantnagar; Hyderabad University; Dr. Punjab Rao Deshmukh University, Akola

Kurukshetra University

IARI, N. Delhi

ANGRAU, Pedapuram, East Godavari; LAM Farm, Guntur

GKVK, Bangalore

SVBPUAT, Meerut; RAS, Lam Farm,Guntur

PAU, Ludhiana; GBPUAT, Garhwal; University of Allahabad; NDUAT, Faizabad; SVBPUAT, Meerut, UB Agrriculture University, Cooch Behar; SKUAST (J&K); HAU, Hisar; IIVR , Varanasi

Biology School, Hydrabad; Agriculture College Guntur; Annamalai University, TN; Horticulture College, Hyderabad,; JNU, Delhi; IARI, New Delhi, Neelkant Govt. Sanskrit University, Pattambi

Calcutta University

CIAH Bikaner; Vibha Agrotech; IARI, New Delhi; Marathwada Krishi Vishwavidyalaya; KRC Horticulture College, Arabhavi; GKVK, Bangalore

KAU, Vellanikkara

CSKHPKV, Palampur; DRDL, Pithorgarh

JNU, New Delhi; Krishi Station, Bihar; Horticulture college, Bihar; GKVK Bangalore; JNKV, Jabalpur

IARI, New Delhi; Krishi College, Vellayani; APHU, Hyderabad; KRC Horticulture College, Arabhavi

APHU, Hyderabad; Calcutta University; KRC Horticulture College Arabhavi

GED, NBPGR ,NO

GED,NBPGR,ND NBPGR RS, Akola, NBPGR RS, Bhowali

GED, NBPGR ,ND

NBPGR RS, Akola

GED, NBPGR ,ND

NBPGR RS, Shimla

NBPGR RS, Shimla, NBPGR RS, Thrissur

GED, NBPGR, ND

GED,NBPGR,ND

GED, NBPGR, NO

GED, NBPGR, ND NBPGR RS, Hyderabad

NBPGR RS, Jodhpur

GED, NBPGR, ND NBPGR RS, Hyderabad

GED, NBPGR, ND

GED, NBPGR, NO NBPGR RS, Akola, NBPGR RS, Thrissur

NBPGR RS, Bhowali

IIVR, Varanasi, NBPGR RS, Hydrabad, NBPGR RS, Bhowali, IIVR, Varanasi

NBPGR RS, Jodhpur

NBPGR RS, Bhowali, NBPGR RS, Jodhpur

GED, NBPGR, ND IIVR, Varanasi

NBPGR RS, Thrissur NBPGR RS, Hyderabad, GED,NBPGR

NBPGR RS, Thrissur

55

Solanum melongena 81 Dr. Panjab Rao Deshmukh Krishi Vidyapeeth; NBPGR RS, Thrissur Horticulture College and Res.lnst., Akola; GED, NBPGR, NO Horticulture Res. Station, Hugeri, Bihar; TNAU, COimbatore; GKVK, Bangatore

Trichosanthes 51 tARt, New Delhi' GED,NBPGR,ND cucumerina var. anguina

Fruits (110)

Musa sp. 73 JNU, Delhi; Banana Res. Station, Thrissur; IARI &CP Central Banana Research Institute, TN; Jamia Milia Islamia, Delhi

Carica papaya 2 Calcutta University Agriculture University, Coimbatore

Punica granatum 35 NRC Pomegranate, Shotapur NBPGR RS, Bhowali

Ornamentals (4)

Gladiolus sp. 4 IARI, New Delhi TCCU,NBPGR,ND

Millets (186)

Setaria italica 111 NIPGR, JNU Campus, Delhi NBPGR RS, Akola

Sprghum bicolor 75 KD College, Simbhaoli GED, NBPGR, NO

Forages (1)

Lepedium sp. 4 CCSHAU, Hisar GED, NBPGR, NO

Medicago sativa 1 CSKHPKV, Palampur GCD, NBPGR , NO

Medicinal and Aromatic plants (201)

Abelmoschus moschatus 1 Hyderabad University NBPGR RS, Jodhpur

Achillea millifolium 1 IARI, New Delhi NBPGR RS, Bhowali

Acorus calamus 2 Horticulture College & Research Institute, NBPGR RS, Bhowali Coimbatore

Althea rosea 1 IARI, New Delhi NBPGR RS, Bhowali Anthemis cotu/a 1 IARI, New Delhi NBPGR RS, Bhowali

Aloe vera 1 Presidency College, Calcutta GED,NBPGR,ND

Andrographis 24 PG College, Noida; Jamia Hamdard, GED, NBPGR, NO paniculata Delhi; Ch. Devilat University, Sirsa;

Delhi University; BAU, Ranchi

Artemisia annual 1 IARI, New Delhi NBPGR RS, Bhowali

Asparagus racemosus 5 Birsa Agri. University, Ranchi GED, NBPGR, NO

Anthemis tictoria 1 IARI, New Delhi NBPGR RS, Bhowali

Calendula officina/is 1 IARI, New Delhi NBPGR RS, Bhowali

Catharanthus roseus 17 Jamia Hamdard, Delhi; liT, GED, NBPGR, NO Delhi; BAU, Ranchi

Cassia tora 1 Hyderabad University NBPGR RS, Jodhpur

Cuminum cyminum 5 Hyderabad University NBPGR RS, Jodhpur

Cymbopogon maritini 1 NDUAT,Faizabad GED, NBPGR, NO

Datura quercifolia 1 IARI, New Delhi NBPGR RS, Bhowali

Eclipta alba 1 Hyderabad University NBPGR RS, Jodhpur

Guizotia abysinica 1 IARI, New Delhi NBPGR RS, Bhowali

Ocimum sp. 98 VIT University Vellore, TN; GED,NBPGR, ND University of Hyderabad, Hyderabad; NBPGR RS, Jodhpur Delhi University; Maharshi Auyrveda Product; NBPGR RS, Bhowali BAU, Ranchi

56 _________________ ANNCALREPORT2009-IO

Lavesticum officina/is 1

Lepidium sp. 4

Mucuna sp. 7

Psora/ea sp. 6

Sa/via sc/area 1

Sesamum indicum 4

So/anum nigrum 1

Tephrosia purpura 5

Tinospora cordifo/ia 2

Withania sominifera 8

Tubers (376)

C%casia sp. 173

Coleus forskoh/ii 2

Dioscorea deitoides 201

Spices (18)

Curcuma sp. 15

Trigonella foenum 3 graceum

Under- utilised crops (277)

Cyamopsis 179 tetragon%ba

Fagopyrum escu/entum 30

Jatropha curcas 59

Psophocarpus 1 tetragon%bus

Sesbania sp. 3

Vicia faba 50

Vigna tri/obata 6

IARI, New Delhi

CCSHAU, Hisar

BAU, Ranchi

BAU, Ranchi

IARI, New Delhi

Hyderabad University, Hyderabad

Horticulture College & Research Institute Coimbatore

Hyderabad University

CSKHPKV, Wheat Res. Centre, Malan

Jamia Hamdard, Delhi; Avinashi Lingam Women College, COimbatore; BAU, Ranchi

CTCRI, RS Thriuvnanthapuram

Agarkar Res. Institute, Pune

Agkarkar Ras. Institute, Pune; CTCRI , Kerala; Jamia Hamdard, Delhi; CCSHAU Hisar

Nirmala college for Women , Coimbatore

PAU, Ludhiana

Veg. Breeding Station ARI, Hyderabad; SDA, Gujarat; liT, Roorkee

Guru Govind Singh Indraprashta University, Delhi , Jaypee Institute of Information Technology, Solan; Bharatidasan University, TN

New Rice Mills, TN

University of Allahabad

IARI RS Samastipur; IARI, NewDelhi

RAS,Lam Farm,Guntur

Research Programme (Code, Title and Programme Leader)

NBPGR RS, Bhowali

GED,NBPGR,ND

GED, NBPGR, ND

GED, NBPGR, ND

NBPGR RS, Bhowali

NBPGR RS, Jodhpur NBPGR RS, Bhowali

NBPGR RS, Bhowali

NBPGR RS, Jodhpur

GED, NBPGR, ND

GEO, NBPGR, NO

NBPGR RS, Shillong

TCCU,NBPGR,ND

NBPGR RS, Thrissur, NBPGR RS Shillong

TCCU, NBPGR

NBPGR RS, Thrissur

GED,NBPGR,ND

NBPGR RS, Jodhpur, GED, NBPGR, ND

NBPGR RS, Shimla

NBPGR RS, Ranchi NBPGR RS, Jodhpur

NBPGR RS, Akola

GED, NBPGR, ND

GED, NBPGR, ND

NBPGR RS, Hyderabad

PGR/GEX-BUR-DEL-01.00: Exchange of plant genetic resources with foreign countries, inland supply of the resources and related information to the scientist/users in the country (Arjun Lal)

Research pr~jects (Project Code, Title, PI, Co Pis and Associates)

PGR/GEX-BUR-DEL-01.01: Import, export and inland supply of PGR in Cereals, Pseudo cereals, Oilseeds, Medicinal & Aromatic Plants and exchange of related information to the scientists and users in the country (Vandana Tyagi, Vandana Joshi, Anitha Pedapati, SP Singh, Surender Singh)

PGR/GEX-BUR-DEL-01.02: Import, export and inland supply of PGR in Millets, Forages, Agroforestry Tree species, Fibers, Sugar yielding and Under Utilized Plants and exchange of related information to the scientists and users in the country (Vandana Joshi, Pratibha Brahmi, Vandana Tyagi, SP Singh, Surender Singh)

r E ) IPL A~MfiXCHAl\iGE __________________ _ '57

PGR/GEX-BUR-DEL-01.03: Import, export and inland supply of PGR in Vegetable crops, Tubers, Plantation crops, Narcot­ics and Beverages and exchange of related information to the scientists and users in the country. (5 K Yadav, Nidhi Verma, Anitha Pedapati, SP Singh, Surender Singh)

PGR/GEX-BUR-DEL-01.04: Import, export and inland supply of PGR in Fruits, Grain Legumes, Ornamentals, Spices and Condiments and exchange of related information to the scientists and users in the country. (Nidhi M Verma, SK Yadav, SP Singh, Surender Singh)

PGR/GEX-BUR-DEL-01.0S: Documentation and dissemination of information on germplasm both imported and collected in the form of Plant Germplasm Reporter and preparation of Crop Inventories. (Pratibha Brahmi, Vandana Joshi, Vandana Tyagi, Nidhi M Verma, SK Yadav, Anitha Pedapati, SP Singh, Surender Singh)

PGR/GEX-BUR-DEL-01.06: Survey and assembly of literature on Plant Genetic Resources and its documentation for procurement of eliteltrait specific germplasm (Arjun Lal, Vandana Joshi, Vandana Tyagi, Nidhi M Verma, SK Yadav, Anitha Pedapati, SP Singh, Surender Singh)

Externally Funded Project:

National Network Project on Underutilized Fruits (SK Yadav, SK Malik)

58 ANNUALRFJ'ORf2009 10

6. TISSUE CULTURE AND CRYOPRESERVATION UNIT

Summary: During the year, a total of 2004 accessions belonging to fruit crops, bulb and tuber crops, medicinal, aromatic and rare/endangered plants, spices, plantation and industrial crops, and others were conserved as in vitro cultures under culture room conditions and/or at low temperature. The average subculture duration ranged from 4-24 months, depending on the species. In Curculigo orchioides, plantlets were regenerated from leaf and intemodal explants and these were also established in pots. In Zingiber officinale, protocol was refined for induction of somatic embryos using leaf explants. In Elettaria cardamomum, cost-effective conservation of in vitro cultures was achieved following media manipulation. Cryopreservation experiments using vitrification technique, led to varying degree of pre-and post-freezing success in Allium sativum and Simmondsia chinensis. In Pyrus communis, shoot tips from cold-acclimated mother cultures, exhibited 40% regrowth following LN freezing. Genetic stability studies employing biochemical and/or molecular markers (AAPD, ISSA or SSA) in 8acopa monnieri, Colocasia esculenta and E. cardamomum revealed that there were no significant differences between in vitro-conserved accessions and the control plants. A total of 66 accessions comprising Coleus forskohlii (2), Dioscorea de/toidea (4), D. f10ribunda (1), Musa sp. (55) and Gladiolus (4) were supplied as in vitro cultures to various indentors.

A total of 460 accessions comprising seeds, embryonic axes, dormant buds and pollen were cryostored during the year totaling 9265 accessions in the cryogenebank. Successful cryopreservation was achieved in seeds, embryos and embryonic axes of Alpinia malaccensis, A. mutica, Callicarpa vestita, Citrus jhambiri, C. limetta, C. macroptera, C. medica" C. megaloxycarpa, C. reshni, Mimusops. elengi and Piper nigrum.

The objectives of TCCU are in vitro conservation and cryopreservation of germplasm, and monitoring genetic stability of in vitro-conserved and cryopreserved germplasm. Salient achievements during the year are detailed below:

6.1 In Vitro Conservation and Cryopreservation

A total of 27 new accessions were added in the in vitro genebank and these include: Colocasia esculenta (2), Curcuma longa (2), Dahlia cv. (I) Dioscorea alata (7), Gladiolus cv. (1), Malus domestica (2), Prunus armeniaca (2), Pyrus communis (1), Rubus spp (7)

and Vaccinium spp (2). A total of 2004 accessions belonging to different crop groups were maintained in vitro and subcultured at periodic interval (Table I).

6.1.1 Tropical fruits: The work on in vitro germplasm conservation of Musa spp. (411 accessions) and Vitis villifera (3 accessions) was continued using previously

developed protocols.

Work on Musa germpJasm conservation was accelerated by commissioning of a joint collaborative project entitled 'Conserving banana diversity for use in perpetuity' between NBPGR, New Delhi, NRC on Banana

(NRCB), Tiruchirapalli and the Katholieke Universiteit Leuven (KUL), Leuven, Belgium and funded by

Bioversity International. Under the three-year project, a total of 250 accessions of Musa are to be cryopreserved

between KUL ( 150) and NBPGR (100). The germplasm to be conserved by NBPGR comprises 50 exotic

accessions of virus-free Musa germplasm from the

International Musa Germplasm Transit Centre (lTC),

KUL and another 50 accessions of Indian Musa germplasm from NRCB.

Germplasm of 50 accessions of Musa received from

lTC, were tested for absence of endogenous bacteria

and only bacteria-free cultures were suitably regenerated

for raising explants for cryopreservation. Forty accessions

of Musa, received from NRCB in the form of freshly

cultured shoot tips explants (2 shoot tips/accession), were

also screened for endogenous bacteria. Out of these,

leaf samples of 22 accessions were sent for pre-indexing

of viruses to NRCB. The virus indexing was carried out

using multiplex PCR technique against four viruses

namely, Banana bunchy top virus (BBTV), Banana streak virus, Mysore strain (BSMysV), Cucumber mosaic virus (CMV) and Banana bract mosaic virus (BBrMV). Only 4 accessions were free from all the

virsuses.

Amongst the ITC germplasm, a batch of 10 accessions

were selected for cryopreservation and multiplied on high

BAP medium to obtain proliferating shoot meristems that

would be suitable for subsequent cryopreservation.

n\SUf,CULTIJRf<,ANDCRYOPRF,SERVA1l0NUNIT ______ _ 59

Table1: Status of in vitro - conserved germplasm in TCCU (on December 31, 2009) "

Crop group

Tropical Fruits (banana, grape)

Temperate and Minor Fruits (mulberry, strawberry, apple, pear, blackberry)

Tuber crops (sweet potato, yams, taro)

Bulbous and other crops (garlic, gladiolus)

Medicinal and aromatic plants (Species of Bacopa, Mentha, Rauvolfia, Tylophora etc.)

Spices and industrial crops (ginger, turmeric, pepper, cardamom, hops, jojoba)

TOTAL

6.1.2 Bulb crops: A total of 174 accessions belonging to 4 genera (Allium spp., Cicer microphyllum, Dahlia ~nd Gladiolus.) were conserved in the in vitro genebank through periodic subculture or through resterilization, under culture room conditions or at low temperature.

One accession each of Allium albidum, A. clarkeii, A. royleii and A. schoenoprasum, procured from Regional Station, Bhowali, were processed for in vitro introduction. During the period under report, 1 accession each of Dahlia cv. and Gladiolus cv. were added in the in vitro genebank,

In vitro conservation protocol, developed for Dahlia cv., was applied to 2 more accessions wherein shoot cultures could be maintained up to 12 months on B5+BAP+AgN03 at 25°C with polypropylene caps as closures.

Cryopreservation experiments were continued with three more accessions of A. sativum, using vitrification technique. Post-thaw survival of shoot tips (isolated from cloves), after cryopreservation, varied from 20-60% depending upon the genotype and the pretreatment conditions.

6.1.3 Medicinal, aromatic and rare/endangered plants: In vitro maintenance of existing cultures of 167 accessions (-4500 cultures) was achieved through periodic subculture and resterilization (4-24 months) either under culture room conditions and/or at low temperature.

A total of 10 accessions comprising Curculigo orchioides (3), Hemidesmus indicus, (3), Plumbago zeylanica (3) and Aristolochia sp. (1) were procured from Regional Station, Hyderabad and planted in pots

60

Genera Species Cultures Accessions (no.) (no.) (no.) (no.)

'2 19 5,100 414

9 41 6,000 304

5 12 9,900 571

4 9 3,570 174

21 29 4,500 167

7 34 5,250 374

48 144 34,320 2,004

for in vitro introduction.

In C. orchioides, effect of 20 combinations of growth regulators on in vitro regeneration was studied. Of the various explants tested, direct regeneration was obtained from leaf segments and internodal explants on MS medium supplemented with BAP. Shoots thus multiplied and rooted in vitro could be successfully transferred to soil.

6.1.4 Spices, plantation and industrial crops: The work on in vitro germplasm maintenance was continued using previously developed protocols. A total of 374 accessions (- 5,250 cultures) comprising 184 of Zingiber species, 154 of Curcuma species, 7 species of Piper, 5 of Elettaria cardamomum, 4 of Vanilla planijolia, 12 of Simmondsia chinensis (6 each of male and female) and 8 of Humulus Zupulus were maintained under short­to medium-term storage. The average subculture period is 8-10 months for Zingiber species, 6-10 months for Curcuma species, 12-24 months for Piper species, 14-15 months for E. cardamomum, 18-22 months for V pZanijolia, 8-15 months for S. chinensis and 6 months for H. LupuLus. During the year, two new accessions of Curcuma Zonga were added to the collection.

In vitro conservation by slow growth method was achieved in E. cardamomum. Using Y2 MS (major salts) + 5 f..lM BAP + 0.25% phytagel; about 70% cultures survived up to 18 months.

Experiments were initiated to refine a protocol for induction of somatic embryos using leaf explant of three accessions of in vitro-conserved ginger accessions. Four growth regulators namely, BAP, TDZ, Dicamba and 2,4-D were tested for somatic embryo induction and

A '\I~t,;ALREPORT 2009 10

maturation. whereas ABA was additionally tested for somatic embryo germination. Highest embryogenic callus was induced (5-44%) on leaf tissue grown on MS + 2,4-D (10~) after 2 months' incubation. Somatic embryo maturation (40-88%) and germination (0-15%) was I '1aximum when the concentration of 2,4-D was reduced to 5 IlM.

Cryopreservation in shoot tips of jojoba (5. chinensis) as tested using vitrification method. Various precu]ture

. edia (supplemented with 0.3, 0.4 M sucrose), p ·etreatments (0.5, 0.75 and 1 M sucrose) and effect of }()ading solution were tested on 4 accessions of jojoba (both female and male). The mean post-thaw survival , fter preculture in 0.3 M sucrose and pretreatment with () 75 M for I day, and with 3 durations ofPVS2 exposure was 38.9% (40 min PVS2), 11.10% (60 min PVS2), and 6.7% (80 min PVS2). Variation was observed in response between accessions as well as between male and female genotypes. Complete recovery of plants after LN exposure is yet to be achieved.

6.1.5 Temperate and minor fruit crops: A total of 304 accessions (-6000 cultures) belonging to 9 genera and 41 species were conserved as in vitro cultures under culture room conditions and/or at low temperature. The average subculture period varied from 6-12 months. During the year, a total of 14 accessions belonging to Malus domestica (2), Prunus armeniaca (2), Rubus spp. (7), Vacciniul11 spp. (2) and Pyrus communis (I) were added in the in vitro gene bank.

In P. communis, encapsulation-dehydration of shoot tip was attempted. Cold accIimatisation was promotory for regrowth of cryopreserved shoot tips. In 3-wk cold acclimatized plants, 40% regrowth of cryopreserved shoot tips was obtained while in non-cold-acclimatized or I-wk cold-acclimatized shoot tips, there was no recovery after LN freezing.

Protocol was developed to raise M. domestica in vitro seedling rootstocks. About 80% seeds germinated and produced healthy shoots and roots which could be used for successful in vitro micrografting.

Experiments on cryopreservation of M. domestica donnant buds was carried out using two step freezing method. The cryopreserved buds were transferred to NBPGR Regional Station, Shirnla for patch budding on rootstocks.

6.1.6 Tuber crops: In vitro maintenance of existing cultures of a total of 571 accessions (-9900) cultures of tuber crops comprising 3 of Alocasia illdica, 183 of Colocasia esculenta, 121 of Dioscorea spp., 255 of Ipomoea halatas, and 9 of Xantlzosonza sagittifolia was carried out through periodic subculture and resterilization (4-12 months) under culture room conditions. During the year, a total of 7 accessions of D .alala and two of C. esclllellta were added in the ill vitro genebank. In vitro corms were induced in 50 accessions of C. esclilenta on MS supplemented with high sucrose (6%).

As a follow up of Recommendation No. 14 b of the Brainstorming on 'Management of Horticultural Crop Genetic Resources' held at NBPGR on April 21,2009, multiplication of 125 accessions of 1. hatalas was undertaken for shifting to CTCRI. Updation of passport information was accomplished in ca 140 accessions for assigning IC/EC numbers.

Table 2: Status of cryopreserved germ plasm in TCCU (on December 31 , 2009)

Categories Accessions (no.)

Recalcitrant & Intermediate Fruits & Nuts 2.573 Spices & Condiments 148 Plantation Crops 22 Agro forestry & Forestry 1,640 Industrial crops 1,179 Orthodox Cereals 240 Millets and Forages 287 Pseudo-cereals 76 Grain Legumes 636 Oil seeds 470 Fibers 66 Vegetables 437 Medicinal & Aromatic Plants 849 Narcotics & Dyes 34 Miscellaneous 16 Sub-total 8,673 Dormant buds (Mulberry) 262 Pollen grains 330 Total 9,265 Wild Relatives* 942 Rare & Endangered plants* 78 Varieties* 653 Elite* 4 Registered germplasm* 22 Number of species 723

*- Included in respective categories stored as orthodox seeds

r Sl [<.Cl}LTIJREANDCRYOPRFSERVATION l ~IT ________________ _ 61

6.2 Genetic Stability of In Vitro Conserved Germplasm

Genetic stability assessment was done in 15 accessions. of taro (Colocasia esculenta) using simple sequence repeats (SSR) markers. There were no significant differences among in vitro conserved plants based on six SSR markers. In B. monnieri, molecular (RAPD) and biochemical analyses (Bacoside A) of in vitro conserved (18 months with mineral oil overlay) and field plants indicated maintenance of stability in the conserved plants. On the basis of 20 RAPD and 13 ISSR primers analyses, no significant variation was detected between the in vitro-conserved plantlets and the mother plants of E. cardamomum. The protocol for genetic stability assessment using ISSR markers was standardized in mulberry (Morus sp.)

. 6.3 In Vitro Germplasm Supply

During the year, a total of 66 accessions viz., Coleus forskohlii (2), Dioscorea deltoidea (4), D. floribunda (1), Gladiolus cv (4) and Musa sp. (55) were multiplied and supplied for research purpose to various indentors.

6.4 Seed, Pollen and Dormant Buds Cryopreservation

A total of 9265 accessions comprising orthodox, intermediate and recalcitrant seed species were conserved in the cryogenebank: (Table 2). A total of 499 accessions of diverse germplasm were received at cryolab from NBPGR regional stations at Thrissur and Akola, Central Sericultural Germplasm Resources Centre (CSGRC), Hosur and Network partners. These included the germplasm collected through explorations and Network project on TBOs. It belonged to fruits and nuts, spices, industrial crops, and dormant buds of temperate and sub-temperate species. During the year, two exploration trips were undertaken and 60 accessions of germplasm of non-orthodox seeds of Citrus species were collected from Arunachal Pradesh and Punjab.

Programme (Code, TIUe and Programme Leader)

A total of 416 accessions were cryostored as seeds and embryonic axes during this period at temperatures between -160 to -180 D C. Cryostored accessions comprised temperate fruits and nuts (189), spices (11) and industrial crops (206) which also included released varieties, wild species and wild relatives of crop plants.

Basic studies on seed viability, moisture content, desiccation and freezing sensitivity were conducted on Capparis decidua, several Citrus species viz., Citrus

sinensis, C. reticulata (cv Fermont, Nagpur Mandarin, King, Willow-leaf, Ponkan) , C. aurantium, Citrumelo (Poncirus trifoliata x C. paradisi), Citrus

megaloxycarpa, C. grandis, C. limon, C. macroptera,

C. medica, C. limetta, C. pseudo limon, C. jambhiri,

Grewia asiatica, Salvadora oleo ides and S. persica.

Two-step freezing and encapsulation-dehydration techniques were attempted using dormant buds of Prunus armeniaca, P. amygdalus and Juglans regia

procured from Central Institute of Temperate Horticulture (CITH) , Srinagar. Culture media was standardized for in vitro culture of dormant buds of aforementioned species. In Morus spp., 24 accessions were cryostored as dormant buds. Pollen of 20 accessions of mainly wild spp. of were also cryostored. A total of 73 accessions of Moms Citrus including C. megaloxycarpa and C. macroptera were characterized for fruit and seed characters as per the descriptors developed by IPGRI. Successful cryopreservation was achieved in seeds, embryos and embryonic axes of Alpinia malaccensis,

A. mutica, Callicarpa vestita, Citrus jhambiri, C. limetta, C. macroptera, C. medica" C. megaloxycarpa,

C. reshni, Mimusops elengi and Piper nigrum. Periodic testing for viability of 45 accessions of orthodox and non­orthodox seeds and for 20 accessions of Morus spp. dormant buds using in vitro methods was undertaken. Retesting revealed retention of original viability in most of the accessions after 1 to 8 years of cryostorage.

PGRlTCCU-BUR-G1 Ex situ conservation of genetic resources of vegetatively propagated crops using in vitro and cryopreaervation techniques (RK Tyagi)

Research Projects (Profect Code, TItle, PI Co-PI and Associates)

PGR/TCCU-8UR-01.01 In vitro conservation of tuber crops with special reference to sweet potato, yams and taro (Neelam Sharma, Zakir Hussain, OK Nerwal)

PGR/TCCU-8UR-01.02 In vitro conservation of spices. plantation and industrial crops (RK Tyagi, Anju Jain, RP Yadav)

62 A"Nl T AL REPORT 2009 10

pGRfTCCU-BUR-01.03 In vitro conservation of bulbous and omamental crops.(Ruchira Pandey, Neelam Sharma)

PGRfTCCU-BUR-0104 In vitro conservation of medicinal and aromatic plants with special reference to rare and endangered species. (Neelam Sharma, Ruchira Pandey)

PGRfTCCU-BUR-01.05 In vitro conservation of tropical fruit crop species. (Anuradha Agrawal, RK Tyagi)

PGRfTCCU-BUR-01.06 In vitro conservation of temperate and minor fruit crops. (Sandhya Gupta, K Pradeep)

PGRfTCCU-BUR-01.07 Studies on genetic stability of in vitro conserved and cryopreserved germplasm. (Zaklr Hussain, RK Tyagi, DK Nerwal)

PGRlTCCU-BUR-Q2 Ex situ conservation of plant genetic resources of agricultural and horticultural crops using cryopreservation of seeds, dormant buds and pollen (Rekha Chaudhury)

PGRfTCCU-BUR-02.01 Cryopreservation of non-orthodox and orthodox seed species in various forms using standard protocols (Rekha Chaudhury, SK Malik, Davender Nerwal)

PGRfTCCU-BUR-02.02 Investigating desiccation and freezing tolerance in non-orthodox seed species. dormant buds and pollen for cryopreservation (SK Malik, Rekha Chaudhury)

nsSl 'E('UJ1JREANDC'RYOPRESERVATION ['NIT ~_ 63

, 7. PGR POLICY PLANNING UNIT

The PGR Policy Planning unit is functioning at NBPGR since 1996 with the following objectives:

1. To document and collect literature on concurrent international and national developments concerning plant genetic resources and related fields such as Biosafety, germplasm utilization, exchange, and quarantine.

2. To provide analytical inputs are per requirements of the policy makers for negotiations and fonnulations of policies at various national and international issues related to PGR management.

7.1 PGR Management and related Issues

7.1.1 Processing application of extant varieties for registration (Protection) with the PPVFRA Authority

• During the year, 123 applications of Extant-notified and New Varieties of 17 crops notified till 2008, were scrutinized, documented and submitted to PPV &FR Authority for plant variety registration. A total of737 applications of Extant-notified and New Varieties have been submitted to PPV &FRA, so far.

• Three new crops have been notified, ginger, turmeric and sugarcane and twenty two new species including oilseeds, vegetables and spices are likely to be notified by the Authority sooo. All concerned Project Coordinators/ Project Directors and Directors were sensitized about the process of filing applications. Inputs on correct filing procedure were provided on request.

7.1.2 Institute Technology Management Commit tee (ITMC)

Three meetings of the ITMC were organized during the year. Cases of MoV (Tripartite/ Agreement), technology transfer and fund utilization were discussed. A draft MoU for technology transfer was finalized in consultation with Zonal Technology Management Committee (ZTMC) at IARI New Delhi, and sent to the users at Maharashtra State Horticulture Department.

7.1.3 Technical Inputs to ICARIDAREI Ministry of Environment and Forests (MoEF)! and National Biodiversity Authority (NBA)

• Technical inputs for CBD CoP- 9 on the issue of importance to agro- biodiversity, lessons from ill­situ on farm conservation, sustainable use of agro­biodiversity and overdose ofNz in fields-mitigation and recommendations for optimum use of Nitrogen were sent to ICARI MoEF.

• Inputs for IV Country Report to CBD on management of Agro- biodiversity in India, were provided to ICAR! MoEF.

• Comments and suggestions on National Biodiversity Action Plan developed by MoEF were sent to ICAR.

• Background note on current regulations and their awareness at national level and policies for sharing of genetic resources with the private sector in Coordination Committee on Genetic Resources management.

• Note for designation of material and its importance for the International Treaty on Plant Genetic Resources for Food and Agriculture to ICAR, DAC and NBA.

• Inputs on the People's Biodiversity Register (PBR) Methodology developed by NBA.

• Inputs to the list of normally traded commodities to be exempted from provisions of Biological Diversity Act to MoEF and NBA.

• Issues of exchange with IRRI scientists regarding use of SMTA and procedure for export.

• Inputs to Export Facilitation Committee of NBPGR for cases of export of PGR under collaborative research projects and other categories.

• Inputs to NBA as member of Expert Committee for export of material outside India and IPRs applied (applications).

64 ~---_______ A:"IM'ALREPORl ')009 10

7.2 Policy Issues related to Plant Biosecurity

7.2.1 Inputs to Ministry of Agriculture

• Provided input to the Department of Agriculture and Cooperation on Plant Quarantine (Regulation for Import into India) Order 2003 on

o As member of the Core Group on Establishment National Agricultural Biosecurity System under the MoA

o prepared comments and provided inputs for preparation of the document to be submitted to the Minister of Agriculture

• Revision of International Standards on Phytosanitary Measures (ISPMs)

o Regulating wood packaging material in international trade (Revision of lSPM No. 15)

o Categorization of commodities according to their phytosanitary risk

o Fruit fly trapping (proposed Annex 1 to ISPM No. 26 (Establishment of pest free areas for fruit flies (Tephritidae))

o Glossary of phytosanitary terms (Amendments to ISPM No.5)

o Terminology of the Convention on Biological I

Diversity (CBD) in relation to the Glossary of phytosanitary terms (proposed supplement to ISPM No.5)

o Structure and operation of post-entry quarantine facilities

o Pest free potato micropropagative material and mini tubers for international trade

• Quarantine aspects of import! export to EXIM Committee and in trade negotiations with other countries.

• Developed a Chapter on Agricultural Biosecurity for the publication of State of lndian Agriculture to be brought out by NAAS with inputs from experts in plant protection, animal husbandry, livestock and pOUltry and fisheries in ICAR, DAC and SAUs

• Developed a Policy Paper on Plant Quarantine including Internal Quarantine Strategies in View of Onslaught of Diseases and Insect Pests.

7.2.2 Inputs to Ministry of Environment and Forests

Technical inputs provided on

Terminology of the Convention on Biological Diversity (CBD) in relation to the Glossary of phytosanitary terms (proposed supplement to ISPM No.5)

Technical inputs provided in regular meetings of

• Consultative Group on Biodiversity

• Technical inputs provided as member of;

o Expert Group on Consistent Interpretation of the Precautionary Principle

o Expert Group on Liability and Redressal issues under Cartagena Protocol

o Committee for revision of list of pests under EPA Rules 1986 to the National Committee of Weapons of Mass Destruction and their Delivery System Act

7.2.3 Inputs to Department of Biotechnology

• Regular input provided in meetings of Review Committee of Genetic Manipulation, Monitoring and Evaluation Committee and Project Evaluation Committee

7.2.4 Inputs to Ministry of Home Affairs

• Provided inputs in regular meetings of Inter­ministerial Working Group of Experts on Bioweapons as nodal person of Ministry of Agriculture and prepared the chapter on "Agroterrorism" for inclusion in the National Disaster Management Guidelines- Management of Biological Disasters.

• Conducted Session on "Agroterrorism: Safety and Security Aspects" during the Continuation Education Programme of Defence Services on Chemical, Biological, Radiological and Nuclear Disasters in November 2009

iRPOl ICYP~MN{j F'JIT __________________________ _

South Asia Network on Plant Genetic Resources \

(SAN PG R) Meeting

A SAN PGR was organized from 3-5 November, 2009, in collaboration with Bioversity International at NBPGR,. New Delhi. The meeting was attended by representatives from SANPGR member countries viz. India, Nepal, Bhutan, and Bangladesh (Sri Lanka could not attend), staff of Bioversity International, representative of Global Crop Diversity Trust and FAO. Officials from ICAR, CGIAR centers in Asia, APAARI and RDA Malaysia also attended the meeting as special invitee. Country Report on the Status of PGR programme in India was prepared and presented in the meeting, besides the presentation on status of Implementation of the International Treaty in the Country.

A short-term course on "Current Regulations and Policies for Access to Genetic Resources" from 10-19 November 2009

The unit successfully organized a short-term course on "Current Regulations and Policies for Access to Genetic Resources" from 10-19 November 2009, at NBPGR, New Delhi. The present course was designed to educate participants on various regulations, policies, national and international treaties agreements and protocols related to access of plant genetic resources. There were 24 participants including 8 from SAU'S, 14 from ICAR Institutes (2 from regional stations, 1 from HQ), 1 from Pvt. Seed Company and 1 from KVK.

SAARC Workshop on Development and Harmonization of SAARC Quarantine Network

SAARC Workshop on Development and Harmonization of SAARC Quarantine Network was organized at National Bureau of Plant Genetic Resources (NBPGR), New Delhi from November 23- 25, 2009 for ground­truthing the current situation and to deliberate on the course of action to meet the future challenges in the region. The Workshop was attended by 20 participants­one from Afghanistan and the others from the stakeholder Ministry and Research Institutes of India. The Inaugural Session was chaired by Dr TP Rajendran, Assistant Director General (ADG) (Plant Protection), Indian Council of Agricultural Research (lCAR), India and Dr RK Khetarpal, Head, Plant Quarantine Division, NBPGR presented the overview of quarantine set-up in the SAARC region. Technical Sessions on country reports and for formulation of recommendations were held over two days and one day was devoted to visits to various quarantine laboratories and facilities at NBPGR and at National Plant Quarantine Station, Rangpuri, New Delhi.

The Recommendations Session was chaired by Dr RK Jain, Head, Division of Plant Pathology, IARI, New Delhi, India and Co-chaired by Dr Arjun Lal' Head, Germplasm Exchange Unit, NBPGR, New Delhi, India. The recommendations categorized under legislative, technical, researchable and capacity building issues were finalized.

66 ________________ ANNUALREPORT2009-10

8. NRC ON DNA FINGERPRINTING

Summary: NRC on DNA Fingerprinting has so far developed protocols for cultivar identifications in 33 crops of national importance using the molecular marker techniques like STMS, AFLP and ISSR. The crops include cereals (rice, wheat, barley), millets (finger millet, sorghum, pearl millet), pulses (chickpea, French bean, horsegram, lentil, peas, pigeon pea, mungbean, ricebean, urdbean, soybean), oilseeds (mustard, safflower, sesame, niger), fibres (cotton, jute), vegetables (tomato, chillies, cucurbits) fruits and nuts (banana, mango, cashew, citrus) and medicinal plants (chlorophytum, neem, vetiver). More than 2500 varieties in different crops were fingerprinted till December 2008. The analysis of diversity in molecular markers of important crops like rice, mungbean, oilseed brassicas and tomato have provided insight into the genetic base of Indian crop varieties. Such information will form the basis for developing efficient strategies for their breeding and genetic resources management.

PCR-based detection protocols have been developed for the several genes in transgenic planting materials some using multiplex PCR for simultaneous detection of promoter, terminator and marker gene along with endogenous genes in duplex, triplex, tetraplex formats in genetically modified crops. Developed protocol for simultaneous amplification of six commonly used marker genes, viz., nptll, aadA, hpt, bar, pat and uidA for detection of GM crops.

Genetic diversity analyses and DNA profiling was conducted in mungbean, fingermillet, pearl millet, sesame, water melon using STMS, ISSR and RAPD markers. The analyses helped in the estimation of available genetic diversity in the collections and also in generating DNA fingerprints of these indigenous cultivars.

8.1 DNA Fingerprinting and Cultivar Identification

8.1.1 Pomegranate (Punica granatum):A collaborative programme with National Research Centre ')n Pomegranate, SoJapur, was initiated to profile the 'Jomegranate germplasm. As per mutually agreed plan, ixty-five of a total of about 180 accessions were collected

in the first phase. In the absence of published SSR l:1arker information, multi-locus markers (RAPD and ISSR) were employed for DNA fingerprinting. 112 RAPD primers were screened to identify a set of 23 informative primers. Similarly two ISSR primers have , also been identified and detailed profiling and data analysis is in progress.

8.1.2 Dendrobium species: A collaborative programme with National Research Centre for Orchids, Packyong, was initiated to profile the Indian orchid germplasm (Dendrobium, Cymbidium and Vanda ceous orchid ~pecies belonging to north eastern regions ofIndia) using DNA markers and sequence analysis. The study was commenced with analysis of ten species of Dendrobium (D. bensonae, D. capillipes, D. chrysanthum, D. chrysotoxum, D. densiflorum, D. infundibulum, D. parish ii, D. pendulum, D. secundum and D. thyrsiflorumolium) using RAPD and SSR markers as well as rDNA, chloroplast and mitochondrial sequences. Forty RAPD primers generated 458 di stinct bands showing 98.9% polymorphism distinguishing the Dendrobium species into three clusters of similar group

RC ON DNA f<lNGERPRINTING

of species (Figure 1). Data mining provided a list of more than 100 SSR primer sequences. Subsequent to screening, 18 primer pairs were optimized for further analysis (Table 1). Variation in the conserved sequences (e.g. ITS 2) is being analyzed (Figure 2).

Table 1: SSR primers optimized for analysis of Dendrobium species

Primer Annealing Allele size Primer sequence temp ("C) range (bp) forward and reverse)

GTF36 48 81-98 GCATAATTAGGAGCGTTG CGTCATAGAGGACTGTC

GTF39 49 143-188 CTTGTGAGTTTCTCTCTCC GGTCATTAATTTAGCTG

TGF26 46 72-93 AATCCCTCTATCCGGCAT CTCACCAAATTTCTCCAC

TGF31 48 87-106 AATCCCTCTATCCGGCAT TCATCATATGTGGCTAG

CAF 1 52 151-168 CATCATGTGACTAGATC CTATCCGGCATAATAGG

CAF3 53 138-159 CTCACCAAATTTCTCCAC ATCCGGCATAATTAGGAG

CAF8 50 151-222 CTTGATGGGGCCATCATT CTCTATCCGGCATAGTT

F5 52 138-223 CCTCCGTTCCCTACTTTC TGCTGGACCACTCTTAG

F 27 53 36-60 GAACTTGATTGGGCCATC CCTCCTCTCTAGGTCTC

F29 54 31-219 AAGACCTCGGTTCCGTCG GATCAAGGGAGTGCAAG

DR 02 50 203-224 GGACATAAAGAGAGCAGGG ATATTCCCACCTGCCCTATC

DR06 55 195-208 GGCCAAAGACTCCTAGGTGA CATCTCTCCCCATGCAACTT

DR12 45 152-172 AAGGCGGCATCGGCGAATG CCTCCCCTTTCTCTCTATTCC

67

DR26 57 169-182 GATCTTTCACTCTCTCCATCAC ACAAAAGGGGAGAGA GCATGAG

DR 30 57 171-183 CTCTCCATCTTGCCATCCTC AGCTTGTGGGGAAGGTGG

DR31 58 219-230 AGAGGGACAGTGCAAGAG CGTCATTTCCACTCCCTCC

DR45 45 190-200 ACTTGGTGGTCGACGAGGTC ACTTGGTCGTCGACGAGCTC

DR67 56 104-129 GATAACTATCTATATACCCCTA GAGAGCAACACGACCAATG

Bensonea

I"""" Parishii

i Thyrisifolium

Crystlnthum

I Densij10nun

I Secundum

Copillapes

~ Infundibulum

Crysotoxum y Pendulum

.10 0.20 0.30 0.40 O.SO

Figure 1: RAPD based grouping of ten Dendrobium species

""',rr»'rS p'wmFrs "" ...... 1-fI~1~ U11tJ"!5 pat1'W16 ...... , rtI''15

"""-~~"t~ pul1'lf'~ ~rfStS IJ.ffrJlJ1'5 esT ffFt5 "'"tll"l! IS!I JT'I~

"""'-P" I'''I~ ..,.~ ","T~

1~1 JtiFf$ .nl!:fIS­.n_tf.'~ ~11rr.-,o; 1--f'1_rt'f.'IS .,..._

..,,,IW* 1-f·.Iff"~ Il¥1lWtS t-If'"'~ 1S'-~!:5 U"1i'¥15 lS~t ,r'F'$ ,_e-

C 0-,,, C,,"CCG4TICCGAc:;.UCtC:OIGAAAlAAGCGCc:coct GTC,",J\,.t,ccaUAC c.J" TC"""CG'" r I Ce>G"C;UCCCGTCU"" UGCGCCCGCC

f;.ACCC;lAC A I,. ltGj~, .. lltGG.C,uCC Ie rG.u.' ..... CCGGCCCCG ""'CGJG.ltCuu" AI A ICC'G'(;" 'I1CGGACA"CCCG'GU4 T .... I C(iGC(i(;CO

"GTe T J,TC'-"GACCA"U ~T" '"'tGA.GC' lCG.G~G.u_CC Ie IGUA 1 uGCtiGCGGCC GGGCC.GICTlc;, ICGH;"CC (OUT alACctoAGCC" lCGGHj.uCCIGI .... AAT.u.CCGGCCGCG

CGC.GGCGCIGIC"GCiICG.a.,-,CC Q, .. ' ", .. CG"CGl ICGC .. CuCcJeIC ...... ',u.GCCCCGGCG

Gt;,G'Cfi,CC(rCG~AGC.U.C"TC"C'CC'l'''C;CCC CC (i. C.IGG GGCiGGtt CtG"CGGGGl;i1l G[GGI C Got C r.tG~.f;.t AG( [G' [[CtGCC~ I CGI:ectt C I" t C Ie ICG.GaGGOtC Gee", GGGGG.\ ccc."'CGCCGCG.C"Ctc.cCC'tcCtGf.CG' CGI:CCCC C Gle IGO.GGGGGCC GeGGCGGIlGG4 fOUl iCC'iCCGCG.AItACG·CCGICtCCGICQ,ICGCCCCC ICC G'lCGCH;iGGGGtC GCGGCOU,_GGA GC "' 1 CGCCGtGAAAtA5I:tGI ccc eccc. I tc;.G[tClCCC G 1 C 1 GcaOGGGGcC GCG'" GGGGG. ecce-. T CGCtGCGA","C.(;CCC C(;C (CO I tCO I t Gt. It c(eCtetAG I C, GGAGGGCGGtcGCGGcG .... GGG" 'c(.r;~r.GCcGCGu"eA"cc. ecce" [!lIeGe lccce tteGC Ie lGtp,GGGGGGr CCGGCGGGGG t

.. .. , C 'G!.; J "A,ucecc.u.ACCGGr: (,.(; "'lI.e 1 GGCGCC "AGe I UC ... , [GU"C.Gt "CGGGCCCGGt A I teG eGGC 1 '~ItACCr.CU,lCr:GGCGC ",oo\c 1 C;GtG,CA'CG1I1H 'A ftGA.AAGAGt"CGGCCCCGGCAI CGe { GGC!C All .. AAH.CftCo!Go(U;'''' ""'CO'CA GGIU,CIAitciUA "OtAC(jHiCCCG(jCA"~GG C:(jC;CC(. A"'C A ...... t:5Ut;.('H. f c.G(G; C .... ,GC .... C1GG1G AA uCACGAG.r.CCG(j,t ... ltCG tGIiit.\t. UC\:CCAI. tc"~tJ:: (0" tot, G A lor; Uf.1AIlGUII, GGtACG.r.Cctt>f,t ... 1CGG AEio6C IG A ... CCCC ..... C( r.&! Gr .ut (i.G' G' CA c.GG.~GC 'AI CG" .... "ACIICCAOCCCGGH:l! CGG "~GC1'4U!:CtC"""cr.GGtt.c"c;.IIr:' GG!. Gr.C.A GGG~.Gr:'A' (i:AU "ACACCitr.Cr.Ce'OCCGt

• ,. Vt ..

, " ..,ICICI'e. ,1':"" lot", "'-Co l Col A(,GI."GA(;l(:GAtTCltG'CU eG'" ... Ic ecce IiiICl(:rG'",,,"cC4\GCCc. Co CI'~. C. HGfATTG.tCACCHICICGACA"IGGA'AICICGGC GICIJ(C.T""-C" "e." Co K~" c.CACGIlITGAt,lt(jAtlt-TtGACAATGC" "'(TCGGe (>T(:T1(C.T,-"GoCLCaAC. CoG C- GeG(C-t C(Al''''AI('G.tACGIICIC1C(jM: .... 'GGA A1tTCGGC crCC'tC,",t.t:",-Gr-cc; I; I;r:&( CCC.r:AtGIAT'C.ACHG,HTCIt'GACAA COCo ... A,crCCitf GIC11,"""c;,r""Cf"T G1Clfr.GII*Gc;,I"~G(G.G c;.C

Figure 2: A snapshot of sequence alignment of internal transcribed spacer 2 (ITS 2) of ribosomal DNA in

Dendrobium spp.

Figure 3: Dendrogram depicting genetic relationships among oat accessions

8.1.3 Oats (Avena sativa): One hundred ten (110) accessions of oat (Avena sativa) were fingerprinted using 12 SSR marker loci. Many of the accessions could not be differentiated from one another indicating the use of additional markers for unequivocal identification (Figure 3).

8.1.4 Jute (Corchorus spp.): Thirty-two (32) varieties of jute belonging to cultivated species Corchorus capsularis and Capsularis oletorius were fingerprinted using 20 ISSR primers. Also, EST-derived SSR markers for six loci were generated all of which but one revealed monomorphic patterns (Figure 4).

8.1.S Forage pearl millet (Pennisetum americanun): Twenty (20) forage pearl millet varieties using 15 SSR markers were fingerprinted. Cultivars HHB 13 and PC443 could not be differentiated at the investigated microsatellite loci (Figure 5)

Figure 4: No polymorphism at EST-derived SSR markers in jute

8.1.6 Flax (Linum usitatissimum.): Three SRAP, 19 RAPD and 24 ISSR primers generated 119, 158 and 183 markers, respectively in 20 flax (L. usitatissium) varieties. All varieties could be discriminated from one another using each of the molecular marker technique. Public databases were searched for ESTs which were mined for SSR markers. Primers for 110 EST-SSR mark­ers were synthesized and surveyed for polymorphism. Eighteen primers were found polymorphic and used for fingerprinting 94 germplasm accessions of flax.

68 _________________ ANNUAL REPORT 2009-10

r HHB146 I r= PUSA605

CZP9802 11 GHB558 l : -- HHB67 '-----MH1236

- --RHB90 PC334 JVB3

_ ,HHB13 1 PC443

'----- PC266 ,...------- HHB117

-----AVKB19 '------- FCB16 ,.---- --- PB106

NANDI32 ICMR356

r~~~==~:j;;;;;;;;;:~ MH1234 BAIF1 0.40 055 070

CoeffICIent 0 85 100

Figure 5: UPGMA clustering of forage pearl millet cultivars

8.1.7 Cucumis melo: Optimization of SSR amplification ~ nd profile development was initiated in Cucumis melD accessions received from NBPGR Regional Station, Jodhpur and other accessions collected from other parts of the country. PCR protocols for STMS profiling of 22 primer pairs were optimized with respect to annealing temperature and STMS profiles for C. melD were developed. Among the profiles developed four were found to be polymorphic (Figure 6).Further primer screening and profiling is in process for genetic diversity evaluation.

8.1.8 Ash gourd: Thirty one primer pairs for Cucumis

melD were evaluated for amplification using the DNA from three ash gourd varieties from India. Clear amplification products were obtained for nine primer

I

p; irs. These SSR markers developed through cross .,pecies amplification are first SSR markers reported for ash gourd. Further SSR markers development is being done and these new SSR markers will be used for genetic di 'ersity evaluation of ash gourd germplasm received from Evaluation Division, NBPGR.

8.1.9 Rose: Twenty one rose varieties maintained at the Rose Germplasm, Floriculture Centre, Govind Ballabh

Pant University of Agriculture and Technology, Pantnagar were used for SSR and ISSR profiling. A total of 33 primers consisting of di-,tri-,tetra- and pentanucleotide repeat motifs were designed and used for initial screening with 3 genotypes, one each from Hybrid Tea, Floribunda and Oil Content varieties in question, namely Kiss of Fire, Delhi Prince, and Noorjahan. Out of these, 9 primers gave no amplification at all, while only 12 primers were found to be polymorphic and generated (31) alleles where the number of alleles per primer ranged from 2 to 5 with an average of 2.58 per primer.The EST-SSR amplification data were used to obtain similarity matrix and dendrogram. Similarity coefficient ranged from 0.143 to 0.923 with a mean value 0.481. The clustering pattern obtained by EST-SSR analysis clearly distinguished all the 21 genotypes into three clusters.

Thirty one ISSR primers were screened and protocol could be standardized for twenty three pI;mers. ISSR profile was completed in twenty one varieties of rose with selected primers. A representative gel picture showing ISSR profiling is given in Figure 7. A similarity matrix and a dendrogram were developed for 21 genotypes. The values ranged from 0.264 to 0.818. The average Jaccard's similarity coefficient between the 21cultivars was found to be 0.47. A clustering pattern obtained by ISSR analysis clearly distinguished all 21 genotypes in to three major clusters. All the genotypes

Figure 7: ISSR profile of 21 rose varieties with primer P21

Figure 6: A representative STMS profile for the Cucumis melD accessions

DNA F1l\iGERPR~"TI"lG 69

that belong to genus Rosa, species hybrida has grouped together with an exception of cultivar Happiness which has grouped with culti var Gruss n Tepliz which belong to Genus Rosa species damscena. Similarly. all the genotypes that belong to genus Rosa species damscena

has grouped together with an exception of cultivar 'Gruss n Tepliz' which has grouped with cultivar 'Happiness' which belong to Genus Rosa species Izybrida.

8.2 Generation of New Sequence Tagged Microsatellite Markers

8.2.1 Finger millet: From the 463 SSRs identified earlier, 140 primer pairs were synthesized and tested for amplification in four elite germplasm lines of finger millet and 75 (53.6%) primer pairs gave clear amplification products (out of 75 primer pairs, 17 primer pairs were reported last year), showing SSR marker generation potential of total rnicrosatellites in the ESTs of finger millet. Out of 75 primer pairs showing amplification, 13 (17.3%),45 (60.0%),11 (14.6%) and 6 (8%) were having di-, tri-, tetra- and penta-nucleotide repeats respectively. A novel set of 75 EST-SSR markers was developed through data mining involving low cost and less time and will serve as a valuable primer set for studying genetic relationships, diversity analyses and marker-assisted selection. These can also be used for understanding of SSR distribution and frequency, development of EST­SSR genetic and physical maps in finger millet and can also be used for comparative genomics. A representative gel profile showing EST-SSRs developed in finger millet is shown in Figure 8.

Figure 8: Gel profile of EST-SSR markers developed in finger millet. The order of loading with respective primer pairs is GE 174, GE 580, GE 4927, GE 4682, Molecular

weight marker: 20 bp. The blank lanes depict the EST-SSRs that could not be amplified.

A set of ninety three primer pair sequences from wheat (36), rice (30), sorghum (17) and pearl millet (10) were tested for cross-species transferability. The transfer rate of SSRs varied from 5.8% (from sorghum) to 50% (from pearl millet and rice) with an average transfer rate of 32.7%. The cross-genus SSR markers from wheat, rice, sorghum and pearl millet were showing either single, double or multiple fragments in the same or different size range in finger millet as compared to the repOited pattern and size of SSRs from that particular genus. Regarding the application of cross-genus amp Ii cons as DNA markers for germplasm characterization and evaluation, transferred SSRs (Xgwm 642, Xgwm 459 and Xgwm 413) were tested in few genotypes of finger millet. Xgwm 459 was amplifying two alleles while other two were showing one allele. Similarly pearl millet SSRs (3032, 3002) were tested in 18 African finger millet accessions. The SSRs 3032, 3002 were producing RAPD like patterns and were polymorphic. These polymorphic cross-genus markers may be useful for diversity analysis. However, more transferred polymorphic SSR markers from major cereal crops need to be tested on more genotypes of finger millet.

8.2.2 Watermelon: Two hundred and thirty two SSRs detected from watermelon EST database were verified for redundant sequences; thereafter two hundred and twelve were given for synthesis. Last year 40 primer pairs were tested and 31 EST-SSR markers were developed. This year, one hundred and seventy two primer pairs were tested for amplification and annealing temperature standardization. Clear amplification products were obtained for 122 primer pairs (70%). One hundred and twenty two new Expressed Sequence Tag-Simple Sequence Repeat primer pairs have been developed in watermelon.

8.2.3 SRAP markers linked with yellow mosaic resistance in sponge gourd: Luffa cylindrica Roem is a recently reported host of Tomato Leaf Curl Virus, which primarily affects tomato and other solanaceous crops. In Luffa, it is associated with yellow mosaic disease which is characterized by yellow spots on newly emerging leaves, followed by mosaic and upward curling of upper leaves. Thirty resistant and thirty susceptible plants from F, obtained through challenge inoculation with white fly were bulked to identify polymorphic markers between resistant and susceptible parent, linked with resistance trait. Among the 101 polymorphic bands generated from 19 SRAP primer combinations, four markers were found that could differentiate resistant

70 ___________________________ ANNUAL REPORT 2009· 10

parent and resistant F2 bulk from susceptible parent and susceptible F2 bulk. Of these two primer combinations (8,6 and 10.6) produced 375 bp and> 1000 bp band, respectively, which were present only in susceptible parent and susceptible bulk. The other two (10,1 and 10,6) produced 80 bp and 275 bp, respectively, which were present only in resistant parent and resistant bulk.

8.2.4 Sesame (Sesamum indicum): For the first time in sesame, one mapping population of 225 RILs was generated using an interspecific cross derived genotype and a cultivar. The parental polymorphism was tested using over 25 RAPD and AFLP primers. This population is being used to generate a framework map sesame for the first time. Further, 250 new SSR markers were generated and basic characterization has been completed. One of the polymorphic primers generated and the extent of variation observed for the alleles is presented below:

High polymorphism detected for the newly developed SSR markers in sesame

The extent of variations present on the contents of polyunsaturated fatty acid and lignan amongst 47 elite cultivars has been estimated. The genetic elements responsible for such variations are being identified to bring in improvement of the nutritional quality of the edible sesame seed oil in future .

8.2.5 Greengram (Vigna radiata): Development of new STMS markers: About 3936 positive colonies were picked from a small insert partial genomic library of the landrace 'MCV' constructed in pUC 18. Plasmid DNA was isolated using the standard miniprep procedu~es from the colonies grown in 96 place deepwell plates. These samples were screened using the PCR screening procedure with the various SSR motif-based oligonucleotide sequences as primers.

Sequence level variations in FAD3 gene sequences in diverse sesame cultivars

( O!'liDNAFINGERPRI~"TING ________ _ 71

The positive clones thus identified were sequenced to obtain the full DNA sequences of the inserts. Out of the 3936 inserts sequenced SSRs were present in 189 fragments (4.8% occurrence). However, in 65 fragments, the length of the flanking sequences was not sufficient for designing primers for PCR amplifications. A total of 124 flanking primer pairs were identified and the summary of the type of rep.eat motifs observed is presented below:

S.No. SSR No. Frequency Repeat Motif observed ('Yo) units

1. AGffC 27 22 8 2. ACfTG 19 15 6 3. GTT/CAA 3 2.4 11 4. CGC/GCG 1 0.8 9 5. GAG/CTC 2 1.6 4 6. AGNfCT 9 7.2 5 7. CAT/GTA 1 0.8 7 8. CAC/GTG 5 4 6 9. AAGfTTC 14 11.3 5 10. ATNfAT 6 4.8 10 11. ATCfTAG 1 0.8 53 12. TGAIACT 6 4.8 5 13. GGAICCT 1 0.8 9 14. TTAlAAT 3 2.4 6 15. TGC/ACG 1 0.8 18 16. TCAlAGT 1 0.8 6 17. AAGfTTC 4 3.2 14 18. ATCTfTAGA 1 0.8 4 19. AATTfTTAA 4 3.2 4 20. AATAAITTATT 4 3.2 5 21. CTTGTI/GAACAA 2 1.6 6 22. AAGAAfTTCTI 6 4.8 14 23. 10mer repeat 3 2.4 15

124

It is clear from the data above that in green gram the most abundant SSRs in order of decreasing abundance are; AG/ TC> ACITG> AAGITTC> AGAlTCT.

The primers synthesized are being optimized to obtain ideal PCR amplifications. 65 primer pairs have been screened so far. A panel of 4 green gram, 4 black gram, 4 moth bean and 2 rice bean cultivars are being used for optimizing the PCR conditions. The polymorphism observed among the green gram cultivars is low. However, for full characterization of the SSRs a panel of 50 green gram, 50 black gram and 50 moth bean cultivars are being used so that the polymorphism pattern in these three important pulses is recorded.

Some of the SSR profiles obtained while optimizing the PCR conditions is presented below:

Primers used are: MgSSR12; MgSSR14; MgSSR15; MgSSR17; MgSSR20; MgSSR 25; MgSSR29; MgSSR30; MgSSR40. 100 bp DNA marker ladder was used for MW estimation.

72 ~ __ ANNUAL REPORT 2009 10

8.3 Genetic Diversity Analysis

8.3.1 Cotton (Gossypium hirsutum): Three Hundred microsatellite primer-pairs were screened on a set of eight cotton lines to identify the ones give optimal and polymorphic amplification products. A total of 40 primer­pairs giving optimum band amplification were identified for further molecular characterization of the working collection of cotton. One hundred fifty-six (156) germplasm lines belonging to seven working groups (yield, variety, okra leaf, oil, boll weight, mean hallo length (MHL) and bacterial blight resistance) were characterized using these 40 primers. PCR amplification products were resolved using polyacrylamide gel electrophoresis. A total of 173 amplification products were obtained, of which 149 were found to be polymorphic resulting in 86% polymorphism. The number of polymorphic markers per primer ranged from 1 (BNL3594, MUCS082, CIR291 , MUCS422, MUCS46) to 8 (MGHES73, JESPR215, JESPR66) with an average of 3.73 polymorphic bands per primer. Resolving power of primers and polymorphism information content (PIC) INere calculated to find their efficiency to distinguish p'enotypes unambiguously. Microsatellite profiling of 156 accessions for MGHES 40 locus is depicted in Figure 9. Average pair-wise similarity was found to be 63% in the whole working collection. Accessions IC-357200 and IC-356527 showed the maximum similarity (98%), while IC-356975 and IC-357682 CY showed the least pair­wise similarity (36%). All the accessions of working collection could be grouped into six major clusters. Band statistics like per cent polymorphism, polymorphism information content (PIC) and resolving power of each marker locus was determined. Resolving power of a pnmer was fouod to be the best statistics for unequivocal identification. Nineteen microsatellite marker loci were found to be useful in discriminating all 156 accessions of working collection based on resolving power. The probability of identity of fingerprints of two accessions by chance was found to be very low (2.95 x 10.17

).

Figure 9: SSR profiling of 156 working collection accessions of cotton

8.3.2 Finger millet: A total of 69 alleles were generated U'~ing, 17 STMS primer pairs. The number of alleles generated per locus ranged from 1 to 8 with a mean of

4.0 alleles per locus . Gene Diversity (expected heterozygosity) for all the 67 lines varied from 0.0 to 0.734 with an average gene diversity of 0.471. The African lines showed higher level of divergence (0.482) as compared to Indian germplasm lines of finger millet (0.434). The diversity data suggested that the Indian germplasm pool was created from a limited number of founder populations. The Jaccard's similarity coefficients (JSC) values for STMS markers ranged from 0.061 to 1.0 with a mean JSC value of 0.394. STMS markers were showing average JSC of 0.439 and 0.335 for the elite germplasm lines of Indian and African origin respectively, revealing less variation in Indian lines. STMS marker data explained considerable diversity among finger millet genotypes used in our study. Considerable consistency of the results among PCO (Figure 10) and clustering method showed that STMS markers accurately revealed genetic structure among el i te germplasm lines of finger millet. Clustering with the STRUCTURE program reflected that this set of lines was really comprised of 5 genetically distinct subpopulations. When only two clusters were allowed, the lines clustered mainly based on geographic origin; Subpopulation I (the African group) while mainly Indian germplasm formed a second subpopulation. There was good correspondence between the geographic patterning observed in the UPGMA tree and the popUlation structure identified using STRUCUTRE. Although the population subgroups corresponded largely to geographic regions, there were some notable exceptions. Majority of the lines of Indian origin appeared together and were sister to the lines that originate mostly from African lowland countries like Zimbabwe, Tanzania and Zambia.

...

Figure 10: 3D Principal Coordinate Plot of 67 elite germplasm lines of finger millet based on STMS data

8.3.3 Wheat: Seventy extant varieties were profiled with 18 STMS primer pairs . PCR products were run on 3% metaphor agarose gel. The number of alleles generated

I ( O_tl,;DNAFINGERPRINTI~G ________________________ _ 73

per locus ranged from 3 to 7 with a mean of 4.1 alleles per locus based on 16 SSR primer pairs. Allele size data of 66 varieties was converted to 011 profiles and subjected to UPGMA cluster analysis. Average Jaccard's similarity coefficient was 0.345 showing around 65% . variation among this set of varieties studied. Two major clusters were observed, Triticum durum varieties could be clearly differentiated from Triticum aestivum varieties; varieties of the two species were placed in different sub-clusters.

8.3.4 Vetiver (Vetiveria zizanioides L.): Eighty-six accessions of Vetiveria zizanioides L were collected from Issapur farm, New Delhi. Fifteen ISSR primers were used for diversity analysis eighty-six accessions of Vetiveria. Initial study shows that ISSR maker could be a good maker for diversity study in Vetiveria accessions (Figure II).

Figure 11 : Molecular Profile generated using ISSR maker UBC-801. M- Molecular weight maker (100bp), Lane 1-48

are Vetiver accessions.

8.3.5 Kalmegh (Andrographis paniculata): ISSR markers were used for diversity analysis of fourteen accessions of Kalmegh. Twenty ISSR primers were screened out of which 15 primers showed good amplifi­cation. Out of this twelve primers were used for study of fourteen accessions. Jaccard's similarity coefficient was used to generate similarity matrix. Dendrogram was constructed for amplicons generated using the ISSR makers using the UPGMA method(Figure 12). All the accessions are grouping in to two clusters except IC-324134 and IC- 471889 which are grouping together and are sharing maximum similarity (1.00).

8.3.6 Jatropha (Jatropha curcas): The National Cryogenebank at NBPGR received germplasm of Jatropha curcas, Pongam, wild apricot, cheura, Garcinia and Simarouba collected under the NOOVD Board project. These accessions are collected from the different

Figure 12 : Dendrogram generated for 14 accessions of Kalmegh based on ISSR data

states of the country. In order to select a set of representative diversity of Jatropha, Pongam and Simarouba for DNA profiling, selection were based on the basis of available data, namely, passport information, oil content and the information on the collection site etc. About 228 accessions of Jatropha, 26 accessions of Pongarnia and 3 accessions of Simarouba from 21 states were selected on the basis of above available information.

The seeds of these accessions were sown to obtain leaf material for the DNA extractions and fingerprinting. The available accessions of Jatropha, Pongamia and Simarouba in NBPGR have been used for DNA extraction and screening of the primers for DNA profiling. Sixty AFLP primers were screened in addition to 200 RAPD and 50 ISSR primers in order to identify the markers polymorphic enough to distinguish distinct genotype of the Jatropha. A set of 40 RAPD, 20 ISSR, 20 AFLP primers were identified as suitable for genetic diversity anaJysis and DNA fingerprinting of the Jatropha genotypes. Thirty out of the 50 suitable RAPD primers were used for profiling of the 257 accessions.

8.4. Molecular phylogeny of species under the genera Vigna, Cucumis and Abelmoschus

Basic data for establishing identity of the species under the three target genera was obrained by survey of 3 major BSI herbaria and identification keys for 11 Abelmoschus species was completed; 20 Vigna from Asiatic region require further evidences and investigations. The work is multifaceted and includes study of morphological variation, basic cytological evidences, molecular cytology, crossability studies and

74 ________________ Al\iNUALRIPORT2009- 1O

molecular taxonomy. Accordingly, species specific DNA fragments were identified for in situ chromosomal hybridization studies: 8 in Vigna, 4 in Cucumis and 6 in 4.belmoschus. Optimization of peR conditions for 32 cpDNA loci in Vigna, Cucumis and Abelmoschus was completed. DNA sequence information was generated for 4 regions in 40 Cucumis; 1 region in 25 Abelmoschus & 1 region in 160 Vigna accessions. peR conditions for direct sequencing of rONA regions were optimized for the 3 target genera. Generated sequence information for 3 regions in each of 40 Cucumis; 25 Abelmoschus and ] 60 Vigna accessions. Prefertilization barriers in A. esculentus x A. tetraphyllus crosses was identified to be due to incompatibility arising out of pollen - pistil interaction on account of callose plug formation. DNA sequence variation in rbcL locus identified to distinguish effectively the 2n=14, C. sativus from 2n=24 C. melD groups.

8.4.1 Prospecting for genes conferring tolerance to moisture stress: In the newly initiated NAIP funded project, basic sets of core accessions for the study were identified in rice (over 6000 accessions), cucurbits (270 accessions), Lathyrus (486) and mothbean (237); these accessions were assembled and multiplied to facilitate screening of the genotypes for characterizing the response to moisture stress. Genes related to stress tolerance in related plant taxa were identified from public databases and primers were synthesized. The SSR primers spanning the whole genome were identified in rice, cucurbits, Lathyrus and mothbean; the peR optimization is in progress.

I

8.5 Molecular Diagnosis of Transgenic Planting Material

8.5.1. peR based detection protocols have been developed for the following transgenic planting materials: Hexaplex peR assay for simultaneous amplification of commonly used marker genes i.e, nptII, aadA. bar, pat, hpt and uidA have been developed, which can be used as an efficient tool for initial screening of GM planting materials, irrespective of the crop and GM trait (Figure-13).

• Multiplex peR assay for simultaneous detection of multiple target sequencesi.e., crylAc gene, crylAb gene CaMV 35S promoter sequence, aadA marker gene, nos terminator along with the specific a­Jructosidase endogenous gene in GM brinjal

~

i i 1 ~ I

! i i i ! ! ~ ~ !

~ ~ ~ 1 i i

800bF' -._.,_ I-- .'" - -.. -._ t:: - .. ~. "iOO bil -.OObp - .... _., ......... _.#_A

- .1_-. _. - -250 bp - - - ... 200 bp - 1nbtll~_ - - - - -..,. -100Dp

.... + - - - - - - I-- _.

Figure 13: Multiplex peR assay for testing of primer interference using equivalent DNA mix of six different GM

events, i.e., MON 531 of cotton, MON 15985 of cotton, Widestrike cotton, 8t rice, GM rice with ferritin gene and

8t176 of maize

• Multiplex peR assays in duplex, triplex and tetraplex format were developed in GM potatofor simultaneous detection of:

• RB gene, CaMV 35S promoter, npt II marker along with a taxon-specific endogenous UGPase gene(figure 14)

Figure 14: Quadraplex peR for simultaneous detection of RB gene, CaMV 358 promoter, nptJl marker gene and

endogenous UGPase gene in GM potato

•

•

M: 50 bp ladder. Lane 1: Water control. Lane 2: Non-GM potato, Lanes 3-4: GM potato with RB gene

Amal gene, CaMV 35S promoter, nos terminator, npt 1I marke and endogenous UGPase gene

crylAb gene, CaMV 35S promoter, nos terminator, nptIJ marker gene and endogenous UGPase gene

('OI\jDNAFINGERPRI~TlNG _____________ _ 75

Simwex and multiplex polymerase chain reaction (PCR) based methods for detection of AVP 1 D transgene, Cauliflower Mosaic Virus (CaMV) 35S promoter, neomycin phosphotransJerase (nptll) selectable marker gene and nopaline synthase (nos) terminator along with fJ-fructosidase gene, an endogenous gene of Solanaceae family has been standardized in GM tomato (Figure 15)

Figure 15: Quadraplex PCR for simultaneous detection of avp1, CaMV 358 promoter, nptll marker gene and

endogenous LAT52 in GM tomato M: 100 bp marker, Lane 1-3: GM tomato, Lane 4: Non-GM tomato,

Lane 5: Water control

• In Bt okra Triplex peR for the detection of crylAc gene, CaMV 35S promoter and npt II marker gene has been standardized.

• In Bt Cabbage Triplex peR for the detection of crylAc gene, CaMV35S promoter and npt 11 marker gene has been standardized.

8.5.2 Development of construct-specific peR based detection protocols for specific GM traits followed by nested PCR in following GM crops:

76

• Bt-brinjal and Bt-rice: rylAc gene specific transgene construct (juncture of35S promoter and crylAc gene)

• GM Tomato: AVP 1 gene construct in XAVPID-2 GM tomato line (juncture of 35S promoter and avp 1 gene)

• GM Cotton: crylAc genes construct in Bt­cotton events viz. BG I, BG II, Eventl and GFM-cry lA (juncture of 35S promoter and crylAc gene)

8.5.3 Qualitative detection using Real Time PCR has been carried out for the following transgenes:

• GM Tomato: AVPI gene in XAVPID-2 GM tomato line

• GM Cotton: EPSPS gene in Roundup ready cotton (MON 1445) (Figure 16)

• GM Potato: crylAb gene in GM potato.

lO.m-.__"""""'"

0.1"0

/ I

Figure 16: Amplification curves for epsps gene in Roundup ready cotton (Man 1445)

8.5.4 Sampling strategies for PCR-based transgene detection upto the detection limit of 0.1 % (by mixing 1 GM seed + 2999 non-GM seeds) at 95% probability level in GM Brinjal and GM Tomato

M -----... -----

• Bt-Brinjal with crylAc gene (Figure 17)

• GM tomato (XAVPlD-2 line) with AVPI gene (Figure 18)

2 3 4 M 2 3 4 ----- -... .. 475 bp : cryfAc -- 19& bp CaMV35S -- • --

Figure 17: peR amplification of cry1Ac gene and CaMV 35S promoter gene in Bt-brinjal test sample

Lane 1: Bt-brinjal test sample (1 GM brinjal seed + 2999 non-GM brinjal seeds), Lane 2: Non-GM brinjal , Lane 3: Water control,

Lane 4: GM brinjal (100% GM)

__ ANNUALREPORT2009-1C

Figure 18: peR amplification of avp1 transgene construct in GM tomato test sample

Lane 1: GM tomato (100%), Lane 2: GM tomato test sample (2999 non-GM tomato

seeds +1 GM tomato seed), Lane 3: Non-GM tomato,

Lane 4: Water control

8.5.5 Molecular testing of imported Transgenic Planting Materials

• Two-hundred and sixteen samples of total fourteen imports including transgenic Oryza sativa (143 ac­cessions-6 imports) with ery1Ab, ery1C, ery1Ae, ery2A, bar, silencing gene for mye gene and rice phytochrome and flowering time (PFfl) by RNA interference (RNAi) genes Gossypium sp. (15 ac­cessions-2 imports) with ery1Ae, ery2Ab, epsps At ANP 1, 5052, At A-20, At CBF-3 and At 5051 genes and Zea mays (10 accessions-5 imports) with e ry 1 Ab, ery 1 F and ep4epsps genes and Arabidopsis thaliana (48 accessions-l import) with CaMV 35S promoter were received for molecular testing.

• All imported transgenic lines were tested to ensure the absence of embryogenesis deactivator gene by PCR with primers specific to the ere-lox system. Plasmid cloned with ere sequence was used as posi­tive control. In PCR amplification of ere sequence the amplicon of l031 bp size was amplified only in positive pla6mid sample while, no amplicon of cor­responding size was observed in any of these transgenic samples ensuring the absence of embryo­genesis deactivator gene.

• Primers were also designed to test for specific/ marker genes in these lines in simplex and multiplex and Real Time PCR.

( Of\4 DNA FINGERPRINTING __

8.6 Whole genome sequencing of Mesorhizobium ciceri isolate CA 181

The fresh isolate of Mesorhizobium eieerae Ca181 authenticated by NBAIM Mau was sequenced using the Roche 454 Pyrosequencing technology. Assembly of short contigs based on lOx sequencing into large consensus sequences resulted in one single contig with a total length of 6.432 ME. The quality values of the base reads were 60 for more than 99.97% of the bases and for the rest the values were 40 indicating high reliability of the sequence reads. In addition to the genomic sequence, sequence of a plasmid of length 261 KB was also obtained. The strain sequenced had a homology of only 85% to M. loti sequence in GenBank.

Summary of genomic sequencing results for Mesorhizobium ciceri isolate no. ca 181:

1. Total number of contigs sequenced 6300

2. Average length of contigs 1025 bases

3. Total number of large contigs 150

sequenced

4. Average length of a large contig 6150 -175000 bases

5. Total length of genome 6.432 MB

6. Average quality score for bases 40 to 60

7. Total genome coverage 99%

8.7 Technology Development

8.7.1 Application of DNA based markers to differentiate Citrus rootstocks: Grafting and microbudding in citrus requires excellent quality root

77

stock material. It has been shown that lambhiri and Rangpur lime provide the quality root stock seedlings. However, GaZgaZ is not advised for various reasons including its susceptibility to diseases. However, it becomes difficult to identify deliberate as well as inadvertant mixture of galgal plants in the nursery. This impediment may lead to great economic loss in the citrus orchards eventually.

Fifteen accessions each of Galgal, Rangpur lime and lambihri were fingerprinted at 25 STMS loci to develop technology for citrus root stock identification. The protocol was optimized for DNA isolated from leaf tissue and includes results based on peR and electrophoresis. A marker was identified and a technology pakcage developed for the purpose of distinction of Galgal, lamhhiri and Rangpur lime on a large scale DNA testing of citrus rootstocks used in the nurseries in Maharashtra. Presently, a MoD is being arrived at

·between NBPGR and KVK (Durgapur) Arnravati to transfer the technology.

8.8 Establishment of National Genomic Resources Repository

National Genomic Resources Repository has been

Research Programme (Programme Code: Title, Leader)

commissioned at NBPGR. Space has been designated and the infrastructural facility for low temperature storage (-80 deep freezers) and high throughput genomics are being developed. To bring the operations under institutional framework, two research programmes have been formulated as:

1. Establishment and maintenance of National Genomic Resources Repository

2. Development of genomic tools for the enhanced utilization ofPGRs

8.9 Human Resource Development

A Winter School on "Molecular markers for efficient management and enhancing utilization of plant genetic resources" was organized from 05 to J 6 January 2010 for the benefit of teachers and scientists from various agricultural universities and research institutes. About 15 scientists attended this Winter School. The topics covered included application of molecular markers, new generation markers and technologies for enhancing utilization of genetic resources.

Technology Development for DNA Fingerprinting of Agri-horticultural (S. K. Sharma)

Research Projects (Code, Title, PI, CoPls and Associates)

PGRlDFP- BUR-DEL-01.00 Technology Development for DNA Fingerprinting of Cereals and Millet Crops (Lalit Arya, Rakesh Singh, GJ Randhawa, SS Malik and Manjusha)

PGR/DFP- B~R-DEL-02.00 Technology Development for DNA Fingerprinting of Pulses, Oil seeds and Fibre Crops (KV Bhat, MK Rana, Rakesh Singh and AB Gaikwad)

PGR/DFP- BUR-DEL-03.00 Technology Development for DNA Fingerprinting of Horticultural Crops (AB Gaikwad, Sunil Archak and K.V. Bhat)

PGRlDFP- BUR-DEL-04.00 Technology Development for DNA Fingerprinting of Medicinal and Aromatic Plants. (Rakesh Singh and G.J. Randhawa)

PGR/DFP- BUR-DEL-OB.OO Crop DNA Finger Print Database and Statistical Analysis Package (Madhu Bala)

PGRlDFP- BUR-DEL-OS.OO Technology Development for DNA Fingerprinting of Forage and Fodder Crops (MK Rana. Manjusha Verma and Lalit Arya)

PGRlDFP- BUR-DEL-07.00 AnalYSis of Genetic Diversity and DNA Fingerprinting of Cucurbitaceous Crops (Manjusha Verma. MK Rana, Lalit Arya and AB Gaikwad)

PGRlDFP-BUR-DEL-08.00 Bioinformatics Softwares Protal (Madhu Bala, Sunil Archak and RC Agarwal)

Externally Funded Projects

• Application of Microorganisms in Agriculture and Allied Sectors (AMAAS) (ICAR) (K V Bhat)

• Referral centre for Molecular Diagnosis of Transgenic Planting Materials (OBT) (GJ Randhawa)

• Development of STMS and SCAR markers in bittergourd (Momordica charantia L.) and their utilization for genetiC characterization and tagging of gynoecious trait (DBT) (Ambika Baldev Gaikwad)

78 _ A."lNl'ALREPORT2009 10

• Molecular characterization of cotton gerrnplasm (TMC MM 1) (Mukesh Rana)

• DNA Fingerprinting and Molecular Characterization of Jatropha Gerrnplasm Collected from Diverse Agroclimatic Zones of India (NOVOO Board) (KV Bhat)

• Molecular Tools for Exploitation of Heterosis, Yield and Oil Quality in Sesame (NAIP) (KV Bhat)

• Biosystematics of the Genera Vigna, Cucumis and Abelmoschus (NAIP) (KV Bhat)

• Development of STMS markers and construction of framework map in greengram (Vigna radiata L. Wilczek) (OBT) (KV Bhat, IS Bisht, Ambika B Gaikwad)

• Prospecting of genes and allele mining for abiotic stress tolerance (NAIP) (KV Bhat, CCPI)

• Rationalization of rice collections originating from major areas of diversity and allele mining in selected unique set of accessions for biotic, abiotic and quality traits using molecular markers. (ICAR-NPTC Project) (Rakesh Singh)

\TR l)l'\j DNA FINGERPRINTING ___________________ _ 79

9. REGIONAL STATION, AKOLA

Summary: Two exploration and collection missions were undertaken to the Vindhya and Satpura ranges of Maharashtra and assembled a total of 141 accessions of germplasm, one for mango germplasm in collaboration with CISH, Lucknow and the College of Agriculture of MPKV, Dhule and the other for vegetable crops and their wild relatives germplasm. A total of 8,654 accessions of germplasm were grown and maintained in the experimental farm, out of which 2,997 accessions were raised during Rabi 2008-09 and 5,697 accessions were raised during Kharif 2009. A total of 1,580 accessions of germplasm were characterized during 2009, 1,048 accessions during Rabi and 532 accessions during Kharif. A total of 512 accessions of germ plasm comprising 176 accessions of grain amaranth, 175 accessions of chick pea, 57 accessions of two species of Abelmoschus, 53 accessions in four species of Lathyrus and 51 accessions in three species of Unum germplasm were multiplied and sent for conservation in the NGB. A total of 726 accessions of germ plasm of various crops/ species were supplied to 29 indenters from different user agencies for their research and improvement programmes within the country, out of which 430 accessions were to 18 indenters outside NBPGR and 296 accessions were to 11 indenters within NBPGR. A field day for Rabi crops was organized at the Station on 21" February 2009 and a total of 50 participants went round the experimental fields and selected germplasm with desired characters in 1158 accessions of Amaranthus, 1010 accessions of chick pea, 517 accessions of safflower, 193 accessions of linseed and 119 accessions of grass pea.

The Station is mandated to explore, collect, evaluate, maintain and conserve the plant genetic resources of different agri-horticultural crops of the Central Indian Region i.e. Maharashtra, Chhatisgarh, Madhya Pradesh and adjoining regions of Gujarat and Karnataka. This station provides the desired germplasm to the breeders and scientists of different institutes/ universities in India and abroad for their research work focused to improve the agri-horticultural crops. It is one of the co-operating centers for All India Coordinated Research Project on Under Utilized Plants.

9.1 Plant Exploration and Germplasm Collection

A total of 141 accessions comprising mango, minor frui ts, vegetable crops and their wild relatives were collected from Satpura and Vindhya ranges in Maharashtra. The exploration-wise details are mentioned (Table-I).

Table 1: Exploration and collection of germ plasm

S.No. Areas surveyed Period of collection Diversity collected No. of accessions

1. Satpura and Vindhya P'-151h June 2009 Mango and minor fruits 41 ranges in Maharashtra

2. Satpura and Vindhya 3"'-12th November 2009 Vegetable crops and 100 ranges in Maharashtra

9.1.1 Exploration for the collection of mango germplasm: An exploration was undertaken to the Satpura mountain ranges of Maharashtra in collaboration with the CISH, Lucknow and the Department of Horticulture, Agricultural College (MPKV), Dhule to survey and identify elite genotypes of mango, especially that of the fast eroding very old and huge mango trees that are left over in the tribal dominated areas of Nandurbar, Dhule and Jalgaon districts of Maharashtra. In all, 38 distinct elite genotypes were identified jointly by the survey team and scion sticks were collected as germplasm from the identified plants using standard

80

their wild relatives

Total 141

techniques. The collected germplasm was packed with adequate care and were sent then and there to CISH, Lucknow for initial establishment, evaluation and further maintenance in their field gene bank. Also the gerrnplasm of one accession each of three wild edible fruits namely, Aegle marmelos, Meyna laxiflora and Grewia tiliaefolia var. tiliaefolia were collected and sent for cryopreservation. The associated passport data and the geographical locations (using GPS) were recorded on the spot for documentation and national accessioning. Seven mango accessions could be successfully grafted at CISH, Lucknow.

_ A"JNUALRIPORT2009-IO

N/09-110: 'Meika' - Cucumis setosus, a very rare edible pecies collected from Igatpuri, Nasik Dist., Maharastra

N/09-88: Pumpkin with red coloured white striprd. fruit weighing around 2 kg. per fruit, collected from the tnbals of

Dad, Nandurbar Dist., Maharashtra.

9. ].2 Exploration and collection of vegetables crops and their wild relatives germ plasm from the Satpura and Vindhya ranges in Maharashtra: As per the recommendation of the Research Advisory Committee of NBPGR and after suitable gap analysis studies, a ten days' exploration mission was undertaken by the Regional Station, Akola to the Satpura and Vindhya ranges in Maharashtra for the collection of prevailing diver~ity of vegetable crops and their wild relatives germplasm. Seven districts namely Jalgaon, Nandurbar, Nashik, Pune, Satara, Ahmadnagar and Jalna were explored and a total of 100 accessions of germ plasm belonging to 32 species spread over in 12 genera comprising 78 accessions of Cucurbitaceous, II accessions of Leguminous, nine accessions of Malvaceous and one accession of Solanaceous members

R .IONALSTATION,AKOlA ________ _

were assembled. Apart from these, a lone accession of red-grained Sorghum germ plasm used solely for pappad making by the tribals of Nandurbar was also collected. Specific collections include one accession of Cucumis setosus from Igatpuri in Nashik District, locally known as 'Meika', which is extremely rare; one accession of Ridge gourd (Luffa acutangula) with very long fruits measuring 63 cms collected from tribals from Kalwan area of Nashik District and one accession of red coloured with white striped pumpkin weighing around two kg/fruit from the tribals of Dab area in Nandurbar district (Table-2).

Table 2: Species-wise germ plasm accessions collected during November 2009

S.No. Species Name Accns.

1 Abelmoschus esculentus 2 2 Abelmoschus ficulneus 4

3 Abelmoschus tetraphyllus 3 4 Canavalia ensiformes 1 5 Canavalia virrosa 1

6 Cucumis callos us 4 7 Cucumis hardwickii 10

8 Cucumis melo 5

9 Cucumis melo var. momordica 3 10 Cucumis sativus 5

11 Cucumis setosus 1

12 Cucurbita moschata 8 13 Cyamoposis tetragonoloba 2 14 Dolichos lablab 2

15 Kedrostis rostrata 1 16 Lagenaria siceraria 5

17 Luffa acutangula 14 18 Luffa acutangula var. amara 1

19 Luffa cylindrica 10 20 Luffa tuberose 1

21 Momordica charantia 4 22 Momordica dioica 1 23 Solanum incanum 1

24 Sorghum vulgare 1 25 Trichosanthes cucumerina 2 26 Trichosanthes lobata 1 27 Trichosanthes palmata 1

28 Trichosanthes tricuspidata 1

29 Vigna khandalensis 1

30 Vigna mungo var. sylvestris 1

31 Vigna sesquipedalis 2

32 Vigna unguiculata 1

Total 100

,

N/09-62: Red grained Sorghum used solely for pappad making by the tribals of Nandurbar, Maharashtra

Fruit variability in ridge gourd germplasm collected from the Vindhya and Satpura ranges of Maharashtra

9.2 Germplasm Maintenance

A total of 8,654 accessions of germplasm were grown and maintained in the experimental farm, out of which 2,997 accessions were raised during rabi 2008-09 and 5,697 accessions were raised during kharif 2009. The crop group-wise accessions grown during rabi were under utilized crops (1 ,158), pulses (1 ,129) and oilseeds (710) and that during kharif were vegetables (2,049), oilseeds (2,017), millets (927) and wild relatives of crop plants (704) (Table-3).

Table 3: Crop-wise accessions maintained

Seasonl Crop Group Crop No. of accessions

Rabi 2008-09 (2,997)

Under utilized crops (1,158) Amaranth 1,158 Pulses (1,129) Chick pea 1,010

Grass pea 119 Oilseeds (71O) Linseed 193

Safflower 517 Kharif 2009 (5,697)

Millets (927) Barnyard miliet 143

82

Finger millet 323

Foxtail miliet 282

Kodomillet 77

Little miliet 84

Prosomillet 18

Oilseeds (2,017) Sesame 1,356

Niger 549

Soybean 112

Vegetables (2,049) Okra 2003

Spine gourd 46

Wild relatives (704) Abelmoschus spp. 480

Sesamum spp. 196

Glycine spp. 3

Setaria spp. 25

Total 8,694

Fruit variability in pumpkin germplasm collected from the Vindhya and Satpura ranges of Maharashtra

N/09-65: Fruits of edible Luffa tuberose collected from Dhadgaon, Nandurbar Dist., Maharashtra

9.3 Characterization of Germplasm

A total of 1,580 accessions of germplasm were charac­terized during 2009, 1,048 accessions during Rabi and 532 accessions during Kharif. The number of acces­sions charactelized in each crop along with their check used are given in Table -4.

_____ A~NllALREPORT2009 10

Table 4: Crop-wise accessions characterized

Season/crop group Crop No. of accessions Checks

Rabi 2008-09 (1,048)

Under utilized crops (823) Amaranth 823 Suvarna and Akola local Oilseeds (225) Castor 225 48-1 and DCS-9

Kharif 2009 (532)

Millets (304) Barnyard millet 143 VL-29, TNAU-101 Kodo millet 77 JK-48, GPUK-3

Little millet 84 PRC-03, JK-8 Oilseeds (228) Soybean 112 TAMS-38, TAMS-98-21, IC-568186

Niger 116 JNC-6, CHH-I, CHH-2

Total 1,580

9.3.1 Characterization of castor germplasm: A total of 225 accessions of castor germ plasm were sown during klzarij2008 in augmented design in three metre row length and row to row spacing of 90 cm were evaluated during the period. Three qualitative and six quantitative traits were recorded. The qualitative traits studied were stem colour, <;eed colour and capsule type. The range, mean and CV % of quantitative traits in 225accessions of castor germpla<;m are given in Table - 5 ..

Fruit variability in Cucumber germplasm collected from the Vindhya and Satpura ranges of Maharashtra

Inter specific fruit variability in Trichosanthes germplasm collected from the Vindhya and Satpura ranges of

Maharashtra

Table 5: Range, mean, CV % and CD of quantitative traits in 225 accessions of castor germ plasm

Characters Range

Stem length (cm) 105.28 -326.98

No of nodes on main stem 13.40-37.20

Effective raceme length (cm) 4.92-67.58

Days to maturity 218-230 (Primary raceme)

Days to maturity 174-220 (Secondary raceme)

100 seed weight (g) 10.50-51.12

Mean

179.93

24.72

21.30

224.31

178.77

27.85

CV(%)

22.11

16.72

39.87

1.11

2.64

20.64

CD (0.05)

68.96

NS

7.46

NS

NS

5.84

Promising accessions of castor identified over the best check for effective raceme length and 100 seed weight were as follows :

()\lALSTATION,AKOLA _______________ _ 8~

Inter specific fruit variability in Cucumis germplasm collected from the Vindh and Satpura ranges of

Maharashtra

..

N/09-111: 'Gomiti' - Kedrostis rostrata, an edible cucurbit collected from Igatpuri, Nasik Dist., Maharastra

Effective raceme length (> 40_0 cm): IC95922, IC240634, IC56176, IC47277, IC240598, IC95904 and IC240543.

100 seed weight (> 40.0g): IC95947 , IC95931, IC240533, IC95902, IC95945, IC249731 , IC240584 and IC95927.

Castor germplasm evaluation

84

Tribal children of Dab, Nandurbar, Maharashtra alongwith their daily collection of wild edible fruit 'Olma'- Meyna

laxiflora (Rubiaceae)

9.3.2 Characterization of Amaranth germplasm: A total of 823 accessions of grain amaranth germplasm were grown in Rabi 2008-09 in augmented design using Suvama and Akola local as checks and were evaluated for seven qualitative and eight quantitative traits. The qualitative traits studied included early plant vigour, plant growth habit, leaf colour, stem colour, stem surface, in­florescence compactness and inflorescence colour. The spectrum of variability observed for quantitative traits are given in Table - 6.

Table 6: Range, mean, CV % and CD of quanti­tative traits in 823 accessions of castor germ plasm (Rabi 2008-09)

Characters Range Mean CV ( %) CD(O.05)

Plant height (em) 18.2 -173.2 94.23 21 .78 NS Leaf length (em) 5.9-17.8 11.68 15.65 3.02 Petiole length (em) 1.7-.9.3 4.45 25.31 NS Stem thickness (mm) 4.68-28.0 13.42 22.14 3.99 Inflorescence length (em) 2.80-38.70 12.49 63.58 1.70 Days to 50% flowering 38-72 54.04 11.67 4.14 Days to maturity 75-105 90.61 5.01 5.20 1,000 seed weight (g) 0.30-0.72 0.50 17.05 0.05

••••• ••••• " •••••• -

IC 573862: '8ael'- Aegle marmelos with bright yellow coloured fruits

_____ ANNUALREPORT2009-10

N/08-40: 'Aboli' - Canavalia ensiformes- a tribal legumi­nous vegetable collected from Dambhurni, Yaval, Jalgaon,

Maharashtra

9.4 Conservation of Germplasm in the National Genebank

A total of 512 accessions of gerrnplasm comprising 176 accessions of grain amaranth, 175 accessions of chick pea, 57 accessions of two species of Abelmoschus, 53

Research Projects (Code: title, PI and CoPls)

accessions in four species of Lathyrus and 51 accessions in three species of Lil'1Um gerrnplasm were multiplied and sent for conservation in the NOB.

9.S Germplasm Supply

A total of 726 accessions of gerrnplasm of various crops/ species were supplied to 29 indenters from different user agencies for their research and improvement programmes within the country, out of which 430 accessions were supplies to 18 indenters outside NBPOR and 296 accessions to 11 indenters within NBPOR.

9.6 Medium Term Storage of Germplasm in the Regional Genebank

A total of 19,424 accessions of gerrnplasm comprising millets and minor millets (1,340), pulses (4,868), vegetables (2110), oilseeds (10,462), wild relatives of crop plants (630) and others (4) are being maintained in the medium term storage module under controlled conditions at 7 0 C and 20% RH.

PGR/GEV-8UR-AKO-01.01: Augmentation, characterization, evaluation, maintenance, regeneration, conservation and documentation of genetic resources of pulses (pigeon pea and chickpea), vegetables (winged bean, amaranth and okra) and under utilized crops (M Abdul Nizar, N. Dikshit).

PGR/GEV-8UR-AKO-01.02: Augmentation, characterization, evaluation, maintenance, regeneration, conservation and documentation of genetic resources of oil seed (sesame, niger, castor, groundnut, safflower, soybean and linseed),

millets and minor millets (N Dikshit, M. Abdul Nizar).

RJ..( lONALSTATION,AKOLA _____________ _ 85

10. REGIONAL STATION, BHOWALI

Summary: Two crop-specific explorations were undertaken and 116 accessions including landraces and primitive cultivars comprising cereals (69), pulses/grain legumes (11), oil seeds (07), M. & AP. (27) and Wild relatives (02) were collected from remote areas of Uttarakhand hills under National Exploration Programme. A total of 207 accessions were received for regeneration, characterization and maintenance. Some of the elite seed samples and live rooted plant material viz. M. & AP and WEUPS (Wild Economically Useful Plant Species): Aloe barbadens-110 nos., Curcuma zedoaria-50 Kg, Cymbopogon flexuosus-267 nos., Rose- Geranium (23196 nos. + 10000 stem cuttings), Lavender (11816 nos. + 10000 stem cuttings), Rosa damescena (552 nos.), Rosmarinus officinalis-31757 nos. and 15100 stem cuttings, Stevia rebaudiana - 176 nos., Bamboo- 96 log; Horticultural Plants: Kiwi (2226 nos.), Kagzi nimbu (227 nos.); Agricultural Crops: Wheat (HB-208)- 13 kg were supplied to different farmers / indentors. A total of 124 accessions were supplied to user scientists in the country and 331 accessions deposited in National Gene Bank for conservation.

The Station was established in 1943, as an Imperial Potato Research Station and known as "Hot Spot" for the development of plant diseases. It was meant for potato seed multiplication work and also for brown rot disease (Pseudomonas solanaeaum) testing. In 1956, with the commencement of Wheat Improvement Scheme under PL-480, it was transferred to Indian Agricultural Research Institute (IARI) and its name was changed as "Wheat Research Station". In 1984 it was transferred to Vivekanand Parvatiya Krishi Anusandhan Shala (VPKAS), Almora and remained under the control of VPKAS, Almora for a period of two years. In April 1986, it was retransferred to National Bureau of Plant Genetic Resources (NBPGR), New Delhi. Since then, it is with NBPGR as one of its Regional Stations.

10_1 Exploration and Collection of Germplasm

A total of 116 germplasm accessions were collected through 02 explorations (02 crop-specific). Under the first crop specific exploration, the crops viz., wheat, barley, rapeseed/mustard and assigned MS & AP germplasm were collected from district of Nainital with collaboration of VPKAS, Almora. Another second crop specific exploration was undertaken collaboration with VPKAS, Almora for Cold tolerant paddy, French bean and assigned M&AP gerplasm from district Uttarkashi, Tehri, Dehradun and U.S. Nagar.The collected germplasm comprised of cereals (69), pulses/grain

legumes (11), oil seeds (07), M. & AP. (27) and Wild relatives (02) as per the details given in Table 1.

10_1.1 Germplasm enrichment: A total of 207 accessions comprising of Ricebean-09 accs. (AVT), Rice bean-07 accs., Ricebean -25 accs., Okra-31 accs., Upland Paddy-130 accs., Winter wheat-02 accs. and Lentil-03 accs. have been received from ICAR, Research Complex for NE Hill Region Sikkim Centre, Tadong, Gangtok; RlS Akola; RlS Phagali, Shirnla; GEX, NBPGR, Pusa, New Delhi; VUC, NBPGR, Pusa, New Delhi; RlS Akola.

Table 1: Explorations undertaken under National Exploration Programme

Crop! Crop group Areas Explored Germplasm I II III IV V collected Cereals Pulses M&AP Oil seeds WEUPs

*Crop Specific Entire district of (Wheat, barley, Nainital, UK 58 37 - 14 07 -

rapeseed/mustard and assigned M. & AP. germplasm)

*Crop specific Districts of 58 32 11 13 - 02 (Cold tolerant paddy, Uttarkashi, Tehri, French bean and Dehradun and assigned M. & AP. U.S. Nagar, U.K gerplasm)

Total 116 69 11 27 07 02

*Collaborative tour with VPKAS, Almora (UK)

86 ~ ____________ ~ ______________ ANNUAL REPORT 2009-1 0

Rainfed cold tolerant paddy! upland rice (Oryza sativa) germplasm grown at NBPGR, RlS Bhowali for

characterization and evaluation

Chilli (Capsicum annuum) germplasm grown at NBPGR, RlS Bhowali for characterization and evaluation

10.2 Germplasm Evaluation

10.2.1 Germplasm characterization, regeneratizon and seed multiplication: The germplasm accessions col­lected from Kumaon and Garhwal regions of Uttarakhand were grown at Bhowali for characterization, regeneration and multiplication during Kharif2009 and Rabi seasons 2008-2009 (Tables 2-6).

Table 2: Germplasm characterization during Kharif 2009

Crop No. of Acc. Checks Used

Finger millet 02 VLS-146, VLS-149

Cucumis sativus ssp. 29 Bhowali local, DC-1 and Long Green hardwickii

Sesamum 10 Bhimtal local, Baitalgbat local, Pithoragarh local and Almora local

Okra 65 Pusa A-4, Pusa sawani and Selection-1 (A. esculentus)

Blackgram 02 PU-19, PU-35 and UG-218

Rice bean IVT, AVT-I & 18 RBL-1, RBL-6, PRR-1 & PRR-2 II Hills 2009

Rice bean germplasm 153 RBL-1, RBL-6, PRR-1 & PRR-2

Soybean 08 VLS-54, VLS-47, VLS-21 & VLS-2

Chilli 97 Pant C-1, Pant C-2, JCA-283 and JCF-206

Paddy (Rainfed) 318 Majhera-7, VL-207, VL-208, VL-209

Paddy (Irrigated) 367 VL-61, VL-62, VL-65, VL-82 & VL-86

Table 3: Multiplication for Long Term Storage in National Gene Bank (Kharif 2009)

Crop No. of Acc.

Bitter gourd 05

Paddy germplasm 46

Perilla 02

Pumpkin 09 . Ridge gourd 32

Table 4: Promising accessions identified during Rabi 2008-2009 and Kharif 2009

Crop Main attributes Accessions identified for specific/desired traits

Pea Powdery Days to 50% flowering EC049972 (85) mildew nursery No. of pods/plant IC212631 (18), IC208377 (16). IC208385 (15.7)

RfGIONAl STATION, BHOWALI ________________________ _ 87

(67 acc.) Plant height (cm) EC507770 (160), IC208371 (160), IC208370 (158.3) Checks: 06 Days to 80% maturity IC212631 (155), IC218988 (155), IC218999 (155) (Selection-18, 100 grain weight (cm) IC356344 (22), IC208371 (19.6), IC208364 (19.4), IC208370 (19.3) Harbhajan, Arkil, Bhowali local A, Bhowali local B & Rachna)

Coriander (33 acc.) Days to 50% flowering IC564130 (110), IC564158 (110), IC553153 (113) Checks: 05 (Pantharit, Days to 80% maturity IC564164 (185), IC564140 (190), IC564143 (190) ACR-250, Kashipur local, 100 grain weight (g) IC564091 (11.37), IC564150 (10.67) ACR-41 & Bhowali local)

Fenugreek (16 acc.) Petiole length (cm) IC553128 (2.67), IC391557 (1.97) Checks: PEB & Days to 80% maturity IC564112 (192), IC564131 (199) Bhowali local 100 grain weight (g) IC553128 (9.33), IC553104 (9.33), IC564113 (8.33)

Rapeseed/mustard Days to 50% flowering IC553079 (107), IC553134 (110) (21 acc.) Plant height (cm) IC553142 (114.87), IC260916 (112.07), IC553120 (110.53) Checks: 05 (PL-303, Siliqua length (cm) IC469868 (6.60), IC553109 (6.10) Bhowali local, Pusa No. of total siliqualplant IC260916 (371.33), IC553142 (257), IC553120 (221) Jai Kisan, Pithoragarh No. of seeds/siliqua IC553120 (28) local & Ramgarh local) Days to 80% maturity IC553115 (172)

Wheat (New Days to 75% ear IC564141 (117), IC564157 (118), IC564147 (118) Collections) - emergence Triticum aestivum Plant height (cm) IC564154 (146.20), IC564122 (144.07), IC564090 (143.33) (36 acc.) Days to 80% maturity IC564157 (181) Checks: 05 (VL-829, No. of grains/spike IC564110 (59.87), IC564129 (57.87), IC564166 (57.53) VL-738, VL-719, 100 grain weight (g) IC564157 (5.43), IC564141 (5.11) VL-616 & HB-208) Wheat (II Year)-Triticum Days to 75% ear IC335944 (89), IC335939 (91), IC335936 (98) aestivum (53 acc.) emergence

Checks: 05 (VL-829, No. of spiklets/spike EC609410 (28), EC609406 (27), EC609337 (26) VL-738, VL-719, Plant height (cm) EC609395 (150), IC553123 (148.2), IC553127 (147.6) VL-616 & HB-208) Days to 80% maturity IC553110 (177), IC335944 (179)

Seed yield/plant (g) EC609337 (28.51) 100 grain weight (g) IC553113 (6.40), IC553089 (6.06), EC609403 (5.79)

Barley-New collections No. of grains/spike IC564152 (93.47) (19 acc.) Checks: 04 Plant height (em) IC564152 (134.6) (VLB-56, VLB-64, VLB-1 Days to 80% maturity IC564128 (177), IC564132 (177), IC564136 (177) & VLB-85) Seed yield/plant (g) IC564152 (10.42)

Barley-II Year (18 ace.) No. of grains/spike IC553114 (94.67) Checks: 04 (VLB-56, Plant height (em) IC553149 (138.53), IC55314 (137.13), IC553068 (133.13) VLB-64, VLB-1 & Days to 80% maturity IC553091 (169), IC553087 (169) VLB-85) 100 grain weight (g) IC553114 (5.20), IC553068 (4.32)

Cold tolerant paddy Days to 75% peniele IC558324 (103), KS-71 (128), KS-20 (130), IC548633 (133), (Rainfed)-134 emergence IC566856 (133) Checks: 05 (Majhera-7, Plant height (cm) IC566801 (164.00), IC548644 (163.2), IC548655 (161.6), VL-206, VL-207, VL-208, IC548652 (158.4) VL-209) Days to 80% maturity IC548391 (137), IC548419 (138), KS-51 (138), KS-72 (138)

100 grain weight (g) IC548622 (3.09), IC548668 (3.02), IC444223 (2.63), IC444253 (2.58)

Grain yield / plant (g) IC566824 (55.04), KS-80 (27.38), IC444253 (25.27), IC566804 (22.73)

Soybean (08) Leaf length (cm) IC566831 (18.67), IC566825 (18.67) Checks: 04 (VLS-2, Days to 80% maturity IC564120 (128) VLS-21, VLS-47, Plant height (em) IC564102 (197.7), IC564100 (152.5), IC566794 (145.3) VLS-54)

88 __ A."lNL'ALREPORT 2009 10

Sesame (09) No. of capsule per plant IC566827 (166), IC566829 (136), IC566807 (134) Checks:04 Plant height (em) IC566827 (114.8), IC566B07 (108.5) (Bhimtal local, Days to 80% maturity IC566807 (123) Baitalghat local, Days to 80% maturity IC566807 (123) Almora local & 100 seed weight (g) IC566829 (2.40), IC556550 (2.25) Pithoragarh local)

Rice bean IVT Hills Days to 50% flowering PRR-2007-1 (60), PRR-2007-2 (60), PRR-2008-1 (67) (14 ace.) Days to 80% maturity PRR-2007-2 (93), PRR-2008-2 (115), PRR-2008-1 (118) Checks: 04 (PRR-1 , Seed yield (q/ha) RL-3 (8.25) PRR-2, RBL-1 & 100 seed weight (g) IC563980 (13.61) RBL-6)

Rice bean Days to 50% flowering LRB-340 (60), LRB-320 (75), LRB-321 (75), LRB-323 (75) germplasm (150) Plant height (em) LRB-498 (280.0), LRB-496 (266.0), LRB-495 (240.0), Checks: 04 (PRR-1 , LRB-492 (220.0) PRR-2, RBL-1 & Days to 80% maturity LRB-305 (115), LRB-306 (115), LRB-307 (115), LRB-415 (120) RBL-6) 100 seed weight (g) EC615198 (10.14), EC615199 (9.86), LRB-420 (8.69),

LRB-437 (8.47)

Table 5: Range, mean and coefficient of variation in various crops during Rabi 2008-2009 and Kharif2009

Crop Character Range Mean PCV"Io

Min Max

Pea Powdery Days to 50% flowering 85 120 110.25 9.01 mildew nursery No. of pods/plant 2 18 10.3 36.6 (67 aces.) Plant height (em) 40.3 160 95.66 33.2

No. of seeds/pod 4 7 5.7 11.9 Days to 80% maturity 155 175 169 3.3 1 00 seed weight (g) 4.3 22 13 40.2

Coriander (33 aces.) Days to 50% flowering 110 143 123.13 7.43 Petiole length (em) 1.6 5.8 3.07 29.73 Plant height (em) 37.6 91.8 62.99 20.2 Days to 80% maturity 185 200 195.39 1.81 100 grain weight (g) 6.0 11.4 8.19 13.34

Fenugreek (16 aces.) j

Days to 50% flowering 102.33 163.33 124.17 11.524 Petiole length (em) 0.87 2.67 1.32 35.3 Days to 80% maturity 192 210.00 205.58 2.44 Plant height (em) 20.70 52.17 37.97 22.57 100 grain weight (g) 6.00 9.33 7.35 14.3

Rapeseed! mustard Days to 50% flowering 107 147 123 10.45 (21 aces.) Plant height (em) 48 115 71 29.21

Siliqua length (em) 2 7 5 18.60 No. of total siliqua/plant 136 371 192 27.05 No. of seeds/siliqua 12 28 21 15.87 Days to 80% maturity 172 198 181 3.72 100 grain weight (g) 2 3.40 2.84 16.47

Wheat (New Days to 75% ear emergence 117 151 134 4.61 Colleetions)-Triti9um No. of spiklets/spike 17.4 22.27 19.41 5.50 aestivum (36 aces.) Plant height (em) 94.13 146.2 130.17 9.88

Days to 80% maturity 181 192 188 1.27 No. of grains/spike 33.67 59.87 46.14 11.15 Seed yield/plant 5.98 13.18 9.38 15.61 100 grain weight (g) 2.99 5.43 3.65 14.46

Wheat (II Year)- Days to 75% ear emergence 89 180 143 15 Tnticum aestivum No. of spiklets/spike 15 28 21 12 (53 aces.) Plant height (em) 70.1 150 120 17.7

'--.

RE (a01\jALSTAll()~, BHOWALI

, Days to 80% maturity No. of grains/spike Seed yield/plant (g) 100 grain weight (g)

Barley-New collection Days to 75% spike emergence (19 accs.) No. of grains/spike

Plant height (cm) Days to 80% maturity No. of spikelets/spike Seed yield/plant (g) 100 grain weight (g)

Barley-II Year (18 accs.) Days to 75% spike emergence No. of grains/spike Plant height (cm) Days to 80% maturity No. of spikelets/spike Seed yield/plant (g) 100 grain weight (g)

Soybean (08 accs.) Days to 50% flowering No. of seeds / pod Days to 80% maturity Plant height (cm) 100 seed weight (g) Seed yield / plant (g)

Sesame (09 accs.) Days to 50% flowering Capsule length (cm) No. of capsule per plant Plant height (cm) Days to 80% maturity 100 seed weight (g)

Cold tolerant paddy Days to 75% penicle emergence (Rainfed)-314 accs. Plant height (cm)

No. of grains/penicle Days to 80% maturity Grain length (cm) Grain width (cm) 100 grain weight (g) Grain yield / plant No. of tillers / plant

Rice bean IVT -(14 accs.) Days to 50% flowering Days to 80% maturity Seed yield (q/ha) 100 seed weight (g) No. of pod/plant

Rice bean germplasm Days to 50% flowering (150 accs.) Plant height (cm)

Days to 80% maturity 100 seed weight (g)

10.2.2 Physiological Characterization in Paddy: Thirty accessions of Paddy (Oryza sativa L.) were characterized for growth and developmental characters. These accessions have sown much variability in these

90

177 222 195 5.89 23 74 47 20

2.86 28.5 10.3 52.7 3.77 6.4 4.66 12.9

125 138 132 2.13 53,6 93,47 67.12 13,40 107 134.60 120.66 4.70 177 186 181 1.54 16.9 27.60 20.87 14.19 4.44 10,42 6.75 23.41 2.78 4.11 3.17 10.08

119 135 125 3.21 59 94.67 71.13 12.36

115.2 138.53 125.88 5.29 169 178 172,46 1,43 16.3 28.9 23.12 13.21 2.64 13.15 8.37 38.88 2.91 5.20 3.81 14.91

68 83 73 7.03 2 3 2 11.63

128.33 153 143 7.34 66.53 197.73 122.38 36.27

6.01 20.71 11,43 52.15 6.3 48.03 25.78 51.85

65 77 71 5.90 2,43 3.03 2.74 7,49

58 166 97 39.50 78.63 114.77 94.71 14.53

123 142 132 4.36 1.35 2,4 1.79 19.47

103 180.00 151 5.98 58 164.00 107.60 19.38

39.40 302.60 133.24 34.03 137 220 178 5.97 4.04 7.86 5.77 12.69 1.58 3.87 2.49 16.48 0.61 3.09 1.94 23.16 0.03 55.04 6.72 80.64 4.00 37.00 11.45 42.37

60 107 82 9.07 93 137 119 6.89

2.24 8.25 5.55 43.51 6.28 13.61 7.25 7.17

61 233 150 55.45

60 115 98 11.31 85 280 175.79 20.70

115 180 133 8.69 4.01 10.14 6.88 13.47

parameters viz., height of the tiller varied from 28.53-l30.50 cm, root length ranged from 4.86-18.75cm, leaf number per tiller 0.34-6.90, leaf area per tiller from 8.88-94.12 cm2 and dry weight per plant 0.36-24,37 g.

_ A~lIALREPORT2009· 0

A view of unique collection of traditional rainfed rice grown in high altitude areas -Jhalla/ Jhall.ua (NMO-3011)

Primitive cultivars and high price fetching Rajma (Phaseo/us vu/garis)-NMO-3012 small grains, red

coloured, climber type collected from village Sidhri, Block Purola, Dist. Uttarkashi, UK

Table 6: Germplasm evaluation and characterization during Rabi 2009-10

Crop No. of Date of Acc. Sowing

Wheat (Irrigated & rainted) 78 21.10.2009 & 30.10.2009

Barley 37 21.10.2009 Pea (for creening ot powdery 68 20.1l.2009 mildew) Coriander 33 15.11.2009

Multiplication/Seed increase Garlic 132 25.10.2009 Lentil 03 ~5.11.2009

10.3 Promising Accessions in Rabi and Kharif Crops against Diseases prevelant in Hills

10.3.1 Rabi crops:

Wheat: On the basis of two years data following accessions were found resistant against wheat diseases: Powdery mildew: ET1l8650, ET1l861O, PIOTTA, SUBTIL and RUMBA; Yellow rust and brown rust: ETI 18566, ETl18638, ETl18699, ET118781, ETl18820, ETI 18889, ET118909 and ET118993; Yellow rust, brown rust aDd powdery mildew: ET118610, ET! 18827, SUBTIL and RUMBA.

Barley: Yellow rust: mON-W-4, mON-W-60, msp­W-lOO, mCB-W-6 and mON-W-92

Pea: Powdery mildew: IC208378, IC389174, EC507770 and IC208367.

Rf JIONALSTATION, BHOWAll _____ _

Checks Used

VL-616, VL-719, VL-738, VL-829 and HB-208

VLB-l, VLB-56, VLB-64 and VLB-85 Harbhajan, Bhowali local, Bhimtallocal, Rachna, Super Lincon, DMR-J I, HFP-4, Selection-18, Arkil and VL-8 Pant harit, ACR-250, Kashipur local and ACR-41

Lohit and Bhowali local VL-l, VL-I05, PL-406, PL-830

10.3.2 Kharif crops:

Til/Sesame: EC556549 against leaf spot and mosaic VlruS.

Chilli: IC537595 against powdery mildew, leaf spot, mosaic virus and fruit rot.

Soybean: NMB-2890 (IC567944) against leaf spot, mosaic virus.

Ricebean trial: RBL-160, IC563980, RBL-6 and PRR-1 against leaf spot, mosaic virus and powdery mildew.

Rice bean germplasm: LRB-320, PRR-l, LRB-425 and LRB-443 against leaf spot, mosaic virus and powdery mildew.

French bean: NMB-2878 (IC566782) and IC280837 against leaf spot, mosaic virus, yellow mosaic virus and powdery mildew (vegetable type climber).

91

Paddy: IC548675, IC548685, IC556520, IC548372, IC548375 and IC548391 against Helminthosporium and leaf spot.

10.4 Germplasm Characterisation I Evaluation' of Horticultural Plants

10.4.1 Fruit germplasm evaluation:

Peach (Prunus persico) germplasm: A total of 18 accessions were characterized and evaluated for 23 traits (qualitative and quantitative). Variability was found among peach gerrnplasms. Plant canopy ranged from 20700-795233.33 cm2

, fruit length varied from 2.94-7.07 cm, fruit width 3.38-6.25 cm, fruit volume 50-170 cc, fruit weight 1.2-170 g, pulp stone ratio 26-176.25 and TSS range from 10-130 Brix.

Apricot (Prunus armeniaca) germplasm: A total of 16 accessions present in field gene bank were characterized for stomatal characters and flower/fruiting behaviour. Much variabilitty was found in these traits among apricot germplasms. Stomatal frequency ranged from 167-343 per mm2

, stomatal size from 65-102 !lID and stomatal conductance from 86-261 m.mol.m-2.s-1

time to complete flowering process ranged from 19-29 days, petal length varied from 0.7-1.6 cm, fruit weight

41-65 g, time to complete ripening ranged from 39-58 days and TSS ranged from 11.02-13.510 Bille

Apple (Malus spp.) germplasm: A total of 20 accessions of apple present in field gene bank were selected for characterization with reference to variation in flowering and fruiting behaviour. It was found that days from 50% bud out burst to flowering ranges from 7-13, number of flower per plant ranges from 95-1610, flower diameter varied from 2.20-3.78 em, petal length varied from 1.00-2.30 em, petal width ranged from 0.80-1.59 em, fruit weight 75-155 g and yield per plant 38-123 kg.

10.4.2 Vegetable germplasm evaluation: Chilli (c. annuum 35) were sown in an randomized design with four checks - Pant C-l, Pant C-2, ICA-283 and LCF-206 in three replications) where row length, row spacing and plant to plant distance was 2.10 m, 45 cm and 30 em respectively. C. frutescens-07, C.annuum var annuum-08) and other 17 acc. were multiplied. The range of variation for plant height (36.39-77.55 cm), number of fruit/plant (11-52), fruit length (5.10-10.03), fruit width (0.82-1.41 em), fruit yield /plant (l9.67-161.675g) and number of seed per fruit (50 - 97) were observed.

Table 7: Range, mean and coefficient of variation in Chilli during Kharif 2009

Character Mean Range CV% Checks

Min Max Pant C-1 Pant C-2 JCA-283 lCF-206

Days to 50% germination 33 28 42 13 29 29 29 29 Days to 50% flowering 141 131 149 3 133 138 139 138 Plant height (em) 59.71 36_39 77.55 17.40 51.67 58.80 60.63 62 .13 Plant canopy (em) 2561.63 914.40 9787.93 53.82 5127.33 2723.33 2575.67 2681.33 Fruit length (em) 7.95 5.10 10.03 14.94 4.83 8.10 6.64 8.55 Fruit width (em) 1.06 0.82 1.41 14.33 0.93 1.07 0.84 1.17

Days to 50% fruiting 155 147 158 2 - 150 154 154 157

100 seed weight (g) 0.44 0.32 0.81 20.75 0.30 0.43 0.34 0.32 No. of fruit / plant 32 11 52 33 27 30 21 28 No_ of seeds / fruit 68.45 50 97 16.56 61.53 71.73 79.20 80.27

Yield per plant (g) 88.60 19.67 161.67 39.46 93.33 50.00 56.67 126.67

Table 8: Promising accessions identified in Chilli during Kharif 2009

Character Best Checks Promising accessions identified

Days to 50% germination Pant C-2 «29) IC383079 (28), IC517099 (28)

Plant height (em) JCF-206 (>62.13) IC337397 (77.55), IC538029 (77.55), IC538026 (73.80), IC517100 (72.40)

Days to 50% fruiting Pant C-1 «150) IC383150 (147), IC381471 (149)

100 seed weight (g) Pant C-2 (>0.43) IC324887 (0.81), IC517099 (0.58), IC537580 (0.54), IC361897 (0.52)

Yield per plant (g) JCF-206 (>126.67) IC383072 (161.67), IC383136 (158.3), IC538010 (120.0)

92 _____________ ANNlIALREPORf2009- IO

10.5 Management and Maintenance of Horticultural Germplasm

10.5.1. Conservation and maintenance: Fruits (470), \'egetables 1212 (Chillies-l201, Chow-chow-ll), flowering perennial plants (109), flowering annual plants and other horticultural crops (78) are maintained in greenhouse (plants in 2500 pots and 7000 polythene packets)lField Gene BanklMTS at RlS Bhowali. Time schedule maintenance of computer updating with F RNET, India and leAR linkages with smooth cl'nnectivity and Green House Complex were maintained.

10.6 Transfer of Technology

Pantnagar Centre for Plant Genetic Resources (PCPGR)·Management of Plant Genetic Resources a NBPGR Regional Station, Bhowali under Mini Mission I of the Horticultural Technology Mission (PCPGR·HTM MM ·1 Bhowali Unit)

i. Greenhouse maintenance (Clonal repository): All regular operations were timely attended for the maintenance of clonal repository/regeneration of the promising fruit material / collected materials (2500 pots and 7000 polythene packets).

ii. Field Gene Bank Maintenance: Exotic horticultural germplasm was established 43 acc. viz. apple (11), pear (14), walnut (04), citrus (06) in Field Gene Bank / Green House and all regular cuI tural operations were undertaken time to time. Germplasm evaluation is continuously done in the Field Gene Bank. Observation! data are in progress.

2. Regenera tion/M u Iti plica tion!N u rse ry management: Kiwi (EC64093, EC24672, EC64094, EC64090, ECI37263, EC64092), Uttaranchali Kagzi Nimboo (Citrus aurantifolia) IC319045, Uttaranchali Chow-Chow (Sechieum edule) IC340574, Uttaranchali Kaku!Japanese persimmon (Diospyros kaki-) IC219062, Uttaranchali Hisalu IC219063, Uttaranchali Hill lemon IC319067 were regenerated through cuttings, grafting and other vegetative means and through seeds for onward supply to different indentors. Budding operation on different intervals for 500 plants in kiwi was done. Bud showed dormanty but not sprout up to 4-5 years after budding.

10.6.1 Distribution of Elite Planting Material! Germplasm

Harvffited fruits: Peach 53 Kg, strawbeny 4 Kg 750 g.

Grafted/rooted cuttings of fruit crops (5528 plants):

RI'.( IONALSTATION, BHOWALI ____ _

Fruits-5372 (Grape-II, Kagazi Nimbu-78. Peach-46, Kiwi-4791, Passion fruit-I6, strawberry-430), Ornamentals-156 (Cryptomeria-30, Hydrangea-126). Raised Kiwi planting material grafted and stem cuttings were distributed in the ratio of 1:5 male and female plants to VPKAS Almoral among farmers of Uttarakhand.

From farmer's field: Technical know-how for propagating kiwi fruits (grafting and cuttings) were provided time-to-time to selected farmer's under PCPGR-HTM I-Bhowali Unit at different places in Nainital, Uttarakhand. Total plants raised and distributed by the farmers at their own level under technical guidance of NBPGR Regional Station, Bhowali "under Mini Mission I of the Horticultural Technology Mission Project were 24472-Hilllemon-2069, Kiwi (4000), Malta (2658), Peach (10000), Plum (500), Santra (307), Uttaranchali Kagazi Nimbu (4638) and Walnut (300).

10.6.2 Wild Economically Useful Plants

Preliminary Evaluation of Allium spp.: A total of 41 accessions of Allium spp. (wild only) are being maintained and evaluated in field gene bank.

Maintenance of Arhorescent Plants: A total of 190 accessions of arborescent plants comprising of 150 species (92 genera of 50 families of both exotic and indigenous origin) have been maintained in the station'S Biodiversity Botanical Garden.

Maintenance of Bamboosetum: A total of 41 accessions comprising of 18 species belonging to seven genera are maintained.

Maintenance of temperate forage grasses: A total of 54 accessions of temperate forage grasses have been maintained in the field gene bank.

10.6.3 Medicinal and aromatic plants: A total of 445 accessions (indigenous -304 acc. and exotic-141 acc.: vegetatively propagated - 125; seed producing- 320) comprising of 260 species belonging to 153 genera of 37 families have been conserved in the field gene bank! herbal garden of the station. Nearly 30 species of the promising and high prized aromatic plants such as Aloe, Alpinia, Artimisia, Asparagus, Bunium, Carum, Centella, Chrysenthemum, Cymbopogon, Hedychium, Lavandula, Matricaria, Marjorana, Melissa, Mentha, Ocimum, Origanum, Pelargonium, Plantago, Pyrethrum, Rosa, Rosmarinus, Salvia, Spilenthus, Stevia, Tagetes, Thymus, Valeriana, Witlzania and Zanthoxylum were multiplied for their supply to the indetors. The essential oil from lemon grass was extracted

93

Unique collection of Lavendula sloechas L. (Lamiaceae)­IC449512 identified for high Camphor Content (52.12%)

Unique collection of long and broad poded French bean­Phaseolus vulgaris, Pole type (IC280837) used as dual

purpose i.e. tender vegetables and pulse.

Table 9: Germplasm Collectedl Assembled

Place/District Hedychium spicatum

Pithoragarh , Champawat, 01 8ageshwar & Almora (UK) Mukteshwar, Nainital (UK) + Kangra & Mandi (HP) 02 Niglat, Nainital (UK) -Solan, Shimla & Kullu (HP) 01 Almora (UK) -Nainital (UK) 04 Pithoragarh & Chanpawat (UK) -Shillong (Khasi HiIlB) North-East, India 01 Garhwal (UK) 04 Mukteshwar, Nainital (UK) -Neli/Gazer, Nainital (UK) -Vinayak, Nainital (UK) -

Total 13

+ Trip for enrichment of previously collected accessions 94

through steam distillation system.

10.6.4 Determination of Percentage of Essential Oil: A total of 83 accessions of aromatic plants were extracted for percentage of essential oil in different seasons through steam and Hydro (Clevenger apparatus) distillation unit. The range of oil percentage observed in different species is as follows: Steam Distillation Unit: Cymbopogon flexuosus-0.21-0AO (g)/0 .25-0AO (Lit.); Hydro Distillation Unit (Clevenger apparatus) 83 ace.: The range of oil % is observed during the months of January to December 2009 as: Acorus calamus­DWB 5.2-9.50, Curcuma casia (0.80), Hedychium spicatum (DWB-1.20-4.20; FWB rhizome (0.30-1.10), rootlets-0.65), Juniper communis (DWB-1.0), Lavendula angustifolia (FWB-0.80-3.13; DWB-1.80-7.47), Lavendula stoechus- FWB 1.27, Marjorana /lOrtensis (DWB-0.80), Micromaria sp. (DWB-0.7), Origanum vulagare (FWB-0.05-0.66; DWB-0.16-2.00), Pelargonium graveolens (DWB-0.72; FWB-0.25-0.54), Valeriana jatamansi (FWB- 0.34-0.82; DWB rhizome-0.58-3.3).

Studies on relationship between ecogeography of the chemotypic variation of nine important but highly threatened medicinal plant species and prospects of their cultivation

All collected accessions (52) have been propagated in beds and glass house (in pots and poly bags) for germplasm enrichment/regeneration/multiplication/ conservation and domestication practice. Laboratory and field based activities have been summarized in the following table 9.

Origanum Valeriana Acorus vulgare jatamansi calamus

08 02 -

+ + -02 - -01 - -02 02 01 01 - -03 03 02 03 - -- 01 -05 02 01 + - -+ - -+ - -

25 10 04

ANNUALREPOR12009·10

A signed threatened medicinal plants were collected in bulk for oil extraction, anatomical characterizationlphysico­('hemical analysis, nursery practice and germplasm conservation.

Germplasm of wild okra (Abe/mosch{js p{jngens) grown at NBPGR, RIS Bhowali for characterization and evaluation.

Traditional method of rice threshing still in practice in most of the areas of Utlarakhand

Table 10: Physico-chemical analysis, morphology & anatomy and conservation-domestication

Variability Extents & Ethno-botanical Notes

Hedychium spicatum Origanum vulgare Valeriana jatamansi

Stomach ache Herbal tea Incense fire Cure asthma Cold & Cough Insects safe-guards Moth repellant Flavour in fast foods Tobacco perfume ,A,nti-fever dose Water-born infection Wound Healing Tobacco perfume Wound Healing Rheumatism Aesthetic value Aesthetic value Aesthetic value Anti-inflammatory Itching problem -Silage bed Ear ache & tonsils -Insects safe-guards - -Wound Healing - -

Chemical ingredients of essential oils

Species , Compounds

Major Minor

Hedychium spicatum 1, 8-cineole (21.14-58.15%) Limonene (1.66-3.22%)

Linalool (1.73-8.30%) a- terpineol (0.86-2.29%)

Germacrene B (0.55-4.27) Terpinen-4-ol (0.31-0.98) Valeriana jatamansi Sesquiterpene hydrocarbons Valerinic acid (4.34-5.70%)

(11.26-14.03%)

Maaliol (21.20-31.60%)

Origanum vulgare a- terpinene (22.75%) Z, ~-Ocimene, E-~ Ocimene (1.12%)

Thymol (31.88%) Z, ~-Ocimene, E-~ Ocimene (1.12%)

p-Cymine (7.80%) Carvacrol (1.98%)

Linalool (1.72%)

Eco-geographical findings

Features Hedychium Valeriana Origanum

Anthropogenic Disturbances + + + Diseases + + + W, d Predation + + +

RI T )NAL I)TATION,BHOWALI ________________________ _

Sunny Sites

Shady-Moist Sites

Plant Growth in natural condition

Illegal Trade/Industrial Demand

Conservation Status

Forest edge effect

Medicinal Uses

Bea forage

10.7 Germplasm Conservation

A total of 331 accessions of different crops viz. Cereals: Wheat (38), Winter wheat (25), Barley (19), Paddy (33); Millets & minor millets: Finger millet (02), Barnyard millet (17); Vegetables: Radish (0 I), Cucumber (05), Meetha karela (27), Okra (01), Pumpkin (04), Ridge gourd (03); Pulses: Lentil (08), Cowpea (06), French bean (l1-dwarf-02 + climber09), Rice bean (01),

. Soybean (21), Blackgram (02); Oil seeds: Sesame (04), Rapeseed/mustard (20); Spices and condiments: Coriander (35), Fenugreek (08), Perilla (09), Chillies (15); Wild relatives: Abelmoschus pUllgens (15 ace.); Cucumis sativus ssp. hardwickii (01) were supplied to LTS (NGB) for their conservation.

A total of 12023 accessions of germplasm have been maintained in MTS ofNBPGR, RlS Bhowali. The details are here under: Cereals (3909), Pseudo cereals (604), minor millets (570), pulses (3799), oil seeds (573), vegetables (365), spices and condiments (1625), M. & AP. (181), wild relatives of crops (375) and ornamental crops (22).

10.8 Germplasm Supply

MTA supply: One hundred twenty four accessions of different crops were supplied to various Research organi ation /indentor under MTA: Agr. Crops: Cucumis sativus (07 acc. and 03 checks) were supplied to Dr. P.K. Mehta, Dept. of Entomology, CSKHPKV, Palampur, HP; Hort. Crops: Punica granatum-34 acc. to Dr. Ram Chandran, Principal Scientist, NRC for Pomegranate, Sholapur, MS., Chilli-19 acc. to Dr. Viijay Kumar Swamy, H.V., Prof. of Biotechnology, University of Agricultural Sciences, GKVK, Banglore, Kamataka; M&AP: Achillea millifolium-01, Anthemis tinctoria-01, Althea rosea-O 1, Anthemis cotula-O 1, Artimisia anflua- 01, Calendula officina/is-O 1, Datura quercifolia-O 1, Guizotia abysinica-O 1, Lavesticum oJficinalis-OI , Salvia sclarea-Ol were supplied to Dr.

NA NA + + + + + + + + + + + + + + + + + + + + + +

S.S. Parihar, Division of Seed Scienice & Technology, IARI, New Delhi; Acorus calamus-O I acc. and Solanum nigrum-O I acc. were supplied to Dr. K. Rajamani, Prof. & Head, Dept. of Spices & Plantation Crops, Hort. College & Research, TNAU, Coimbatore, Tamil Nadu; Allium (wild)-l0 acc. were supplied to Dr. Maumita Bandopadhyay, Lecturer, Dept. of Botany, University of Calcutta, 35 Ballygunge, Circular Road, Kolkata, W.B.; Sesamum indicum-02 acc., Ocimum spp.-03 acc. to Dept. of Plant Science, School of Life Sciences, University of Hyderabad, Hyderabad; Punica granatum-34 acc. to Dr. Ram Chandran, Principal Scientist, NRC for Pomegranate, Sholapur, MS.

Rose geranium plants provided to progressive farmers of Uttarakhand

NBPGR supply/ exhibition: Different crops were also supplied with in Bureau and other institute for exhibition! research purposes i.e. Agr. crops: Buckweat-02 acc. and Perilla-Ol acc. to NRC, DNA Fingerprinting, NBPGR, New Delhi; WEUPS: Allium spp.- 13 acc. to TCCPU, NBPGR, Pusa, New Delhi; 130 accessions and 10 checks of Upland Paddy germplasm to Dr. J.e. Rana through Dr. K. Pradeep for preliminary evaluation and characterization at Palampur, HP.; 12 samples of brown rust of wheat were supplied to lARl, Flower dale, Shimla, HP for identification of race analysis work to identify prevelant race in Uttarakhand; 10 samples of yellow rust submitted (05-wheat + 05-Barley) for race analysis work

96 --_____________ A\lNUAl REPORT2009 I

tc DWR, RJS Flower Dale, Shimla; WEUPS: Allium pstll!osum-Ol, A. altaicum-O 1 and Ginkgo biloba-O 1 to Mr. Santosh Uphadhyay, NBRI, Lucknow; Allium grifithianum-02 nos. and 01 bulb, A. consanguineum-01 no. to Ms. Deepsikha, CCRAS, Tarikhet; Hort: C .ptomeria japonica-02, Peach-02 to Dr. S.K. Verma, , WGR, RJS Trissur; Rice bean (BRS-l)-250 g seeds to Dr. A.c. Sinha, Head, Dept. of Agronomy, Uttarbanga Klishi Vishwavidyala, P.O. Punibari, Cooch, Bihar.

}<'armers/indentors supply: Seed samples and live ro )ted plant material viz. Hort. crops: Apple-lO nos., Citrus fruits (mixed)-255 kg, Cryptomeria-35 nos., Grapes-08 Kg+l1 no., Gladiolus spikes- 57 nos., Hydrangia-160 nos., Kagazi neebu-227 nos., Kiwi-2226 nos., Lemon-O 1 no., Passion fruit-64 nos., Malta-30 nos., Peach-71 nos. +45 Kg, Santra-88 nos., Strawberry - 400 nos. and 9.75 kg, Tagetes-40 nos., Walnut-03.25 Kg, ClIllilia chinellsis (10 nos.); Agrl. Crops: Barley-16 Kg, Wheat-13 Kg, French bean (300 g), Rajma mixed gl ains-19 .50 Kg, Maize-07 kg; Rice bean mixed-16 Kg, Pta (green pod)-106 Kg; M&AP: Achillea millefolium-12 nos., Acorus calamus 02 nos., Allium chinensis- 10 nos., A. fistuLosum-l 0 nos., A. griffirhianum- 05 nos., A. scorodoprasm-lO nos., ALoe barbadens-ll 0 nos., Apium graveolens-05 nos., Artemisia annua-24 nos. and 95 g, Artimisia maritima-05 nos., Asparagus-Ol ntl Bergenia -04 nos., Brahmi-05 nos., Celery-02 nos., Curculigo orchioides -07 nos., Curcuma zedoaria-

Research Programme (Programme Code: Title" Leader)

50.275 g, Cymbopogon flexuosus-267 nos., Damask rose-42 nos., Digiatlis purpurea - 200 g, Duranta-02 nos., Foeniculum vulgare-09 nos., Ginkgo biloba-07 nos., Gymnosperm- 02 nos., Hedychium spicatum - 05 nos., Hedera nepalensis-O 1 no., Karchoor-02 nos., Lavendula officinalis-05 nos., Lavender-1l816 nos. and 10000 stem cuttings, Marjorana hortensis- 217 nos., Matricaria chamomilla-l0 g, Mentha arvensis-25 nos., Mentha cardiaca-02 nos., Mentha citrata-02 nos., Mentha piperata-05 nos., Melissa officinalis-02 nos., Ocimum kilmondischianum-02 nos., Ocimum viride-05 nos., Origanum vulgare-03 nos., Parsely- 02 nos., Pelargonium graveolens-23196 nos.+l0000 stem cuttings, Pelargonium tomelltosum -02 nos., Plantago-08 nos., Rose-525 nos., Pogostemoll cabLin -05 nos., Plantago lanceolata -05 nos., Pyrethrum ciner~folillm-02 nos., Rosmarinus officillalis-Blue flowered French type-22564 rooted plants; stem cuttings-l 5 1 00, Rosmarinus officinalis-White flowered-788 nos., Rosmary- 8405 nos., Rubia cordifolia (05 nos., Ruta graveolens- 40 g, Salvia moorcoftianum (02 nos.), Salvia officinalis - 44 nos., Salvia verticillata-05 nos), Stevia rebaudiana-176 nos., Valeriana jatamansi-34 nos., Viola serpense-05 nos., Thymus serphyllum-217 nos., Winter savory-02 nos., Withania somnifera-1O g; WEUPS: Bamboo-96 log, Dectylus-20 nos., Gymnosperm-l 0 nos., Lolium-60 nos., Napier-20 nos., Garlic-4.200 gm were supplied to different farmers/ indentors.

PGR/PGC-BHO-01.00: Augmentation, Characterization, Evaluation, Maintenance, Regeneration, Conservation and Documentation of Genetic Resources of the Northern Himalayas and Adjoining Plains (KS Negi)

Research Projects (Code, Title, PI, CoPls and Associates)

PGR/PGC-BHO-01.01: Augmentation, characterization, evaluation, maintenance, regeneration, conservation and documentation of genetic resources of field crops with emphasis on etheno botanical aspects (KC Muneem, KS Negi, SK Verma (upto April 06, 2009), AK Trivedi (w.e.f. June 17, 2009) and PS Mehta)

PGR/PGC-BHO-01.02: Augmentation, characterization, evaluation, maintenance, regeneration, conservation and documentation of genetic resources of temperate horticultural crops (AK Trivedi (w.e.f. June 17, 2009), SK Verma (upto April 06, 2009), KC Muneem, KS Negi and S Gupta)

PGR/PGC-BHO-01.03: Augmentation, characterization, evaluation, maintenance, regeneration, conservation and documentation of genetic resources of medicinal and aromatic, wild economically useful, rare and endangered species (KS Negi, KC Muneem, SK Verma (upto April 06,2009), AK Trivedi (w.e.f. June 17, 2009) A Raina)

Rf. JIONALS1AfIO~, BHOWALI 97

11. BASE CENTRE, CUTTACK ,

Summary: During the reporting period, two explorations were undertaken for collection of niger, M&AP and other wild economic plants from different parts of Odisha. Apart from this, one joint exploration mission with CRRI, Cuttack was executed for the collection of halophytes and a total of eight accessions comprising Suaeda maritima(2), Porteresia coarctata (1), saline tolerant cultivated rice (5) were collected from coastal areas and Bhitarakanika sanctuary in Odisha. A total of 2167 aces. comprising cultivated rice (2088), green gram (38), black gram (41) were characterized for various agro­morphological traits. The accessions viz. IRGC35045, 22499, 26772 in rice, IC565287, 565226, 565255, 569058 in green gram and IC565229, 565220, 568908, 565276 in black gram performed better than the best checks among the respective crops. In addition, a set of 145 accs, of small and medium grained scented rice and 27 aces. of flood tolerant rice germplasm collected were grown during Kharif 2009 for evaluation in collaboration with CRRI, Cuttack. A total of 2,258 accessions comprising cultivated rice (2,036 accs.), green gram (38 accs.), black gram (41 accs.), horse gram (18 accs.), sesame (125 accs.) deposited for LTS and M & AP (63 accs.) and 2 accs. of wild relatives were added to the field gene bank of the centre. A total of 3,094 accs. comprising cultivated rice (2,212), medicinal and aromatic plants (349), sesame (300), wild Oryza species (164), other wild relatives (22), economic plants of agro-forestry importance (24), banana (17), horticultural crops (06) are being maintained in the experimental field and FGB of the centre.

The Base Centre, Cuttack has the responsibility for managing plant genetic resources through conducting exploration and collection of indigenous agri-horticultural crops, wild relatives of crop plants, medicinal and aromatic plants and wild economic plants of Odisha and adjoining regions along with the characterization and conservation of rice genetic resources of northern and eastern plain regions of India.

11.1 Exploration and Germplasm Collection

During the reporting period two exploration missions were planned and undertaken for collection of niger, M&AP and other wild economic plants from Similipal Biosphere Reserve, Koraput and Kalahandi districts of Odisha. A total of 79 aces under 26 species comprising niger (36 aces.), M&AP (40 aces.) and wild relatives of crop plants (03 aces.) were collected out of which 12 acces­sions comprising M&AP (11 aces.) and one accession of O,yza granulata could not survive in the field gene bank of the centre.

Table 1: Details of exploration and germ plasm collection

Crops Areas Collabo- Collection No.of No.of ration sites spp. aces.

M&AP Similipal - 12 25 43 Biosphere Reserve (Odisha)

Niger Koraput & ~UAT, 35 01 36 Kalahandi Bhubaneswar (Odisha)

TOTAL 26 79

The first exploration mission was undertaken for collection of M&AP and other economic plants from Similipal and adjoining areas of Odisha. A set of 43 accessions comprising seeds (8) and live plants (35) were collected during the exploration programme. Out of 43 accessions

98

31 aces. comprising of M&AP (29 aces.) and wild relative of crop plants (2 aces.) could survive and maintained in the field gene bank of the centre. The important medicinal plant species viz., Asparagus racemosus, Bixa orellana, Curcuma longo, Cymbopogon martinii, Emblica ojficinalis, Entada rheedii, Mucuna monosperma, Mucuna pruriens, Rauvolfia serpentina, Rauvolfia tetraphylla, Saraca asoca, Semecarpus anacardium, Strychnos nux­vomica, Terminalia bellerica, Terminalia chebula, Tinospora cordifolia, Urginea indica and the wild relatives of rice viz., Oryza ojjicinalis, Oryza granulata and brinjal (Solanum xanthocarpum) were collected along wi th passport and ethno-botanical information during the exploration.

Collection of Aeg/e marme(os

____ ANNLALREPORT 2009· 1(1

Alangium salvifolium (minor fruit) in profuse fruiting at Similipal

The second exploration mission was executed in collaboration with ~UAT, Bhubaneswar for collection of niger (Guizotia abyssinica) germplasm from diverse agro-ecological conditions in Kalahandi and Koraput districts of Odisha. The niger breeder and ADR, Semiliguda (OUAT) was associated in the collection programme. A total of 36 accessions with various desirable traits were collected during the trip. Collections were made starting from low altitude (120m) to very high altitude (900 m) in hilly areas of Koraput. Variability in plant height (dwarf, intermediate and tall), leaf size & colour (green and light green), flower heads (small and large), seed colour (brown and black) and yield (low­high) was recorded during the exploration. Information on the use of seed oil for getting relief in rheumatic pain was recorded.

Collecting niger germplasm in the hill side at Semiliguda

In addition, with an objective to augment germplasm of wild/weedy relativ.es of cucurbits, and to introduce and maintain the medicinal and aromatic plants in field gene bank of the centre, collections were made in coastal Odisha. A total of 64 aces. under 45 species comprising M&AP (42 accs. under 38 sps.) and wild relatives of

Farm women threshing niger crop at Koraput

crop plants (22 accs. under 07 sps.) were collected from Khurda and Cuttack district of Odisha. Apart from this, one joint exploration mission with CRRL Cuttack was executed during 5th_7 th February and 2nd - 5th March, 2009 for the collection of some halophytic plant species under family Chenopodiaceae from coastal areas and Bhitarakanika sanctuary in Odisha. A total of eight accessions comprising Suaeda maritime (2), Porteresia coarctata (1), saline tolerant cultivated rice (5) were collected during the exploration.

11.1.1 Wild relatives of crop plants: The diversity and distribution of wild cucurbits in different habitats of Khurda and Cuttack district in coastal Odisha has been assessed and seed samples of 22 accs. of 7 sps. were collected which included wild relatives and wild species of cucurbits such as cucumis melD var. agrestis (3), Coccinia grandis (3), Trichosanthes cucumerina (5), Trichosanthes tricuspidata (5), Luffa aegyptiaca (3), Diplocyclos palmatus (2) and Mukia madraspatna (1). The variability in fruit shape, size, texture, wall thickness & stripes and seed colour among different accessions was recorded. Some of the specific morphological-trait germplasm collected include Trichosanthes tricuspidata, Trichosanthes cucumerina and Mukia madraspatna (Table 3). The wild types are characterised by bitter/ sour taste and with conspicuous stripes/markings on the fruit. The ethnic uses are that the dark green pulp of fruit is used as an abortifacient by local inhabitants and the fruit is extensively used in the traditional decorations during worship of moon in the month of Aswina. The fruit paste of Trichosanthes cucumerina is fed to the livestock for healing swellings of leg or hoof rot disease. Besides 1 acc. each of Oryza officinalis and Solanum xanthocarpum has been collected from SimilipaI.

B f ('ENTRE,(1mACK _______________________ _ 99

Table 2: Variability in wild cucurbits of coastal Odisha

Species Character(s)

Trichosanthes cucumerina L. Fruit length (wild snake gourd)

T. tricuspidata Lour. (Red ball gourd) Fruit shape

Seed colour

Mukia madraspatana Fruit texture (L.) Roem (Syn. Cucumis madraspatna L.) Seed colour

Trichosanthes cucumerina

11.2 Germplasm Characterization

11.2.1 Cultivated rice: A total of 2,088 accessions of cultivated rice along with six checks (Panidhan, Geetanjali, Jyoti, Tulsi, Ketakijoha, Kalajira) were grown in augmented design during Kharif, 09 for characteriza­tion. Observations on various morpho-agronomic char-

Normal form Variability Remarks

2.5 -7 cm 4 - 16 cm Extreme long in few accs.

Spherical/ Pointed/ acute 1 aec. out of 6 globose fruit base Black White 1 acc. out of 6

Uniform Striped Striped fruit

Grey White White seeded

Trichosanthes tricuspidata

acters were recorded as per the minimal descriptor. The accessions viz. IRGC-3504S (7.12 t/ha), 22499 (6.46 tJ ha) 26772 (6.36 t/ha) were found promising based on their yield performance over the best check (Panidhan 6.3 t/ha). The range of variability recorded and promis­ing accessions identified for various agronomic traits are given in (Table-3).

Table 3: Range of variation in quantitative traits (Kharif-2009)

Traits Range Mean Promising lines Best check Minimum Maximum

Plant height (cm) 46.46 258.68 152.57 IRGC24225, 1622, Kalajira (IRGC36841 ) (IRGC24225) 32104, 36659, 15924, (158.77)

19935 EBT 1.33 22.60 11.96 IRGC19894, 41788, 35059, Ketakijoha

(IRGC21563) (IRGC19894) 41787, 36788, 15777 (8.29)

Leaf length (cm) 17.84 83.14 50.49 IRGC41377, 41720, 40924, Kalajira (IRGC19891 ) (IRGC41377) 41710, 41705, 20154 (58.94)

Leaf width (em) 0.50 2.50 1.5 IRGC41796, 41146, 11169, Panidhan (IRGC19812) (IRGC41796) 35274, 15924, 289 (1.06)

Panicle length (em) 11.44 37.23 24.33 IRGC5295, 11169, 19935, (31.40) (IRGC-399) (IRGC5295) 17541, 732, 4602 Kalajira

100 grain wt. (gm) 0.81 4.32 3.31 IRGC5908, 33192, 42033 Jyoti (IRGC12485) (IRGC5908) (3.22)

Yield/Plant (gm) 1.39 22.9 12.14 IRGC35045, 22499, 26772 Panidhan (IRGC12485) (IRGC35045) (21.82)

100 -- ---- _____ ANNUALREPORT2009- 10

11.2.2 Green gram: A set of 38 aces. of green gram germplasm collected from Odisha during 2008 were grown in RBD (two replications) with three checks (Pusa Vishal, LGG-460, PDM-54) during Rabi, 09 for characterization. Observations on various agro-morphological characters were recorded as per the minimal descriptor. The accessions viz 1C-565287 (5.91 g) 565226 (4.77 g), 565255(4.34 g), 569058(4.33 g) were found promising on the basis of yield/ plan! over the best check LGG-460 (4.06 g). The range of variability recorded for various agronomic traits are given in (Table-4).

Table 4: Range of variation in quantitative traits (Rabi-2009)

Traits Range Mean Promising lines Best check

Minimum Maximum

No of pods/cluster 2.2 4.4 3.3 IC565255, 565292, 565245, 565285, LGG-460 IC565241 IC565255 565226,565261,565287,565248 (3.65)

No. of seeds/pod 6.6 10.7 8.65 IC565255, 568946, 565292, 565293, POM-54 IC565249 IC565255 565248, 565252 (10.20)

Pod length (cm) 5.22 6.95 6.08 - Pusa Vishal IC565295 IC565203 (7.06)

100 seed wt. (mg) 1.42 3.01 2.21 - POM-54 IC565223 IC565293 (3.84)

Yield/plant (gm) 1.08 5.91 3.49 IC565287, 565226, 565255, 569058 LGG-460 IC565264 IC565287 (4.06)

11.2.3 Black gram: A set of 41 acc. of black gram collected from Odisha during 2008 were grown in RBD (two replications) with four checks (PDU-l, PU-30, PU-35, PU-19) during Rabi, 09 for characterization. Wide range of variability was recorded for various agro-morphological characters viz., No. of pods/cluster, No. of Pods/plant, No. of seeds/pod, Pod length (cm), 100 seed wt. (mg) and Yield/plant (gm). On the basis of yield/plant over the best check; PU-30 (3.87 gm) the accessions viz., IC-565229 (5.9), 565220 (4.31), 568908 (4.28), 565276 (3.94) were foulld promising. The range of variability recorded for various agronomic traits are given in (Table-5).

Table 5 : Range of variation in quantitative traits (Rabi-2009)

Traits Range ! Mean

Minimum Maximum

No. of pods/ cluster 2.2 3.1 2.6 IC565232 IC565291

No. of Pods/ plant 10.8 28.3 19.55 IC565265 IC565220

No. of seeds/ pod 5.3 6.7 6 IC565244 IC565260

Pod length (cm) 3.03 4.24 3.63 IC565205 IC568947

100 seed wt. (mg) 1.82 3.76 2.79 IC565288 IC565263

Yield/plant (gm) 1.26 5.90 3.58 IC565227 IC565229

In addition, a set of 145 aces. of small and medium grained

scented rice and 27 aces. of flood tolerant rice germplasm

~ollected from Odisha were grown during Kharif2009

for e aluation in collaboration with CRRI, Cuttack.

B f. ('BNfRE, C'UTIAC'K

Promising lines Best check

IC565291, 565275, 565276 PU-19 (2.97)

IC565220, 565276, 565263, PU-30 568980, 568908 (22.77) IC565260, 565260 PU-35

(6.63) IC568947, 565220, 568899, 565260 POU-1

(3.98) - PU-35

(4.16) IC565229, 565276, 568908, 565220 PU-30

(3.87)

11.3 Seed Multiplication

A set of 2479 accs. comprising cultivated rice, sesame, black gram, green gram and horse gram germplasm were multiplied during 2009. All the germplasm acces­sions were harvested and processed for long term con-

101

servation in National Oene Bank.

11.3.1 Cultivated rice: A total of 2,088 aces. of culti­vated rice germplasm comprising 2004 aces. received from germplasm conservation division and 84 accs. col­lected from Odisha were multiplied during Kharif, 09 ' for LTS.

11.3.2 Sesame: A set of 294 accs. comprising 258 accs. . received from NBPGR Regional Station, Akola, 32 accs. from previous year (less seeds) and 04 accs. collected from flood affected areas of Odisha was multiplied dur­ing Rabi, 2009. Each accession was maintained in two rows of 3.25cm length. Out of which a set of 125 accs. were processed and deposited in the NOB, New Delhi for long term storage.

11.3.3 Green gram: A set of 38 aces. of green gram germplasm collected from Odisha was multiplied during Rabi, 2009. All the accs. were processed and deposited in the NOB, New Delhi for long term storage.

11.3.4 Black gram: Forty one aces. of blackgram germplasm collected from Odisha were multiplied dur­ing Rabi,2009 which were deposited in the NOB, New Delhi for long term storage.

11.3.5 Horse gram: A set of 20 aces. of horse gram germplasm was grown for seed multiplication during Rabi, 2009. Out of which 18 accs. were deposited in the NOB, New Delhi for long term storage.

11.4 Germplasm Exchange

Under germplasm exchange activity 3151 accs. of culti­vated rice received from NBPOR, New Delhi (2004 accs.) were grown in the experimental field of this base centre for characterization and seed multiplication and another set of 1147 aces. were received from CRRI, Cuttack and supplied to NBPGR, New Delhi for research purpose. The details are given in (Table-6).

Table 6 : Details of germplasm exchange ac­tivities

Crops No. of Received Supplied Purpose accs.

Cultivated 2004 NBPGR - Character-rice New ization &

Delhi multiplication

Cultivated 1147 CRRI, NBPGR Character-rice Cuttack ization &

multiplication Research programme

102

11.5 Germplasm Conservation

A total of 2258 accessions comprising cultivated rice (2036 accs.), sesame (125 accs.), green gram (38 accs.), black gram (41 accs.), horse gram (18 aces.) were deposited for long term conservation in NOB, NBPOR, New Delhi. In addition, 63 accs. of M & AP and 2 accs. of wild relatives of crop plants were added to the field gene bank of the centre .

11.6 ~ermplasm Maintenance

A total of 3094 aces. comprising cultivated rice (2,212), medicinal and aromatic plants (349), sesame (300), wild Oryza species (164), other wild relatives of crops (22), economic plants of agro-forestry importance (24), ba­nana (17), horticultural crops (06) are being maintained in the experimental field and FOB of this base centre.

11.6.1 Maintenance of wild relatives of crop plants

Species Accessions

Abelmoschus moschatus 01 Aty/osia scarabaoides 01 Cajanus cajanifolia 01 Curcuma angustifolia 06 Flemingia sp. 01 Rhynchosia suaveolens 01 Solanum khasianum 01 Solanum torvum 01 Solanum xanthocarpum 01 Vigna sp. 03 Zingiber casumunar 02 Zingiber rubens 03

TOTAL 22

11.6.2 Maintenance of wild rice germplasm

Species Genome No. of Acce-ssions

Oryza alta Sw. CCDD 02 0. australiensis Domin. EE 03 0. barthii A. Chev. AA 04 0. brachyantha Chev. et. Roehr. FF 03 O. eichingeri A. Peter CC 03 O. glumaepatula Steud. AA 03 O. grandiglumis (Doell) Prod. CCDD 01 0. granulata Nees et Am.

ex Watt GG 02 O. latifolia Desv. CCDD 04

A"'INUALREPORT2009 11)

O. longistaminata A. Chev. et Roehr. M

O. meridionalis Ng M

O. nivara Sharma et Shastri M

O. officina lis Wall. ex Watt CC

O. punctata Kotschy ex Steud. BBCC

O. rhizomatis Vaughan CC

O. rufipogon Griff. M

0. spontanea Roschev. M

O. sativa var spontanea M Porteresia coarctata (Roxb.) Tateoka

S!.No.

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47

M

TOTAL

Species

Abelmoshus moschatus Abroma angusta Abrus precatorius Abutilon indicum Acalypha indica Achyranthes aspera Acorus calamus Aegle marmelos Aganosma caryophyllata Ageratum conyzoides Alocasia macrorrhizos Aloe vera Alstonia scholaris Amorphophallus paenifolius Anacardium occidentale Andrographis paniculata Anisochilus carnosus Aristolochia indica Artocarpus lacucha Asparagus racemosus Atalantia monophylla Atylosia cajanifolia Atylosia scarabaeoides Azadirachta indica Bacopa monnieri Baliospermum montanum Barleria longiflora Barleria prionitis Barleria strigosa Bauhinia vahlii Biophytum sensitivum Bixa orellana Bombax ceiba Caesalpinia bonduc Calamus viminalis Calotropis gigantea Calycopteris floribunda Careya arborea Carissa spina rum Caryota urens Cassia fistula Catharanthus roseus Centella asiatica Cinnamomum zeylanicum Cipadessa baccifera Cissampelos pareira Cissus quadrangularis

02

04 45

07

02 04

36

12

25

02

164

11.6.3 Maintenance of medicinal and aromatic plants: A total of 349 accs. of medicinal and aromatic plants comprising 151 species belonging to 131 genera and 58 families have been conserved in the field genebank of the centre. Out of which species of promising and highly valued plants are Asparagus racemosus, Bacopa monnieri, Baliospermum montanum, Centella asiatica, Crinum defixum, Gardenia gummifera, Hemidesmus indicus, Litsea glutinosa, Piper longum, Plumbago rosea, Pterocarpus santalinus, Rauvolfia serpentina, Saraca asoca, Stevea rebaudiana, Tinospora cordifolia and Watakaka volubilis.

Family

Malvaceae Sterculiaceae Fabaceae Malvaceae Euphorbiaceae Amaranthaceae Arecaceae Rutaceae Apocynaceae Asterceae Araceae Liliaceae Apocynaceae Araceae Anacardiaceae Acanthaceae Lamiaceae Aristolochiaceae Moraceae Liliaceae Rutaceae Fabaceae Fabaceae Meliaceae Scrophulariaceae Euphorbiaceae Acanthaceae Acanthaceae Acanthaceae Fabaceae Oxalidaceae Bixaceae Bombacaceae Caesalpiniaceae Arecaceae Asclepiadaceae Combretaceae Lecythidaceae Apocynaceae Araceae Caesalpiniaceae Apocynaceae Apiaceae Lauraceae Meliaceae Menispermaceae Vitaceae

Local Name

Bana bhendi Olta kamal Kaincha Pedipedika Indra maricha Apamaranga Bacha Bela Malati Pokasungha Man kanda Ghee kuanri Chhatiana Olua Kaju Bhuinimba Benia Hansalata Ceuta Satabari Narguni Bana Harada Bana kolatha Nimba Jal brahmi Danti Daskaranta Daskeranta Banamali Siyali lata Chhota Lajkuli Latken, Kum kum Simili Gila Beta Arakha Kukhidia Kumbhi Dudhakoli Salapa Sunari Red Sadabihari Thalkudi Dalchini Pittamari Akanabindi Hadabhanga

B ~ECENTRF.CLTTACK ______________ ~ 103

48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94. 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 108. 109. 110. 111. 112. 113.

104

Cissus vitiginea Clerodendrum siphonanthus Clitoria ternatea Cocculus hirsutus Coleus amboinicus Costos speciosus Crinum asiaticum Crinum defixum Croton roxburghii Cryptolepis buchananii Curculigo orchioides Curculi/go trichocarpa Curcuma montana Cymbopogon martinii Datura metel Desmodium gangeticum Desmodium pulchellum Desmodium heterocarpon Diospyros malabarica Eclipta prostrata Elettaria cardamomum Eryngium foetidum Eupatorium triplinerve Euphorbia nerifolia Euphorbia hirta Euphorbia tirucal/i Evolvulus nummular ius Ficus hispida Flacourtia indica Flemingia stricta Garcinia cowa Gardenia gummifera Gardenia jasminoides Glycosmis pentaphylla Gymnema sylvestre Hemidesmus indicus Holarrhena pubescens Hygrophila auriculata Ichnocarpus frutescens Jasminum multiflorum Jatropha curcas Jatropha gossipifo/ia Justicia adhatoda Kaempferia galanga Kalanchoe pinnata Lannea coromandelica Lasia spinosa Lawsonia inermis Leea indica Leea macrophylla Leonotis nepetifo/ia Uppia javanica Litsea glutinosa Madhuca indica Mentha piperita Mesua ferrea Mikania micrantha Nelsonia canescens Ocimum basi/icum Ocimum sanctum Ocimum canum Paederia foetida Pandanus amaryllifolius Pedilanthus tithyma/oides Phoenix sylvestris Phyllanthus fratemus

Vitaceae Verbenaceae Fabaceae Menispermaceae Lamiaceae Liliaceae Amaryllidaceae Amaryllidaceae Euphorbiaceae Asclepiadaceae Hypoxidaceae Hypoxidaceae Zingiberaceae Poaceae Solanaceae Fabaceae Fabaceae Fabaceae Ebenaceae Asteraceae Zingiberaceae Apiaceae Asteraceae Euphorbiaceae Euphorbiaceae Euphorbiaceae Convolvulaceae Moraceae Flacourtiaceae Fabaceae Clusiaceae Rubiaceae Rubiaceae Rutaceae Asclepiadaceae Asclepiadaceae Apocynaceae Acanthaceae Apocynaceae Oleaceae Euphorbiaceae Euphorbiaceae Acanthaceae Zingiberaceae Crassulaceae Anacardiaceae Araceae Lythraceae Leeaceae Leeaceae Lamiaceae Verbenaceae Lauraceae Sapotaceae Lamiaceae Clusiaceae Asteraceae Acanthaceae Lamiaceae Lamiaceae Lamiaceae Rubiaceae Pandanaceae Euphorbiaceae Araceae Euphorbiaceae

Jangli Angur Bhanaramal White aparajita Dadaia Rukuna Kau kauka Arisha Bana piyaza Mahasindhu Dudhi Kalimusali Gadakita Sakuta Dhanwantari Kala dudura Salaparni Krushnaparni Krushnaparni Mankada kendu Bhrungaraj Gujurati Bana dhania Ayapan Khadisiju Chitakutei Khadi siju Bichhamalia Dimiri Bhaincha Gariguri Rajkusuma Ghurudu Sugandhi Chauladhua Gudumari Anantamula Pitakorua Koilekha Shyama lata Jangli malli Dhala baigaba Nali baigaba Basang Rama Kedara Patragaja Mahi Kanta Alu Manjuati Batkhai Hatikan Sidha Naguari Jayasandha Mahula Pudina Nageswar Amari lata Bada rasna Durlava Tulasi Krishna Tulasi Bana tulsi Pasaruni Annapurna Patrasiju Khajuri Bhui Amla

ANNUAL REPORT 2009-10 -----

114. 115. 116. 117. 118. 119. 120. 121. 122. 123. 124. 125. 126. 127. 128. 129. 130. 131. 132. 133. 134. 135. 136. 137. 138. 139. 140. 141. 142. 143. 144. 145. 146. 147. 148. 149. 150. 151.

Phyllanthus urinaria Physalia minima Piper longum Pithecellobium dulce Pluchea indica Plumbago rosea Plumbago zeylanica Polyalthia suberosa Pongamia pinnata Premna latifolia var. viburnoides Pterocarpus santa linus Pterospermum xylocarpum Rauvolfia serpentina Rauvolfia tetraphy/la Sanseviera roxburghiana Sansevieria cylindrica Saraca a50ca Scoparia dulcis Solanum nigrum Solanum torvum Solanum via rum Spilanthes acmella Stevea rebaudiana Streblus asper Suaeda maritima Tarenna asiatica Terminalia arjuna Terminalia bellirica Tino5pora cordifolia Triumfetta neglecta Tylophora indica Typhoniurn trilobatum Urginea indica Vitex negundo Watakaka vo/ubi/is Wedelia chinensis Zingiber zerurnbet Ziziphus oenoplia

11.7 Herbarium Preservation

Odisha and adjoining region harbours a rich diversity of indigenous species representing about If5 th of total flora of India and many of which are wild relatives of crop plants, medicinal and aromatic plants and wild economic species with enormous unknown / less known species of tribal importance but are significant genetic resources

Research Programme (Programme Code: Title, Leader)

Euphorbiaceae Solanaceae Piperaceae Mimosaceae Asteraceae Plumbaginaceae Plumbaginaceae Annonaceae Fabaceae Verbenaceae Fabaceae Sterculiaceae Apocynaceae Apocynaceae Agavaceae Agavaceae Caesalpiniaceae Scrophulariaceae Solanaceae Solanaceae Solanaceae Asteraceae Asteraceae Moraceae Chenopodiaceae Rubiaceae Combretaceae Combretaceae Menispermaceae Tiliaceae Asclepiadaceae Araceae Liliaceae Verbenaceae Asclepiadaceae Asteraceae Zingiberaceae Rhamnaceae

Bhui Amla Tipai Pipali Sima kayan Kokronda Rakta chita Dhala chita Guakoli Karanja Gandhana Rakta Chandan Giringa Patala garuda Garuda Gada Gada Ashoka Jastimadhu Nunununia Denga Bheji Kanta Bheji Raipura Mitha tulasi Sahada Giriya Jojaka Arjuna Bahada Guluchi Badi Nalita Swashamari Chakad Jangli piyaj Begunia Dudhilata Bhrungaraj Bana Ada Kanteikoli

need to be explored, gathered in germplasm collections and conserved. Proper identification and documentation of species is the primary component, so far conservation of plant diversity is concerned. Hence, it is planned to build up a regional herbarium of all such species at NBPGR Base Centre, Cuttack. To begin with about 50 voucher specimens of wild relatives/medicinal! economic species were prepared and housed in the centre.

PGR/EXP- BUR-CUT- 01.00- Augmentation, characterization, evaluation, maintenance, regeneration, conservation documentation and distribution of plant genetic resources of Odisha and adjoining regions (DR Pani)

Research Projects (Project Code, TItle, Project Leader; Associates)

PGRlEXP-BUR-CUT- 01.01- Augmentation, characterization, evaluation, maintenance, regeneration, conservation and documentation of genetiC resources of agricultural and horticultural crops in Odisha and adjoining regions (DR Panl, RC Misra)

PGR/EXP-BUR-CUT- 01.02- Augmentation, characteri zation, evaluation, maintenance, regeneration, conservation and documentation of genetic resources of medicinal & aromatic plants, wild economically useful and rare and endangered plants of Odisha and adjoining regions (RC Misra, DR Pani)

BAC;;I CENfRE,C'LTIACK------------ 10')

\ 12. REGIONAL STATION, HYDERABAD

Summary: A total number of 61,495 samples [17,436-imports & 44,059-exports] were received for quarantine processing during the period under report. All the import samples were subjected to various seed health tests like visual examination, blotter test, X-ray radiography, Enzyme Linked Immunosorbent Assay (ELISA), centrifugation and microscopic examination and several pests of quarantine significance were intercepted. A total of 2147 imported samples were found infested! infected with pathogens (1988), insects (70) and nematodes (89). A total of 2,144 samples were salvaged and 3 samples were rejected. In all, 172 phytosanitary certificates were issued during the reporting period.

A total of 15 explorations were undertaken for the collection of indigenous diversity and 950 collections of various crops were made. A total of 629 accs. of different agri-horticultural crops consisting of sorghum (64), linseed (88), sesame (89), brinjal (62), chillies (201), dolichos bean (77) and tomato (57) were grown for characterization! evaluation! multiplication during Rabi 2009-10. A total of 718 accs. of germplasm of black gram (50), italian millet (164), amaranths (70), bottle gourd (20), brinjal (175), chillies (92), field bean (76), onion (22), tomato (49) and wild edible legumes (49) were sown in the field along with appropriate checks for characterization! evaluation! multiplication. A total of 255 aces. including small millets (70 accs.), horse gram (8), green gram (1), black gram (2), brinjal (50), chillies (64), linseed (29 accs+2 check varieties) Vigna trilobata (20), Clitoria tematea (4), Crotalaria juncea (2), and Mucuna pruriens (5) were sent for long term storage to NGB, New Delhi. Seeds of 722 accs. of germplasm collected during explorations comprising of Brassica spp., seed spices (83), yard-long bean, Asiatic Vignas (63), pongamia (91), horticultural crops (429) including chillies, Luffa spp. & other vegetables, Moringa, onion & garlic, and spine gourd along with wild edible legumes (56) were sent to GHU for medium term storage and national accessioning. A total of 258 accessions of horticultural germplasm consisting Bottle gourd, Brinjal, Chillies, Ridged gourd, Smooth gourd and Solanum torvum, were supplied to APHUI CIAHI IARII MAUl NBPGR HQ./ UAS-Dharwad

as per their requests.

2.1 Quarantine Processing

A total number of 61,495 samples [l7,436-imports & 44,059-exports] were received for quarantine processing.

12.1.1 Import Quarantine' During the year 2009, a total of 61,495 samples of different crops were received and processed for quarantine clearance. Out of these, 17,436 samples (paddy-l 1,852; wheat-510; maize-2079; sorghum-l 054; pearl millet-II; foxtai1millet-2; chickpea-178; greengram-12; cowpea-45; soybean-7; Brassica napus-IO; Roselle-16; groundnut-230; ricebean-l; sunflower-482; castor-83; cotton-291; chilli-2; tomato-303; snakegourd-l; watermelon-30; sweet potato-225; sugarcane-l; and Eucalyptus spp-ll) were imported from different countries and the rest 20,059 (Maize-4207; sorghum-4287; pearlmillet-4940; chickpea-4559;

Pathogens Alternaria ricini, Macrophomina phaseolina and Fusarium oxysporum Macrophomina phaseolina and F. oxysporum Pseudomonas syringae pv tomato Alternaria brassicicola Acremonium strictum Peanut mottle virus Rhizoctonia solani Rhizoctonia solani Acremonium strictum and Rhizoctonia solani Rotylenchulus reniformis Sporisorium sp Alternaria ricini

Col/etotrichum spp and Fusarium oxysporum

pigeonpea-468; groundnut-l410 and smallmillets-188) were meant for export to different countries. In addition to the above, a set of 23,000 + 1000 duplicate samples for viability tests of ICRISAT mandate crop germplasm (sorghum, pearl millet, proso millet, little millet, chickpea, pigeonpea and groundnut), meant for export to Norway for conservation in the Svalbard global seed vault, was examined from seed health angle and exported.

12.1.2 Quarantine interceptions in imported material: All the import samples were SUbjected to various seed health tests like visual examination, blotter test, X -ray radiography, Enzyme Linked Immunosorbent Assay (ELISA), centrifugation and microscopic examination. The following pathogens were intercepted during the reporting period.

Crop Country Castor USA

Sunflower Australia Tomato Taiwan Brassica napus Germany Sorghum USA

Groundnut Niger, USA Soybean AVRDC, Taiwan Sorghum USA Mustard Australia Castor USA

Sweet potato Peru

The healthy accessions were released after giving the necessary c;;alvaging treatments

106 ~ "lNlIALREPORT 2009 10

During the period underreport, 15,262 samples including paddy samples (11,770), maize (648), sorghum (1068), pearl millet (11), foxtailmillet (2), chickpea (163), greengram (38); groundnut (186), sweet potato (225) and Brassicas (57); rice bean (1) ; and watermelon (30); ,ugarcane (1); cotton (291); Eucalyptus sp (11); untlower (467); chilli (2); tomato (291) were released

to the respective consignees after giving the mandatory treatments.

12.1.3 Import Germplasm Salvaged:

Total number of samples infected 2,147 (Fungi: 1928; bacteria: 87; viruses: 3; nematodes: 89; insects: 70) Number of samples salvaged 2144 Number of samples detained 03 Number of samples rejected Nil

12.1.4 Post-entry Quarantine Observations

Crop samples grown in the greenhouse (NBPGR): Groundnut samples (225) received from USA are grown in the greenhouse for testing against seedbome viruses and found healthy except few plants, which showed Peanut mottLe virus infection. The infected plants were uprooted and destroyed.

Soybean samples (7) received from AVRDC, Taiwan are grown in the greenhouse for testing against seed­borne viruses. ELISA testing of leaf samples indicated that all accessions were free from Peanut stripe virus, Peanut mottle virus and Tobacco streak virus.,

Crop samples grown in the greenhouse (ICRISAT): The photosensitive lines of sorghum (11 aces.) from Mali and groundnut (40) from USA grown in the greenhouse were found free from diseases. (74) Chickpea accessions Ethiopia (15), Israel (9), Ukraine (17) and USA (33) were grown in the greenhouse at ICRISAT. Of the 33 aces. from USA, only four aces. could be harvested. Chickpea accs. (17) from Ukraine, which could not establish in the field were well established in the greenhouse and found healthy. Chickpea accs. from USA did not establish. Plants suspected with inf~ction were removed and destroyed.

Crop samples grown in post-entry quarantine isolation area (PEQIA)-(ICRISAT farm): Post-entry quarantine inspection of 2,040 accs. of germplasm belonging to maize 303, sorghum 188, pearlmillet 778, foxtail millet 2, finger millet 5, chickpea 270, pigeonpea

RI IONAl STATION. HYDFRABAD _

309 and 185 groundnut, grown at PEQIA of ICRISAT was conducted at weekly intervals.

Incidence of blight (Drechslera maydis) and zonate leafspot (Gloeocercospora sp) was noticed in some maize accessions. Four pearl millet accessions (EC606970, EC606999, ISP441 and ISP766) did not germinate. Among the pearl millet accessions, smut affected panicle was noticed in ISP-596. Affected panicles were removed and destroyed. Two pearl millet accs. (EC607266 and EC606999) recorded nil germination while two accs. (ISP-441 and EC607170) produced very less seed. The harvested accessions of sorghum (28), chickpea (30) and pearl millet (776) were inspected and released.

Both the foxtail millet accessions from Italy did not germinate while only 5% germination was recorded in maize consignment. Zonate leaf spot (Gloeocercospora sorghi) incidence was noticed on sorghum accs. imported from Mali. Symptom variation was observed and hence attempts are being made to isolate the fungus from different accessions showing variability. Rust (Puccinia penniseti) incidence was noticed in both the pearl millet consignments from Niger. Some lines (ISP 143,151,153 and 678) were found tolerant to rust incidence, while two accs. (ISP448 and 634) were found highly susceptible.

Incidence of Gloeocercospora sorghi (Zonate leaf spot) and Curvularia sp. was noticed on sorghum germplasm from Mali (11) and USA (106). Six accessions (EC637021, EC637022, EC637023, EC637026, EC637027 and EC637028) were found completely free from zonate leaf spot incidence and, EC637013 and EC637015 were found moderately susceptible. Curvularia sp. incidence was observed on EC637027. Three harvested sorghum accessions (photosensitive lines from Mali) from both field and greenhouse were inspected and found healthy.

Pigeon pea accessions (309) from Kenya were grown in PEQIA, of which 81 accessions did not germinate and 188 accessions were infected with Phytophthora blight (PB) (Phytophthora drechsleri f. sp. cajani) due to heavy rains in the season. All infected plants were rogued out and incinerated. Of 188 accs., 15 accessions (EC616532, EC616493, EC616466EC 616517, EC616494, EC616534, EC616532, EC616535,EC616544, EC616547, EC616542, EC616545548, EC616555, EC616455 and EC616471) were found highly susceptible and 40 accessions were found free from the disease.

107

Private industry: The details of crop germpJasm that is being grown and inspected in the fields of Private industry \

are as below: The infected /suspected plants were uprooted and incinerated.

Crop Country No. of samples Private company Remarks

Sunflower Turkey 10 MIS Dev Gen Seeds and Alternaria leaf spot Crop Technology Pvt Ltd., (Alternaria helianthl)

Argentina 38 Hyderabad Very meager germination; Alternaria leaf spot (Alternaria helianthl)

USA 161 Very meager germination; Alternaria leaf spot (Alternaria helianthl)

Chile 16 MIS Vibha Agrotech Pvt Ltd. All were healthy. Hyderabad

Sunflower Serbia 18

South Africa 5 HiTech Seeds Pvt Ltd., Tobacco streak virus infection Patancheru, Hyderabad. noticed on one accession

(AA14) and the affected plant was uprooted and destroyed

Sunflower Australia 5 JK Seeds Pvt Ltd., All were healthy Maize Chile 12 MIS Vibha Agrotech Pvt Ltd. Downy mildew oticed in border rows.

Hyderabad Advised metalaxyl spraying. Maize USA 11 Ei-Dupont Pvt Ltd., All were healthy (transgenic) Turkapally, Hyderabad.

Non-transgenic 3

Paddy Belgium 26 MIS Dev Gen Seeds False smut or Udbatta disease and Crop (Ustilaginoidea virens) noticed Technology Pvt Ltd., Hyderabad

Singapore 32 MIS Dev Gen Seeds and All were healthy Crop Technology Pvt Ltd., Hyderabad

Paddy Belgium 33 Bt events Bayer Crop Sciences Pvt Ltd., All were healthy (Transgenics) Patancheru

47 Bt events Bayer Crop Sciences Pvt Ltd., Patancheru

USA 36

China 3 Ei-Dupont Pvt Ltd., Turkapally, Hyderabad. All were healthy

Maize Thailand 85 Sehgal Foundation, ICRISAT, Inspection at sowing and active (treated) 88 Patancheru. crop growth stage; found healthy

Mexico 410

Sweet Australia 18 Advanta India Ltd., Hyderabad All were healthy sorghum Maize hybrids Thailand 28

Sorghum Australia 39 Advanta India Ltd., Hyderabad Zonate leaf spot (EC638701-03 were highly susceptible)

USA 250 Anthracnose in EC645509 Mustard Australia 47 Advanta India Ltd., Hyderabad Very poor to Nil germination

in many aces; High incidence of leaf webber, semilooper and red hairy caterpillar noticed.

Cotton USA 196 Bayer Crop Sciences At sowing

82 Pvt Ltd., Patancheru At active crop growth; All found healthy

108 - ANNUAL REPORT 2(Xl9-1 0

12.1.5 Export Quarantine

Pre-export crop inspection: During the rainy season of 2009, a total of 1,458 accessions of genebank gennplasm and breeding accessions (groundnut -1120, finger millet-148 and foxtail millet-190) consisting of reference collection, diverse germplasm, regeneration accessions, international trial and elite lines were inspected in the field plots during active growth period for their plant health status. All groundnut and foxtail millet accessions were found free from quarantine significant pests, except 3 accessions where downy mildew suspected symptoms were noticed. In finger millet, 23 accessions were found infected with Pyricularia grisea Sacc.(Perfect state Magnaporth grisea Barr.). The infected plants were rogued out and incinerated.

During the post-rainy season, sweet sorghum hybrid seed production for 5 hybrid parents, 51 AJBIR seed increase plots and chickpea 270 entries of breeding plots consisting of reference set, trials, F 2 populations, were inspected during active growth period for plant health. In sorghum, zonate leaf spot (Gloecercospora sorghi), cercospora leaf spot (Cercospora sorghi) and sheath blight (Rhizoctonia solani) was observed in very few plants. In chickpea one F2 population (ICCX 020041), many plants showed symptoms of dry root rot disease (Rhizoctonia bataticola). All Infected plants were rogued out and incinerated.

Export germplasm processed: A total of 44,059 export samples consisting of maize (4207), sorghum (4287), pearl millet (4940); chickpea (4559); pigeonpea (468); groundnut (1410) and small millets (188) samples were processed for export to different countries. In addition to the above, a set of 23, 000 + 1000 duplicate samples for viability tests of ICRlSAT mandate crop germplasm (sorghum, pearl millet, proso millet, little millet, chickpea, pigeonpea and groundnut), meant for export to Norway for conservation in the Svalbard global seed vaUlt, was examined from seed health angle and exported.

A total of 153 seed samples (sorghum-92, pearl millet-11, chickpea-23, pigeonpea-21, groundnut-5 and foxtail millet-I) was rejected due to pathological reasons, while 669 samples were withdrawn by the consignee. The remaining 43,237 healthy samples were exported to different countries. In all, 172 phytosanitary certificates were issued during the reporting period.

Rr,GIONALSTATION, HYDfRABAD

Crop Samples

Processed Rejected Released

Sorghum 4287 92 4195 Pearl millet 4940 11 4929 Small millets 188 1 187 Chickpea 4559 23 4536 Pigeonpea 468 21 447 Groundnut 1410 5 1405 Maize 4207 - 4207

Grand Total 20,059 153 19,906

The rejections in the export germplasm of ICRISAT mandate crops were mainly due to failure of germination, seed contamination by Bipolaris sacchari, Fusarium oxysporum f.sp. ciceri, Fusarium spp., Rlzizoctonia bataticola, R. soLani etc.), stored-grain pests and bacteria of unknown etiology.

12.1.6 Supportive research in quarantine

• Six leaf samples of squash collected from post­entry quarantine field of Hytech Seeds Pvt Ltd., were ELISA tested and two samples showed positive reaction to Tobacco streak virus (TSV).

• Cowpea germplasm (26 accs) imported from AVRDC, Taiwan were subjected to grow-out test for four weeks. None of the plants was found infected with viruses and hence released.

• Seven samples of pillipesara were found susceptible to TSV on sap inoculation. Five mungbean germplasm lines and two pillipesara lines sap inoculated with TSV, BICMV and PBNV, all were susceptible to TSV & BiCMV. All PBNV inoculated lines produced local lesions but three mungbean lines remained free from systemic infection. The pillipesara genotypes screened against TSV (19) and BLackeye cowpea mosaic virus (17) by mechanical sap inoculation were found susceptible. Ten pillipesara accessions screened against TSV and Blackeye cowpea mosaic virus by mechanical sap inoculation were found susceptible.

Of 30 cultivars of groundnut received from NRCG, Junagadh, all were inoculated with Tobacco streak virus (TSV) and 20 with PBNV by sap inoculation and all were found susceptible. Another set of ten groundnut cultivars from NRCG, Junagadh were sap inoculated with

109

PBNV. Of these, three cultivars remained free from imported from Niger were subjected to non-PBNV. destructive seed ELISA test against PStV and

PMV. All seeds were found free from the above NAIP-Virology two viruses and the seedlings are kept for

• Virus disease surveys were conducted under observations in the greenhouse.

NAIP-Virology project in groundnut and • Four groundnut accessions imported from Niger

groundnut based cropping system in Anantapur were ELISA tested against Peanut stripe virus

district of Andhra Pradesh. Plant samples (PStV) and Peanut mottle virus (PMV) after

collected on groundnut and several crop plants growing for four weeks in the greenhouse. All

and weeds during the survey were ELISA tested were found free from the above two viruses

against TSV and PBNV. Groundnut samples (7 except one plant that showed PMV infection

of 18 and 2 of 18) were positive to TSV and during ELISA. The infected seedling was

PBNV, respectively. Of 208 Parthenium uprooted and incinerated.

samples collected, 121 were positive to TSV. • Leaf samples of 225 groundnut accessions

Peanut yellow spot was inoculated on cowpea imported from USA were tested against Peanut

and groundnut for virus establishment. stripe virus (PStV) and Peanut mottle virus

• Thirty-eight leaf samples of groundnut collected (PMV) using ELISA. Observations revealed the

from Anantapur were ELISA tested utilizing the presence of PMV infection in two accessions

mixture of polyclonal antibodies to Groundnut (EC654654 and EC654659). Individual plants of

bud necrosis virus (1:5000), Tobacco streak these accessions were again tested and found

virus (1 :20,000) and Peanut yellow spot virus that one plant of each accession was infected

(1 :2000). On initial testing of mixture of antisera, with PMV and hence incinerated. Remaining

27 showed positive to any of the three viruses. healthy plant were released for post-entry

Subsequent tests utilizing individual antisera, 8 quarantine growing in the greenhouse.

were positive to GBNV, 15 to TSV, 2 to both • TSV infected leaf samples (197) of cotton,

GBNV and TSV and 2 to PYSV. collected from Warangal and Khammam districts

• As fresh samples of the above seedbome viruses of Andhra Pradesh were ELISA tested and 48

are not readily available, the test was conducted samples were detected as positive. The samples

utilizing a mixture of polyc1onal antibodies to that showed positive reaction in ELISA were

PStV (1:10,000) andPMV (1:5000) on imported sap inoculated on to the healthy local lesion host,

groundnut seed pre-tested as positive to PStV cowpea, cv. C-152 plants and ascertained

and PMY. Nineteen seeds consisting of 9 PStV biological activity. Purified TSV cotton isolates

infected and 4 PMV infected and 6 healthy were from Warangal, Khammam and Karimnagar

mixed together and tested utilizing the mixture districts are being maintained on cowpea cultivar,

of antisera. Thirteen were positive and 6 were C-lS2. Weed plants (300 samples) collected in

negative. In subsequent tests utilizing individual and around surveyed cotton fields ofWarangal,

antisera, nine were positive to PStV, four to Khammam and Karimnagar districts were

PMV and all six healthy seeds were negative. ELISA tested to identify naturally occurring

• Parthenium plants (172) sap inoculated with symptomless reservoir hosts of the virus.

Tobacco streak virus in glasshouse and 90 • Parthenium plants (96 samples) that were sap

Parthenium plants from field were ELISA tested inoculated with Tobacco streak virus (TSV)

to identify TSV positive plants for tOOp-pollen under glasshouse conditions were tested for the

transmission experiments. Of the inoculated presence of infection through ELISA and found

plants, 23 greenhouse maintained plants and 25 that 19 of 96 were positive.

plants from field were positive to TSV. • Natural infection of TSV in parthenium was

Parthenium plants (76 samples) that were sap studied on 164 Parthenium leaf samples,

inoculated with TSV were tested for the collected from NBPGR fields by conducting

presence of infection through ELISA and found ELISA and found nine of them positive. The

that 22 of 76 were positive to TSV. plants showing positive response were tagged

• Ten seeds each of four groundnut accessions and retained for further studies. Artificial

110 ANNLALRfroRT2009- 1O

inoculation ofTSV under glass house conditions was done on 7 crop plants and 16 weed species, out of which five weed species exhibited local lesions. Five cotton cultivars were screened against TSV and all of them exhibited local lesions. ELISA will be performed after 30 days of inoculation on these cultivars.

• To carry out thrip transmission studies, TSV infected parthenium plants were maintained in the glasshouse to get infected pollen. The infected pollen was dusted on to cowpea plants along with varied number of thrips/plant. Observations revealed that even single thrip/plant caused infection.

Seed health testing

• Leaf samples (20) of cultivated crop plants and weed species, received from ANGRAU, were ELISA tested against Tobacco streak virus and found four of them positive.

• Paddy samples (30) supplied by Advanta India Pvt Ltd were tested against seedborne fungi, bacteria and nematodes. Eight of 30 samples were found infected with Xanthomonas spp and hence rejected for clearance. Another 5 samples from different location were submitted by the company and on testing 4 of them were found unfit for export due to seedborne pathogen infection.

• Paddy samples (4) supplied by Bayer Biosciences Pvt Ltd. were tested and found not suitable for export as they were infecte~ with the target pests, viz., Pseudomonas sp., and Drechslera state of Cochliobolus carbo rum.

• Four seed and leaf samples of medicinal plants (Mucuna bracteata; Pueraria javanica; Calopogonium mucunoides) were tested against Peanut stripe virus by ELISA and growing them in the greenhouse for four weeks. All samples were found healthy.

• Paddy samples (20) supplied by MIS. DevGen Seeds Pvt Ltd., were tested against seedborne fungi , bacteria and nematodes. Six of 20 were found infected with Xanthomonas spp and hence rejected for clearance. Paddy samples (6) submitted by Advanta India Pvt Ltd were tested against seedborne fungi, bacteria and nematodes and one sample infected with bacteria was rejected.

• Sorghum samples (2) submitted by Advanta India Pvt Ltd were tested against Ditvlenchus

Rf ( tONAl STATION HYDERABAD _

dipsaci and only one sample was found free from nematode infection.

12.2 Plant Genetic Resources Activities

12.2.1 Plant Exploration and Germplasm Collection: A total of 15 explorations were undertaken and 950 collections of diverse crop germplasm were made as follows:

Medicinal Plants: The exploration was undertaken for the collection of Medicinal Plants germplasm particularly species of Hemidesmus, Curculigo, Aristolochia and Plumbago from Rayalaseema region of Andhra Pradesh including parts of Kurnool, Anantapur. Kadapa and Chittoor districts. A total of 58 accessions were collected including Plumbago (6), Curculigo (7) , Hemidesmus (26), Aristolochia (8), Andrographis (3). Red sanders (1), Gloriosa superba (1), Aloe vera (1). Agave sp. (l), wild turmeric (I), Lemon grass (I), Ceropegia sp. (1) and Ocimum sp (1). Variation was observed for leaf size and shape and scentedness in Hemidesmus and tuber shape and size in Curculigo.

Wild legumes: The survey was undertaken in Telangana region of Andhra Pradesh including parts of Khammam, Warangal, Karimnagar, Medak, Adilabad and Nizamabad. A total of 56 accessions were collected including (Canavalia ensiformis-8; C. cathartica-6; Mucuna pruriens-7; Cassia absus - I, C. alata-3 ; C. auriculata-l; C. Jistula-l; C. occidentalis - 1, C. sophera-l; Cassia obtusa - 1; Abrus precatorius-2; Pithecellobium dulce-I; Pongamia pinnata-I; Acacia jarnesiana- l; Aristolochia tagala - 1, Bauhina racemosa - 1, B. semla - 3, Pterocarpus marsupium-1; Clitorina ternatea-2 ; Crotalaria juncea - 2, Erythrina jusca-2; Caesalpinia bonduc-2; and others (Lagenaria siceraria - I , Sesamum indicau -1, Solanum incanum - 1, Solanum melongena - I, Xylia xylocarpa - 1). In Mucuna variability was observed in seed colour, size and coat ornamentation. In Canavalia ensiformis diversity was observed in seed shape and colour. In Caesalpinia bonduc variation was observed in seed shape. A unique spindle shaped bottle gourd accession (IC) was also collected.

Brassica and Seed spices (Karnataka): The survey was undertaken in collaboration with NRC on Rapeseed and Mustard, Bharatpur, Rajasthan, NRC on Seed Spices, Ajmer, Rajasthan and UAS. Dharwad, from parts of Bidar, Dharwad, Shimoga & Chitradurga di<;tricts of

II

Kamataka. A total of 83 accessions including 42 accessions of Brassica juncea (L.) Czern., 34 accessions of seed spices (Coriandrum sativum (L.) -15, Trigonella foenum-graecum (L.) - 14" Trachyspermum ammi (L.) -4, Foeniculum vulgare Mill. -1 and 7 accessions of other crops viz. castor-3, wheat -1, smooth gourd-I, wild brinjal-l, wild cucumber-l

. were collected during the survey. Variability in the collected mustard germplasm was observed with respect to the seed size, seed colour. Variability was also observed in the siliqua size and arrangement on the panicle. The seed material collected will be processed and shared among the collaborators as per their mandate crop.

Luffa sp and other vegetable germplasm: The survey was undertaken in collaboration with INRI APHU! UAS-Bangalore in southern region of Andhra Pradesh and adjoining eastern parts of Kamataka in the districts of Anantapur, Cuddapah, Chittoor and Kuroool and Bellary, Chickballapur, Kolar and Raichur. A total of 175 accs.of germplasm which include Luffa acutangula- 38; Luffa cylindrica- 27; Luffa acutangula vaL amara- 8; Luffa tuberosa- 14; cucurbits: 33; Beans: 25; Solanaceous vegetables: 10; other vegetables: 9; medicinal: 2 and wild relatives: 9 (Abelmoschus ficulneus, Canavalia sp., Hibiscus sp., Melothria sp., Schouwia purpurea, Solanum pubescens, Vigna trilobata) could be collected. Significant diversity was observed in Ridge gourd and Smooth gourd for fruit length, size, shape, colour, no. of seeds! fruit and seed size. Related wild species viz. Luffa acutangula var. amara and Luffa tube rosa which are endemic to the region and almost threatened could also be sighted and collected.

Chillies: The survey was undertaken in collaboration with IIHR, Bangalore & UAS, Dharwad in parts of Bidar, Gulbarga, Dharwad, Gadag, Haveri, Koppal and Belgaum districts of Kamataka. A total of 56 accessions were collected including chillies (51) and others (5). Important landraces collected include: Annigeri, Byadagi dabbi, Byadagi kaddi, Byadagi, Devanur dabbi, Devanur kaddi and Sankeshwar etc. Significant diversity was observed in plant height (medium tall and tall), degree of plant spread, leaf shape & size, flower size, fruit colour (red and dark red), bearing, fruit length, width, size & shape (medium thick! stout paprikas and long medium thick byadige types), pungency (nil, low, moderate, high), duration and yield.

112

In addition to the above, an exploration for Brassica and Seed spices led by Dr Ranbir Singh, Principal Scientist, NBPGR New Delhi was undertaken. The survey was undertaken in collaboration with NRC Seed Spices, Ajmer in Telangana region of Andhra Pradesh including parts of Warangal, Karimnagar, Adilabad, Nizamabad, Medak & Mahaboobnagar districts and a total of 68 accessions were collected .

Onion and Garlic: Two explorations were undertaken in collaboration with NRC O&G, Rajgurunagar, Pune, one in Northern Telangana region of Andhra Pradesh (Karimnagar, Nizamabad, Adilabad) and the second in Chhattisgarh (Bastar, Dantewada) and Maharashtra (Chandrapur, Nanded, Gadchiroli, Yavatmal); 212 accessions consisting of Allium cepa (Onion)-166 and Allium sativum (Garlic)-46 were collected. Variation was observed in shape, size and colour in Chattisgarh where red types were more preferred. In Maharashtra, white types were dominant and variation was observed primarily in size. In garlic variation was observed in colour and size. No major diseases were observed on either bulb or seed crop. The material was collected as bulbs. One set of the collected germplasm has been shared with NRC Onion and Garlic, Pune for evaluation and maintenance.

Palmyra Palm: An exploration was undertaken for the collection of Palmyra palm (Borassus flaberrifer L.) from Srikakulam district of North coastal region of Andhra Pradesh in association with the APHU, Hyderabad and TNAU, Coirnbatore under the auspices of the AICRP on Palms (lead institute) in which a total of nine accessions were collected. One set each of the accessions were shared between APHU, Andhra Pradesh and TNAU, Tamil Nadu for initial establishment, characterization, evaluation and utilization. Significant diversity was observed both in qualitative and quantitative traits as follows: Qualitative traits: palm height (short! medium tall! tall! very tall), palm branching (nil), leaf colour (shades of yellow! green), fruit colour (black! black with orange-red blotch at bottom! black with purple blotch at bottom! black with orange bottom with purple blotch at centre! orange with a purple blotch at bottom! orange with light purple markings on the side and bottom! orange­yellow with purple striations on the side and a big blotch at bottom! yellow-orange characterized by small faint diffused markings on the side and a blotch at bottom), fruit shape (elliptical-oval! oblong! oval-oblong! oval­round! round-oblong! round-oval! spindle-oblong), fruit

ANNUALREPORT2009-10

size (smallJ medium! large), yield (sparse/ medium! beuV), bearing (seasonalJ over-lapped) and suitability to tapping (non-suitable/ medium suitable/ highly suitable). Quantitative traits: age of the palm (15-35vcars), tree height (6.4-16.0m), girth of trunk at 1 m height (1.3-1.9m), total leaves (15-46), petiole length (1.1-1.7111), leaf length (1.9-2.7m), lamina width (1.2-1.7m), bunches/ tree (5-12), fruits/ bunch (10-38), fruit length (lO.0-14.0cm), fruit circumference (31.0-38.0cm), stones/ fruit (1-3).

Yardlong bean and other Asiatic Vignas: A region specific and crop specific survey mission was undertaken for the collection of germplasm from parts of Srikakulam, Vizianagaram districts of Andhra Pradesh and adjoining regions of Koraput and Gajapati districts of Orissa. Collections of yardlong bean were made for the first time from Srikakulan and Vizianagaram, while villages and blocks of Gajapati (Kashinagar , Gumma) and Koraput (Subai, Beesingpur, Similiguda), earlier unexplored were surveyed for variability. A total of 63 accessions including Vigna unguiculata ssp sesquipedalis (39), Vigna unguiculata ssp unguiculata (16), Vigna mungo 0), Vigna radiata (1), Vigna lImbellata 0), Lablab purpureus 0), Phaseolus vulgaris (1), Phaseolus lunatus (1), Capsicum annuum (2). Variation was observed for pod length and colour and seed size and colour in both yardlong bean and cowpea. Pods were green, dark green and purple. Seeds were coloured brick red, red with a white tip, white with red mall ing, Variation in pod length ranged from 24 cm -75cm; in fresh pod weight (10 pods) from 60g to L40g and seeds/pod from 6.2 to 17. 100 seed weight varied from 7.3g to 66.4g. Specific accessions collected include KVrrSA - 27 and KVrrSA -38 (pod length 75 cm), KVrrSA - 54 and KVrrSA 55 (fresh pod weight of 10 pods - 140, 135g).

Momordica dioica (kakrol/ spine gourd): An exploration was undertaken for the collection of germplasm from North Telangana and North Coastal Andhra Pradesh in the districts ofWarangal, Kharnrnam, West Godavari and East Godavari in collaboration with APHU. A total of 72 accessions of Momordica dioica and one accession each of Cucumis pubescens, Musa ornata and Vanilla wightiana were collected. In Momordica dioica, diversity was observed in Leaf colour, leaf margin; number of ridges on stem; number of stt-ms/tuber; fruit shape, size, spine density; tuber size and &hape.

H, O\j At STATION, HYDERABAD

Moringa: The exploration trip on Moringa was carried out with the collaboration with IIVR, Varanasi, covering parts of Ranga Reddy, Medak, Mahaboobnagar, Kurnool, Bidar, Raichur, and Gulbarga. A total of 49 accessions of Moringa cuttings along with Moringa seeds (16) and other material (9) including bottle gourd (4), sponge gourd (1), chillies (1), brinjal (1), bitter gourd (1) and sweet beans (1) were collected (25 samples). One set of all these collections was shared with the collaborator for evaluation and maintenance of thl! germplasm. Diversity in Moringa concanensis and M. oleifera (M. pterigosperma) was observed in the size of fruit (length and width), cluster bearing to normal, pink tinged branches and leaves to normal, pink flowered trees to creamy and white and bitter non edible fruits to normal fruits suitable for cooking. The rooted 14 accessions of Moringa are being maintained at this station.

Pongamia and Jatropha: Three explorations were undertaken for collection of Pongamia pinnata germplasm from the states of Chhattisgarh, Rajasthan and Andhra Pradesh. The surveyed region in Chhattsgarh involves Dantewada, Dhamtari, Narayanpur, Durg, Bastar and Kanker districts which resulted in collection of 56 accessions. In Rajasthan 35 accessions were collected from the districts of Ajmer, Bhilwara, Chittorgarh, Banswara,Udaipur, Dungarpur and Rajasmund. A total of 12 collections were made from parts of Guntur and Krishna districts of Andhra Pradesh. In collaboration with the Central Research Institute for Dryland Agriculture, an exploration for collection of Jatropha germplasm was undertaken from parts of north coastal region involving Srikakulam, Vizianagaram, West Godavari and Visakhpatnam districts of Andhra Pradesh with collection of 28 accessions (Jatropha - 25accs. and Pongamia - 3 accs.). Diversity in Pongarnia was observed for pod shape, colour, width, thickness, and prominence of beak. Good variation in shape, color, width and thickness was observed in seed traits. The number of kernels per pod varied from 1 to 2. Mainly three types branching pattern was observed viz. erect, semi-erect and drooping. Leaf colour varied from light green to dark green. There was variability in flower colour which ranged from pink to white.

12.3 Germplasm Characterisation I Evaluation I Multiplication

12.3.1 Rabi, 2008-09: A total of 629 accessions of linseed, sesame, sorghum, brinjal, chillies and dolichos bean were grown in the field along with checks for characterization/evaluation/multiplication.

113

Crop No. of aces. Checks Characterization Evaluation Multiplication

Sorghum 64 (RBO) M 35-1, CSV-14, CSV-216 Linseed 88 (ABO) J-23-10

RLC-6 Sesame 89 (ABO) Swetha, JLT - 26, TC-25 Brinjal 62 (ABO) Bhagyamati, PPL,

Shyamala Chillies 201 (ABO) CA-960, LCA-334,

Pusa Jwala Oolichos 77 (ABO) Arka Jay, Arka Vijay bean & RNO-1 Tomato 57 (ABO) Pusa Ruby, Marutham

& Punjab Chauhara

Sorghum: Sixty four accessions were evaluated along with three check varieties viz .. M-35-1, CSV 14 and CSV 216. Accession IC527022 was the earliest to flower in 64 days as compared to check M 35-1 (75 days). Varia­tion was observed for total number of leaves (5.11 -10.11), plant height (103.55 -213.43cm), number of tillers

' (0.77-4.75), leaf length (36.11-1.68), leaf width (2.69-12.39cm), ear head length (8.90-30.73), ear head width (4.53-25.26) and 100 seed wt 1.43-4.53g).

Sesame: IC413138 with eight 10cules / capsule was found to be promising and is to be evaluated further for confirmation of its superiority over other germplasm.

Linseed: Eighty four linseed accessions were charac­terized for 11 qualitative and lO quantitative traits. Varia­tion in seed traits was as follows: length (4.6 - 5.4 mm), width (9 2.3 - 8.6 mm), thickness (0.9 - 1.3 mm), lOOO­seed weight (5.7, 8.9g). The oil content of the linseed germplasmranged between 29.4% and 42.6%. IC564681 recorded the highest oil content (42.6%), while the ac­cession IC564591 recorded the least (29.4%). With re­spect to linolenic acid (omega-3 fatty acid), IC 564631 possessed the maximum (57.1 %) and IC564687 the mini­mum (39.5%). Linseed germplasm with high oleic acid content was identified with IC564627 recording the maxi­mum of 32%.

Brinjal: A total of 62 accessions were evaluated along with 3 check varieties viz ., Bhagyamati, PPL and Shyamala. A wide range of variation was observed for number of fruits per plant (6.0-51.0), number of primary branches (2.0-8.0) and fruit length (6.5 - 18.0 em). Accessions identified as promising include ICll1431 for maximum fruit/plants (51), IC345309 for large number of primary branches (8) and IC90136 for longest fruits (18cm).

114 - ----~

" .J

V V V

V V V

..; V V

..; V ..;

V " " Chillies: A total of 201 accessions were characterized, evaluated and multiplied with CA-960, LCA-334 and Pusa Jwala as check varieties. A total of 55 qualitative and quantitative descriptors pertaining to plant, flower, inflorescence and fruit were recorded. Variation was observed for fruits/ plant (no), 25 dry fruit weight (g) and fruit length (em). Accessions found promising­IC413714 for fruit length (em), IC446521 for 25 dry fruit weight (g), IC214947 for days to flowering and IC446493 for fruits/ plant (no).

Dolichos Bean: A total of 77 accs. were character­ized, evaluated and multiplied in an ABD with Arka Jay, Arka Vijay and RND-l as the local checks. IC546364 was found promising for no. of seeds/ pod.

Tomato: A total of 37 accessions were characterized, evaluated and multiplied in an ABD with Marutham and Pusa Ruby as local checks .. Data pertaining to qualita­tive and quantitative descriptors belonging to plant, flower and fruit characters was recorded. Wide range of diver­sity was observed for various qualitative and quantita­tive traits including fruit skin thickness (0.01 to O.Imm) and T.S.S (1.2° - 7.2°brix). Accessions found promising for fruit characters with good T.S.S (brix» for further evaluation for processing- EC320574, EC163605, EC162601 and EC145622. A set of 20 accessions were also screened for their field reaction against leaf curl in an ABD with Marutham, Pusa Ruby and Punjab Chauhara as local checks. Accession EC251672 was found to be field promising against leaf curl confirming the results of previous years.

12.3.2 Kharif 2009: A total of 718 accessions of germplasm of black gram, Italian millet, amaranths, bottle gourd, brinjal, chillies, field bean, onion and tomato were sown in the field along with appropriate checks for char­acterization! evaluation! multiplication.

____ A~M'ALREPORT2fX)9~ 1O

Crap No. of aces. Checks Characterization Evaluation Multiplication

Black gram 50 T-9, PU-19, LBG-20 .J -I J Italian millet 164 Si.A-326 (Prasad),

AK-132·1 (Lepakshi), Si.A-2593 (Krishnadevaraya), Si.A-2622 Narasimharaya), Si.A-2644 (Sri Lakshmi), Si.A-2829, Si.A-2871)

Amaranths 70 RNA-1, S-67, NDS-46 J .J Bottle gourd 20 Arka Bahar, Bio Gaurav, J J

Pusa Naveen, Swathi Brinjal 175 Arka Neelkant, Bhagyamathi, J J J

KS-331, PPL, Punjab Sadabahar, Pusa Ankur, Pusa Kranti, Pusa Upkar and Shyamala

Chillies 92 CA-960, LCA-334, Pusa Jwala J J .J Field bean 76 TFB-1, IC-426988 Onion 22 Light Red, Nasik Red,

White Marglobe Tomato 49 Lakshmi, Marutham and

Pusa Ruby Wild edible 49 legumes

Black gram: 50 accs of blackgram were characterized and evaluated. IC 519619 flowered in 38 days on par with the check variety T-9. Variation in quantitative traits observed was as follows: IC 343812 had maximum pods/ plant (50) as compared to check variety T-9 (40).

Italian millet: A total of 164 accs. of Italian millet germplasm were characterized, evaluated and multiplied in an ABD with Krishnadevaraya, Narasimharaya, Prasad, Si.A-2829, Si.A-2871, Srilakshmi and Lepakshi as the local checks. IC413272 was the earliest to flower in 44 days and IC257895 was the earliest to mature in 71 days when compared to seven check varieties. IC308981 was the most promising accession for panicle length with 40.9 cm. in comparison to seven check varieties.

Amaranth: Seventy accessions of amaranth's were sown for characterization, evaluation and multiplication along with appropriate check varieties. Two accessions, IC561305 and IC561315 , recorded 36 days to 50% flowering which was on par with one of the checks­RNA-l and better than the other check S-67 which flowered in 48 day·s.

Bottle gourd: Twenty accessions of bottle gourd

germplasm lines including some wild species collected in A.P are being characterized. (plant vigour: ranged from poe' (IC546178) to very good (10 accs.); plant growth habit ranged from short viny (8 aces.) to long viny

.J .J J

..; ..;

J

..; J

(lC546170); twining tendency varied from slight (IC546148 and IC446598) to pronounced (8 accs.); leaf size ranged from small (IC546178 and IC446596) to large (IC546170) and IC546182; petiole length ranged from 10.3 cm in IC446592 to highest in IC570480; days to 50 % flowering ranged from 60 days for IC446593 to 78 days for IC446598.

Brinjal: A total of 170 accessions along with 9 check varieties Pusa ankur, Pusa upkar, PPL, Pusakranti, Punjab sadabahar, KS-331, Arka Neelkant, Bhagyamatbi and Shyamala. A wide range of variation was observed for plant height (330 - 836cm), plant spread (57 - 120cm), days to 50% flowering (73 - 80) and fruit weight (4.5g-461.6g). IC261899 recorded maximum plant spread (] 3] cm) and fruit width (12.0cm) ; IC381562 recorded maximum fruit length (26.0cm) & IC345309 with 6-8 primary branches.

Chillies: A total of 92 accessions were characterized, evaluated and multiplied in an ABD with CA-960, LCA-334 and Pusa lwala as check varieties. A total of 55 qualitative and quantitative descriptors pertaining to plant, flower, inflorescence and fruit were recorded. Wide range of variation was noticed particularly for fruits/ plant (no), 25 dry fruit weight (g) and fruit length (em). IC570376 was the earliest to flower in 77 days and EC596940 was the earliest to mature in 130 days when compared to three check varieties. A naturally occumng purple landrace collection (lC436231) from Andhra

RHJIONALSTATlO~,IM)ERABAD ________________________ _ 115

Pradesh has been on evaluation for recording it's unique characters and purification to advance this particular genotype for germplasm registration. This accession has purple pigmentation on stem, node, leaf (dorsal side), pedicel, corolla, filament, style, calyx and fruit. It is also characterized by erect flowers and fruits and appears to be promising as a distinct morphological marker. It assumes significance in the wake of plant variety protection and DDS characters where in unique and distinctiveness has to be brought in to phenotypic traits of varieties for differentiation between varieties already released and proposed for release.

Field bean: A total of 76 accs. were characterized, evaluated and multiplied in an ABD with TFB-l and IC426988 as the local checks. Data pertaining to plant, flower, pod and seed characters of 12 qualitative and 13 quantitative deSCriptors was recorded. 10 fresh pod weight, 100 seed weight, pedicel length and primary branches (no.) appeared to show more diversity. IC526916 was the earliest to flower in 113 days.

Onion: Twenty two accessions of Onion collected from the states of Orissa, Andhra Pradesh and Chhattisgarh were evaluated in an augmented block design. The seedling vigor ranged from poor (IC564085) to very good (IC571927), minimum leaf girth was 9.82 cm (lC571921) and maximum was 17.36 cm (IC571927), leaf length ranged from 34.8 em (IC564084) and 55.8 cm (IC571927). The leaf cross section showed semi-circular (17 aces.) and V-shapes (5 accs.), the minimum number of leaves were 6.4 (IC564085) and maximum were 11.6 (IC571904), the maximum plant height was recorded by IC571927 (61.0 cm) and minimum was recorded by IC564084 (44.4 em). Accession (lC571904) had recorded the lowest bulb weight of 44.64 g and accession (IC564054) had recorded highest bulb weight of 170.97 g. The number of dry scales per bulb ranged from 2.6 (IC 564085) to 4.8 (lC571922), whereas number of total scales per bulb varied from 10.6 (IC564054) to 14.6 (IC564076).The maximum (4 nos) bulb hearting was recorded by IC564056 and IC571913. There are mainly three types of bulb flesh color was noticed viz., White (IC571904), Pinkish White (IC564071) and Reddish

Crop No.ofaccs. Checks (DeSign)

Sorghum 403 (ABD) M-35-1

Barnyard 16 (RBD) K-1, VL-29 millet (promising trial)

116 - _________ _

White (IC571919) and total Soluble Sugars ranged from 6.92 (IC57 1959) to 12.2 (lC571935). The range values for equatorial diameter, polar diameter and neck diameter ranged from 52.6 (IC564056) to 75.63 (IC571959), 50.43 (IC564084) to 81.77 (lC564055) and 5.72 (IC571919) to 19.07 (IC564076) respectively. Two accessions IC571904 and IC571935 exhibited bolting phenomenon.

Wild edible legumes: A total of 59 accessions of Canavalia ensiformis (26), Mucuna spp. (7), Cassia ssp. (10) and Vigna trilobata (pillipesara bean) (23) were characterized and evaluated. Variation was observed as follows:

• Canavalia: pod length (13.6 - 26.3cm), pod width (2.7 - 4.7 cm), seeds per pod (5.0 - 11.6), pod weight (12.0 - 32.1 g), 100 seed wt.(87.9 -284.9g). seed protein (31.4% - 42.0%).

• Mucuna: seed length (5.0 - 10.2mm), seed width (2.8 - 7.9mm), seed thickness (l.2-6.5mm), 100-seed weight (10.9 - 27.lg).

• Vigna trilobata: days to 50% flowering (48-70), plant height (l0.8 - 66.5cm), terminal leaflet length (3.1 - 6.0cm), terminal leaflet witdth (2.5 - 16.7cm), primary branches (2.9 - 4.5), length of primary branch (41.0 - 78.0cm), number of secondary branches (0.0 - 3.5), peduncle length (15.l - 37.5cm), pods/cluster (2.0 - 6.4), c1usters/ plant (5.3 - 9.7), pods/plant (13.9 - 51.2), pod length (4.6 - 5.6cm), seeds/pod (9.5 - 13.2), 100seed weight (0.9 - 1.6g).

• Cassia spp.: Seed protein content in 10 aces of Cassia spp., ranged from 17.2% (CassiaJistula­IC571835) to 23% (Cassia alata - IC571795).

Jatropha curcas: A total of 47 accessions from Andhra Pradesh were analysed for total oil content using Soxhlet method. The oil content ranged between 13.3% and 36.8%.

12.3.3 Rabi, 2009-10: A total of 1106 accessions including sorghum, small millets, linseed, brinjal, chillies and tomato were grown in the field for characterization! evaluation/ multiplication.

Characterization Evaluation Multiplication

...; ..;

..; ...;

_ ANNUALREPORT2009-IO

Finger millet 16 (RBO) PR-202, VL-149 V V

(promising trial)

Little millet 16 (RBO) CO-2, OLM-203 V .J

(promising trial)

Linseed 81 (ABO) J-23-10, RLC-6 " .J

Brinjal 62 (ABO) Bhagyamati, PPL, V " .J Shyamala

Chillies 104 (ABO) Arka Jay, Arka Vijay, RNO-1 V " V

Tomato 408 Pusa Gaurav, Pusa Sheetal, ..; ..; V Pusa Ruby, Punjab Chuara

National Herbarium of Cultivated Plants: Fifty-five herbarium specimens representing variation in medicinal plant species and wild edible legumes including Hemidesmus indicus, Aristolochia indica, A. bracteata, A. tagala, Plumbago ind.ica, Plumbago zeylanica, Vigna trilobata, Canavalia ensiformi and Crotalaria sp. were prepared and submitted for inclusion m the National Herbarium of Cultivated Plants at Delhi.

12.4 Germplasm Conservation

A total of 255 accessions including small millets (70 accs.), horse gram (8), green gram (1), black gram (2), brinjal (50), chillies (64), linseed (29 accs+2 check varieties) Vigna trilobata (20), Clitoria ternatea (4), Crotalaria juncea (2), and Mucuna pruriens (5) were sent for long term storage to NGB, New Delhi. In addition, a set of 20,000 voucher samples of the material received from ICRISAT and processed for the SVALBARD genebank, Norway were sent for long­term storage in the NGB.

Seed of 722 accessions of germplasm collected during explorations comprising of Brassica spp., seed spices (83), yardlong bean, Asiatic Vignas (63), pongamia (91), horticultural crops (429) including chillies, Luffa spp. & other vegetables, Moringa, onion & garlic and spine gourd along with wild edible legumes (56) were sent to GHU for medium term storage and national accessioning. germplasm characterization! evaluation! multiplication.

Research Programme (Programme Code: Title, Leader)

A total of 154 accessions of Pongamia{91) and yardlong bean and Asiatic Vignas (63) gemlplasm collected during the explorations were added to the medium term storage at NBPGR, Hyderabad. In addition, a total of 5342 voucher samples of import germplasm of various crops were stored in the Cold Store.

12.5 Germplasm Distribution

A total of 229 accs. comprising of Brassica spp. (42 accs. to NRCRM), Seed spices (34 accs. to NRCSS) and Brassica spp. and seed spices (83 accs. to UAS­Dharwad) were shared! supplied to respective institutes who participated in the collaborative explorations. A total of 70 accessions of Pongamia collected from Chattisgarh (44) and Rajasthan (26) were shared respectively with Agro-Forestry Centre ANGRAU and CRIDA. A total of 997 accessions of horticultural germ plasm consisting of Luffa spp. & other Vegetables, Chillies, Moringa, Onion & Garlic, Seed Spices and Spine gourd were supplied to APHU/ IIHRI IIVRI NRCO & G / NRCSS/ UAS-Bangalore/ UAS-Dharwad, the collaborating institutes for their utilization in crop improvement programmes. A total of 258 accessions of horticultural germplasm consisting Bottle gourd, Brinjal, Chillies, Ridged gourd, Smooth gourd and Solanum torvum, were supplied to APHU/ CIAH/ IARII MAUl NBPGR HQ.I UAS-Dharwad as per their requests.

PGRJPQR- BUR-HYO-01.00- Quarantine Processing of Plant Germplasm Under Exchange And Supportive Research (KS

Varaprasad)

PGRJPQR- BUR-HYO-02.00- Augmentation, Characterization, Evaluation, Maintenance, Regeneration, Conservation, Documentation and Distribution of Genetic Resources of South East Coastal Zone (KS Varaprasad)

RI .GIONAl STATION, HYDERABAD 117

Research Projects (Project Code, Title, Project Leader; Associates)

PGRJPQR- BUR-HYD-01.01- Detection, Identification and Control of Pests Associated with Import and Export of Seed! Plant Material (K Anitha, KS Varaprasad, RK Khetarpal RDVJ Prasada Rao (till July 31), SK Chakrabarty, B Sarath Babu, N Somasekhar, N Sivaraj and Babu Abraham)

PGRJPQR- BUR-HYO-01.02- Developing a Database on Pests and Pathogens of Quarantine Significance (B Sarath Babu, KS Varaprasad, RDVJ Prasada Rao (till July 31), and K Anitha)

PGRJPQR- BUR-HYO-01.03- Quarantine Treatments for Germplasm under Exchange and Developing Detection Techniques and Treatment Schedules for Seed Bome Pathogens (SK Chakrabarty and K Anitha)

PGRlPQR- BUR-HYO-01.04- Post-entry Quarantine Processing of Imported Germplasm (ROVJ Prasada Rao (till July 31), KS Varaprasad (w.e.f August 1), SK Chakrabarty, B Sarath Babu, K Anitha and Babu Abraham)

PGRlPQR- BUR-HYO-02.01- Augmentation, Characterization, Evaluation, Maintenance, Regeneration, Conservation, Documentation and Distribution of Genetic Resources of Agricultural Crops (Cereals, Millets, Pulses, Oilseeds etc.) and their Wild Relatives. (Kamala Venkateswaran, SR Pandravada, N Sivaraj, N Sunil, T Rama Srinivas and Babu Abraham

PGR/PQR- BUR-HYO-02.02- Augmentation, Characterization, Evaluation, Maintenance, Regeneration, Conservation, Documentation and Distribution of Genetic Resources of Horticultural Crops (Vegetables, Fruits, Species, Medicinal and Aromatic Plants Etc.) and their Wild Relatives (Someswara Rao Pandravada, K Venkateswaran, N Sivaraj, Mr N Sunil, T Rama Srinivas and Babu Abraham

PGRJPQR- BUR-HYO-02.03- Characterization and Evaluation of Wild edible Crops of Leguminosae (N Sivaraj, SR Pandravada, K Venkateswaran, N Sunil and Babu Abraham)

Externally funded projects

• Improvement of brinjal and chillies for root knot nematode resistance using molecular markers (OBT)

• Collection, assembly and conservation of genetic resources of physicnut (Jatropha sp. Linn (OBT)

• Novel strategies for molecular diagnosis of plant viruses (NAIP)

118 ANNUAL REPORT 2009· 10

13. REGIONAL STATION, JODHPUR

Summary: Two exploration and collection trips were undertaken and 64 germplasm collections of different crops and wild species were made from different parts of North Gujarat and South Rajasthan. Spice germplasm were collected in collaboration with NRCSS, Ajmer. Besides these 16 collections of eight different and economically important taxa were collected locally. Observations were recorded on morpho-agronomic traits of 125 and 1971 accessions of different crops raised during ummer and Kharif 2009, respectively. Genetic stocks with unique traits like determinate habit with early maturity, branched,

and all node bearing pods in guar; bold seeded and early maturity with high yield accessions of mungbean and fodder type pearl millet and moth bean accessions were characterized evaluated during Kharif 2009. Blocks of horticultural plants and plants of economic importance were maintained and data were recorded. In all 30,377 germplasm accessions are conserved In the MTS facility. A total of 749 germplasm accessions of different taxa are maintained in the field gene bank. A total of one hundred and nineteen accessions consisting of guar (104) and exotic mungbean (15) were sent to NGB for LTS. Seed samples of 56 accessions were received from different sources and 861 germplasm accessions were supplied to various

indentors.

13.1 Exploration and Collection

A total of 64 germ plasm collections were made from different parts of Gujarat (58) and Rajasthan (08) under two exploration trips (Table 1). First exploration trip was undertaken in collaboration with National Research Centre for Seed Species during March 2-9, 2009. A total of28 collections comprising of Coriander (I) , Cumin (24), Dill (2) and Fennel (0 I) were made from Banaskantha (03), Kachchh (20) and Patan (05) districts of Gujarat. A wide range of variability in seed species germplasm was collected specially in cumin. The variability was observed in plant habit, nature of umbel , bearing and seed characters. Germplasm collection GKKB- l78 collected from village Kumarkheda - Bela in Rapar taluk of Kachchh district was found to be very good in branching behavior with higher number of umbels/plant, more seeds/ umbel and bold seeds. While another collection GKKB-196 co llected from village Tharad , Taluk Yav of Banaskantha district was found to have strong fragrance.

The second exploration and germplasm collection trip was made to collect wild species of Vigna and weedy forms of guar from north western parts of Gujarat and adjoining Rajasthan during October 13-23, 2009. A total of 36 germplasm collections belonging to three different crops were made (Table 2) which includes Adak guar (29), Chidi moth (06) and globe cucumber (01). Out of these,

8 collections of Adak guar were made from J alore district of Rajasthan. A wide range of variability was found specially in Adak guar germplasm. The variability was observed in plant habit, shattering habit, bearing and seed characters.

GKKB-178 Cumin collection with high number of umbels/ plant

Plants of wild and cultivated guar

Table 1: Exploration and collection trips undertaken

Explorations (Target species) Area explored! period Collaborator Total collection

Seed species Kachchh region NRCSS, Ajmer 28

Wild species of Vigna and Parts of N.W. Gujarat and - 36 weedy forms of guar adjoining Rajasthan

Total 64

RI )IONAl STATION JODHPl....'R __________ _ 119

TaJ:>le 2: Germplasm collection of different crops

Crop/ Plant species

Banaskantha .

Adak Guar (Cyamopsis tetragonaloba) 4 Chidi moth (Vigna trilobata) 2 Coriander (Coriandrum sativum) -

Cumin (Cuminum cyminum) 2 Dill (Anethum graveolens) -Fennel (Foeniculum vulgare) 1 Globe cucumber (Cucumis prophetarum) -

Total 9

13.2 Germplasm Augmentation

Germplasm of Abutilon indicum (L.) sweet (1), Argyreia nervosa (Burm. F) Boj. (1), Chenopodium album Linn. (1), c. murale Linn. 0), Cocculus pendulus (Forsk), Die]s (5), Eclipta alba (L.) Hassk (1), Maerua oblongifolia (Hook f. & Thomas) (5) and Sida cordifolia, Linn. (1) were augmented from local sources.

Fruit Variability in Maurua oblongifolia

Inilorescence and leai variability in Chenopodium murale and C. album

120

1

_StatelDistrict Gujarat Rajasthan Total

Kachchh 1 Patan Jalore

14 3 8 29 2 2 - 06 1 - - 01 19 3 - 24 - 2 - 02 - - - 01 1 - - 01

37 10 8 64

13.3 Germplasm Characterization and Evaluation

13.3.1 Summer 2009: A total of 125 accessions comprising of guar (92 aces.) and mung bean (33 aces.) were raised during summer 2009. Seeds of trait specific guar (17 aces. + 3 checks) and mung bean (20 accs. + 3 checks) were sown in R.B.D. for evaluation. While seeds of 72 accessions of guar and 13 accessions of mungbean were also sown for multiplication. Data on variability in various parameters was recorded on the germplasm accessions as per the description.

13.3.2 Khari! 2009: In all, 1971 accessions of field crops namely pearl millet (147), cowpea (138), guar (524), mothbean (216), mungbean (544), castor (42), sesame (200) and Cucumis spp. (140) were raised for characterization/ evaluation! multiplication! rejuvenation during Kharif 2009 (Table 3). The data on various descriptor traits was recorded.

BANG-4-P4- branched all node bearing determinate guar

__ _ ANNUALREPORT2009-1

IC34028 Semi-erect narrow leaves broad lobed fodder moth beam

~ , ~

4 ~

\\ t/1: ~

~ \\\ y

~

Leaf and pods of cultivated & adak guar

13.3.3 Identification of New Genetic Stock: In mungbean, new stable genetic stocks possessing unique traits have been identified and characterized. One of the important genetic stocks identified during the period include genetic producing extra bold seeds with )100 seed weight of more than 9.0g.

Pod variability mungbean

13.3.4 Rabi 2008-2009: Seeds of Triticum aestiVllnl (1 acc.), T. dicoccum (1 acc.), T durum (2 accs.), T polonicum (1 acc.), T sphaerococculIl (l acc.), Cicer arietinum (2 accs.), Coriander (1 acc.), Cumin (1 acc.), Fenugreek (1 acc.), grain amaranth (2 accs.), Lepidium sativum (1 acc.) and Plantago ovata (l acc.) were multiplied.

Horticultural Crops

Transplantation: Seedling ofber (20 accs.) and sapling of pomegranate (19 accs.) were transplanted in the field gene bank.

Hybridization: Interspecific crosses were attempted between Cucumis callosus,Cmelo var. melo, C sativus var. hardwickii, C trigollus and C prophetarum and seeds were harvested.

Data recording; Data of survival was recorded in 20 and 19 different accessions of ber and pomegranate

Table 3: Germplasm accessions of various crops grown during Kharif 2009

Crop No. of Checks Activity accessions

Pearlmillet 167 CZP-9802, Raj-171, ICMV-221, Characterization (147), Evaluation (20) Pusa 383, JBV-2

Cowpea 138 FTC-27, GC-3, NS-24/8-2,V-240, V-585 Characterization (138) Guar 524 PLG 85, RGC-197, RGC-1066 Characterization (200)

Durga Kanchan, IC11388, PLG 85,Pusa Navbahar, Suvidha Evaluation (20); Multiplication (304)

Mothbean 216 Jadiya, Jwala, Maru Moth, RMO-40 Evaluation, fodder type (16);Characterization and multiplication (200)

Mungbean 544 M1319B, Pusa Vishal, Pusa-105 Evaluation (40) Rejuvenation (504)

Castor 42 48-1, DCS-9, TMV 5-1 Multiplication (42) Sesame 200 - Multiplication (200) Cucumis spp. 140 - Multiplication (140)

Total 1,971 ...._

I JI ) ALSTATION,JODHPCR ________________ _ 121

acc~ssions. Monthly data were on plant height, flowering and canopy was recorded in aonla, bael, ber, Carissa carandus, C. edulis, C. grandiflora, custard apple, date palm, guava,jamun, ber, lasora, lemon, mulberry, phalsa, pomegranate and tendu. Observation of floral biology was observed in Cucumis spp. Flowering and fruiting was recorded in Carissa spp. and Capparis decidu as (15 accs.).

Fruit bearing in Carissa carandus

Economic Plants

Seed sowing: Seeds of Argyreia nervosa (I acc.), Asparagus racemosus (2 accs.), Cocculus pendulus (5 accs.), Datura alba (4 accs.), D. innoxia (2 accs.), D. metel (2 accs.), Maerua oblongifolia (5 accs.), Moringa oleifera (1 acc.) and Tinospora cordifolia (2 accs.) were sown in pots for germination and other studies. The study in Moringa oleifera also involves sowing of seeds at ten different depths and in three different positions of micropylar end in the pots.

Transplantation: Seedlings of Acacia senegal (I5 accs.), Argyreia nervosa (I acc.), Asparagus racemosus (l ace.), Datura alba (4 accs.), D. innoxia (2 accs.), D. metel (2 accs.), Date palm (I acc.), Maerua oblongifolia (5 accs.), Moringa oleifera (I acc.), Prosopis cineraria (2 accs.), Tinospora cordifolia (2 accs.) and Withania somnifera (1 acc.) were transplanted in the field.

Data recording: Seed germination and survival percentage were recorded in Argyreia nervosa (l acc.), Asparagus racemosus (2 accs.), Coccuius pendullus (l acc.), Datura 'lLba (4 accs.), Datura innoxia (2 accs.), D. metel (2 accs.), Maerua oblongifolia (5 accs.) and Moringa oleifera (1 acc.). Sprouting was recorded in Ceropegia bulbosa (l acc.) bulb during July 2009. Observations on plant height, canopy, flowering and fruiting were recorded in Acacia senegal, Bar/areia acanthoids, Jatropha curcas, J. gosnpifolia, Jojoba,

122

Root variability in Asparagus recemosus

Fruit bearing in Leptadenia reticulata

Leptadenia reticulata (2 accs.), L. pyrotechnica (I acc.), Moringa concanensis, M. oleifera, Prosopis cineraria, Putranjiva roxburghii, Saraca asoca and Withania coagulens.

Seed harvesting: Fruits and seed harvesting was done in Abutilon indicum (2 accs.), Argeria nervosa (l acc.), Asparagus racemosus (l acc.), Eclipta alba (l acc.), Moringa concanensis (1 acc.), M. oleifera (l acc.), Tinispora cordifolia (2 accs.), Tylophora indica (2 accs.) and Withania somnifera (l acc.)

Maintenance: All economic plants in various blocks Acacia spp, Aloe barbadensis, Agave spp., Asparagus racemosus, Barleria acanthoidis, Bougainvellia spp., Cassia spp., Celatrus paniculata, Commiphora wightii, Datura spp., Euphorbia spp., Grasses. Jatropha spp., Jojoba, Leptadenia spp., Moringa, spp .. Muraya kognii, Nyctanthes arbor-tristis, Prosopis cineraria, Putrangiva roxburghii, Saraca asoca, Tinospora cordifolia, Tylophora indica and Vitex neg undo, Withania coagulens and W sominfera are being maintained in the field. Pergularia daemia (1 acc.), Tinospora cordifolia (2 aces.) and Tylophora indica (2 accs.) are maintained in the shed and on fence and trees. While Caralluma edulis, Ceropagia bulbosa. Cissus quadriangularis, different species of cactii and Sarcaslemma acidum are maintalOed in the pots

_ ANNUAL REPORT 2(X)Q

JW'cct of Climate Change

Flo ering was recorded in Tecomella undulata and Tillc ,pora cordifolia in early winter season too.

13.4 Germplasm Conservation

13.4.1 MTS Facility: During the period a total of 330 at.:ctssions of different crop and taxa were added to the '\iTS facility at this station. The germplasm additions include Abutilon indicum (2), Argyreia nervosa (1), Asparagus racemosus (1), Chenopodium album (1), C. Illurale (1), Cocculus pendulus (5), Eclipta alba (1) Jatropha curcas (2), Maerua oblongifolia (5) (economic plants), Adak: guar (29), Adak: moth (5), Trait specific guar (104), Castor (42), Chidimoth (l0), Coriander (1), Cuntin (24), Cucumis hardwickii (3), c. prophatarum (1), c. sativus (5), Dill (2), Fennel (1), Fodder moth (16), Mungbean (61) and water melon (2) (different crops) collected/multiplied at this regional station and received from different sources. Altogether a total of 30,377 germplasm accessions have been conserved at the MTS facility of this station.

13.4.2 Field Gene Bank: In total 749 accessions helonging to 110 crops/ taxa are being maintained in field gene bank of this station (Table 4).

Table 4: Germplasm maintained in the field gene bank.

Cropl taxa group Number Cropl taxa AccesSion

FrUits 26 263 Orn.{mentals 10 53 Oil :ielding plants 5 211 Me,licinal & Aromatic plants 37 146 Muilipurpose trees 17 44 Fibe· yielding plants 1 8 Forage grasses 5 14 Others 9 10

Total 110 749

Plant of 8arleria acanthoids

A group of Withania coagu/ens plants

13.4.3 Germplasm sent to LTS: During 2009, a total of 119 germpJasm accessions of different crops namely determinate (101) and branched all node cluster bearing (03) guar and exotic mungbean (15) were sent to NGB, NBPGR, New Delhi for long-term conservation.

Putrangiva roxburghii in field gene bank

Saraca asoca in field gene bank

13.5 Germplasm Exchange

Germplasm Received: A total of 56 gennplasm accessions of legume (04), oil yielding crop (42), horticultural crops (08) and economic plants (02) have been received from different sources (Table 5).

RE (, l"JALSTATION,JODHPlJR __________ _ 123

Table 5: Germplasm received from different sources

Name ofthe cropl taxa (No. of acc.) Source

Vigna aconitifolia (6)

Castor (42)

Cucumis hardwickii (03)

C. sativus (05)

PC AICRP on Arid Legumes, CAZRI, Jodhpur

Germplasm Exchange Division, NBPGR, New Delhi

NBPGR, RS, Akola

Jatropha curcas (02)

NBPGR, RS, Akola (01) and NBPGR RS, Thrissur (04)

Germplasm Exchange Division, NBPGR, New Delhi

Germplasm Supplied: During 2009, a total of 861 germplasm accessions including pseudo cereal (J ace.), millets (3 aces.), legumes (372 aces.), oil seeds (284 aces.), horticultural crops (99 aces.) and economically important plants (106 aces.) were supplied to different indentors.

13.6 Germplasm Registration

...

• • • • ..

• • • • • ?

~

• • • 0

- ~

IC418452 M1319B 0 ,

I • • • • ,.. '" -

'" I • • • • • _Co -• • , • • • ___.,

Pusa Vishal Pusa 105

IC418452- A unique extra bold seeded mungbean accession

Research programme (programme code: Title, Leader)

Four proposals were sent for the registration of genetic stocks of (i) mungbean possessing highest 100-seed weight (>9.00 g), and of (i) guar, a. possessing highest gum content (34.38%), b. all nodes cluster bearing habit and dwarf plant and with shortened internodes.

13.7 Compilation of Characterizationl Evaluation Data

Evaluation data of 618 accessions of different crops grown during summer 2009 namely determinate guar (17) and bold seeded mungbean (20 aces.); and crops grown during Kharif 2009 namely pearl millet (167 aces.), cowpea (138 aces.), determinate (200 aces.) and fodder (20 aces.) guar; mothbean fodder type (16 aces.) and early maturing (20 aces.) and high yielding (20 aces.) mungbean was complied.

PGR/GEV-BUR-JOD-01.00: Augmentation, characterization, evaluation, maintenance, regeneration, conservation, documentation and distribution of genetic resources in arid and semi-arid regions (NK Dwivedi)

Research Projects (Code, Title, PI, CoPls)

PGRI GEV-BUR-JOD-01.01: Augmentation, characterization, evaluation, maintenance, regeneration, conservation, documentation and distribution of genetic resources of cereals, pearlmillet, minor millets and horticultural crops (Gopala Krishnan S, NK Dwivedi)

PGRI GEV-BUR-JOD-Ol.02: Augmentation, characterization, evaluation, maintenance, regeneration, conservation, documentation and distribution of genetic resources of legumes and oilseeds. (NK Dwivedi, Gopala Krishnan S)

PGRI GEV-BUR-JOD-01.03: Augmentation, characterization, evaluation, maintenance, regeneration, conservation, documentation and distribution of genetic resources of fodder, forage, fuel, medicinal and aromatic and other economic plants. (NK Dwivedi, Gopala Krishnan S)

Externally Funded Projects

Collection, assembly and conservation of genetic resources of physic nut (Jatropha curcas Linn.) (DBT) (N K Dwivedi)

Biosystematics of the Genera Vigna, Cucumis and Abelmoschus (NAIP) (Gopala Krishnan, S)

Bioprospecting of genes and allele mining for abiotic stress tolerance (NAIP) (Gopala Krishnan, S)

124 - __________________________ _ ANNUALREPORT2009 10

14. EXPLORATION BASE CENTRE, RANCHI

Summary: During the period under report, four explorations were undertaken and 322 samples of different agri-horticultural crops including the wild relatives and wild economic types were collected. A total of 362 accessions of kulthi and 38 of Mucuna germplasm were characterised for qualitative and quantitative traits. Medicinal and aromatic plants (160 species) and 180 accessions of Jatropha curcas germplasm collected from different states of India are being maintained at National Ja.ropha Garden at the farm of Ranchi.

National Bureau of Plant Genetic Resources, Base Centre, Ranchi is located at latitude 23°N and longitude 85°E and in the tribal belt of Chotanagpur plateau. It has an altitude of about 625 m above the mean sea level. The average rainfall is about 1300 nun. The region is endowed with rich agro-ecological diversity superimposed with tribal and ethnic diversity of very primitive order. The region is well known for its immensely rich primitive crop plant diversity including wild related species of many crop plants. The agriculture is most traditional. The spread of improved technology by the Government Department! State Agriculture Universities imposed the danger to landraces and wild rebtives in the region. The primary responsibility of this station is exploration, collection, evaluation, maintenance of plant diversity in Bihar, Iharkhand and adjoining areas.

14.1 Exploration and Collection of Germplasm

A total of four explorations were undertaken in different crops. First exploration for tuber crops was undertaken in collaboration with Central Tuber Crops Research Institute, Trivandrum and 82 samples of tuber crops (Amorphophallus paeoniifolius sub sp campanulatus (12), Dioscorea alata (20), Colocasia esculenta (23), Alocasia macrorrhiza (13), Xanthosoma sagittifolium (03), Zingiber officinale (01), Xanthosoma violaceum WI), Curcuma Zanga (03), Urginea indica (01), Dioscorea bulbifera (02), Caladium sp.(OI), Ipomoea batatas (02) were collected

Second exploration for banana germplasm was undertaken in collaboration with NRCB, Trichy, Tamilnadu. 24 banana germplasm were collected from the areas of Patna, Vaishali, Khagaria, Begusarai, Supol, Madhubani, Sitamarhi, Samastipur, Muzaffarpur, Darbhanga, districts of Bihar. JBT 491RN17 was unique collection ofkotia type. It had waxy type peel and locally known as Dhudhia. The notable collections were Robusta, Kottia-mottia, Singapuri, On-Pon Muttia, Barhori, Bagner Kela, Manaki, Dhudhmuga The cultivar Dhudhmuga is very tasty to eat as told by owner of genotype. The Manaki is reported to be of superior eating quality with resistance to diseases and also aroma on ripening. One wild type IBT 49/RN/16 (Musa bulbisiana) was observed and collected.

Third and fourth explorations were conducted for the collection of medicinal and aromatic plants. The third exploration was undertaken in the areas of Ranchi,

Ramgarh, Khunti, Giridih, Hazaribagh districts of Iharkhand and 127 samples were collected. The fourth exploration was carried in the areas of Ranchi, Khunti, Ramgarh, Giridih, Koderma, Deoghar, Dhanbad, Bokaro districts of Iharkhand. 89 collections were made. The explorations were carried out mainly for the collection of medicinal and aromatic plants and to record the Indigenous Traditional Knowledge associated with them. The details of combined collections are as follows:

S.N. Germplasm Samples

1. Abutilon indicum 1 2. Asparagus racemosus 15

3. Atropa belladonna 1 4. Acorus calamus 2

5. Acacia catechu 1 6. Artemisia scoparia 1 7. Abrus precatorius 3 8. Aerua lantana 1 9. Andrographis echioides 1 10. Argyreia nervosa 1 11. Atylosia scarabaeoides 2 12. Ardisia sp. 1 13. Antidesma sp. 1

. 14. Abelmoschus sp . 3 15. Andrographis paniculata 1 16. Acacia sp. 1 17. Aristolochia sp. 1 18. Bauhinia vahlii 1

19. Clerodendron sp. 1

20. Bhim tulsi 1

21. Boswellia serrata 2

22. Bryonopsis laciniosa 1 23. Bixa orellana 1

24. Coftea arabica 1

25. Colchicum luteum 1

26. Cleome sp. 1

XPl ORA..flON BASE CENTRE, RANCHl ________ _ 125

27. Cassia sp. 28'. Crescentia cujete 29. Clerodendron serra tum 30. Cymbopogon sp. 31. Celastrus paniculatus 32. Cassine glauca 33. Chlorophytum sp. 34. Carissa carandas 35. Curcuma angustifolia 36. Curcuma amada 37. Curcuma caesia 38. Curcuma sp 39. Cissampelos pareira 40. Clitoria tematea 41. Curculigo orchioides 42. Chlorophytum arundinaceum 43. Cymbopogon citronella 44. Cymbopogon martini 45. Costus speciosus 46. Pholidota 47. Plumbago zeylanica 48. Paederia foetida 49. Persuta 50. Pandanus sp. 51- Rauvolfia serpentina 52. Randia dumetorum 53. Rauvolfia tetraphylla 54. Raid pushpi 55. Sonchus sp. 56. Solanum xanthocarpum 57. Sida cordifolia 58. Semecarpus anacardium 59. Smilax zeylanica 60. Smilax sp 61. Smilax macrophylla 62. Sapindus mukorossi 63. Sterculia sp. 64. Cucumis sp. 65. Coleus amboinicus 66. Cyperus scariosus 67. Charpundha 68. Desmodium sp. 69. Dioscorea pentaphylla 70. Dioscorea sp. 71. Diospyros sp. 72. Doodhi grass 73. EClipta alba 74. Evolvulus alsinoides 75. Evolvulus nummularius 76. Flamingia nana 77. Gymnema sylvestre 78. Grewia hirsuta 79. Ailanthus excelsa 80. Synadenium grantii 81. Holarrhena antidysenterica 82. Hemidesmus indicus 83. Hyptis suaveolens 84. Hygrophi/a auriculata 85. Helicteres isora 86. Hedychium spicatum

126 ____ _

2 1 1 2 4 1 2 3 1 1 1 6 3 2 11 2 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 4 3 1 1 1 3 1 1 1 1 2 1 3 2 1 2 2 1 3 1 1 1 1 3 2 1 1 2 1

87. Hemidesmus sp. 2 88. Ipomoea quamoclit 1 89. Indian cinchonna 1 90. Kaemferia galanga 1 91. Buettnaria herbacea 1 92. Leea macrophylla 1 93. Liver plant 2 94. Lygodium flexuosum 3 95. Luffa sp. 2 96. Abelmoschus moschatus 1 97. Momordica sp. 2 98. Mucuna pruriens 1 99. Masjod 2 100. Matha 1 101. Vernonia anthelmintica 1 102. Ocimum sp. 2 103. Premna herbacea 1 104. Pueraria tuberosa 1 105. Piper longum 2 106. Putranjiva roxburghii 1 107. Pedilanlhes tithymaloides 1 118. Plumeria acutifolia 1 109. Strychnos nuxvomica 1 110. Sphaeranthus indicus 3 111. Tinospora cordifolia 8 112. Tylophora asthmatica 1 113. Trichosanthes palmata 1 114. Flemingia prostrata 1 115. Plectranthus sp. 1 116. Thespesia lamp us 3 117. Urginea indica 1 118. Uraria sp. 2 119. Ventilago calyculata 3 120. Vanda sp. 1 121. Vanda tesselata 1 122. Vetiveria zizanoides 1 123. Vernonia sp. 1 124. Withania somnifera 2 125. Terminalia chebula 1

14.2 Evaluation of Germplasm

14.2.1 Kulthi germplasm: Characterization and multiplication of Kulthi germplasm-362 accessions of kulthi germplasm were evaluated in augmented design with 15 blocks. Four rows of 5 metre length were used for each accession. Two checks Madhu and Birsa Kulthi-1 (BK1) were used in the experiment. The spacing between rows (30cm) and between plants (lOcm) was kept. The observations on 10 plants of each accession were recorded and average was taken. The observation on primary branches per plants, days to 50% flowering. pods/plant, pod length (cm), plant height (cm), no. of seeds/pod, yield/plant (g), 100 seed weight (g), growth habit, growth pattern, leaf colour, leaf surface, pod shape. pod surface and seed colour were recorded. The data was analyzed for quantitative traits. (Table-I)

14.2.2 Mucuna Germplasm: 38 accessions of Mucuna gennplasm were evaluated in RBD with two replications. Each accession had one row of five metres length. The spacing was lxlm. The observations were recorded on plant height, leaflet shape, odd leaflet length, odd leaflet width, days to flower initiation, inflorescence length, no. t f inflorescence per plant, flower per inflorescence, tlower colour, number of pods per cluster, number of pod cluster per plant, pod pubescence intensity, pod pubescence colour, pod shape, pod length, pod width. Some entries are late maturing so data could not be analyzed.

14.3 Germplasm Maintenance in Field Gene Bank

The germ plasm of fruit crops, minor fruit crops and medicinal and aromatic crops are being maintained in the field gene bank -

(A). Fruit crops

Artocarpus 154 Artocarpus 14 heterophyllus lakoocha (Barhal) (Jackfruit)

Tamarindus indicus 51 Musa sp. 36 (Tamarind)

Mangifera indica 19 (Mango)

(B) Economically important crops, medicinal and aromatic plants-

Botanical Name No. , Abelmoschus moschatus (Jangli bhindi) 1 Abroma augusta (Ulat kambal) 3 Abrus precatorius (Ratti) 5 Abutilon indicum (Kanghi) Acacia nilotica (Babool) Acacia concinna (Shikakai) 2 Achyranthes aspera (Chirchiri) 1 Acorus calamus (Ghora bach) 3 Adhatoda vasica (Vasak) Adiantum capillus-veneris (Hansraj) Aegle marmelos (Bael) 53 Agave americana (Konga) Albizzia procera (Safed Siris) Allium hookeri (Jangli lahsoon) 1 Aloe vera (Ghritkumari) 3 Alpinia galanga (Kulanjan) 2 Alstonia scholaris (Chhatni) 1 Androgaphis paniculata (Kalmegh) 7 Aristolochia ringens (Duck flower) Aristolochia indica (Ishar mool) Artemisia scoparia (Dona)

E Pl ORATIOl"ll BASBCENTRE. RANCHl ____ _

Artimisia annua (Davna) 4 Asparagus racemosus (Satawar) 14 Atropa belladonna (Belladonna) Atylosia scarabaeoides (Ban kulthi) 2 Azadirachta indica (Neem) 4 Bacopa monniera (Brahmi) 1 Barferia prionotis (Kata karanj) 2 Bauhinia purpurea (Kachnar) 2 Bauhinia sp. 2 Boerhaavia diffusa (Punarnava) 1 Bombax ceiba (Semal) 1 Bryonopsis laciniosa (Shivlingi) Bryophyllum sp. (Patharchitta) Buchanania lanzan (Piyar) 6 Bulbophyllum sp. (Patthar kela) 2 Butea monosperma (Palash) 3 Caesalpinia crista (Gargaria) 3 Cardiospermum halicacabum (Balloon vine) Callicarpa macrophylla (Budd hi ghassic/ Bundudn) Calotropis procera (Akwan) Canavalia ensiformis (Bara sem) Canna indica (Keli) 2 Carissa carandas (Karonda) Cassia alata (Ringworm senna) Cassia angustifolia (Senna) Cassia fistula (Amaltas) 2 Cassia occidentalis (Bara chakor) Cassia sophera (Kasaunda) 2 Cassia tora (Chakor) 1 Catharanthus roseus (Sadabahar) 5 Cissampelos pareira (Pitusingh) Celastrus paniculatus (Kujari) 3 Celosia cristata (Murgaphool) Centella asiatica (Beng saag) Chlorophytum sp.(Safed musali) 14 Cinnamomum tamala (Tejpat) Cinnamomum zeylanica (Dalchini) 2 Cissus quadrangularis (Harjor) 1 Clerodendron indicum (Bharangi) 1 Clerodendron infortunatum (Ghato) Clerodendron serratum (Barangi) Clitoria ternatea (Aparajita) 3 Coix lachyrma jobi (Vaijayanti) Colchicum futeum (Hirantutuya) Coleus amboinicus (Pattharchur) 2 Commiphora wightii (Guggul) 1 Costus speciosus (Kewa kand) 9 Curculigo orchioides (Kali musali) 10 Curcuma amada (Aam aadi) 1 Curcuma angustifolia (Tikhur) Curcuma aromatica 1

Curcuma caesia (Nil kanth) 2 Curcuma sp. 13 Cymbopogon martinii (Palma rosa) 2 Cymbopogon winterianus (Citronella java)

127

Cymbopogon flexuosus (Lemon grass) 3 Pentapetes phoenicea (Oopahariya) Cyperus scariosus (Nagar motha) 1 Phyllanthus amarus (Bhui aonla) Dalbergia sissoo (Shisham) 1 Phyllanthus niruri (Bhui aonla) 1 Datura metel (Ohatura) 4 Physalis ixocarpa (Bada makoi) 1 Desmodium gangeticum (Salparni) 2 Piper longum (Pippali) 2 Dioscorea pentaphylla (Saru) Plumbago zeylanica (Chitrak) 3 Dioscorea sp. 15 Pongamia pinnata (Karanj) 2 Diospyros tomentosa (Kend) 1 Portulaca oleracea (Kulfa) Eclipta alba (Bhrinraj) 1 Premna herbacea (Bhui jamun) Elephantopus scaber (Bara jari) 1 Psora lea corylifolia (Babchi) Emblica officina lis (Aonla) 19 Pterospermum acerifolium (Makchund) Entada scandens (Jangli Imli) 1 Pueraria tuberosa (Patal kumhra) Euphorbia nerifolia (Sij) 1 Putranjiva roxburghii (Pitonji)

Lawsonia inermis (Mehandi) 25 Randia dumetorum (Portoho)

Erythrina indica (Oadapl Mandra) Rauvolfia serpentina (Sarpgandha) 4 Euphorbia hirta (Ooodhi) Rauvolfia tetraphylla (Nag bel) 2

Ficus benghalensis (8argad) 1 Ruta graveolens (Sitav) 1 Ficus religiosa (Peepal) 1 Santalum album (Chandan)

Glycosmis pentaphylla (Ban Nimbu) 2 Sapindus mukorossi (Ritha) 1

Gmelina arborea (Gamhar) 4 Schleichera oleosa (Kusum) 1

Grewia hirsuta (Kukurbicha) 1 Scoparia dulcis (Hazardana) 1

Gymnema sylvestre (Gurmar) 3 Semecarpus anacardium (Bhelwa) 2

Heydichium spicatum (Kapoor kachari) Sense viera sp. 1

Helicteres isora (Marorphali) Sesbania grandiflora (August phool) 1

Hemidesmus indicus (Anantmool) Sida acutifolia (Bariyar)

Hibiscus pungens (Pat saag) 1 Smilax sp. (Ramdatun) 4

Holarrhena antidysenterica (Kurchi/Oudhi) 1 Shorea robusta (Sakhua) 1

Hygrophila auriculata (Gokhala kanta) 1 Solanum khasianum / Solanum viarum

Indigofera tinctoria (Nil) 2 (Jangli baingan)

Syzygium cuminii (Jamun) 46 Solanum nigrum (Makoi)

Kaempferia galanga (Chandramula) 1 Solanum torvum (Kutumba) 2

Lagerstroemia speciosa (Jarul) 2 Solanum xanthocarpum (Katrangni) 1 Sphaeranthus indicus (Gorakhmundi) Leea macrophylla (Haathi kaan) Spilanthes paniculata (Bada Akarkara) Leucas aspera (Guma) Spondias mangifera (Amda) Lily sp. Sterculia urens (Teley)

Litsaea polyantha (Pojo) 1 Stevia sp. (Chinisakam)

Lygodium flexuosum (Mahadev jat) 2 Tectona grandis (Sagwan) 9 Madhuca indica (Mahua) Tephrosia purpurea (Sarpunkha) 1

Martynia diandra (Baghnakhi) Terminalia arjuna (Arjun) 6

Melia azedarach (Bakain) Terminalia bellerica (Bahera) 5

Mentha arvensis (Pudina) 1 Terminalia catappa (Oeshi Badam) 2 Mimosa pudica (Lajwanti) 1 Terminalia chebula (Harra) 3 Mirabilis jalapa (Sandhya malti) 4 Terminalia tomentosa (Asan) 1 Momordica dioica (Kheksa) 1 Thespesia lampus (Ban kapas) 2 MOringa oleifera (Sahjan) 11 Tinospora cordifolia (Giloy) 4 Mucuna pruriens (KewanchlAlkushi) 38 Tridex procumbens 1 Murraya koenigii (Kari pata) 2 Typhonium trilobatum (Nirvisha) 3 Leonotis nepataefolia (Hejurchei) 1 Urginea indica (Ban piyaj) 3 Nyctanthes arbor-tristis (Harshingar) 2 Vanda tessel/ata (Rasna jari) 2 Ocimum basilicum ( BanTulsi) 2 Vitex negundo (Senduar) Ocimum sanctum (Tulsi) Vitis sp. (Jangli angoor) Ocimum kilimandscharicum (Kapoor Tulsi) Withania somnifera (Ashwagandha) 4 Oroxylum indicum (SonachaIlSonpatti) 3 Woodfordia fruticosa (Ohatki) Pachyrrhizus angulatus (Misrikand) Zingiber sp. (Wild ginger) 10 Paederia foetida (Gandhali) Flemingia nana (Bir but) 1 Pandanus amaryllifolius (Basmati) Gloriosa superba (Kalihari) 2

128 ---- _ ANNUALREPORT2009 1

Research Programme (code: Title, Leader)

PGR/PGC-BUR-RAN-01.00-Augmentation, characterization, evaluation, maintenance, regeneration, conservation, documentation and distribution of genetic resources in Bihar, Jharkhand and adjoining areas. (JB Tomar)

Research Projects (Code, TItle, PI, CoPls)

PGR/PGC-BUR-RAN-01.01- Augmentation, characterization, evaluation, maintenance, regeneration, conservation and documentation of genetic resources of agriculture crops, their wild relatives and economic species including medicinal plants (JB Tomar)

PGR/PGC-BUR-RAN-01.02Augmentation, characterization, evaluation, maintenance, regeneration, conservation and documentation of genetic resources of horticultural crops& perennial medicine (JB Tomar)

Externally Funded Project

• Genetic Improvement of Jatropha curcas for adaptability and oil yield (NMITLI)

• Establishment and maintenance of herbal garden and capacity building in the production about the medicinal plants of Jharkhand and adjoining areas. (JB Tomar)

• Bio-survey, Inventorisation & Conservation of endangered, threatened and rare Medicinal and Aromatic Plants (MAPS) and Associated Indigenous Traditional Knowledge (ITK) in Tribal Region of Jharkhand. (Funded by DADO) (JB Tomar)

·\PI ()R \IION BASI.: CENTRE, RA ~CHI 129

\ 15. REGIONAL STATION, SHILLONG

Summary: One crop-specific exploration was undertaken and 110 accessions including land races and primitive cultivars of rice germ plasm were collected from remote areas of Champhai and Lunglei Districts of Mizoram. A total of 68 germplasm of paddy (50), chilli (10) and okra (08) were received and as many as 40 accessions of paddy (10), maize (10) and colocasia (20) were distributed to different indenters.

15.1 Exploration and Collection of Germplasm

A total of 110 accessions of rice gennplasm were collected from remote areas of Champhai and Lunglei Dists. of Mizoram during 3111012009 to 1111112009. Champui, popularly known as rice bowl of Mizoram, it was observed that under Jhum cultivation no fertilizer was used. Farmers normally not reported any disease or insect pests on paddy crop. Some of the selections made by farmers were also collected which were mainly for bold seed and early duration. It was also communicated by farmers that short duration rice is having less taste and aroma.

15.2 Germplasm Evaluation

15.2.1 Germplasm characterization, regeneration and seed multiplication: The germplasm accessions collected from NEH Region were grown at Shillong for characterization, regeneration and multiplication during the report. (field crops: maize, paddy (low land & upland), horticultural crops: chilli, turmeric, ginger, colocasia, dioscorea and fruit crops, oil seed crops: mustard, perilla; UU & UEP crops: buck wheat, coix, rice bean; (Tables 1-4 ).

Table 1: Germplasm characterization

S.No. Crop No. of Acc. Checks Used

Field crops

1 Maize 154 10 checks (C1-Local RCM-1-3, C2- Local Him, C3- Local Parwat, C4- Local RIM-1, C5 Local Navjot, C6 -Local red, C7- Local yellow, C8- local white, C9- Local Delhi check & C10- Local HIC)

2 Paddy (low land) 171 5 checks (C1- Manipuri, C2-Prasad, C3-Sarsha, C4-Gnoba, C5-Kalajoha) 3 Paddy (upland) 129 5 checks (C1- Manipuri, C2-Prasad, C3-Sarsha, C4-Gnoba, C5-Kal;&ohc&

Horticultural crops

4 Turmeric 137 3 checks (Shillong local, IC023437,IC420402)

UU & UEP crops

5 Buck wheat 85 6 checks (Akabra, Kuppa, Sabrosh, Phesru, Reshuwat, Kulugang) 6 Coix 54 4 checks (C1-Mayeun, C2-Pollin, C3-Local Check-1 IC089382 &

local check-2 IC524631)

Table 2: Multiplication! Seed Increase! regeneration for Medium Term Storage (MTS)! long Term Storage (l TS) in NGB

S.No. Crop No. of Acc. Date of sowing I Date of sowing I transplanting transplanting

Field crops

Paddy 50 05/06/09 06/11/09 Horticultural crops

Colocasia 38 25/04/09 --Dioscorea 46 23/04/09 --Ginger 112 15/04/09 --Turmeric 137 15/04/09 --Chilli 64 15/03/09 & 03/06/09 05/10109

Oil seed crops

Mustard 36 04/12/09 --Perilla 87 20105/09 --

UU & UEP crops

Rice bean 85 22/07/09 05/12109

130 _____________________ ANNUALREPORT2009 10

Table 3: Promising accessions identified in various crops

S.No. Crop Main attributes Accessions identified for specific/desired traits

1. Maize Checks: C1-Local RCM-1-3, No. of cobs/plant (>2) IC538973 (3.2), IC557480 (2.6), IC557490-A (2.0) C2- Local Him, C3- Local Plant height (cm) (>395) IC557454 (397), IC447196 (395) Parwat, C4- Local RIM-1, Tussel length (cm) (>53) IC526750 (53.8), IC545347 (53.6), IC527215 (53.4) C5 Local Navjot, C6 -Local No. of seeds per kernel IC557455 (44.2), IC557445-C (39.4), IC557461 (38) red, C7- Local yellow, C8- rows (>38) local white, C9- Local Delhi check & C10- Local HIC

2. Paddy (low land) Checks: C1- Manipuri, Plant height (cm) (> 150 ) EC3178894-1 (152.8), EC317888 2-2 (151.8), C2-Prasad, C3-Sarsha, EC317891 3-1 (151.6) , EC317871 3-2 (150.52), C4-Gnoba, C5-Kalajoha EC317891 2-1 (150.5)

Panicle length (cm) (>31 ) EC317888 3-1 (34.36), IC558268 (32.24), IC558314 (32.08), IC558277 (31.6)

Total seed / panicle (>53 ) IC558277 (58.04), EC317889 4-1 (54.8), EC317888 1-1 (53.8), EC317888 3-2 (53.24)

3. Paddy (upland) Checks: C1- Manipuri, Plant height (cm) (>150 ) IC539001 (161.4), IC526552 (156.6) C2-Prasad, C3-Sarsha, Panicle branch (> 15) IC540240 (17.4), IC540205 (15.8), IC540212 (15.6) C4-Gnoba, C5-Kalajoha Total seed / panical (>220) IC540209 (252), IC560771 (245), IC560759 (221)

100 grain weight (g) (>50) IC540240 (57), IC447220 (56) 4. Turmeric

Checks: Shillong local, Plant height (cm) (>50) IC420440 (66.30), IC212577 (51.60) IC023437, IC420402 Number of carmel (> 8 ) IC211435 (8.3), IC211420 (8), IC211400 (8),

IC394936 (8) Carmel length (cm) (>10) IC540383 (10.30), IC521330 (10.30),

IC330435 (10.20), IC319341 (10) Carmel dia. (cm) (> 2.6) IC221592 (2.76), IC212577 (2.68),

IC521526 (2.63), IC521527 (2.63) Carmel weight (g) (>840) IC545212 (1070), IC545139 ( 880),

IC006071 (840) 5. Buck wheat

Checks: Akabra, Kuppa, Days to 50% flowering Sabrosh, Phesru, No. of primary i branches Reshuwat, Kulugang No. of primary branches

Plant height (cm) Days to 80% maturity 100 seed weight (g)

6. Coix Checks: C1-Mayeun, Plant height (cm) (>365) IC089391 (380), IC204184 (368), IC089394(368) C2-Pollin, C3-Local Leaf length (cm) (>84) IC089384 (84.80), IC334314 (84.62), IC089387 Check-1 IC089382 & local (84.60), IC012703 (84.30) check-2 IC524631 Leaf width (cm) (>6) IC012703 (6.10)

100 Seed weight (g) (>B.5) IC540267 (9.92), IC540244 (B.77), IC5401B1 (B.55)

Table 4: Range, mean and coefficient of variation in various crops

Crop Character Range Mean PCV"!o . Min Max

Maize No. of cobs/plant 1.0 3.2 1.1 4.81 Plant height (cm) 152 397 304.06 3.63 Tussel length (cm) 20.4 53.8 43.95 3.59 No. of seeds per kernel rows 11 44.2 26.82 4.90

Paddy (lOW land) Plant height (cm) 57.40 152.80 108.77 4.40 Panicle length (cm) 17.32 34.36 25.69 3.33 Total seed / panical 9.84 5B.04 33.20 5.31

RHiIONALSTATION, SHILLONG 131

Paddy (upland) Plant height (em) 77.40 161.40 120.70 3.94 \ Panicle branch 6.80 17.40 11.15 4.18

Total seed / panicle 41.20 252 168.51 4.02 100 grain weight (g) 0.13 0.057 0.03 5.17

Plant height (cm) (>130.?3) 10.60 66.30 28.71 6.14 Number of carmel 3 8.3 5.21 0.74

Turmeric

Carmel length (cm) 4.7 10.3 7.56 0.72 Carmel dia. (cm) 1.2 2.76 1.90 0.17 Carmel weight (g) 126.6 1070 379.47 108.52

Buck wheat Days to 50% flowering 30 42 34.70 8.38 No. of primary branches 1.33 5.33 3.08 25.58 Plant height (cm) 35.67 119.33 89.34 17.23 Days to 80% maturity 62 79 67.78 7.98 100 seed weight (g) 1.20 3.04 2.45 18.26

Coix Plant height (cm) 189 380 288.54 14.84 Leaf length (cm) 61.36 84.80 73.86 7.32 Leaf width (cm) 4.0 6.10 4.63 8.21 100 Seed weight (g) 4.64 9.92 6.60 15.84

15.3 Management and Maintenance of Horticultural Germplasm

15.3.1 Conservation and maintenance: Nursery and green house management and Field Gene Bank maintenance of 440 acc. of horticultural crops ( fruit crops 92, rhizomatus & others 248, vegetables 64 and M & AP 36) were done.

15.4 Germplasm Conservation

A total of 1025 accessions of freshly harvested (different orthodox seed crops) seed material have been maintained in Gene Bank of NBPGR, Regional Station Shillong as active collection. This includes low land paddy (171), upland paddy (129), regenerated paddy (50), collected paddy during 2009(110), maize (154), coix (54), perilla (87), rice bean (85), buck wheat (85), chilli (64) and mustard (36).

15.4.1 Germplasm Supply: Germplasm of paddy (10) and maize (10) to NRC Groundnut, Junagarh and colocasia (20) to TCCV NBPGR, New Delhi were supplied.

Research Programme (Programme Code: Title, Leader)

PGRJPGC-SHL-01.00 : Augmentation, characterization, evaluation, maintenance, regeneration, conservation, documentation and distribution of plant genetic resources in north-eastern India. (S K Verma)

Research Projects (Code, Title, PI, CoPls and Associates)

PGR/PGC-SHL-01.01: Augmentation, characterization, evaluation, maintenance, regeneration, conservation and documentation of genetic resources of agricultural crops, their wild relatives, plants of economic importance and underutilized crops under AICRP. (AK Misra, SK Verma, SK Singh)

PGRJPGC-BHO-01.02: Augmentation, characterization, evaluation, maintenance, regeneration, conservation and documentation of genetic resources of horticultural crops (chilli, ginger, turmeric, yams, taros, Citrus, banana and passion fruit) and their wild relatives. (SK Verma, A K Misra, M Goswami)

132 __________ ANNUAL REPORT 2009 I

16. REGIONAL STATION, SHIMLA

summary: Two explorations were undertaken and 234 germplasm accessions were collected from Solan, Shimla, Bilaspur, Mandi, Kangra, Sirmour, Kinnour and Hamirpur areas of Himachal Pradesh. The germplasm diversity collected represents­cereals (4), pseudocereals (61), pulses (38) and seed spices (131). A total of 2070 accessions of kidney bean (747), pea (146), cowpea (227), amaranth (427), buckwheat (121), chenopod (25), adzuki bean (25), rice bean (50), garlic (243) and ruit crops (59) were characterized and evaluated for various qualitative and quantitative characters. A total of 10,377 germplasm

accessions of seed crops are being maintained in the MTS Shimla while 1,175 accessions of perennial and vegetative propagated crops have been conserved in the field gene bank. One hundred fifty six herbarium specimens were prepared and deposited at national Herbarium of Cultivated Plants. Germplasm accessions of agricultural crops (629) and horticultural

crops (84) were supplied to various indenters.

The station has major responsibility for the conservation and management of plant genetic resources of Western Himalayan region particularly the state of Himachal Pradesh. The germplasm of temperate fruits viz. apple, pear, peach, apricot, plum, walnut, almond, pecan nut, Rubus, Ribes, kiwi, minor fruits, medicinal and aromatic plants is m'lintained in the field gene bank while germplasm of seed crops like french bean, amaranth, buckwheat, chenopod, adzuki bean, cowpea, pea and rice bean is being maintained in MTS, This station has been designated as one of the active germplasm sites for pesudocereals and temperate fruits.

16.1 Germplasm Augmentation

Two crop specific explorations were undertaken and 234 germplasm accessions were collected from various parts of Solan, Shimla, Bilaspur, Mandi, Kangra, Sirmour, Kmnour and Hamirpur districts of Himachal Pradesh (Table 1). The crops diversity collected from different regions represent Oryza sativa (4), Amaranthus hypochondriacus (18), A. caudatus (4), A. hybridus (5 ), A. virdis (4), A. tricolor (3), A. retrojlexus (2), A. spmosus (2), Fagopyrum esculentum (2), F tataricum ( 1), F cymosum (2), F gigantium (1), Chenopodium

I

album (5) C. botrys (2), Phaseolus vulgaris (38), Lepidium sativum (5), Coriandrum sativum (45), Trigonella foenum-grecum (30), Trigonella comiculata (3), Trachyspermum ammi (3), Brassica nigra (4), Anethum graveolens (39), and Vernonia anthhelmintica (2).

Table 1: Germplasm exploration undertaken

Crops Collected

Coriander, Methi and Sowa

Amaranth, buckwheat, chenopod and french bean

Area explored Accs.

Solan, Shimla, 131 Bilaspur, Mandi, Hamirpur & Kangra

Shimla, Sirmour 103 and Kinnaur

R(,CJIONALSTATION. SHIMLA

Genetic variability was collected for plant type, inflorescence colour, shape and size in grain amaranth while for pod length, seed shape, size and colour in french bean. The genetic resources of minor cereals such amaranth, buckwheat, chenopod, finger millet are being eroded at much faster rate because of cash crops and the boom of hybrid varieties, An accession having red foliage which is uncommon in case of Amaranthus hypochondriacus was collected from Sirmour (Fig.l). The rate of genetic erosion was found more pronounced in buckwheat, chenopod and finger millet as it is cultivated in very limited pockets and if the present scenario continues, the crops may go off-farms. The factors found responsible are more inclination of farmers towards cash crops, change in food habits, lack of assured market and most important is poor knowledge of farmers on the loss of agro-biodiversity and its consequences on food security. Nevertheless, there are some farmers who have realization and not only showed their concern but putting their best to conserve wide range of crops. On the other hand seed spices are grown as kitchen garden! backyard crops intercropped with onion and garlic in this region. Genetic variability was observed for seed characters and plant types.

133

\

Variability in seed size and colour in pomegrante Red foliage is uncommon in Amaranthus hypochondriacus and collecetd from Sirmour dist of HP

16.2 Germplasm Characterization and Evaluation

16.2.1 Agricultur&l crops: A total of 2011 gennplasm accessions comprising of different field crops were characterized and evaluated. All crops were evaluated in Augmented Block Design along with the standard checks as given below in Table 2.

Table 2: Germplasm of various field crops evaluated

Crop Accessions Checks

French bean 747 PLB 10-4, PLB 14-1, Baspa , Triloki, Jawala, Kailash

Amaranth 427 Annapurna, Durga, PRA-2, PRA-3

Buckwheat 121 Himpriya, VL-7, Shimla B1, PRB-1

Chenopod 25 IC415477, EC507741, PRC 9801, IC22503

Adzuki bean 25 HPU 51, Totru Local

Rice bean 50 PRR1, PRR2, RBL 1, RBL6

Pea 146 IC279125, DMR7, DMR11, Rachna, HFP4

Cowpea 227 Local check

Garlic 243 Godawari, Baswant, G41, G50, Parwati, Shimla local

Data were recorded as per the descriptors developed by NBPGR. The data recorded were analyzed for mean and range and promising accessions identified for important traits (Table 3). The evaluation data revealed wide range of variability in the gennplasm for yield and yield contributing traits.

May fire - a cultivar of Nectarine doing well in Shimla conditions

134

IC415477 - High yielding and early maturing accession of chenopod

ANNUALREPORT2009 1

Table 3: Range, mean and promising accessions identified for important traits

Character Range Mean Promising accessions

Amaranth

Plant height (em) 196387 -393-25 34.01 IC35601, IC35565, IC35564, IC35710, IC35523 Leaf length (em) 12.15-33.35 30.1 IC35783, IC35519, IC35517, IC355468, IC35432 Inflorescence 52.3-116.2 109 IC36832, IC35660, IC35653, IC35624, IC35618 length (cm) Days to maturity 126-171 133 IC42309, IC4231 0-1 , IC42315, IC42327, IC42339 1000 seed weight (g) 0.5-1.0 0.95 IC42309, IC42337, IC35429, IC35432, IC35626 Grain yield/plant (g) 40.23-243.48 170.49 IC35520-1, IC35525, IC35518, IC35535, IC35542

Chenopod

Plant height (cm) 199.25-333.45 213.8 IC107263, IC107535, IC106340, IC107296, NC58231 Inflorescence 34.25-54.5 48.3 IC108818, IC10a088, IC106340, IC107535, EC507740 length (em) Leaf length (em) 7.8-15.75 13.05 IC329494, IC341695, IC341705, IC10a088, IC108816 Leaf width (cm) 3.1-19.7 14.15 IC107185, IC107296, IC107263, IC341705, IC107535 Days to maturity 101-156 106 IC415477, EC507748, EC507742, EC507740 1000 seed weight (g) 0.4-1.65 1.50 EC507748, IC415477, EC507744, EC507740 Grain yield/plant (g) 10.62-44.37 31.06 IC108816, IC329494, IC106340, IC107185

Buckwheat

Plant height (em) 55.11-235.8 204.1 EC288737, EC274442, EC125937, EC18864, IC204082 Leaf length (em) 3.6-11.2 9.15 IC37309, EC216635, IC108510, EC104485 Leaf width (em) 4.2-11.3 9.2 EC278739, EC216635, EC104485, IC107631, IC49680 No. of Infl./plant 12.5-50 37 IC49666, IC107291 , IC24300, IC107631 Days to maturity 75-114 79 IC16552, IC24300, IC24301, IC26583, IC 18870-1 1000 seed weight (g) 12-40 36 IC37309, EC216635, EC125940, EC323723 Grain yield/plant (g) 9.10-36.18 25.95 IC109729, IC109728, IC202268, IC204089

Adzuki bean

Plant height (cm) 56.7-88.2 76 EC030270, EC340246, EC340249, EC57959 No. of cluster/plant 8.5-12.3 11 EC000251 , EC018151, EC340260, IC341948 No. of pods/cluster 1.0-4.0 i 3 EC015256, EC340249, IC341948, EC024523 No. of pod/plant 17.0-32.0 31 EC000251, EC015256, IC341948, ECOOO377 Days to maturity 102.0-119.0 103 EC000377, EC015256, EC024523, EC030256 1000 seed weight (g) 7.16-12.63 11.34 EC000251 , EC340258, IC341939, IC341946

French bean

Pod length (em) 9.2-18.7 17.95 EC589468, EC537995, EC537972, EC537967 No. of seeds/pod 3.5-7.5 6.5 EC500395, EC572772, EC500547, EC500226 No. of pod/plant 7.5-41 36 EC590326, EC537971, EC530929, EC530910 Leaflet length (em) 8.4-17.35 15.7 EC537967, EC531448, EC500547, IC381 082 Leaflet width (em) 7.5-15.25 11.05 EC531148, EC500263, IC381082, IC530907 100 seed weight (g) 10-70 50.60 EC589468, EC500892, EC500941, IC405509

Pea

Pod length (em) 4.2-8.58 70 IC278261, IC296678, IC418020, IC469147 No. of pods 7.5-59 46.5 EC394028, IC469145, IC469150, IC394039 No. of seeds/pod 4-7.5 7 IC394018, IC381 054, IC469137, IC398817 100-seed wt. (g) 5.56-29.32 17.74 IC469135, IC398816, IC208399, IC310833 Day to maturity 153-187 160 IC397028, IC396802, IC396777, IC208378

Grain yield/plant (g) 12.49-90.12 66 IC396743, IC398604, IC267151, IC334160-1

There were few accessions which were found superior for multiple traits (Table 4).

RH I()~AL STATION, SHIMLA 13:;

Tab,le 4: Promising accessions for multiple traits

Crop Accession

Amaranth IC27821, IC35369, IC35432, IC35426, IC35429, IC35468, IC35532

Buckwheat EC216635, IC49666, IC109438, IC24301, IC204089

French bean IC329154, IC381102, IC 405546, EC284247, EC500290, EC500682

Pea IC208387, IC218982, IC218985, IC278261, IC291541, IC299013

16.2.2 Horticultural crops: Fifty nine accessions of various fruit crops were characterized for different qualitative and quantitative characters. The data were analyzed for range, coefficient of variability (CV) and promising accessions identified. In peach maximum CV was found for fruit weight (60.92) followed by pulp to stone ratio (45.59), stone weight (40.23) and fruit width (31.71).Fruit weight ranged from 25.50 to 176.00g, fruit width 27.50 to 70.80, stone weight 2.65 to 8.60g, pulp to stone ratio 5.12 to 26.07 and TSS 10.10 to 16.10%. Promising accessions for high productivity were EC038376 (Nishiki), IC447934 and EC284453. In plum CV was highest for fruit weight (6l.64%), followed by fruit width (31.81 %) while days to fruit harvest ranged from 75 to 120 days. EC127176-A (Myrobalan Plum) was earliest (75 days) and EC538999 (Laetitia) showed late fruit maturity (120 days). Fruit weight ranged from 7.31 (ECI27176-B) to 79.60g (IC558084). Most of the accessions showed more than 15% TSS except

Screening of pea germplasm against powder mildew

Myrobalan plum and Prunus tomentosa. EC552694 (Black Amber) and EC552695 (Japan plum) were found promising for fruit productivity.

In walnut, high phenotypic CV was recorded for nut weight (32.05%) followed by kernel ratio (29.90%), and

136

Trait

Leaf length, inflorescence length, gain yield, 1000-seed weight

Leaf length, 1000-seed weight, cymes/plant, early maturity, grain yield

Grain yield, pod length, pods/plant, seeds/pod, early maturity

No. of cluster, pod length, pods/plant, seeds pod, grain yield

Evaluation of amaranth germ plasm

kernel weight (26.20%). Out of 16 walnut accessions, only two namely EC024562 and EC026591 showed soft shell and high productivity while EC024562 showed high kernel recovery (60.61 %). In pomegranate, highest phenotypic coefficient of variation was observed no. of female flowers/tree (88.70%) followed by no. of male flowers/tree (87.90%) and juice content (63.00%). The days to fruit maturity ranged from 91 to 131 days. The fruit weight ranged from 37.00 to 243.4 g and number of arils /fruit 94 to 406. The accessions viz. IC318706, IC318733, IC 318741, IC 318759 and IC318760 were found high yielding.

16.3 Germplasm Conservation

16.3.1 Germplasm supplied to National Genebank: Germplasm comprising 511 accession of different crops such as french bean (88), amaranth (270), buckwheat (60), chilies (14), meetha karela (18), Tomato (10), medicinal plants (15), and forage (50) were deposited for Long Term Storage in the NGB.

16.3.2 Germplasm conserved in the MTS facility: A total of 10377 germ plasm accessions of seed crops are being maintained in the MTS (Table5.)

ANNUAL REPORT 2()(l1.)-1(

Table 5: Germplasm accessions being maintained in the MTS

Crop Accs. Crop Accs. Crop Accs.

Amaranth 3086 Adzuki bean 155 Finger millet 410 Buckwheat 890 Cowpea 174 Foxtail millet 278 Chenopod 166 Meetha karela 42 Barnyard mi!let 71 French bean 3784 Cuphea 16 Proso millet 160 Rice bean 327 Pea 688 Horse gram 130 Total 10,377

16.3.3 Germplasm maintained in Field Gene Bank: 1175 accessions of perennial and vegetative propagated crops have been conserved in the field gene bank (Table 6 )

Table 6: Temperate fruit crops germplasm conserved in field gene bank

Crop Accs. Crop Accs. Crop Accs.

Apple 274 Pista 3 Viburnum 3 Peach 53 Chinese ber 3 Rubus spp. 20 Pear 99 Hops 6 Ribes 6 Plum 55 Citrus 4 Quince 8 Apricot 38 Pine-apple guava 2 Grape 14 Cherry 19 Fig 16 Mespilus spp. 4 Walnut 166 Strawberry 4 Mulberry 4 Hazelnut 20 Olive 6 Rose 47 Pecan nut 50 Passion fruit 2 Pomegranate 106 Almond 18 Crataeagus 6 M&AP 66 Kiwi 9 Chest nut 2 Other economic plants 32 Persimmon 13 Total 1,175

16.3.4 Conservation of wild relatives of crop plants: Wild relatives of various agri-horticultural crops species have been maintained both in the MTS facility for seed crops and in the FGB for perennial and vegetative propagated crops (Table 7.)

Table 7: Wild relatives of crop plants conserved

Crop

Amaranth

Buckwheat Chenopod French bean Faba bean Apple Pear Prunus

Walnut Kiwi Grapes amurensis, Pistachio nut Rubus spp.

Minor fruits wendlandii,

Allium Spp.

Wild relatives

Amaranthus hybridus, A. retrof/exus, A lividus, A viridis, A graecizans, A dubius, A. spinosus, and A. tricolor Fagopyrum emarginatum, F. cymosum, F. tataricum var. himalaicum and F. giganteum Chenopodium amaranticolor, C. bofrys, C. murale, and C. ambrosioides Phaseolus lunatus, and P. coccineus Vicia hirsuta, V. tetrasperma, V. vil/osa Malus baccata, M. spectabilis, M. micromalus, M. zumi, M. sargentii, M. sikkimensis Pyrus pyrifolia, P. pashia var. kumaoni, P. jacquemontiana, P. pashia Prunus nepaulensis, P. armeniaca, P. cerasoides, P. mira, P. mume, P. x pseudocerasus, P. cerasus, P. cornuta Juglans nigra, J. mandshurica, J. ailantifolia, J. cordiformis Actinidia arguta,Acal/osa Vitis ficifolia, V. arizonica, V. riparia, V. barlandierii, V. acerifolia, V. gerdiana, V. aestivalis, V. V. cinerea, Parthenocissus quinquefolia, P. himalayana Pista atlantica, P. terebinthus, P. chinensis ssp. Integerrima

. Rubus el/ipticus, R. niveus, R. paniculatus, R. lasiocarpus, R. fruticosus, R. macilentus, R. mol/ucanus, R. assamensis, R. nutans, R. calycinus Punica granatum, Cotoneaster. bacillaris, C. salicifolia, C. zabelli, C. franchettii, Crataegus C. melanocarpa, C. oxycantha, Feijoa sel/owiana, Cydonia oblonga, Docynia indica, Viburnum cotinifolium, Elaeagnus umbel/ata, Castanea crenata, Olea cuspidata, Ziziphus jujuba, Diospyros lotus, Ficus palmata, F. carica, Corylus jacquemontii AI/ium fistulosum, A carolinianum, A tuberosum, A schoenoprasum, A. auricula tum, A griffithianum, A consanguneum, Allium sativa var. ophioscordon, A. ampeloprasum

REGIO'lALSTATION. SHIMLA_ 137

Medicinal plants Acorus calamus, Asparagus adscendens, A. filicinus, Habenaria intermedia, Viola serpens, Hedychium spicatum, Taxus wallichiana, Heracleum candicans, Thymus serphyllum, Dioscorea deltoidea, Roylea elegans, Podophyllum hexandrum, Polygonatum cirrhifolium, P. verticil/atum, Valeriana wallichii, Roscoea procera, Achillea millefolium, Betula uti/is, Ephedra gerardiana, Lilium polyphyllum, Picrorhiza kurroo, Stevia reb_audiana, Saussurea costus, Arctium lappa, Wtthania somnifera

16.3.5 Germplasm supply: Germplasm comprising 629 accessions of agricultural crops and 1664 rooted plants and 641 bud sticks of 54 accessions were supplied to researchers across the country.

• Seed Crops: Amaranth (86), buckwheat (63), french bean (226), cowpea (40) pea (99), rice bean (25), adzuki bean (14), chenopod (45), Kulthi (25), fmgermillet(4) and foxtail millet (2).

• Rooted plants: Apple (28), kiwi (234), peach (122), plum (31), pear (25), pepino (776), persimmon (97), Stevia (111), apricot (2), pecan nut (54), quince (10), walnut (37), pineapple guava (28), Chinese ber (4), hazelnut (9), behrni (25), medicinal plants (20), minor fruits I ornamentals (104)

• Bud sticks: Apple (283), peach (55), plum (30), pear (112), pecan nut (35),apricot (66), cherry (20), Rubus (10), and Ficus (30)

Research Projects «Project Code, Title (PI and CoPl)

PGRlGEV/BURlSHM-01.01: Augmentation, characterization, evaluation, maintenance, regeneration, conservation, documentation, and distribution of genetic resources of pseudo cereals, pulses, and other lesser known hill crops (JC Rana,VD Verma and K Pradheep (up to 9.7.09)

PGR/GEVlBURlSHM-01.02: Augmentation, characterization, evaluation, maintenance, regeneration, conservation, documentation, and distribution of genetic resources of temperate fruits, vegetables and medicinal and aromatic plants. (VO Verma, K Pradheep, JC Rana and Sandhya Gupta)

Externally funded Ad-hoc research projects

• On farm conservation and promotion of cultivation of small millets and pseudo-cereals in participatory mode in Himachal Pradesh (JC Rana)

• Mass multiplication of quality planting material of some new fruits as an alternative to diversity fruit cultivation in HP (JC Rana)

• Impact of climate change on plant species composition: analyzing with a few typical plant species in Shimla and Kinnaur Districts of Himachal Pradesh (JC Rana)

138 _ ANNUALREPORf2009-IO

17. REGIONAL STATION, SRINAGAR

Summary: Explorations of agricultural crops were undertaken in Jammu, Kashmir and Leh regions. A total of 156 accessions Of forage crops and pseudocereals were collected. The 86 accessions of different forage crops were collected from the mterior regions of Punch, Rajouri and Naoshera. The 70 accessions of pseudocereals and other crops were collected from the remote areas of Nubra Valley, Leh, Kargil, Drass and Satalic. The 605 accessions of wheat (330), barley (164) and mustard (111) were characterized and evaluated for their morphological characters during rabi 2008-09 and the 576 a >cessions of wheat (303), barley (145) and sarson (128) were sown in Rabi 2009-10 for characterization and evaluation.

The NBPGR, Regional Station, Srinagar was established in 1989 with responsibility of plant exploration and germ plasm collection of agri-horticultural crops and their wild relatives from the region and their characterization and evaluation. It IS located about 14 Ian from Srinagar city at KD Farm near old airfield, Rangreth. In spite of unfavourable socio­political environment in the region, PGR activities were carried out and annual report is presented below.

17.1 Germplasm Exploration and Collection

A Total of 156 germplasm accessions of different agricultural crops were collected from Jammu, Kashmir and Leh regions.

17.1.1 Collection of Germplasm of Forage Crops: The 86 accessions of Trifolium resupinatum, T. frageriferum, T. repens, T. pratense, T. campestrel, Vigna unguiculata, Triticum aestivum, Avena sativa, Zea mays, Pennisetum glaucum, P. orientale, P. allfodotale, Bromus cathartieus, B. japonica, Lotium temulentum, Polypogon monspeliensis, Medicago poiymorpha, Lathyrus aphaca, Vieia sativa, Vicia bithynica, V. hirsuta, Melilotus illdicus, Medicago It/pulina, Lotus corniculatus, and Avena fatua from the interi.or regions and jungles of Punch, Rajoun and Naoshera.

17.1.2 Collection of Germplasm of pseudo cereals: The seventy accessions of pseudocereals including Chenopodium botrys, C. hybridum, Amaranthus caudatus, Fagopyrwn spp. , F esculentum, Hordium

Genetic diversity in Setaria italica (L.)

RI GIONALSTATIO~ . ~RINAGAR __

Setaria Italica growing in the field of village Sima (Leh)

vulgare, Fagopyrum tartaricum, Hypericum perforatum, Dracocephalllnl heterophyllulfl, Verbascum tizapsas, Salvia .'Ie/area, Allium humile, Setaria ifalica, S. virids, Panicum milliacium,Alliu1l1 humile were collected from Nubra valley, Leh, Battalic and Drass regions. Also seeds of some medicinal plants like Hypericum perforatlll1l, Dracoceplzalum heterophyllum, Verbascum thapsas and local accessions of Pisum sativum Phaseolus vulgare, Hordum vulgare, Triticum aestivum were also collected.

17.2 Germplasm Characterization and Evaluation

A total of 605 accessions comprising of wheat (330) barley (164) and Mustard (111) were characterized and evaluated for their morphological characters in Augmented Block Design during Rabi 2008-09 under rain fed condition. The 576 accessions of wheat (303), barley (145) and mustard (128) have been sown in the field during Rabi 2009-10 for characterization and evaluation under rainfed condition.

139

17.2.1 Identification of promising genotypes:

Wheat:

The 330 accessions of wheat were sown in the. Augmented Block Design during Rabi 2008 for evaluation of them for their morphological characters at the Research Farm of Regional Station of National Bureau of Plant Genetic Resources, K.D. Farm, Rangreth, Old Air Field, Srinagar. The standard agronomical practices were followed to raise good crop under rainfed condition. The observation were recorded for seed yield per plant and its contributing characters i.e. number of seeds per spike, number of spikelets per spike, spike length and 100 seed weight. The higher seed yield per plant than best performing check PBI0-343 (14.54±0.79gm) was recorded for accessions IC278958 (32.38±0.79gm), IC278994 (25 .25±0.79gm), IC279333 (24.43±0.79gm), IC266789 (23.56±0.79gm), and IC266872 (23.51±0.79gm). The higher number of grains per spike were recorded for accessions IC59574 (61.50±1.80), IC279323 (61.0±1.80), IC279877 (59.60±1.80), IC266872 (59.25±1.80), IC212177 (58.1O±1.80) than the best performing check GW 322 (51.30±1.80) for the character. The genotypes that have longer spikes than best performing check HD 2733 (10.99±0.26) were IC279204 (14.28±0.26), IC279060 (13.63±0.26), IC279003 (13.19±0.26), IC279085 (13.14±0.26) and IC278994 (13.11±O.26). The spikeletes per spikes were recorded more in number for genotypes IC279060 (21.80±0.12), IC279207 (21.64±0.12), IC279OO3 (21.60±0.12), IC31 0071 (21.6±O.12), IC335955 (21.60±0.12) than the best performing check GW 322 (18.60±0.12). The test weight was observed to be higher for the genotypes IC279030 (4.68±0.07), IC279326 (4.54±0.07), IC279317 (4.51±0.07), IC279878 (4.51±0.07), IC278987 (4.47±0.07) than the best performing check HD 2733 (3.21±0.07).

Barley:

The 164 accessions of barley were sown in the Augmented Block Design during Rabi 2008, for evaluation of them for their morphological characters at the Research Farm of Regional Station of National Bureau of Plant Genetic Resources, K.D. Farm, Rangreth, Old Air Field, Srinagar. The standard agronomical practices were followed to raise good crop under rainfed condition. The observation were recorded for seed yield per plant and its contributing characters i.e. number of seeds per spike, number of spikelets per spike and 100 seed weight. The higher seed yield per

140 --

plant than best performing check Jyoti (19.86±0.67gm) was recorded for accessions IC279133 (32.20±0.67 gm), IC279132 (29 .28±0.67 gm), IC279152 (24. 70±0.67 gm), IC279935 (22.22±0.67 gm), and IC279267 (21.29±0.67gm). The higher number of grains per spike were recorded for accessions IC279148 (65.40±1.32), IC310087 (60.30±1.32), IC311059 (58.60±1.32), IC279009 (58.40±1.32), IC279029 (57.80±1.32) than the best performing check Jyoti (556.1 O± 1.32) for the character. The spikeletes per spikes were recorded more in number for genotypes IC279278 (35.22±0.16), IC278978 (23.50±0.16), IC310087 (22.00±0.16), IC31l059 (22.00±0.16), IC31l049 (21.20±0.16) than the best performing check Jyoti (20.20±0.16). The test weight was observed to be higher for the genotypes IC279269 (4. 76±O.17), IC279940 (4. 71±0.17), IC279167 (4.69±0.17), IC279270 (4.67±0.-17), IC279274 (4.64±0.17) than the best performing check Jyoti (3.38±O.l7).

Sarson:

The 111 accessions of sarson (mustard) were sown in the Augmented Block Design during Rabi 2008 for evaluation of them for their morphological characters at the Research Farm of Regional Station of National Bureau of Plant Genetic Resources, K.D. Farm, Rangreth, Old Air Field, Srinagar. The standard agronomical practices were followed to raise good crop under rainfed condition. The observation were recorded for seed yield per plant and its contributing characters i.e. number of seeds per silique, silique length (cm), total number of siliquae on primary branches, total number of siliquae on main stem, total number of siliquae per plant, and test weight. Higher seed yield per plant than best performing check Pusa Kranti (22.90±1.34gm) was recorded for accessions IC346012 (35.69±1.34gm), EC 513428 (30.99±0.1.34gm), IC261671 (27.02±0.1.34gm), EC400056 (24.70±1.34gm). The number of seeds per silique were recorded for accessions IC261671 (21.30±0.73), EC 191597 (21.20±0.73), EC 501604 (20.90± 0.73), as compare to best performing check Bhawani (23.60±0.73) for the character. The genotype that have higher number of siliquae on primary branches per plant than the best performing check BM-BG 88 (74.90±2.55) wereEC 389916 (83.1O±2.55). The longer siliquae were recorded for EC 501604 (8.86±O.37), EC 230974 (8.04±0.37), EC 513428 (8.03±0.37), EC 3899] 6 (7.62±0.37) and IC261671 (7.57±0.37) than the best check Bhawani (7.51±0.37) for the character. The total numbers of siliquae per plant were observed for

___________ ANNUAl REPORT2()(IQ

accessions EC 230974 (314.30±8.34), EC 261671 (311.50±8.34), IC389916 (284.80±8.34) as compare to Pusa Kranti (315±8.34). The higher number of primary branches were recorded for EC389916 (6.20±0.12), EC261671 (6.10±0.12), EC 261683 (6.10±0.12), IC346084 (5.80±0.12) than the best performing check • ali Stauls (5.79±0.12). The observed test weight for accessions IC267540 (0.68±0.07), K 361511 (0.67±0.07),

Research Project (code, title, project leader, associates)

EC 389916 (0.62±0.07), IC346090 (0.61±0.07) as compare to check BMBG 88 (0.64±0.07).

17.3 Maintenance of Germplasm

The 39 accessions comprising Dioscorea deltoidea (23), strawberry (5), pran (5), mint (3) and Iris spp. (3) were maintained as a live plants.

PGR/PGC-BUR-SRI-01: Augmentation, characterization, evaluation, maintenance, regeneration, conservation, documentation and distribution of germplasm resources of various crops from Jammu and Kashmir regions (Om Vir, Sheikh M. Sultan and D. Gautam).

RHJIONALSTATION, SRINAGAR ______ _ 111

\ 18. REGIONAL STATION, THRISSUR

Summary: A total of 274 samples of germplasm was collected in 5 exploration and collection missions carried out in 2 districts of Goa, 6 districts of Karnataka, 11 districts of Ke~ala, 2 districts of Maharashtra, 1 district of Tamil Nadu and 1 district of Union Territory of Lakshadweep Islands. This resulted in the collection of 6 samples from Goa, 31 from Karnataka, 141 from Kerala, 21 from Maharashtra, 11 from Tamil Nadu and 64 from UT of Lakshadweep. Out of the collected germplasm, 36 samples were sent for long-term storage in the National Genebank, NBPGR, New Delhi. During rabi 2008-09, 111 accessions of rice (Oryza sativa) and 116 of horsegram (Macrotyloma uniflorum) were evaluated. In summer 2009, 22 accessions of kokum (Garcinia indica) were characterised/ evaluated. During Kharif 2009, 80 accessions of rice, 35 of brinjal (Solanum melongena) and 34 of Malabar tamarind (Garcinia cambogia) were characterised! evaluated. Sent seeds of 167 multiplied accessions of rice for long-term storage. For cryo-preservation, 30 multiplied accessions and 25 collected samples were sent. Seeds of 486 accessions of various crops/wild relatives were added to the MTS facility of the station. Based on material transfer agreement, 388 accessions were supplied to 16 user agencies. Transferred 136 accessions of greater yam, 31 of Chinese potato, 61 of lesser yam, 30 in vitro c<;>nserved cassava, 2 each of wild taro and Tacca leontopetaloides and one each of lesser yam, sweet potato, cocoyam and Dioscorea oppositifolia to CTCRI, Thiruvananathapuram; 30 accessions of Cajanus lineatus, 4 of redgram, 1 each of green gram, black gram, Vigna vexillata to IIPR, Kanpur; 4 accessions of castor to DOR, Hyderabad and 2 accessions of sun hemp to CRIJAF, Barrackpore. A total of 184 accessions in 2 crops (cassava-40, and ginger-127) and 12 wild related species are maintained in in vitro conservation media. One accession of Alpinia calcarata, IC210421 (INGR No. 09051) was registered as genetic stock for high 1,8-cineole and frenchyl acetate.

18.1 Exploration and Collection

Five exploration and collection missions were executed resulting in the collection of 274 samples from 2 districts in the state of Goa (6 samples), 6 districts in Karnataka (31), 11 districts in Kerala (141), 2 districts in Maharashtra (2] ), one district each in Tamil Nadu (1) and OT of Lakshadweep (64 samples). The number of samples collected in each taxa from different states is presented in the table.

Horse gram (IC105498) - Field tolerant to yellow mosaic virus disease

# Botanical name

1. Abelmoschus angulosus var. purpureus 2. Abelmoschus angulosus var. grandiflorus' 3. Abelmoschus moschatus subsp. tuberosus' 4. Aloe barbadensis 5. Alpinia abundiflora 6. Alpinia calcarata

7. Alpinia galanga 8. Alpinia malaccensis 9. Afpinia mutic'3 10. Amaranthus dubius 11. Amaranthus hybridus 12. Andrographis paniculata 13. Aristolochia tagala 14. Bacopa monnieri

State

Karnataka Kerala Kerala Kerala Kerala Kerala Karnataka Kerala Kerala Kerala UT Lakshadweep UT Lakshadweep Kerala Tamil Nadu UT Lakshadweep

A 1t3&::131 ItW.3!lll

Kokum kernel variability

No. of samples

1 1 1 1 1

11 1

18 1 1 1 1 1 1 1

142 ----- -----------------~---- A "'NLALREPORf2009

15. Beioperone p/umbaginifoJia Kerala 1

16. Caesa/pinia bonduc UT Lakshadweep 1

17. Cajanus cajan Kerala 1 Karnataka 3

18. Cajanus lineatus Kerala 1 Karnataka 19

19. CalophyJlum inophyJlum UT Lakshadweep 1

20. Canavalia cathartica UT Lakshadweep 1

21. Capsicum baccatum UT Lakshadweep 1

22. Cardiospermum ha/icacabum UT Lakshadweep 1

23. Cayratia pedata Kerala 4

24. Ce/astrus panicuJatus Tamil Nadu 1

25. C/itoria ternatea UT Lakshadweep 2

26. Coleus zeylanicus Kerala 1

27. Golocasia escu/enta UT Lakshadweep 1

28. Gorchorus triJocuJaris UT Lakshadweep 1

29. Grota/aria pallida UT Lakshadweep 2

30. GucumeJ/a silenvaJ/eyii Kerala 3

31. Gucumis melD var. agrestis' UT Lakshadweep 3 Kerala 1

32. Gucumis sativus var. hardwikiii' Karnataka 1 Kerala 1 Tamil Nadu 1

33. Dioscorea oppositifolia UT Lakshadweep 1

34. Garcinia indica Goa 6 Maharashtra 21 Karnataka 2

35. Gloriosa superba Kerala 1

36. Gossypium arboreum Kerala 1

37. Hedychium spicatum Kerala 1

38. Helicteres isora Kerala 1

39. Holostemma ada-kodien Kerala 2

40. /ndigofera tinctoria UT Lakshadweep 5 Kerala 4 Karnataka 1

41. Ipomoea batatas UT Lakshadweep 1

42. Kaempferia e/egans Kerala 6

43. Kaempferia galanga Kerala 14

44. Launea sarmentosa UT Lakshadweep 1

45. Macaranga roxburghii UT Lakshadweep 1

46. Mappia foetida Tamil Nadu 1

47. Momordica sahyadrica Kerala 1

48. Morinda citrifolia UT Lakshadweep 24

49. Moringa concanensis Tamil Nadu 1

50. Naringi crenulata UT Lakshadweep 51. Pemphis stronga UT Lakshadweep 52. Premna serratifolia UT Lakshadweep 1

53. Pseudarthria viscida Kerala 1

54. Rauvolfia canescens UT Lakshadweep 1

55. Rauvolfia serpentina Kerala 1

56. Ricinus communis UT Lakshadweep 2

57. Scaveola sericea UT Lakshadweep 1 58. Sesamum pr()startum' Kerala 1

59. Tacca /eontopeta/oides UT Lakshadweep 2

60. Tinospora cordifolia UT Lakshadweep 2

61. Vigna da/zel/iana' Tamil Nadu 2 Kerala 33

62. Vigna marina UT Lakshadweep 1

63. Vigna mungo' Karnataka 1

64. Vigna radiata* Karnataka 1

65 Vigna pi/osa' Kerala 2

RLUIONAL SlAl10N, TI-IRISSl.'R __ 143

66. Vigna radiata var. sub/obata* Kerala 11 67. Vigna trinervia var. bourneae* Kerala 9

Tamil Nadu 3 68. Vigna trinervia var. trinervia * Kerala 2 69. Vigna tri/obata* Tamil Nadu 70. Vigna vexillata * Karnataka 71. Xanthosoma sagittifo/ia UT Lakshadweep 72. Zea mexicana Tamil Nadu 73. Ziziphus mauritiana UT Lakshadweep

* - Collected under the NAIP project on Biosystematics of the Genera Vigna, Abe/moschus and Cucumis

In the survey conducted in Lakshadweep Islands for the study of scope of collection of plant genetic resources, the islands of Agathi, Kavarathy, Kalpeni and Minicoy and uninhabited, inaccessible and remote islets of Cheri urn and Vilingiri were covered. Coconut is the main crop and tropical fruits and vegetables introduced from mainland India are cultivated rarely in home gardens. However good variability in Morinda citrifolia (Noni) was observed in all islands with sizable populations in Minicoy Island. Interesting wild relatives collected are Corchorus trilocularis, Vigna marina, Cucumis melD var. agrestis and Canavalia cathartica. These are naturalised wild populations. EnuJTleration of biodiversity along with herbarium specimens was carried out where no viable propagule could be collected.

In the exploration mission conducted in collaboration with llPR, Kanpur to shola forests and grasslands of Western Ghats covering Chikmagalur, Shimoga, Uttar Kannad, Dakshin Kannad and Kodagu districts in Karnataka and Wynad district in Kerala, variability in Cajanus lineatus was collected. Cajanus lineatus and C. trinervius are the only erect species allied to red gram and both are niche specific.

In the exploration and collection mission conducted for the collection ofkokum from Goa and south Maharashtra, kokum based industries were also visited, in addition to the visit to field genebanks of this crop at RFRS, Vengurle; ARS, Mulde; Coconut Research Station, Bhatye, Ratnagiri; Rice Research Station, Shirgaon; Horticultural Nursery, College of Horticulture, Dapoli; and KVK, Devde, Ratnagiri. The unique collections made ofkokum were IC573483 with dark maroon to black fruits, IC573484 early sea~;on and profuse bearing and IC573485 with large fruits and late season bearing.

In the exploration and collection mission conducted in collaboration with IIHR, Bangalore to different parts of Kerala state and adjoining Tamil Nadu Anamallais for prioritized medicinal plants and wild relatives of crop

144 ------------

IC571755, Cajanus /ineatus - (wild relative of red gram) habit - collected from Abby falls, Kodagu District, Karnataka

Zea mexicana (JRNRl2009-20) collected from Anamallais, Tamil Nadu

plants, covered Thrissur, Ernakulam, Kottayam, AIapuzha, Thiruvananthapuram, Kollam, Pathanamthitta, Malappuram, Kozhikode and Wynaad districts of Kerala and adjoining Coimbatore district of Tarnil Nadu. Being vegetatively propagated, Alpinia gaianga, A calcarara and Kaempferia gaianga, no variability has been observed. However, in the case of Agaianga, farmers recognize three types of rhizome thickness namely, thin. medium and thick. Commercial cultivation of Agalanga was observed in two villages in Pathanamthitta district

________ ANl\iUAL RI PORT 2009 )(

IC571757, Vigna vexillata - plant with pods - collected from Mercara, Kodagu District, Karnataka

A distant view of the grasslands and shola forests in Bababudan Hills - natural habitat of Cajanus lineatus.

IC571756, Cajanus lineatus - mature pods - collected from Abby falls, Kodagu District, Karnataka

and in a village (Thiruvambady) in Kozhikode district, original material brought from Pathanamthitta district. Pathanamthitta district is the main centre for cultivation of this species. A. calcarata and Kaempferia galanga are grown in isolated pockets in homesteads only.

In addition to these, an exploratory survey of Kodagu (Coorg) district oJ Karnataka was carried out in collaboration with CHES of IIHR for assessing the prospects of custard apple germplasm collection (RAC recommendation). Anona squamosa is of rare Occurrence as the heavy rainfall pattern prevailing in this district is not favourable for its growth and expression. However very good population of A. ret icu lata (Ramphal) was fou nd both in homesteads and as

naturalised populations in forests. A.muricata (soursop) and atemoya (A.clzerimola x A.squarnosa) were also spotted rarely in cultivation in home gardens. None are cultivated commercially, even though Ramphal and atemoya show good growth and yield. Carpological specimens and herbarium of all the four specie were preserved for deposit in NHCP as reference samples for species identification.

18.1.1 Herbarium: A total of 20 voucher herbarium specimens collected from Andaman Islands and Lakshadweep Islands was deposited in NHCP, NBPGR, New Delhi. This included one accession each of Cucumis melD var. agrestis, Momordica cochinclzinensis (Male), M. cochinclzinensis (Female), M. charantia var. muricata, M. subangulata subsp. renigera, Morinda citrifolia, Piper ribesoides, V umbellata , Indigo/era tinctoria, Tacca leontopetaloides. Tinospora cordifolia, Macaranga roxbllrghii. Premna serrati/olia, Corchorus trilocuLaris, Raul'ol/ia canescens, Canavalia cathartica, Launea sannentosa. Naringi crenulata, Cardiospermum halicacabum and Vigna marina.

18.2 Characterisation and Evaluation

18.2.1 Cereals

Rice (Oryza sativa) Rabi 2008-09: One-hundred and eleven accessions of rice were evaluated for 11 qualitative and 12 quantitative characters along with four check varieties namely Ahalya, Jaya, Jyoti and Thulasi. No remarkable variability was found in qualitative characters except for seed coat color. The variability observed in 10 quantitative characters is presented below:

Characters Range Mean SO CV(%)

Leaf length (cm) 26.2-57.4 38.8 7.8 20.1 Leaf width (cm) 0.5-1.4 1.1 1.4 132.8 Days to 50% 41-88 56.7 10.6 18.7 Flowering No. of effective tillers 12.2-38.2 20.2 4.9 24.5 Plant height (cm) 52.0-118.0 93.9 16.3 17.3 Panicle length (cm) 12.6-30.0 19.5 3.2 16.4 Grain length (mm) 6.4-10.8 8.4 1.0 12.2

Grain width (mm) 2.4-3.5 2.9 0.7 23.9

100 grain weight (g) 1.2-3.1 2.5 1.2 47.2

Grain yield/ plant (g) 4.0-32.4 14.8 6.3 42.6

IC086422, IC086005, IC086143B, IC444032, IC350614, IC443972 and IC4440 12 were found superior for number of tillers with more number of tiller.;; compared to the

l{f<.GIONALSTATION. THRISSl'R ___________ _ 1 "

best check Thulasi (25.0); IC324568, IC324572, IC324692A, IC324651, IC350512, IC443959, IC567961 and IC443962 for grain yield per plant compared to the best check Thulasi (21.2g) and IC537515, IC567841, . IC567972 and IC443973 for 100 seed weight compared to the best check Jaya (2.7g).

During Kharif 2009, 80 accessions of rice were characterized for 11 quantitative and 12 qualitative characters. IC350483, IC567841, IC567865, IC350453, ICS3743SB, IC0860S1A, IC444001 and ICS67938 were found to be high yielding (more than 20.0g/plant) and tolerant to brown plant hopper (bph) compared to all the four check varieties namely Ahalya, Jaya, Jyoti and Thulasi where their yield was less than 19/plant and susceptible to bph.

18.2.2 Grain legumes

. Horsegram (Macrotyloma unijlorum) rabi 2008-09: One-hundred and sixteen accessions of horsegram were scored for yeIJow vein mosaic virus (YMV) disease under field epiphytotic conditions. The range of infection was 0-90%. Ten accessions IC089006, IC089017, IC089018, IC089020, IC089024, IC145283, IC043503, IC047120, ICOS6136 and ICI05498 were found to be field tolerant to YMY.

18.2.3 Vegetables

Brinjal (Solanum melongena) Kharif 2009: Thirty­five accessions which were found field tolerant to bacterial wilt disease and stem borer attack during 2008-09 were raised in a nursery, and of these 20 accessions were found susceptible to damping off disease. The remaining fifteen accessions were evaluated in the field for second time for tolerance to bacterial wilt and stem borer. The accessions ICl11387, IC1l2747 and IC548897 were found to be field tolerant to bacterial wilt and stem borer.

Okra (Abelmoschus esculentus) Kharif 2009: One­hundred accessions of okra were taken up under the IIVR-NBPGR collaborative multi-location evaluation trial in an augmented block design along with four checks namely Arka Anamika, Salkeerthi, Pusa Sawani and VRO-5. Yield levels were very low due to eratic rainfall.

18.2.4 Spices

Malabar tamarind (Garcinia cambogia) Kharif 2009: Characterised 59 flowering trees in 43 a acccessions for leaf lamina length, lamina width and

146 -

petiole length which ranged from 7.5-14.3,2.8-6.7 and 0.5-1.9 cm respectively. The variability (%) of the above was 14.6, 16.2 and 21.9 indicating high variability in the case of petiole length. This year 42 seedling progeny trees in 34 accessions and 22 trees in 9 accessions of grafted plants bore fruits. Among them, IC136681, IC244100-2, IC244100-3, IC244 1 11-1 and IC244 1 13-1 were superior for number of fruits per tree with more than 1500. IC2441 00-2, IC244100-3, IC244111-1 and IC244113-1 were also superior for yield per tree, more than 140 kg. In the case of grafted, IC244083-1-1 and IC244083-1-2 were supelior for total number of fruits, fresh fruit weight per bush and single fruit weight of 213,264; 21, 26 kg.; and 99, 97 g respectively. Sixteen accessions were estimated for kernel oil content. This ranged from 20.12 to 44.11 with the mean of 30.91 %. Accessions IC21 0720-1 and IC2441 09-1 were promising for oil content, which had 43.73 and 44.11 % respectively . Sixty-nine trees in 52 accessions were characterized for girth (cm) at breast height 0.3 m from soil level), branching pattern of trunk (unbranched or basal or middle or top branched), orientation of lateral branches with reference to the trunk (drooping or diagonal), leaflamina length (cm), leaf lamina breadth (cm) and petiole length (cm). These ranged from 13 to 96 em, unbranched or basal or middle or top branched, diagonal or drooping, 8.2 to 14.3 cm, 2.6 to 6.7 cm and 0.7 to 1.9 cm, respectively.

Registered one accession of Alpinia calcarata, IC210421 (lNGR No. 09051) for high 1,8-cineole and frenchyl acetate.

18.3 Biosystematics of the Genera Vigna, Cucumis and Abelmoschus

18.3.1 Vigna species: Eco-geographic survey of distribution and phenology in west coast and the ghat regions of Kerala and adjoining Anamalais of Tamil Nadu: Conducted an eco-geographic survey of Vigna species in Anamalai hills of Western Ghats, covering Chalakkudy - Sholayar section (Kerala), Sholayar - Valparai section (Tamil Nadu) and Valparai­Aliyar section (Tamil Nadu). V. dalzelliana was found to have wider distribution from 90 to 1200 m. V. trinervia var. bourn.eae was sporadic. Overlapping distribution of Vtrinervia var. bourn.eae and V dalzelliana was noticed at several places above 400 m in Sholayar forests. V. trinervia var. trinervia and V.trinervia var. bourn.eae were found growing side by side at 700 m altitude in Anakkyam range of Sholayar forest. Overlapping

AN'\fLALREPOR12009 10

distribution of V dalzelliana and V radiata var. sublobata was observed near Mangalam Dam in Nenmara forest division. Phenological observations indicated that flower initiation was late during October in V. trinervia var. bOllrneae and early during September in respect of V. dalzelliana. V. dalzelliana was found istributed from near mean sea level to 1150 m in western

coastal and ghat regions of Kerala. Other species of Vigna namely V. radiata var.sublobata and V. trinervia var.bourneae were found to occur in the lower elevations only. Overlapping distribution of V. dalzelliana, V radiata vaLsublobata and V. trinervia vaLbourneae was found in lower elevations. Wide variability was seen in V. dalzelliana with respect to plant type and size of

pod.

Vigna trinervia var. trinervia (JRN/09-03), a wild relative of green gram and black gram, collected from Sholayar

forest, Anamallais, Western Ghats

FJs of 12 crosses involving 10 taxa were grown and percentage of germination observed is detailed below:

Female Male parent parent

V. radiata var. V. radiata var. sub/obata radiata V. radiata var. setu/osa

Percentage of germ­ination

92 74

V. mungo var. sy/vestris 1 00

V. mungo var. mungo

II. umbel/ata

(Cultivated)

V. hainiana 67 V. trinervia var. bourneae V. radiata var. sub/obata II. radiata var. setu/osa II. mungo var. sylvestris II. hainiana II. trinervia var. bourneae II. umbel/ata (Wild)

II. c;ja/zelliana

73 94 88 83 100 100 100

o

Among the F J s studied, no fruit set was obtained in hybrid from the cross involving V. radiata x V. trinervia var. bOllrneae indicating the distant relationship among these two species. Pod set was obtained in V. radiata x V. ra· iata var. sublobata and V. mungo x V. mungo var. ~Yhestris hybrids when back crossed with the female

RfGIOl\iAI STATION, TIIRlSSUR _______ _

Vigna trinervia var. bourneae (LN/09-03) collected from Palakkad district, Kerala

parent. Selfed pods could also be harvested in these hybrids. But a hybrid of V. radiata x V. trinerl'ia var. bourneae failed to set any pod both in selfing and back crossing. One pod was obtained between V. radiara and V. khandalensis cross. Pod set was obtained in the cross between V. radiata and V. trinervia var. trinervia.

18.3.2 Abelmoschus species: Herbarium study at Central National Herbarium ofBSI was carried out from 22/06/2009 to 26/06/2009. A total of 113 sheets in Abelmoschus including type specimens lodged at CAL were examined for recording the distribution, phenology and infraspecific variability present in this genus. Validity and occurrence of A.crinitus in India could be confirmed. Wide hybridization in 22 cross combinations involving A.

Flower of hybrid between Abelmoschus moshatus subsp. moshatus and A. moshatus subsp. tuberosus

Flowers of the hybrid (middle) with the female parent (yellow) and male parent (red smaller flower).

147

,

F1 hybrid of cross between Abelmoschus esculentus x A. tuberculatus

esculentus, A. caillei, A. manihot subsp. tetraphyllus var. tetraphyllus and var. pungens, A. ficulneus and A. tuberculatus was attempted. Fruit set was obtained in the following crosses namely, A. esculentus x A. manihot subsp. tetraphyllus var. pungens, A. tuberculatus x A. caillei, A.manihot subsp. tetraphyllus x A.manihot subsp. tetraphyllus var. pungens, A. moschatus x A. moschatus subsp. tuberosus, A. moschatus subsp. tuberosus x A. moschatus and A. sagittifolius x A. moschatus subsp. tuberosus. Back cross and selfing of 12 combinations of Fl hybrids were also carried out. FI hybrids and their reciprocal cross between A. moschatus subsp. moschatus and A. moschatus subsp. tuberosus were found to be promising as ornamentals. It has prolific flowering and bright red big attractive flowers exceeding both the parents. Seed scarification was found effective in breaking dormancy in Abelmoscus anglosus var. purpureus.

18.3.3 Cucumis species: Herbarium study at Central National Herbarium of BSI was carried out and a total of 200 sheets in Cucumis were examined for recording the distribution, phenology and infraspecific variability present in this genus. Validity and occurrence of Cucumis hystrix and C. setosus in India could be confirmed. Based on field and herbarium studies a taxonomic key for identification of Cucumis sativus, C. melo, C. prophetarum, C. hystrix, C. callosus and C. setosus and infraspecific taxa C. melo subsp. agrestis and C.

Cucumella silentvallei (JRN/09-15) related to Cucumis collected from Anamallais , Tamil Nadu

148

_. -

Fruiting and seed set in cross between Cucumis hardwicki; x Cucumis callos us

sativus var. hardwikii was developed. Three accessions of Cucumella silentvallei were collected from high

ranges of Western Ghats.

Wide hybridization involving 2 cultivated and 4 wild species was attempted in Cucumis. A total of 383 flowers was crossed. Fruit setting was observed in wide crosses in Cucumis namely, C. sativus x C. sativus var. hardwickii and its reciprocal, C. sativus var. hardwickii x C. melD var. connoman, C. callos us x C. melD var. momordica. C. callosus x C. melo var. connoman. C. melo var. melD x C. callos us and C. sativus var. hardwickii x C. callosus. Successful seed set was obtained in crosses involving C. callosus x C. melo and its reciprocal. In Cucumis, FIs were raised in 5 cross combinations namely, C. melD x C. melD var. agrestis, C. sativus x C. sativus var. hardwikii, and their reciprocals and C. melD x C. callosus. Normal fruit set and seed set were observed in all these hybrids. Back crossed fruits could be harvested in two hybrids of C. melo var. agrestis x C. meLo var. melo.

Cucumis melo var. agrestis (JRN/09-22) a wild non-edible melon collected from Palakkad gap of Western Ghats

Taxonomic key for species and varieties of Cucumis L. in India

1. Plants climbing. central leaf lobe angular 2. Plants prostrate, Central leaf lobe broadly round

1 a. Young fruits sparsely tuberculate, blossom end round or obtuse, wild or cultivated

............................... C. sativus

_ _______ ANNUALREPORT2009 10

I b. Young fruits densely aculeate with short aculei, blossom end rostrate, wild

...... C. hystrix

1 c. Young fruits setose hairy, blossom end round, wild

.............................................. C. setosus

2 a. Annual, flowers lemon yellow, male flowers in cluster, young fruits soft hairy, wild or cultivated

............................................................ C. melD

2 b. Perennial with tuberous tap root, flowers sulphur yellow, male flowers solitary, fruits on pendent stalks, always wild:

2. b-l. Fruits echinate with long recurved spines

..................................... C. prophetarum

2 b-2. Fruits non aculeate, softly pubescent

. .. . . . . . ............. .................. ....... . .. C. callos us

Key to the varieties of C. melo

Plants robust, fruits big, polymorphous, non bitter, always cultivated

............... subsp. melo

Plants slender, fruits small, oval, oblong or round, wild or weedy

................. subsp. agrestis

Key to the varieties of C. sativus

Plants robust, fruits 10-30 x 5- 15 cm, non bitter, cultivated

.... .. .......... . ........... . ... var. sativus

Plants slender, fruits 5-10 x 3- 5 cm highly bitter, wild

............... ..................... var. hardwikii

18.4 Collection, Clonal Multiplication, Conservation and Biochemical Profiling of Kokum (Garcinia indica), a Potential Source of Edible Oil found in Southern Western Ghats

In kokum, 18 trees in 13 accessions were characterized for 7 fruit, 6 seed and 2 kernel characters. The range of variation observed was 14.5 - 50.0 g for fresh weight of fruit, 1.7 - 604 for number of seeds per fruit, 13.9 - 21.1

mm for seed length with coat, 8.0 - 12.2 rom for seed width with coat, SA - 7.5 mm for seed thickness with coat, 0.5 - 1.1 g for fresh seed weight with coat, 0.3 -0.7 g for dry seed weight with coat, 0.2 - 0.5 g for fresh weight of kernel and 0.1 - 004 for dry weight of kernel. The mean for each of these characters was 31.7 g, 3.9, 17.6 mm, 10.5 mm, 604 mm, 0.8 g, 0.5 g, 0.3 g and 0.3 g respectively. IC342303-2, IC342301-1, IC342319-2 and IC342301-2 were superior with 004 g for dry weight of kernel. IC136685-1 was superior with 6.4 for number of seeds per fruit. Thirty trees in 22 accessions which bore fruits during summer 2009 were characterized for yield, number of fruits/tree and mean weight of indi vidual fruit. The range of variation for each of these characters is 0.028 to 64.568 kg/tree, 1 to 4360/tree and 7.36 to 36.78 g/fruit. Forty-nine trees in 25 accessions were characterized for girth (cm) at breast height (1.3 m from soil level), branching pattern of trunk (unbranched or basal or middle or top branched) and orientation of lateral branches with reference to the trunk (drooping or diagonal), which ranged from ] 0 to 54 cm, unbranched or basal or middle or top branched and diagonal or drooping, respectively. Thirty-eight accessions ofkokum were estimated for kernel oil content which ranged from 29.51 to 46.98 with a mean of 40.80%. The percentage of oil content was more in accessions IC342293-1 (46.98) and in IC573490 (45.20). The other accessions found promising for oil content were IC573487, IC573483 and ICI 36681-1 with more than 40.00%. Soft wood grafting of IC136687-2 and IC136687-3 has revealed effective union with 5041 % and 19.05% respectively indicating tree to tree differences for effective grafting.

18.5 Germplasm Conservation

MTS at Thrissur:

This year, 348 accessions of rice, 128 of horsegram and 59 of pumpkin were added to the MTS facility .

LTS at New Delhi

Direct deposit of exploration samples:

A total of 36 samples comprising Morinda citrifolia (26 samples) , Crotalaria pallida (2), Corchorus trilocularis (1), Canavalia cathartica (l), Cajanus lineatus (1), Launea sarmentosa 0), Vigna marina 0), V.vexillata (1), Helicteres isora (1), lndigofera tinctoria (4), Macaranga roxburghii (l), Premna serratifolia (1), Scaveola sericea (1), Pemphis stronga (1), red gram (1) and green gram ( 1) was deposited in LTS, NGB, New Delhi directly after collection. In addition

REGIONALSTATION,THRISSUR ______________________ _ 149

to this, 10 samples of OroXylU111 indicllIn and 9 of Celastrus paniculatus received from IIHR, Bangalore were also deposited for long-term storage.

Multiplied germplasm:

A total of 167 accessions of rice was multiplied and deposited.

Supply of germplasm to TCC Unit, New Delhi for conservation: During this year, 10 accessions of black pepper, 23 new samples of kokum collected, 19 of Malabar tamarind, an accession each of Cerbera manghas, Alpinia mutica and A. malaccensis were sent for cryo-preservation.

In vitro conservation at Thrissur:

In all, 184 accessions of germplasm are being maintained in in vitro as detailed below:

'Crop! No. of accessions in culture

wild species Initiation I Conservation

Cassava - 40' Ginger - 127*' Alpinia calcarata 1 -Bacopa monnieri 1 -Dioscorea pubera - 1 D.pentaphyl/a - 3 D.intermedia - 1 D.belophyl/a - 1 D.bulbifera - 2 D.tomentosa - 1 D.wallichi - 1 D.oppositifolia - 1 Curcuma amada - 2 C.raktakanta - 2 C.aeruginosa - 1 C.latifolia - 1

Total 2 184

• 30 accessions transferred to CTCRI, Thiruvananthapuram •• 119 accessions transferred from NBPGR, New Delhi.

18.6 Germplasm Supply

18.6.1 Germplasm transfer to NAGS: A total of 258 established accessions from the FOB comprising 136 of greater yam, 31 of Chinese potato, 61 of lesser yarn and 30 ill vitro conserved accessions of cassava was transferred to CTCRI, Thiruvananathapuram for maintenance and characterisation on the basis of Proceedings of the Brainstorming Session on Horticulture Crops held in NBPOR, New Delhi on 21104/2009.

Collected materials comprising 30 samples of Cajanlls

lilleatus, 4 of redgram, 1 each of green gram, black gram and Vigna vexiLlata were transferred to IIPR, Kanpur; 8 samples comprising 2 each of wild taro and Tacca leontopetaloides and one each of lesseryam, sweet potato, cocoyam, Dioscorea oppositifolia, collected from Lakshadweep Islands to CTCRI, Thiruvananathapuram; and 4 samples of castor and 2 of sunhemp to DOR, Hyderabad and CRIJAF, Barrackpore, respectively.

18.6.2 Germplasm supply for multi-location evaluation: A set each of 100 accessions of okra was supplied to 6 centres for multi-location evaluation under the NBPGR-IIVRjoint evaluation trial through the Head, Oermplasm Evaluation Division. Similarly another set of 100 accessions of horsegram was supplied to 2 centres namely UAS, Bangalore and RARS, KAU, Pattambi for multi-location evaluation during 2009-10 under the NNP on Arid Legumes.

18.6.3 Germplasm supply for chemical evaluation at GED: Supplied 25 accessions of kokum, 35 of Malabar tamarind and one accession of Hydnocarpus pentandra for biochemical analysis including fatty acid profiling and protein along with oil-cake parameters.

18.6.4 Germplasm supply under MTA to user agencies: A total of 388 accessions was supplied to 16 user agencies under MTA. Details are as below:

• 22 accessions of brinjal, 10 accessions of pumpkin and 70 of rice to Tamil Nadu Agricultural University, Coimbatore

•

•

•

•

•

One accession each of Amorphophallus dubius, A. sylvaticus, A. bulbifer and A. commutatus to University of Kerala, 11tiruvananthapuram

Three accessions of Curcuma aurantiaca, 2 of C. mutabilis and 1 each of C. albiflora, C. aromatica, C. coriacea, C. harita, C. karnatakensis, C. [utea, C. mangga, C. raktakanta, C. vamana and C. zanthorrhiza to Nirrnala College, Coimbatore

5 accessions of bittergourd to Institute of Agricultural Sciences, University of Calcutta

25 accessions of bittergourd to KRC College of Horticulture, Arabhavi, Karnataka

7 accessions of okra, 5 of Chinese spinach, one each of brinjal and chillies to Agricultural Officer,

150 -------- ______________ A~MIALREPORT2009- 10

Administration of UT of Lakshadweep , Lakshadweep

• 12 accessions of bittergourd, 31 of M. charantia var. muricata, 1 each of Momordica balsam ina and M. subangulata ssp. renigera for AVRDC Taiwan to GEX, New Delhi

• 20 accessions of bittergourd and 5 of M. charantia vaL muricata to College of Agriculture (KAU), Thiruvananthapuram

• 5 accessions of bnnjal to UAS, Bangalore

• 5 accessions of black pepper to Dayalbagh Educational Institute, Agra, UP

• 35 accessions of Abelmoschus manihot ssp. tetraphyllus, 16 of A. moschatus ssp. moschatus, 1 of A. moschatus var. rugosus, 13 of A. angulossus var. grandiflorus, 5 of A. caillei, 3 each of A. fica/neus and A. tuberculatus to IARI, New Delhi

• 7 accessions of okra to Ajith seeds, Aurangabad

Programme (Code, Title and Programme leader)

• 30 accessions of okra to Sree Neelakanta Govt. Sanskrit College, Pattambi

• Two accessions each of Oryza ojficinalis and O. nivara to NBRI, Lucknow

• 5 accessions of Solanum melongena vaL insanum to ITBT Unit, COH, KAU, Thrissur

• Leaf samples of 16 accessions of Malabar tamarind (2 with fruits), 4 of kokum and 1 accession of Garcinia xanthochymus to IISR, Kozhikode

18.6.5 Germplasm supply to NBPGR: Three accessions of jack bean, one accession each of Canavalia gladiata, C. cathartica and chillies collected from Andaman Islands, Goa and Karnataka, were supplied to NBPGR RS, Hyderabad; 315 accessions of rice supplied to NBPGR, New Delhi for molecular characterisation.

18.6.6 Germplasm receipt: Five accessions of pumpkin were received from NBPGR, New Delhi.

PGR/GEV-BUR-THR-01.0: Augmentation, Characterisation, Evaluation, Maintenance. Regeneration, Conservation, Documentation and Distribution of Plant Genetic Resources in Southern India including Goa and Andaman & Nicobar Islands (Z Abraham)

Research Projects (Project Code, Title, PI Co-PI and Associates)

PGR/GEV-BUR-THR-01.01: Augmentation, characterization, evaluation, maintenance, regeneration, conservation. documentation and distribution of genetic resources of field crops and their wild relatives (M latha; Z Abraham; KI Asha; S Mani)

PGR/GEV-BUR-THR-01.02: Augmentation, characterization, evaluation, maintenance, regeneration, conservation, documentation and distribution of genetic 'resources of tuber and fruit crops and their wild relatives (1<1 Asha; K Joseph John; R Asokan Nair)

PGR/GEV-BUR-THR-01.03: Augmentation, characterisation, evaluation, maintenance, regeneration, conservation, documentation and distribution of genetic resources of spices, their wild relatives and medicinal & aromatic plants (Z Abraham; M Latha, K Joseph John; S Mani)

PGR/GEV-BUR-THR-01.04: Augmentation, characterisation, evaluation, maintenance, regeneration, conservation, documentation and distribution of genetic resources of tropical vegetables and their wild relatives (K Joseph John; M Latha; R Asokan Nair)

PGR/GEV-BUR-THR-02.00; Use of in vitro technology for mass propagation and conservation of cIon ally I vegetatively propagated crops and their wild relatives (Z Abraham; KI Asha; A Indira Devi)

EXTERNAllY FUNDED PROUECTS

• NAIP Project on Biosystematics of the Genera Vigna, Cucumis and Abe/moschus (Joseph John K. and Latha M,) . • NOVOD Board Project on Multiplication, Conservation and Biochemical Profiling of Kokum (Garcinia indica), a

Potential Source of Edible Oil found in Southern Western Ghats (Z Abraham, Sangita Yadav and M Latha)

REGIONAl STATION, THRISSl R _________ _ 1'51

19. GENERAL INFORMATION

19.1 Institute Management Committee (IMC)

Dr S K Sharma, Director, NBPGR, New Delhi-12 Assistant Director General (Seed), ICAR, New Delhi -110 114 Sh. Surender Singh, C-33/84, Madhopur, Behind MCD Office, Varanasi (U.P.) Dr Sushama Chaphalkar, Director, School for Biotechnology, Vidya Nagiri,

Baramati Dist., Pune, Maharashtra Development Commissioner (Rural), Delhi Government Director (Agri.), Government of Rajasthan, laipur Dr RK Khetarpal, Head, Plant Quarantine Division, NBPGR, New Delhi - 12 Dr SS Malik, Principal Scientist, NRC on DNA FP, NBPGR, New Delhi - 12 Dr KS Varaprasad, Officer in Charge, NBPGR, Regional Station, Hyderabad (AP) Dr KV Prabhu, Head, Division of Genetics, IARI, New Delhi - 12 Sh KK Harnza, Finance & Account Officer, IASRI, New Delhi-12 Ms. Sunita Sharma, Sr. Administrative Officer, NBPGR, New Delhi -12

The 36th and 37th IMC meetings were held on 1 May and 13 October 2009, respectively.

19 \

Chairman Member Member Member

Member Member Member Member Member Member Member Secretary

The XI meeting of the RAC of NBPGR was held under the Chairmanship of Dr YS Nerkar, on August 3-4, 2009. RAC members, all Heads of Divisions, Officers-in-Charge of Regional Stations, Units and Cells, and other scientists attended the meeting.

Dr YS Nerkar Ex-Vice Chancellor, MPKV Rahuri, Village-Ner, Tehsil-Dhule, Distt. Dhule-424 303, (Maharashtra)

Dr V Ramanatha Rao Ex Sr. Scientist, Bioversity International, c/o Ashoka Trust for Research in Environment and Engineering, 659, 5th A main, Hebbal, Bangalore-560 024, (Kamataka)

Dr JL Karihaloo Coordinator, Asia Pacific Consortium for Agricultural Biotechnology, NASC Complex, Todapur, New Delhi -110012

Dr Sujata Arora Additional Director, Ministry of Environment and Forests, Prayavaran Bhavan, CGO Complex, New Delhi - 110 016

Dr OP Dubey Ex AOO (PP), B-9 Green View Apartment, Sector-9, Rohini, Delhi -110 081

Dr SK Sharma Director, NBPGR, Pusa Campus, New Delhi-110012

Dr NO lambhale Assistant Director General (Seeds), ICAR, Krishi Bhavan, New Delhi - 110114 Members (2, non-official), Management Committee, NBPGR, New Delhi

Dr RK Tyagi Principal Scientist, NBPGR, New Delhi-llOOl2

Chairman

Member

Member

Member

Member

Member

Member

Member Secretary

Drs NO lambhale and Sujata Arora were unable to attend the meeting due to some urgent pre-occupation.

152 --~~~~ ANNUALREPORT2OC'f)- IO

1 g 3 Institute Research Council

Chairman- Director NBPGR

Member Secretary- Dr Pratibha Brahmi

The second IRC meeting of the year 2008 was held f'om January 12-14, 2009. The reports of all in- house projects for the period April to December, 2008 were discussed. Chairman IRC in his remarks said that the IRC meeting is an important platform for discussing about the progress made up to December 2008 and recommendations emerged in various committees meetings like QRT, RAC, GAC could be discussed and action on these points could be initiated. He informed that the mandates of each Regional Stations should be presented as assigned by Council and needs to be changed as per the recommendations of the QRT. Presentations by Head of Divisions/ Stations/ Units were made in three days deliberations.

The first IRC for the year 2009 was held form 5-7 August, 2009. Dr. Ramanatha Rao, Member of the Research Advisory Committee, NBPGR, also attended the meeting. The new scientists who joined NBPGR and its regional stations, during last year were welcomed by the house and they introduced themselves. Dr SK Sharma, Chairman, IRC in his remarks welcomed the members of the IRC and new scientists. He emphasized that the presentation by the PIs should be very focused, highlighting only the new or salient achievements during the year. He mentioned that keeping in view that many new scientists have joined, activities of various Divisions and Stations would be strengthened. New Projects sbould

9.5 Personn

Scientific Staff

be proposed by them keeping in view the mandate of NBPGR and expertise of scientists. The Chairman also emphasized that each Regional Station should identify thematic areas related to their mandate and crops assigned, for proposing in- house as well as externally funded projects. The IRC proposed and recommended the name of Dr KK Gangopadhyay as the new member secretary for IRC, with immediate effect.

19.4 Institute Joint Staff Council

Chairman- Director, NBPGR

Staff Side

1. Technical: Sh. Dinesh Chandra Mishra (Secretary Staff Side), Sh Lal Singh: (also Member of CJSC)

2. Administrative: Sh. Ganga Nand, Sh. Yogesh Kumar Gupta

3. Supporting: Sh. Mahesh Ram, Sh. Sanjeev Paswan

Office Side

1. Dr (Mrs.) Veena Gupta, Pr. Scientist: Secretary (Office Side)

2. Ms Sunita Sharma, Sr. Admn. Officer: Member

3. Dr SK Malik, Scientist: Member 4. Dr Arjun Lal, Principal Scientist: Member 5. Shri R P Chamola, F&AO : Member

The IJSC meetings were held on 28 March and 27 June 2009 under the chairmanship of Director NBPGR.

Dr SK Sharma Director Genetics & Plant Breeding

Division of Germplasm Evaluation

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13.

Dr SK Mishra

Dr RK Mahajan Dr SK Pareek Dr Ranbir Singh Dr IS Bisht Dr Ashok Kumar Dr RC Agarwal Dr KK Gangopadhyay Mr NK Gautam Mr Gunjeet Kumar Dr (Ms) Sang ita Yadav Dr (Ms) Archana Raina Dr T V Prasad (w.eJ 17 June, 2009)

Head

Principal Scientist PrinCipal Scientist Principal Scientist Principal Scientist Principal Scientist Principal Scientist Senior Scientist Scientist (SG) Senior Scientist Senior Scientist Senior Scientist Senior Scientist

Gentics & Plant Breeding

Agricultural Statistics Agronomy Economic Botany Plant Pathology Plant Breeding Agricultural Statistics Horticulture Economic Botany Horticulture Biochemistry (Plant Science) Plant Biochemistry Agricultural Entomology

G~,~ORMATION _______________________________________________ ___ 153

14. Dr Mohar Singh (w.e.f 24 June, 2009) Senior Scientist 15. Dr Zakaaullah Khan (w.e.t 25 June, 2009) Senior Scientist 16. Dr Anirban Roy (w.e.t 1 September 2009) Senior Scientist 17. Dr Tej Pal Singh (w.e.f 25 June, 2009) Senior Scientist 18. Dr Mool Chand Singh (w.e.t 17 June, 2009) Senior Scientist 19. Dr Arivalgan M Scientist 20. Dr Rakesh Bhardwaj

(w.e.f 31 December, 2009) Senior Scientist

Division of Plant Exploration and Germplasm Collection

1. Dr 0 C Bhandari 2. Dr (Ms) E Roshini Nair 3. Dr (Ms) Anjula Pandey 4. Dr Rakesh Srivastava 5. Dr KC Bhatt 6. Dr K Pradeep (w.e.f 17 July, 2009) 7 . Dr Anil Kumar Singh (w.e.f 2 July, 2009)

Division of Germplasm Conservation

1. Dr RK Tyagi 2. Dr (Ms) Kalyani Srinivasan 3. Dr (Ms) Veena Gupta 4. Dr (Ms) Neeta Singh 5. Dr Sidheshwar Prasad 6. Dr (Ms) J Radhamani 7. Dr Anjali Kak 8. Dr (Ms) Chitra Pandey 9. Dr Sushi I Pandey

Division of Plant Quarantine

1. Dr RK Khetarpal 2. Dr PC Agarwal 3. Dr Beche Lal 4. Dr (Ms) Usha Dev 5. Dr (Ms) Manju Lata Kapur 6. Dr Rajan 7. Dr DB Parakh 8. Dr Baleshwar Singh 9. Dr (Ms) Shashi Bhalla 10. Dr (Ms) Celia Chalam V 11. Dr (Ms) Kavita Gupta

Germplasm Exchange Unit

1. Dr Arjun Lal 2. Dr Deep Chand 3. Dr Vandana Joshi 4. Dr Vandana Tyagi 5. Dr Nidhi Verma 6. Dr S K Yadav 7 . Ms Anitha Pedapati

Policy Planning

1. Dr (Ms) Pratibha Brahmi

Tissue Culture & Cryopreservation Unit

1. Dr (Ms) Rekha Chaudhary

Pro Scientist & Head Principal Scientist Principal Scientist Senior Scientist Senior Scientist Senior Scientist Senior Scientist

Pro Scientist & Head Principal Scientist Principal Scientist Principal Scientist Senior Scientist Senior Scientist Senior Scientist Senior Scientist Senior Scientist

Pro Scientist & Head Principal Scientist Principal Scientist Principal Scientist Principal Scientist Principal Scientist Principal Scientist Principal Scientist Principal Scientist Senior Scientist Senior Scientist

Pro Scientist & Head Senior Scientist Senior Scientist Senior Scientist Senior Scientist Senior Scientist Scientist

Senior Scientist

Principal Scientist

Plant Breeding Nematology Plant Pathology Plant Physiology Agronomy Plant Biochemistry

Biochemistry

Economic Botany Economic Botany Economic Botany Horticulture Economic Botany Economic Botany Economic Botany

Economic Botany Plant Physiology Economic Botany Plant Physiology Electrical Engineering Plant Physiology Economic Botany Seed Technology Seed Technology

Plant Pathology Plant Pathology Agricultural Entomology Plant Pathology Agricultural Entomology Nematology Plant Pathology Plant Pathology Agricultural Entomology Plant Pathology Agricultural Entomology

Nematology Economic Botany Economic Botany Economic Botany Economic Botany Economic Botany Economic Botany

Economic Botany

Economic Botany

154 ________________ ANNUAl RFPORTJOO9 )11

2. Dr (Ms) Ruchira Pandey Principal Scientist Economic Botany

3. Dr (Ms) Neelam Sharma Principal Scientist Economic Botany

4. Dr (Ms) Anuradha Agarwal Senior Scientist Economic Botany

5. Dr (Ms) Sandhya Gupta Senior Scientist Economic Botany

6. Dr SK Malik Senior Scientist Economic Botany

7. Dr Zakir Hussain Senior Scientist Genetics 8. Dr (Ms) Anju Jain (w.e.f 2 July, 2009) Senior Scientist Economic Botany

Under Utilized & Under Exploited Plants Project

1. Dr RP Oua Principal Scientist Plant Breeding

2. Dr BS Phogat Senior Scientist Agronomy

3. Dr Hanuman Lal Raigar Senior Scientist Agricultural Statistics

DNA Fingerprinting

1. Dr KV Bhat Principal Scientist Plant Breeding

2. Dr (Ms) Gurinderjit Randhawa Principal Scientist Plant Physiology

3. DrMCYadav Principal Scientist Genetics

4. Dr Som Sundar Marla Principal Scientist Bio-informatics

5. Dr Mukesh Kumar Rana Senior Scientist Plant Breeding

6. Dr Sunil Archak Senior Scientist Biotechnology

7. Dr Ambika Baldev Senior Scientist Biotech nology

8. Dr Rakesh Singh Senior Scientist Biotechnology

9. Ms Lalit Arya Scientist (SS) Biochemistry

10. Ms Madhu Bala Scientist (SS) Computer Applications

11. Ms Manjusha Verma Scientist (SS) Biotechnology

12. Sh. Amit Kumar Singh Scientist Biotechnology

13. Dr K Parimalan (w.e.f 18 June, 2009) Scientist Biotechnology

14. Sh. Chet Ram (w.e.f 20 June, 2009) Scientist Biotechnology

Regional Station, Shillong

1. Dr 0 K Hare (upto 30 April, 2009) Pro Scientist & In Charge Economic Botany

2. Dr S K Verma (w.eJ 1 May, 2009) Pro Scientist & In Charge Economic Botany

3. Dr A K Misra (w.e.f. 18, August, 2009) Principal Scientist Economic Botany

Regional Station, Thrissur

1. Dr Z Abraham Pr. Scientist & In-charge Economic Botany

2. Dr Joseph John K Senior Scientist Economic Botany

3. Dr (Ms) Asha KI Senior Scientist Economic Botany

4. Dr (Ms) M Latha Senior Scientist Plant Breeding

Regional Station, Jodhpur

1. Dr NK Owivedi Pro Scientist & In-charge Economic Botany

2. Dr Gopala Krishnan S Scientist Plant Breeding

Regional Station, Ranchi

1. Dr JB Tomar Pro Scientist & In-charge Economic Botany

Regional Station, Shimla

1. OrVO Verma Pro Scientist & In-charge Economic Botany

2. Dr JC Rana Senior Scientist Plant Breeding

GF..NERAl INFORMATION 155

3. Dr K Pradheep (upto 9 July 2009)

Regional Station, Akola

1. 2

Mr Nilamani Dikshit Mr Abdul Nizar

Regional Station, Bhowali

1. Sh KC Muneem 2. Dr KS Negi 3. Dr SK Verma (upto April 6, 2009) 4. Dr AK Trivedi (w.e.f. June 17, 2009)

Base Center, Cuttack

1. Mr Diptiranjan Pani 2. Dr RC Mishra (w.e.f August 3, 2009)

Regional Station, Hyderabad

1. Dr KS Varaprasad

2. Dr RDVJ Prasada Rao (upto 31 July 2009)

3. Dr SK Chakraborty

4. Dr B Sarath Babu

5. Dr (Ms) Anitha Kodaru

6. Dr SR Pandrawada

7. Dr (Ms) Kamla Venkateshwaran 8. Dr Natrajan Siva raj

9. Ms T Rama Srinivasan

10. Mr Sunil Neelam

11. Dr K Rameash (w.e.f 31 December 2009)

Regional Station, Srinagar (J & K)

1. 2.

Dr Om Vir Singh Dr M S Sultan

Scientist (SS)

SCien.tist (SG) & In-charge Scientist (SS)

Principal Scientist Pro Scientist & In-charge Principal Scientist Senior Scientist

Scientist & In-Charge Senior Scientist

Pro Scientist & In-charge

Principal Scientist

Principal Scientist

Principal Scientist

Principal Scientist

Senior Scientist

Senior Scientist

Senior Scientist

Scientist (Senior Scale)

Scientist (Senior Scale)

Senior Scientist

Pro Scientist & In-charge Senior Scientist

Economic Botany

Economic Botany Economic Botany

Plant Pathology Economic Botany Horticulture Plant Physiology

Economic Botany

Nematology

Plant Pathology

Plant Pathology

Agricultural Entomology

Plant Pathology

Economic Botany

Economic Botany

Economic Botany

Horticulture

Economic Botany

Entomology

Plant Breeding Economic Botany

Technical Staff at NBPGR Headquarters and its Regional Stationsl Base Centres

15. 16. 17.

Miss Poonam Suneja T-7-8 (Tech. Officer) Sh Rakesh Singh T-6 (Tech. Officer) Sh Mahabir Singh Rathore T-6 (Tech. Officer)

S. No. NAME DESIGNATION 18. Miss Anshu T-5 (Tech. Officer) 19. Sh Harinder Singh T-6 (Tech. Officer)

NBPGR Headquarters' at New Delhi 20. Sh Ram Singh T-5 (Tech. Officer) 21 . Sh K DJoshi T-6 (Tech. Officer)

1. Sh B P Dahiya T-7-8 (Elect. Engineer) 22. Sh Daya Shankar T-6 (Tech. Officer) 2. Sh Om Prakash T-7-8 (Tech. Officer) 23. Sh Rajiv Gambhir T-6 (Tech. Officer) 3. Sh Jitender Mohan T-7 -8 (Tech. Officer) 24. Dr Dinesh Chand T-6 (Tech. Officer) 4. Sh Abhay Sharma T-5 (Tech.Officer)Shifted 25. Sh Ashok Kumar Maurya T-6 (Tech. Officer) 5. Smt Rita Rani T-6 (Tech. Officer)Shifted 26. Sh Surender Singh Ranga T-6 (Tech. Officer) 6. Sh Charan Singh T-7-8 (Tech. Officer) 27. Sh Axma Outt Sharma T-6 (Tech. Officer) 7. Sh Rajiv Mathur T-7-8 (Tech. Officer) 28. Sh Bharat Lal Meena T-6 (Tech. Officer) 8. Sh C S Raghav T-7-8 (Tech. Officer) 29. Sh Dinesh Chand Mishra T-4 (Tech. Asstt.) 9. Dr (Mrs) Manju Upreti T-7-8 (Tech. Officer) 30. Sh Rita Gupta T-5 (Tech. Officer) 10. Dr Ranbir Singh Rathi T-7-8 (Tech. Officer) 31. Sh Rajvir Singh T-6 (Tech. officer) 11 . Ms Sheela Kumari T-7 -8 (Tech. Officer) 32. Sh Dinesh Kumar Pokhrial T-2 (Lab. Asstt.) 12. Sh. Anil Kumar Singh T-7-8 (Tech. Officer) 33. Sh Rohtash Singh T-2 (Lab. Asstt.) 13. Sh S P Singh T-7-8 (Tech. Officer) 34. Sh Babu Ram T-5 (Tech. Officer) 14. Sh Ram Prasad Yadav T-7-8 (Tech. Officer) 35. Ms Sangeeta Tanwar T-5 (Tech. Officer)

156 _____________ ANNUALREPORT2009-10

36. Sh. Narendra Singh Panwar T-6 (Tech. Officer) 96. Sh Ramit Joshi T-3 (Fieldman) 37. Sh R S Yadav T-S (Tech. Officer) 38. Sh Devendra Kumar Nerwal T-S (Tech. Officer) NBPGR, Regional Station, '"!yderabad 39. Smt Gurvinder Khera T -4 (Telephone

Operator) 97. Sh Babu Abraham T-S (Tech. Officer) 40. Sh Bhopal Singh Panwar T-S (Tech. Officer) 98. Sh R Gunasekharan T-S (Tech. Officer)

41. Sh Y S Rathi T-S (Tech. Officer) 42. Sh Ombir Singh Ahlawat T-4 (Fieldman) NBPGR, Regional Station, Jodhpur

43. Sh Om Parkash (Library) T-4 (lab. Tech.) 44. Sh Satya Prakash T-4 (Elect.!Mech.) 99. Sh B C Bachhawandia T -6 (Tech. Officer)

45. Sh Surender Singh Bhoj T-4 (lab. Tech.) 100. Sh Bhikka Ram Saini T-4 (Sr. Tech. Asstt.)

46. Sh Narendra Pal T-4 (Tech. Asstt.) 101. Sh Kheta Ram T-S (Tech. Officer)

47. Sh Parmesh Kumar T-4 (Tech. Asstt.) 102. Sh Bhatta Ram T-4 (Expl. Asstt)

48. ShAnang Pal T-4 (Tech. Asstt.) NBPGR, Regional Station, Ranchi 49. Sh Ram Chander Yadav T-4 (Field man) 50. Sh Bhawnesh Kumar T-4 (Fieldman) 103. Sh Ashok Kumar Gupta T-S (Tech. Officer) 51. Sh Gopi Chand T-4 (Field man) 52. Sh Ramesh Chander T-4 (lab. Asstt.) NBPGR, Regional Station, Shillong 53. Sh Ram Kumar Sharma T-4 (Field man) 54. Sh Arun Kumar Sharma T-3 (lab. Asstt.) 104. Sh M Goswami T-4 (Expl. Asstt)

55. Sh Dharam Pal Singh Meena T-4 (Fieldman) 105. Sh S N Sharma T-3 (Fieldman)

56. Sh Ram Kuwar T-2 (Fieldman) 106. Sh Sanjeev Kumar Singh T-4 (Tech. Asstt.)

57. Sh Om Prakash, T-3 (Fieldman) 107. Sh Gopal Singh T-1 (Driver)

58. Sh Dilawar Singh T-2 (lab. Tech.) 59. Sh Lal Singh T-2 (Electrician) NBPGR, Regional Station, Shlmla

60. Smt Nirmala Dabral T-2 61 . Sh Poonam Chand Binda T-2

108. Sh Brij Pal Singh T-6 (Tech. Officer)

62. Sh Shashi Kant Sharma T-3 109. Sh Prakash Chand T-2 (Fieldman)

63. Sh Ram Milan T-1 110. Sh Ram Chander T-2

64. Sh Vijay Kumar Mandai T-2 111. Sh Dayal Singh T-1

65. Sh Ram Nandan T-2 66. Sh Harideo Prasad T-2

NBPGR, Regional Station, Thrlssur

67. Sh Naresh Kumar T-2 112. Sh R Ashokan Nair T-6 (Tech. Officer) 68. Sh Sunil Kumar T-2 113. ShS Mani T-5 (Tech. Officer) 69. Sh Virender Prasad T-2 114. Sh T T Veliaudhan T-4 (Fieldman) 70. Ms Smita Jain T-3 115. Smt Indira Devi T-4 71. Sh S K Ojha T-1

Drivers (Headquarter/Reg. Station/ Base Centre) NBPGR, Regional Station, Sri nagar

72. Sh Kishan Nath T-5, New Delhi 116. Sh Diksha Gautham T-4

73. Sh Gordhan Singh T-3, New Delhi 74. Sh Balwant Singh T-2, New Delhi List of Administrative Staff as on Dec. 2009 75. Sh Braham Prakash T-2, New Delhi 76. Sh E N Prabhakaran T-2, Thrissur S.No. Name Designation

77. Sh Joginder Singh T-2,Shimla 78. Sh Khusvinder Kumar T-2, New Delhi

1. Ms Sunita Sharma Sr.Admn. Officer

79. Sh L T Dabekar T-2, Akola 2. Sh R P Chamola F&AO.

80. Sh Mohd. Abas Ali Khan T-2, Hyderabad 3. Shri Parmod Chander Asstt.Admn.Officer,Shimla

81. ShMohan Ram T-2, Bhowali 4. Sh Mahender Kumar Jr. Accounts Officer

82. Sh Narendra Ram T-2, Ranchi 5. Mrs Archna Raghav A.D. (Ol)

83. Sh Ram Balak Rai T-2, New Delhi 6. Sh Umesh Chamdra Sati Security Officer

84. Sh Ravinder Kumar T-2, New Delhi 7. Shri Madan Lal Malik Assistant

85. Sh Dev Sunder T-2, (Tractor Driver) 8. Shri Kulwant Singh Assistant 9. Shri Geetam Kumar Assn Admin. Officer

86. Sh M S Thangkhiew T-1, Jodhpur 10. Sh Girish Chandra Asstt Admin. Officer 87. Sh Wazir Singh T-2, New Delhi 11. Mrs Vijay Laxmi Gulati Assistant 88. Sh Ranjit Singh T-2 New Delhi 12. SM Din Dayal Assistant

13. Mrs Vinay Bala Sharma Assistant NBPGR, Regional Station, Akola 14. Mrs Kuljeet Kaur Assistant

89. ShJ Klngle T-6 (Tech. Officer) 15. Mrs Pratibha Assistant, Shimla

90. ShSGPadam T-2 (Fieldman) 16. Mrs Sonl Laloo Assistant, Shillong

91. Sh M Venkataraman T-1 17. Shri P U Anjankar Assistant, Ranchi 18. Shri Nandan Singh Patwal, Assistant, Showali

NBPGR, Regional Station, Bhowall 19. Shri P Venugopalan Assistant

92. DrPSMehta T-6 (Tech. Officer) 20. Sh S S Wange Assistant

93. Sh V KPant T-5 (Tech. Officer) 21. Shri Dinesh Prasad Assistant

94. ShAS Rana T-5 (Tech. Officer) 22. Sh Subhash Chander Assistant

95. Sh Rattan Ram Arya T-5 (Tech Officer) 23. Mrs R S Latha Devdas Stenographer

GENERALINFORMATION 157

24. 'Mrs V Vijayalaxmi Stenographer 25. Sh Ganga Nand Stenographer 26. Mrs Kanchan Khurana Stenographer 27. Mrs Urmila Stenographer 28. Mrs Poonam Batra Stenographer 29. Mrs Neelam Khatri Stenographer 30. Mrs Dkhar Stenographer, Shillong 31. Sh T V Govindan Stenographer, Thrissur 32. Mrs Yashoda Rani Sr. Clerk 33. Mrs Surinder Kaur Sr. Clerk 34. Sh Surender Kumar Sr. Clerk 35. Mrs Bharti Sharma Sr. Clerk 36. Mrs Savitri Devi Sr. Clerk 37. Mrs Sangeeta Gambhir Assistant 38. Mrs Vijay Laxmi Sharma Sr. Clerk 39. Shri Mahabir Singh Yadav Sr. Clerk 40. Shri Yogesh Kumar Sr. Clerk 41. Mrs Satvinder Kaur Sr. Clerk

19.6 Staff Reservations

Category Total number of Employees

Scientist 128

Technical 117

Administrative 60

Supporting 126

19.7 Staff Transferredl Retiredl New Appointments

19.7.1 Transfers

42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59.

Total number of Scheduled

Caste (SC) Employees

10

14

14

44

1. Dr SK Verma, Principal Scientist transferred to NBPGR, R/S Shillong w.eJ. April 06, 2009.

Mrs Madhu Chawla Sr. Clerk Shri Prabal Dasgupta Sr. Clerk Shri Purushottam Dhoke Sr. Clerk, Akola Mrs Leela Sharma Sr. Clerk, Jodhpur Mrs Radha Rani Sr. Clerk, Hyderabad Shri Sita Ram Sr. Clerk Shri Dinesh Sharma Sr. Clerk Shri J K Singh Sr. Clerk Sh M Srinivasa Rao Sr. Clerk, Hyderabad Sh Sanjay Kumar Lal Sr. Clerk, Cuttack Sh Benny Mathew Sr. Clerk, Thrissur Mrs Lakshmilian Kharnary Sr. Clerk, Shillong Sh Avdhesh Kumar Sr. Clerk Shri Birbal Singh Jr. Clerk, Ranchi Sh San jay Dangwal Sr. Clerk Sh Arvind Kumar Jr. Clerk Sh K C Kundu Jr. Clerk Sh PSuleman Jr. Clerk, Hyderabad

Total number Total number of Scheduled ofOBC

Tribe (ST) Employees Employees

1 12

3 -4 1

5 13

7. Shri Hari Ram, (SSG-IV) superannuated on 31 July, 2009

8. Shri Kheta Ram, (T-5) superannuated on 30 September, 2009

9. Shri TK Mani, SS Gr n, NBPGR R/S Thrissur retired on 30 November, 2009

2. Shri Wazir Singh T-2 Driver, NBPGR HQ was transferred to RlS Srinagar for a period of six months.

19.7.3 Voluntary Retirements

19.7.2 Retirements

158

1. Dr D K Hore, Principal Scientist & Officer In Charge, NBPGR Regional Station, Shillong superannuated on 30 April, 2009.

2. Shri Roshan Lal, SS Grade IV superannuated on 30 April, 2009

3. Shri Devta Das, SS Gr II superannuated on 30 April,2009

4. Smt Rantu Maya, SS Gr III superannuated on 30 May, 2009

5. Dr Deep Chand, Senior Scientist superannuated on 30 June, 2009

6. Dr R D V J Prasada Rao, Principal Scientist (plant Pathology), superannuated on 31 July, 2009.

1. Dr J L Karihaloo, Project Director, NBPGR on 1 February, 2009

2. Shri Om Prakash, SSG, NBPGR on 30 September, 2009

3. Shri Jit Ram, SSG, Issapur farm on 20 November 2009

19.7.4 New Appointments

1. Dr Sushil Pandey, Senior Scientist joined NBPGR HQ w.e.f 16 June 2009

2. Dr TV Prasad, Senior Scientist joined NBPGR HQ w.eJ 17 June 2009

3. Dr Mool Chand Singh, Senior Scientist joined NBPGR HQ w.eJ 17 June 2009

4. Dr AK Trivedi joined NBPGR, R/S Bhowali as a Senior Scientist w.eJ. 17 June, 2009.

5. Dr Parimalan R, Scientist joined NBPGR HQ w.e f 18 June 2009

___ t\\lNl'AI REPORT2009 iO

6. Dr M C Yadav, joined as Principal Scientist at New Delhi on 1 September, 2009.

7. Dr Soma Marla, Principal Scientist joined at New Delhi on 7 September, 2009.

8. Dr Chet Ram, Scientist joined NBPGR HQ w.eJ 20 June 2009

9. Dr Mohar Singh, Senior Scientist joined NBPGR HQ w.eJ 24 June 2009

10. Dr Zakaaullah Khan, Senior Scientist joined NBPGR HQ w.eJ 25 June 2009

11. Dr Tej Pal Singh, Senior Scientist joined NBPGR HQ w.eJ 25 June 2009

12. Ms Anitha Pedapathi, Scientist joined NBPGR HQ w.e.f 26 June 2009

13. Dr Anju Jain, Senior Scientist joined NBPGR HQ w.eJ 2 July 2009

14. Dr AK Misra, Principal Scientist joined RIS Shillong w.eJ August 18, 2009.

15. Dr K Rameash, Senior Scientist, Entomology, joined NBPGR RIS Hyderabad w.e.f 29 December 2009

16. Dr Sheikh M. Sultan, Senior Scientist, joined on August 1, 2009 at NBPGR Reg. Station, Srinagar.

17. Dr Rakesh Bhardwaj, Senior Scientist joined NBPGR HQ w.eJ. 31 December, 2009

19.7.S Expired

I. Shri Shri Bhagwan T-l, RlS Jodhpur expired on 12 March 2009.

2. Shri Sanbor War, S S Gr III, RlS Shillong expired on 29 June 2009

3. Shri PU Anjankar,Assistant, RlS Ranchi expired on 30 June 2009

4. Shri T V Govindan Stenographer, RlS Thrissur expired on 30 June 2009

5. Shri S G Padam, T-2 Field man expired on 9 September 2009

19.8 Promotions of Staff

1. Dr R K Tyagi promoted to Head, Germp1asm Conservation Division on 29 April 2009

2. Dr A K Singh, Technical Officer, NBPGR HQ selected as Senior Scientist and joined Exploration Division at NBPGR Headquarter, New Delhi on 2 July 2009

3. Dr K Pradheep, Scientist Sr. Scale, NBPGR, Regional Station, Shimla selected as Senior Scientist and joined Exploration Division at NBPGR Headquarter, New Delhi on 10 July 2009

4. Dr Chitra Pandey, Scientist Sr. Scale, NBPGR, New

Delhi selected as Senior Scientist and joined Germplasm Conservation Division on July 162009

5. Dr. Gopala Krishnan S., Scientist selected as Senior Scientist (Plant Breeding) in IARI, New Delhi and been relieved on the afternoon of 31 December 2009

6. Shri R P Yadav and Shri B P Dahiya Technical Officers, NBPGR HQ promoted to T-7 -8 and T-9, respectively.

7. Shri KC Kundu, LDC was promoted to UDC on 12 November 2009

19.9 Awardsl Honoursl Prizes

1. Dr. S.K. Verma received "Bioved Environment Conservation Award 2008" in the area of Horticulture at the occasion of "11 th Indian Agricultural Scientists and Farmers Congress" held at Allahabad, UP by the Bioved Research Institute of Agriculture & Technology-a research Institute of Bioved Research Society on Feb 14-15,2009.

2. Dr. N.K. Dwivedi, Gopa1a Krishnan, S. and Raju Ram S. Meghwal received Best Poster Award from Indian Society of Pulses Research and Development, I1PR Kanpur during the International Conference on Grain Legumes on February 14-16.2009.

3. Ms. Radha Rani. Sr Clerk was awarded the Best Worker Award for the year 2008-2009

4. Sh. Jogeshwar Rai, SSG IV (Mali), received hest worker award from honorable Sh. A.K. Upadhyay Secretary (ICAR) on NBPGR foundation day at NBPGR, New Delhi on August 1, 2009.

7. Dr Sandhya Gupta received the 'Best Poster Award' for the poster entitled 'In Vitro Production of Apple Seedling Rootstock' in National Symposium on 'Recent Developments in the Management of Plant Genetic Resources' at NBPGR, New Delhi, December 17-18, 2009.

8. Mr Sunil received the 'Best Poster Award' for the poster entitled "Adaptive response of Jatropha genotypes for elevated Co

2" in National Symposium

on Recent Global Developments in the Management of Plant Genetic Resources" at NBPGR, New Delhi, December 17-18, 2009

9. Dr Nidhi M Verma was awarded Young Scientist Award 2009 by Society for Recent Development in Agriculture (SRDA), Meerut during I st Agricultural Scientist and Farmers Congress, 2009.

10. Dr Anirban Roy was awarded the prestigious Pran Vohra Award for the year 2009-2010 by the Indian Science Congress Association, Kolkata.

G~RAL~ORMATION _______________________________________________ __ 159

II. Dr TV Prasad was conferred with AZRA Fellow Award 2008 by the Applied Zoologists Research Association, Central Rice Research Institute, Cuttack for his contributions in the field of Applied Zoological Research.

Dr. N.K. Dwivedi, OIC, receiving best poster award at IIPR, Kanpur, during an International Conference on Grain

Legume on Feb. 16, 2009

19.10 Deputationsl Visits Abroad

160

• Dr SK Sharma participated in International Conference on Food Security and Climate Change in the Dry Areas at Amman, Jordan from 1-4 February 2009.

• Dr RK Khetarpal was nominated by FAO as TCDC Expert on Plant Pest Risk Analysis under the project TCP/CMB/3104 at Phnom Penh, Cambodia for 7 days from 15 to 21 March 2009.

• Drs Anuradha Agrawal, Neelam Sharma, Ruchira Pandey and Sandhya Gupta attended the 'International Symposium on Cryopreservation in Horticultural Species' held at Leuven, Belgium from 5-8 April 2009.

• Dr SK Sharma participated in the GIGA International Steering Committee Meeting, Bioversity International, Rome, Italy from 18-19 May 2009.

• Drs RK Tyagi and Anuradha Agrawal attended a training on "Technological and Management Aspects of Banana Cryobanking" at the Katholieke Universitiet Leuven, Leuven, Belgium from June 7-22,2009.

• Dr Pratibha Brahrni was deputed to attend the third Governing Body meeting of International Treaty on Plant Genetic Resources for Food and Agriculture (ITPGRFA) at Tunis, Tunisia from 1-5 June, 2009.

• Dr PC Agarwal was nominated by FAO as

International Consultant under project UTFILIBI 026ILIB on Seed Pathology and Health Testing from 10-26, June 2009

• Dr SK Sharma participated in the First National Focal Points Meeting of Project GCPIRAS/JPN

at FAO Regional Office for Asia and the Pacific, Bangkok, Thailand from 29-30 June, 2009

• Dr RC Agrawal was invited by Food and Agriculture Organization of the United Nations at its Regional Office, Bangkok, Thailand from 2-3 July 2010 for the training for trainers on the National Information Sharing Mechanism -Global Plan of Action (NISM-GPA) (GCPIRASI

240/JPN.

• Dr SK Sharma participated in International Symposium on "Plant Genetic Resources and Its Application at Chungnam National University, Daejeon City, Korea from 21-22 September, 2009.

• Dr RC Agrawal was invited as International Consultant of the Food and Agriculture Organization of the United Nations for assistance in the development of database related to National Information Sharing Mechanism (NISM) in Bhutan from 21-25 December, 2009.

• Dr RC Agrawal was invited as International Consultant of the Food and Agriculture Organization of the United Nations for establishment of information system for the seed information system in Iran (Seed and Plant Certification and Registration Institute) from 28 December 2009 to 4 January, 2010.

• Dr RK Khetarpal was nominated by FAO as International Consultant-SPS Subject Specialist­Phytosanitary Measures for Cambodia for 42

Dr RC Agrawal during a demonstration session at SPCRI, Karaj, Iran

_________ ANNUAlREPORT2()()Q to

days during November 25,2009 to January 12, 2010.

19.11 Library and Documentation Services

NBPGR library is a special library on plant genetic re sources management scientists, technical staff, . esearch associates, students and trainees are regular users of the library. Library maintained its designated services and activities of acquisition of books and journals, exchange of literature, cataloguing and documentation. During the year, 443 books related to various aspects of PGR management and Hindi literature were added to Headquarter and Regional Stations libraries through purchase and exchange basis. Library procured 69 journals including 30 foreign journals and 39 Indian through subscription/gist and exchange for the use at the Headquarters and different regional stations. Newspaper clipping services related to PGR and its related subjects were provided to readers regularly at headquarters. Library possesses AGRIS, AGRICOLA, CABSAC, CAB-CD and PLANT GENE database. Bureau's publications were provided to over 270 different organizations in India and abroad and in return 260 publications as gratis received from various organizations. NBPGR Annual Report, Newsletters, Crop Catalogues, Brochures and other publications were distributed to various trainees and visitors from India and abroad.

19.12 Field Days Organized

Germplasm field days organized at NBPGR, New Delhi: To promote germplasm utilization Germplasm Field Days were organized for different crops. These were for Brassica (13 March 2009), Rabi pulse crops (1 9 March 2009), Wheat, Barley and Triticale (26 March 2009), Maize (18 September 2009), Kharif pulses and okra (14 October, 2009). A large number of participants from different parts of country belonging to ICAR institutes, State Agricultural Universities, Govt. Departments, NGOs and private organizations

Participants of Pulses Field day

participated in the Germplasm Field Days. The scientists/ research workers selected the material of their choice.

Field Day Organized at Regional Stations

A field day for Rabi crops was organized at the Regional Station, Akola on February 21, 2009. A total of 1158 accessions of Amaranthus, 1010 acces. of chick pea, 517 accessions of safflower, 193 acces. of linseed and 119 accessions of grass pea were on display. A total of 50 participants toured the experimental fields and selected germplasm with desired characters.

A sorghum Field Day was jointly organized by NBPGR RS Hyderabad and Project Directorate for Sorghum Research on 26.03.09. Ten Sorghum Breeders from PDSR and the AICSIP centers visited the Field. A total of 17 accessions were selected for various traits as seed boldness, luster, fodder quality and yellow grains. Seven accessions registered for specific traits: chillies (2), wild tomato (2), cowpea (10) and Jatropha (2) along with 10 promising accessions including black gram (4), green gram (4) and brinjal (2) were sown for display.

A field day on rice, Abelmoschus, Cucumis and Dioscorea species was conducted on 15 September 2009 at RlS Thrissur for the benefit of crop improvement scientists. A total of 65 participants representing students, scientists of SAUs from Kerala and Tamil Nadu attended. A total of 1143 accessions was exposed to the

Okra Field Day

Participants of field day selecting desirable types in Chick pea

(JENERALINFORMATION __________________________ _ 161

Participants of field day selecting desirable types in Grain Amaranth germplasm

Participants of field day selecting desirable types in Linseed

participants. Selection of desirable germplasm was carried out by the scientists. In the afternoon, a wrap-up session was conducted where the scientists of the station interacted with the participants. In the afternoon, forty­four students representing Horticulture College, KAU, III year B.Sc.(Ag.) were briefed on the importance of PGR of various crops of Southern Western Ghats including their wild/weedy relatives and on the role of NBPGR in the collection, conservation, documentation and management of PGR in India. They were also taken around the facilities of the station including the farm.

International Day for Biological Diversity Celebrated on 22 May 2009

The International Day for Biological Diversity (IDB) is an UN-sanctioned international day to increase understanding and raise awareness on biodiversity issues and is celebrated every year on May 22. The theme for the IDB in 2009 was Invasive Alien Species (lAS) - one of the greatest threats to biodiversity, and to the ecological and economic well­being of society and the planet. The Day was celebrated in two phases- one in the forenoon with more than 50 students from schools and colleges in and around Delhi. Competitions were organize on essay writing, debate and a quiz for the younger children. The children showed keen interest and enthusiasm for participation. An exhibition was arranged on the occasion with more than 20 posters

displayed, photographs from last year's celebrations and display of seed samples of invasive species. The best entries were given prizes.

A joint programme was organized on the occasion by Indian Council of Agricultural Research, Ministry of Environment and Forests and the National Biodiversity Authority (NBA) at National Bureau of Plant Genetic Resources. The Chief Guest of the function was Dr B S Parsheera. Special Secretary, MoEF and the Chainnan for the function was Dr C D Mayee, Chainnan ASRB. The other dignitaries included Dr P L Gautam, Chairman, NBA, Dr S K Sharma, Director NBPGR, Dr R S Rana Ex-Director, NBPGR, and several eminent scientists from ICAR, IARI and NBPGR. A Souvenir on the Theme­Invasive Alien Species- A Threat to Biodiversity, and the Hindi translated version of the National Biodiversity Action Plan were released. A couple of leaflets published by NBPGR and NBA were also released on the occasion. Eminent scientists highlighted the impor1ant invasive alien species of plants (Dr JG Varshney. DWSR, Jabalpur), pests and diseases of plants (Dr RK Khetarpal, Head, Plant Quarantine, NBPGR) and animals including fishes and their pests and diseases (Dr K K Vijayan. Director, CMFRI, Cochin).

A documentary film especially produced by NBA and directed by Mr Ajay Kanchan made for the occasion entitled "Deadly Neighbours- The World of Invasive Alien Species" was also released and screened. The documentary was anchored by Mr Mahesh Bhatt, the renowned Indian film maker.

The International Day for Biological Diversity was also celebrated at RlS Thrissur in the form of a Seminar

Celebration of the International Day for Biological Diversity at this Station on the theme "Biodiversity and Invasive Alien

Species" at RlS Thrissur

162 ------____________________ A~NUALREPORT2009- l(l

with two lectures by Dr. Joseph John K., Senior Scientist, NBPGR on "Biodiversity and Invasive Alien Species" and Dr. C.T. Abraham, Professor and Head, AICRP on Weed Control, KAU on "Invasive Alien Species - A Threat to Biodiversity", in order to generate awareness among students of College of Forestry, KAU, Vellanikkara. Eighteen students including 6 girl students of final year B.Sc. Forestry attended the same. Celebratation of International Day for Biological Diversity by

seed sowing of different medicinal plants of arid and semi­arid region Staff at RlS Jodhpur.

Celebration of Hindi Week at Regional Station, Thrissur, Kerala

• 'Hindi Week' was observed from 23/09/2009 to 0311012009. On 23/09/2009, Dr. Jagdish Kumar, AssociaU Professor and Assistant Director, KVK, KAU, Thrissur gave a talk on the activities of KVK, Thrissur ir Hindi. Subsequently, on all working days Hindi classes were held between 12.00- I 3.00 hours for impartin~ functional knowledge in Hindi to the staff who have not learnt Hindi at school. Similarly, between 15.30 tc 16.30 hours practical lessons in the use of Hindi as official language was imparted using the teaching aic provided by the Thrissur TOLle. This was attended by all members of the staff.

19.13 Workshops! Group meetings! Trainings organized during 2009

SN Title of the programme Duration Venue

1. Winter school on "Biosecurity and 4 january- 3 February NBPGR, New Delhi Biosafety: Policies, Procedures and Issues"

2. National Symposium on "Plant Pathology 27-28 February NBPGR, New Delhi in the Changing Global Scenario"

3. One-Day Brainstorming on "Management 21 April NBPGR, New Delhi of Horticultural Crop Genetic Resources"

4. One day brainstorming for "On Farm 23 May NBPGR, RlS Shimla Conservation and Promotion of cultivation of' at CSK-HPKV Hill Agriculture Traditional Mountain Crops and varieties" and Extension Centre,

Bajura, Kullu (HP).

5. An International training course on 9-21 November NBPGR, New Delhi 'In Vitro and Cryopreservation Techniques for Conservation of Plant Genetic Resources"

6. Short-term course on "Current Regulations 10-19 November NBPGR, New Delhi and Policies for Access to Genetic Resources"

7. SAARC Workshop on "Development and 23-25 November NBPGR, New Delhi Harmonization of SMRC Quarantine Network"

8. National Symposium on "Recent Global 17-18 December NBPGR, New Delhi developments in the Management of Plant Genetic Resources"

9. Group Meeting on "Quarantine of Oil Palm" 19 December NBPGR, New Delhi

10. One day training programme on "Kiwi 23 December NBPGR, RlS Bhowali production"

( iENERALINFORMATION ---- ------------------ 163

\

Inaugural Session of Winter School on "Biosecurity and Biosafety: Policies, Procedures and Issues

. Participants of the short-term course on "Current Regula­tions and Policies for Access to Genetic Resources'

One day kiwi training programme was organized at Village Rangchaura, Block Gairsain, Dist. Chamoli, Uttarakhand on dated Dec. 23, 2009 and distributed >200 grafted plants to the villagers

National Symposium on 'Recent Global Developments in the Management of Plant

Genetic Resources' organized at NBPGR, New Delhi

A National Symposium on 'Recent Global Developments in the Management of Plant Genetic Resources' was held from 17-18 December at NBPGR. It was organized by the Indian Society of Plant Genetic Resources (ISPGR) in collaboration with NBPGR, New Delhi, with the objective of providing a forum for discussion among the researchers and other stakeholders regarding the management of PGR in the era of some recent global

Drs RS Paroda, RB Singh and SK Sharma releasing the

Souvenir and Abstracts Book

Participants of SAARC Workshop on Development and Harmonization of SAARC Quarantine Network

Group Meeting on Quarantine of Oil Palm

One day brainstorming for "On Farm Conservation and Promotion of cultivation of Traditional Mountain Crops and

varieties" at Bajura (HP)

issues and develop suitable strategies for their efficient conservation and sustainable utilization including adaptation to climate change.

To mark the occasion, a Book of Souvenir cum Abstract and a Year Book of ISPGR were released by the dignitaries. The ISPGR website was formally launched by the Chief Guest and a film on NBPGR, entitled 'A Journey of Plant Genetic Resources' was released.

A total of 400 participants including scientists, researchers, students and policy makers from allover India participated in the symposium. The theme areas on which deliberations were made, included: • New technologies and approaches in PGR

management • Access and benefit sharing mechanism in PGR • Climate change and PGR management • Exchange and safe movement of germplasm

164 _________________________ ANNUALREPORT2009-10

19.14 Participation of Staff in Seminars! Symposia! Conferences! Workshops! Training Programmes

Name of Employee

J.B.Tomar

Anitha Kodaru, Radha Rani and M. Srinivasa Rao

N. Sivaraj

R.K. Tyagi and Sandhya Gupta

Title of Seminarl Symposium! Conference! Workshop! Training

programme

National Seminar-cum-Sellers-Buyers Meet on medicinal plants

Training Programme for Consortia Partners on Procurement related matters and Financial Management System

National Symposium on Vegetable oils scenario: Approaches to meet the growing demands

4th World Congress on Conservation Agriculture

K.K. Gangopadhyay XXVII Group Meeting on AICRP (Vegetable crops)

N.K. Dwivedi and Gopala Krishnan S.

K. Pradheep

K.S. Varaprasad

N.Sivaraj

Rekha Chaudhury

J.C. Rana

Vandana Tyagi and GJ Randhawa

J.B.Tomar

Ashok Kumar

K.S. Negi and S.N.Ojha

B.S. Phogat, R. P. Dua and H. L. Raiger

J.B.Tomar

M. Abdul Nizar

J.B.Tomar

International Conference on Grain Legumes: Quality Improvement, Value Addition and Trade

National Conference on Medicinal Plants of Himalayas-Traditional Uses and Conservation Issues

39th Annual Group Meeting of All India Coordinated Sorghum Improvement Project

One day Meeting on Medicinal and Aromatic Plants: Production and Marketing Opportunities - Buyers and sellers coordination meet

National Workshop on Seribiodiversity Conservation

National Seminar on Need of Forestry Research and Diagnostic Studies for Rural Development

Conference on Open Access to Science Publications: Policy Perspective, Opportunities and Challenges

Workshop on Strategy for Conservation of Farm Animal Genetic Resources

All India Maize Research Workers Group Meet

1st Annual Workshop of NAIP-IV

20th Group Meet of AICRN on Underutilized Crops

Seminar on- "Potentialities of CeRA in NARS"

44th Annual Pearl Millet Research Workers Group Meeting

Launch Workshop of NAIP on "A Value Chain of Lac & Lac based products for domestic and export market

(11 ~'ERALINFORMATION ___ _

Place and period

BAU, Ranchi, 28-30 January 2009

NAARM, Hyderabad, 29-30 January 2009

Indian Society of Oilseeds Research, Hyderabad, 29 - 31 January 2009

New Delhi, 4-7 February 2009

TNAU, Coimbatore,

12-15 February 2009

IIPR, Kanpur, 14-16 February 2009

HNB Garhwal University, Srinagar, Uttarakhand, 19-21 February 2009

College of Agriculture, RVSKW, Indore, 27-28 February 2009

AP Horticultural University under the aegis of NMPB, Hyderabad, 27 February 2009

CSGRC, Hosur, TN 7-8 March 2009

HFRI, Shimla, 24 March 2009

India Habitat Centre, New Delhi, 24 March 2009

TAAS, New Delhi, India & BAU, Ranchi, Jharkhand, 10 April 2009

UAS, Dharwad, 10-12 April 2009

IVRI, Bareilly, UP, 13-15 April 2009

GBPUAT, Ranichauri, 18-19 April 2009

IINRG (ICAR), Namkum, Ranchi, 28 April 2009.

M.P.K.v., Rahuri, 28-30 April 2009

IINRG, Ranchi, 30 April 2009

165

N.K. Dwivedi and Gopala K.S.

N.K. Dwivedi and Gopala K. S.

National Seminar on "Arid Legumes: Yesterday, Today and Tomorrow"

Silver Jubilee Workshop of Arid Legume

CAZRI, Jodhpur, 14 May 2009

CAZRI, Jodhpur, 15-16 May 2009

K.S. Negi and CIC meeting of the NAIP funded sub-project on "Biosystenatics of NBPGR, New Delhi, 18 May 2009 Gopala Krishnan S. the Genera Vigna, Cucumis and Abelmoschus

K. S. Varaprasad, S. R. Pandravada, T. Rama Srinivas and N. Sunil

Ranbir Singh

J.B.Tomar

J.B.Tomar

z. Abraham and K.K. Gangopadhyay

K. S. Varaprasad

S.K. Sharma, J.C. Rana, and S.K. Malik

Ranbir Singh

J.C. Rana and VD. Verma

K.C. Bhatt and A.K. Singh

Rakesh Singh Z. Abraham

Vandana Tyagi

T. Rama Srinivas and N. Sivaraj

Mohar Singh

J.C. Rana

Ranbir Singh

D.R. Pani

N. Sunil

K.S. Varaprasad, B. Sarath Babu, N.Sivaraj and Kamala V.

166

Workshop on "Invasive alien species - A great threat to Agriculture" ANGRAU, Rajendranagar, Hyderabad, 19 May 2009

Annual Research Workers' Group Meeting on Sunflower and Castor

IX Annual Workshop of Sesame & Niger Research Workers

29th Kharif Research Council Meeting

20th Group Meeting of All India Network Project on Spices

Launch Workshop of the NAIP Project on Development and maintenance of the Rice Knowledge Management Portal

9th Agricultural Science Session of Indian Science Congress

XVI Annual Research Workers' Group Meeting on Rapeseed mustard

Information Technology Applications in Horticultural Crops

IV EDUSAT Training Programme on "Basics of Remote Sensing, GIS & GPS"

Annual Review Meeting of Rubber Research Institute of India

Celebrating Women in Science Nehru Memorial Museum & Library,

Seminar on "Nano technology and Agro biodiversity"

Workshop on Genetic Diversity Analysis of Germplasm­Methods and Uses

National Workshop on Role of Gyan Choupals in Spreading Climate literacy & in building sustainable food and water security

Annual Research Workers' Group Meeting on Linseed and Safflower

Training programme on Experimental Design and Data Analysis

Review meeting of the RSAD funded bio-diesel crops

Seminar on Cow Based Organic Farming-Sustainable Rural Development

Junagarh University, Gujarat, 21-23 May 2009

BAU, Ranchi, 28-30 May 2009

BAU, Ranchi, 2-3 June 2009

TNAU, Coimbatore, 6-8 June 2009

DOR, Hyderabad, 16 June 2009

SKUAST (K), Srinagar, 22-24 June 2009

College of Agriculture, Nagpur, 6-8 August 2009

CPRI, Shimla, 24-25 August 2009

IARI, New Delhi, 12 August - 30 October, 2009

Kottayam, Kerala, 17 -18 August 2009

Teen Murti House, 19 August 2009

Directorate of Rice Research, Hyderabad, 28 August 2009.

ICRISAT, Hyderabad, 1-5 September 2009

NAAS Complex, New Delhi, 2-3 September 2009

OUAT, Bhubaneshwar, 3-5 September 2009

CRRI, Cuttack, 7-11 September 2009

A.P. Secretariat, Hyderabad, 19 September 2009

Vishwa Mangala Gow-Grama Yatra, Agricultural College Auditorium, Hyderbad, 25 September 2009

_____________________ ANNlJALREPORT2009· JO

Nidhi M Verma

Rekha Chaudhury

T.P.Singh

Dua R.P., B.S. Phogat and H.L. Raiger

Vandana Tyagi

K.K. Gangopadhyay and K.S. Varaprasad

S.K. Sharrna J.C. Rana and N. Sivaraj

R.K. Khetarpal, P.C. Agarwal, D.B. Parakh, B. Singh, V. Celia Chalam, Kavita Gupta, Anirban Roy, Dinesh Singh and Ashok Maurya

A.K. Trivedi

Z. Abraham

J.C. Rana

Sandhya Gupta

1st Agricultural Scientist and Farmers Congress on "Technological Innovations for Enhancing Agricultural Production"

National Seminar on Spices

Winter School on training and capacity building on application of ionising and non ionising Energies in Agriculture.

National Symposium on Achieving Millennium Development Goals: Problems & Prospects

National Workshop on Climate Change and the Himalayan Ecosystem Experiences Referrals

6th Solanaceae Genome Workshop (SOL 2009)

International Conference on Horticulture

5th International Conference on Plant Pathology on "Plant Pathology in the Globalized Era"

Short term course on Current Regulations and Policies for Access to Genetic Resources

Biennial Workshop on Tropical Fruits

National Conference on Forestry Solutions: Strategies for Mitigation and Adaptation of the Impacts of Climate Change in Western Himalayan Mountain States

International Seminar on 'Meeting Challenges of Global Wheat Production: A Tribute to Dr. Norman E. Borlaug'

R.K. Khetarpal, SAARC Workshop on Development and Harmonization of Arjun Lal, PC Agarwal, SAARC Quarantine Network B Lal, Rajan, V Celia Chalam and Kavita Gupta

N.K. Dwivedi and Gopala Krishnan S.

Archana P. Raina

Sang ita Yadav, Poonam Suneja

Sangita Yadav, Poonam Suneja

Kavita Gupta

All Scientific, Technical staff of NBPGR, New Delhi and Regional Stations

International Conference on "Nurturing Arid Zones for people and the environment: Issues and Agenda for the 2151 Century"

2nd International Symposium on Medicinal and Nutraceutical Plants

Recent techniques in Nitrogen Estimation

Mass Spectrometry in India

Regional Workshop on Quality Seed in SAARC Countries

National Symposium on "Recent Global Developments in the Management of Plant Genetic Resources"

G~~ORMATION __________________ _

CCS University, Meerut, 3-4 October 2009

SKUAST, Jammu, 22-24 October 2009

NRL, IARI New Delhi, 4-24 November 2009

IGFRI, Jhansi, 25-26 October, 2009

INSA, New Delhi, 6-7 November 2009

Le Meridien, New Delhi, 8-13 November 2009

Dr. P.N. Agricultural Science Foundation, Banglore 9-11 November 2009

IARI, New Delhi, 10-13 November 2009

NBPGR, Pusa Campus, New Delhi, 1 0-19 November 2009

KAU, Vellanikkara, 16- 19 November 2009

Dept. of Information and Public Relations, Shim la, 19-21 November 2009

NASC, Pusa, New Delhi, 21-22 November 2009.

NBPGR, New Delhi, 23-25 November 2009

CAlRI, Jodhpur, 24-28 November 2009

AIIMS, New Delhi, 25 -27 November 2009

IARI, New Delhi, 27 November 2009

Siddhartha Hotel, New Delhi,

11 December 2009

NASC Complex, New Delhi, 16-18 December 2009

NBPGR, New Delhi, 17-18 December 2009

167

Dua R.P., International Conference on Food Security and Environmental Sustainability

liT, Kharagpur, H.L. Raiger and B.S. Phogat

17-19 December 2009

J.B.Tomar and S.K. Mishra

Seminar on Designing Crops For C.hanging Climate Birsa Agri. Univ., Ranchi, 30-31 December 2009

19.15 Publications

19.15.1 Research Papers

168

1. Arjun Lal, Deep Chand, Vandana Tyagi, Nidhi Verma, SK Yadav, Vandana Joshi, SP Singh and Surender Singh (2009) Important Crop Germplasm Introduced in India during 2008. Indian J. Plant Genet. Resour. 22(1): 53-57.

2. Bhatt KC, A Pandey and N Sharma (2009) 'Ladakhi tea' Bidens pilosa L. (Asteraceae): A cultivated species in the cold desert of Ladakh Himalaya, India. Genetic Resources and Crop Evolution 56: 879-882.

3. Bhatt KC, Pandey, OP Dhariwal, NS Panwar and DC Bhandari (2009) 'Tum-tbang' (Crotalaria tetragona Roxb. ex Andr.): a little known wild edible species in the northeastern hill region ofIndia. Genetic Resources and Crop Evolution 56:729-733.

6. Chalam VC, DB Parakh, RK Khetarpal, AK Maurya and Digvender Pal (2009) Interception of seed-transmitted viruses in broad bean (Vida Faba L.) germplasm imported into India during 1996-2006. Indian Journal of Virology 20 (2): 83-87.

7. Chandra S, Shweta Verma, Usha Dev and Nidhi Joshi (2008). Tetraaza macrocyclic complexes: synthesis, spectral and antimicrobial studies (2008). Journal of Coordination Chemistry 62 (8): 1327-1335.

8. Dev Usha, PC Agarwal, B Singh, N Joshi, Dinesh Chand, AK Maurya, KD Joshi and RK Khetarpal (2008) Seed-borne Pathogens Intercepted in Germplasm Introduced in India During 2005-06. Indian J. Plant Genet. Resour. 20: 226-233.

9. Dikshit N and P Swain (2009) Evaluation for yield of traditional upland rice cultivars of Orissa. Oryza 46(3):248-249.

10. Dikshit N, SG Bharad and MP Badge (2008) Diversity in custard apple germplasm collections from Maharashtra, India. J. Plant Genet. Resour.21 (1): 82-84 (appeared 2009).

11. Dinesh Singh, Mohar Singh and RK Gupta (2009) Characterization of pecan germplasm of seedling origin through regression and principal component analysis. Indian J. Agric. Sci. 79 (4): 324-326.

12. Dwivedi N K and Gopala Krishnan (2009) IC418452- a unique extra bold seeded germplasm accession of mungbean (Vigna radiata (L.) Wilczek). J. Arid. Legumes 6(2): 78-80.

13. Dwivedi NK (2009) Evaluation of vegetable guar (Cyamopsis tetragonoloba (L.) Taub.) germplasm. J. Arid. Legumes 6(1) : 17-19.

14. Dwivedi NK (2009) Indigenous herbal therapy for controlling diabetes in parts of arid and semi-arid regions of Rajasthan, India. Research Link - 60, VIII1 : 18-19.

15. Dwivedi NK (2009) Retile Shushk Pradesh Ki Lupt hoti Jadi-buti: Hernkand (Maerua oblongifolia). Research Link - 69, Vol. vm (10): 62-63.

16. Dwivedi NK, DC Bhandari, Gopala Krishnan Sand RR Meghwal (2009) Plants used for curing piles in add and semi-arid regions of western Rajasthan, India. J. Econ. - Taxon. Bot. 33(4): 787- 802.

17. Dwivedi NK, Gopala Krishnan, S Neelam Bhatnagar and Bhag Chand (2009) Characterizing white seeded cowpea (Vigna llnguiculata(L.) Walp) germplasm in arid region . J. Arid Legumes 6(2) : 84-86.

________ ANNCALREPORT 2009- 10

20. Gangopadhyay KK, SK Yadav, Gunjeet Kumar, BL Meena, RK Mahajan, SK Mishra and SK Sharma (2009) Correlation, path coefficients and genetic diversity in Fenugreek (Trigonella foenum graecum ). Indian J Agril. Sciences. 79(7):521-26

22. Gupta D and SK Sharma (2009) Inheritance of some qualitative characters in cultivated x wild lentil subspecies crosses. J. Genet. & Breed. (In press).

26. Gupta S, D Chauhan and M Bala (2008) Micropropagation of [Aegle marmelos (L.) Corr.l-An indigenous medicinal fruit of India. J. Plant Genet. Resour. 21(3): 213-216 (appeared 2009).

27. Gupta V, A Kak, C Devi, M Bhardwaj and K Dashora (2009) Comparative analytical studies on two species of Morinda - The modem day sanjivani . IntI. Jour. For. Usuf Mngt. 10 (1): 34-38.

28. Kak A, C Devi and V Gupta (2009) Assessment of viability of Jatropha curcas L. seeds through tetrazolium test. Seed Sci. Technol., 37: 512-515.

29. Kak A, C Devi, V Gupta, M Bhardwaj, and K Dashora (2009) Effect of sulphuric acid pre-treatment on breaking hard seed dormancy in diverse accessions of four wild Corchorus species. Seed Sci. Technol., 37: 568-572.

30. Kamala V, HC Sharma, D Manohar Rao, KS Varaprasad and PJ Bramel (2009) Wild relatives of sorghum as sources of resistance to sorghum shoot fly Atherigona soccata. Plant Breeding 28(2): 137-142.

31. Katoch V, Susheel Sharma, S Pathania, DK Banayal, SK Sharma and R Rathour (2009) Molecular mapping of pea powdery mildew resistance gene er2 to pea linkage group ill. Mol. Breeding. DOl 10.1oo7/s11032-009-9322-7 (Online publication).

32. Kumar Ramesh, MS Kanwar and Mohar Singh (2009) Manifestation genetic diversity in European Carrot in dry temperate zone of North Western Himalayas. Adv. Hort. Sci. (Italy) 23 (2): 71-74.

33. Latha M, S Mani, Baby Lissy Markose, Z Abraham, R Asokan Nair, Hanuman Lal and SK Mishra (2009) Collection and characterisation of field bean (Lablab purpureus (L.) Sweet var. purpureus). Indian J. Plant Genet. Resour. 22 (2): 93-97.

35. Mandal S, Poonam Suneja, S Hussain, DK Hore and Nidhi Verma (2009) Seed Oil Quality of Perillafrutescens (L.) Britt. Genotypes. Indian J. Plant Genet. Resour. 22 (2):123-128.

36. Mehta PS, AK Sharma, KS Negi and KC Muneem (2008) Traditional crop diversity in Kumaon Himalayas of Uttarakhand state-A case study. J. Pi. Genet. Resour. 21(3): 159-166 (appeared in 2009).

37. Mehta PS, Anjula Pandey, KC Bhatt and A K Sharma (2008) Inventorying plant genetic resources of religious importance: a case study of farming community of Kumaon Himalaya, Uttarakhand, India. Indian J. Plant Genet. Resour. 21(2):65-73 (appeared 2009).

38. Mehta PS, KS Negi and A K Sharma (2008) Traditional rice landraces of district Bageshwar, Uttarakhand and their conservation. J. Pi. Genet. Resour. 21(1): 55-59(appeared 2009).

39. Mishra AC and KS Negi (2009) Effect of organic manures and chemical fertilizers on the performance of a newly introduced crop Clarysage (Salvia scalarea Linn.) in the Uttarakhand. Natural Product Radience. 8(2): 158-161.

40. Misra RC and D Sahu (2009) A contribution to the flora of Niyamgiri hills, Orissa. India. 1. Econ. Tax. Bot., 33 (2): 259-276.

41. Mohanty A,Parajita, Babeeta Chrungu, Nidhi Verma and K R Shiv anna (2009) Broadening the Genetic Base of crop Brassicas by production of new Intergeneric Hybrid. Czech J. genet. Plant Breed. 45(3): 117-122.

42. Mukta Nand N Sunil (2009). Traditional knowledge of Mahua (Madhuca indica J.F GMEL.) and its utilization in current initiatives. Journal of Economic and Taxonomic Botany. 33:192-197.

43. Muneem KC, PS Mehta, KS Negi and RK Mahajan (2009) Genetic divergence of climber frenchbean (Phaseolus vulgaris L.). J. Arid Legumes 6(2): 91 -95.

GE~"ERALI~FORMATIO~ ______ _ 169

44. N Sivaraj, N Sunil, S R Pandravada, V Kamala, Vinod Kumar, BVSK Rao, RBN Prasad and KS Varaprasad (2009) DIVA-GIS approaches for diversity assessment of fatty acid composition in linseed (Linum usitatissimum L.) germplasm collections from peninsular India. Journal of Oilseeds Research, 26 (special issue): 13-15.

45. Nayar ER, Anjula Pandey, Rita Gupta, K Pradheep and DC Bhandari (2009) National herbarium of cultivated plants: Taxa added during 2008. Indian J. Plant Genet. Resour. 22(2): 167 -172.

46. Pal D, S Kumar and JC Rana (2009) Collection and characterization of wheat germplasm from North-West Himalaya. J.Pl.Genet.Resour. 20(2): 170-173.

47. Panwar NS, VK Dwivedi and SS Malik (2009) Variability studies in French Basil (Ocimum basilicum L.). Indian J. Plant Genet. Resour. 22(2):160-166.

48. Parakh DB, RK Khetarpal and VC Chalam (2008) Risk of seed-transmitted viruses associated with exchange of soybean germplasm and the South Asian scenario. Indian J. ' Virol. 19 (1): 47-49.

49. Patel Bhanwari and N K Dwivedi (2009) Characterization and conservation of cluster bean (Cyamopsis tetragonoloba (L.) Taub.) germplasm collected from Rajasthan. J. Arid Legumes. 6(1): 17-19.

50. Patra BC, DR Pani., KK Gangopadhyay, K Laxminarayan (2009) Salvaging plant genetic resources from flood affected areas of Orissa Plant Science Res. 59-60.

51. Pradheep K and Suresh Kumar (2008) Observations on diversity in temperate fruits in north eastern region, India. Indian J. Plant Genet. Resour. 21(1):26-31.

52. Raiger HL, RP Dua, SK Sharma, BS Phogat and RS Rathi (2009) Stability for seed yield and quality traits in Kalingada (Citrullus lanatus). Indian J. Agri. Sci., 79(9): 745-747

55. Rana JC, KS Negi, SA Wani, Sanjeev Saxena, K Pradheep, Anjali Kak, SK Pareek and PA Sofi (2009) Genetic resources of rice in the western Himalayan region of India: current status. Genetic Resources and Crop Evolution 56:963-973.

56. Rana JC, OP Chaurasia, K Pradheep and VD Verma (2009) Pea (Pisum sativum) germplasm with bold seed size with 100 seed weight. J. Pl. Genet. Resour. 20(3): 268-269.

57. Rao A, R Chaudhury, SK Malik, S Kumar, R Radhakrishanan and SMH Qadri (2009) Mulberry biodiversity conservation through cryopreservation. In Vitro Cellular DeveloptaI. BioI. Plant 45 (6): 639-649.

60. Seeratpreet Kaur, Narpinder Singh, N S Sodhi and J C Rana (2009) Diversity in properties of seed and flour of kidney bean germplasm. Food Chemistry. 117 (2): 282-289.

61. Sharma S B, You M and Varaprasad KS. (2008) Biosecurity-An integral part of global food security strategy. Indian J. Pl. Prot. 36 (2): 165-172.

62. Sharma Y, A Kumar, A Singh and JC Rana (2008) Important medicinal plants and their uses in Me-Gad watershed area of Labaul & Spiti. J Econ & Taxon Bot. 32: 116-122.

63. Sholi NJY, A Chaurasia, A Agrawal and NB Sarin (2009) ABA enhances plant regeneration of somatic embryos derived from cell suspension cultures of plantain cv. Spambia (Musa sp.). Plant Cell Tissue and Organ Culture 99: 133-140.

64. Singh A, KK Kumar and Z Hussain (2009) Genetic improvement of Litchi (Litchi chinensis Sonn.) International Journal of Tropical Agriculture 27: 89-99.

65. Singh AK, SS Malik and YS Tomar (2008) Studies on the medicinal compound L-Dopa in Mucuna pruriens Bak. Indian. J. Plant Genet. Resour. 21(3):217-220 (appeared 2009).

66. Singh A K, Nidhi Verma, SK Yadav, Aparajita Mohanty, Satyapal Singh and Surender Singh (2009). Indian Forage Genetic Resources: Perspectives and Strategies. Prog. Agri. 9 (2): 250-256.

67. Singh A K, Vandana Tyagi, Nidhi Verma, Manibushan, Naresh Chandra and RC Bharati (2009) Monarda-A potential floricultural plant for temperate India. Environ Ecology 27 (2): 677-681.

170 -- _______ ANNUALREPORT2009-l0

68. Singh Archana, Y Singh, A Kumar and JC Rana (2008) Important medicinal plants flourishing in Moolbari watershed area of Himachal Pradesh. J. Econ. Taxon Bot. 32: 123-130.

69. Singh Dinesh, Mohar Singh and RK Gupta (2009) Characterization of pecan germplasm of seedling origin through regression and principal component analysis. Indian J. Agric. Sci. 79 (4): 324-326.

70. Singh Neeta, C Devi, A Kak, G Singh, A Kumari, and RK Mahajan (2009) Influence of seed coat colour associated heterogeneity on quality and storability in horse gram (Macrotyloma uniflorum). Seed Sci. Technol., 37(1): 239-247.

71. Singh S, SK Pradhan, DR Pani, R Chandra and ON Singh (2008) Multivariate analysis in tropicaljaponica "New Plant Type" Rice (Oryza sativa L.) J. Plant Genetic Res., 21 (2) : 125-127 (appeared 2009).

72. Singh TP, PS Deshmukh and SK Misbra (2009) Improvement of physiological traits in chickpea crosses for increasing productivity. New Botanist 35: 113-121.

73. Subudhi HN and N Dikhit (2008) Variability and character association of yield components in Rainfed low land rice. Indian J. Plant Genet. Resour.22 (1):31-35.

75. Tyagi RK, R Goswami, R Sanayaima, R Singh, R Tandon and A Agrawal (2009) Micropropagation and slow growth in vitro conservation of cardamom (Elettaria cardamomum Maton). In Vitro Cellular Deveioptai. BioI. Plant 45: 721-729.

76. Tyagi Vandana and Pratibha Btahmi (2009) Germplasm Exchange Issues in era of Intellectual Property Rights. International J. Trop Agr. 27 (1-2): 51-55.

77. Velayudhan KC, M Unnikrishnan, KI Asha and Maya C Nair (2009) A note on the fmger bearing species of the genus Curcuma L. of Western Ghats and the report of a new taxon Curcuma amada Roxb. var. glabra from Kerala, India. J. Econ. Taxon. Bot. 33 (1): 162-171.

78. Velayudhan KC, SR Pandravada., Johnson K George and KS Varaprasad (2009) Report of occurrence of a new taxon Curcuma longa var. vanaharidra from Visakhapatnam district, Andbra Pradesh, India. J. Econ. Taxon. Bot. 33 (1): 172-176.

79. Verma Nidhi, MK Rana, Gunjeet Kumar, Aparajita Mohanty and IS Bisht (2009) RAPD Based Genetic diversity assessment of Perilla Jrutescens (L.) Britton from Indian Himalayas. International J. Trop Agr. 27 (3~4): 383-386.

80. Verma Shweta, Sulekh Chandra, Usha Dev, Nidhi Joshi (2009) Synthesis, spectral and biological studies of nitrogen-sulphur donor macrocyclic ligands and their transition metals complexes. Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy. doi:l0.1016/j.saa.2009.06.029.

81. Verma YD, K Pradheep and JC Rana (2009) Evaluation studies on some walnut genetic resources in Himachal Pradesh. Indian J. Plant Genet. Resour. 22(2): 129-133.

82. Verma YD, K Pradheep, Anil Kumar, KS Negi and JC Rana (2009) Collection and characterization of Allium species from Himachal Pradesh. Indian J. Plant Genet. Resour. 21(3):225-228(appeared in 2009).

83. Verma YD, K Pradheep, SK Yadav and JC Rana (2009) Characterization and evaluation studies in apricot germplasm under high hills of Himachal Pradesh. Indian J. Plant Genet. Resour. 22(1):17-21.

84. Verma, YD, K Pradheep, SK Yadav, JC Rana and Ram Chander (2009) Evaluation of indigenous and exotic peach germplasm under upper hill conditions. Indian Journal oj Horticulture 66(3):415-419.

19.15.2 Chapter~ in books, review articles, proceedings, bulletins, manuals, etc.

1. Agrawal A, RK Tyagi and DB Parakh (2009) Safe transfer of vegetatively propagated material. In: Training Manual on Current Regulations and Policies Jor Access to Genetic Resources (eds. Brahmi et al.) November 10-19,2009, NBPGR, New Delhi, pp.l27-139.

2. Arjun Lal and Vandana Tyagi (2009) Exchange Procedures for Plant Germplasm including Transgenics. In: Training Manual on Biosecurity and BiosaJety: Policies, Procedures and Issues (eds. Chalam et al.) NBPGR, New Delhi. pp 71-32.

GENERAL INFORMATION 171

172

3. Arjun Lal, SP Singh and Surender Singh (2009) Exchange of Germplasm: Guidelines and Procedures. In : , Training Manual on Current Regulations and Policies for Access to Genetic Resources (eds. Brahmi

et al.) New Delhi, pp 38-54.

4. Arjun Lal, Vandana Joshi and S K Sharma (2009) Status of forage crops in India In : Proceedings Emerging trends in Forage research and livestock production. Indian Society of Forage Research, CCS HAD, Hisar, 10 pp.

5. Bhalla Shashi, RK Khetarpal and SK Sharma (2009) Electron beam irradiation as phytosanitary measure for the safe movement of agricultural commodities In: (eds. Singh et al.) Training and Capacity Building on Applications of Ionizing and Non ionizing Energies in Agriculture IARI, New Delhi. p 208.

6. Bhandari DC and K Pradheep (2009) Access and benefit sharing - understanding the rules for collection and use of material. In: Current Regulations and Policies for Access to Genetic Resources (eds. Brahmi et al.) NBPGR, New Delhi, pp 55-68.

7. Brahmi P, Shashi Bhalla and V Tyagi (2009) International and National Regulatory Instruments related to Biological Diversity. In: Invasive Alien Species-A threat to Biodiversity (eds: SK Sharma, R K Khetarpal, Kavita Gupta, Arjun Lal, K Venkatraman and CA Reddy), pp 84-100.

8. Dev Dsha, PC Agarwal, B Singh, Dinesh Chand and RK Khetarpal (2009) Detection and Identification of Seed-borne Fungi in Quarantine. In: Training Manual on Seed Health Testing. (eds. Dev et al.), New Delhi, India, pp 13-48.

9. Dua RP, HL Raiger, BS Phogat and SK Sharma (2009), Genetic resources and its role in improvement of arid legumes. In: Legumes in Dry Areas (eds. Kumar et al.), Indian Arid Legume Society and Scientific Publishers (India), Jodhpur: 34-41.

10. Dwivedi N K, Gopala Krishnan S and R R Meghwal (2009) Characterization of Mungbean [Vigna radiata (L.) Wilczek] Germplasm in Arid and Semi-arid Region of India. In: Legumes in Dry Areas (eds. Kumar et al.). Indian Arid Legumes Society & Scientific Publishers, Jodhpur, India. pp 42-50.

11. Gopala Krishnan Sand NK Dwivedi (2009) Development of new plant types in guar [Cyamopsis tetragonoloba (L.) Taub.] for enhancing productivity and grain quality. In: Legumes in Dry Areas (eds D Kumar et al). Indian Arid Legumes Society & Scientific Publishers, Jodhpur, India. pp 55-63.

12. Gopala Krishnan S and NK Dwivedi (2009) Leaf shape in Mungbean [Vigna radiata (L.) Wilczek] variation in leaflet lobation pattern. In: Legumes in Dry Areas (eds. Kumar et al.). Indian Arid Legumes Society & Scientific Publishers, Jodhpur, India. pp 72-76.

13. Gupta Kavita and RK Khetarpal (2009) Plant Quarantine System in India. In: Seed Science and Technology (ed. N C Singhal), Kalyani Publishers, New Delhi. pp 441-453.

14. Gupta Kavita, V Celia Chalam, Usha Dev and RK Khetarpal (2009) Global Information on Invasive Alien Species. In: Invasive Alien Species- A Threat to Biodiversity. Indian Council of Agricultural Research, Ministry of Environment and Forests and National Biodiversity Authority, pp 39-54.

15. Gupta N, SK Sharma JC Rana and RS Chauhan (2008) Comparative Genomics towards Understanding Molecular Biology of Rutine Biosynthesis in a Nutraceutical Food Crop (Buckwheat). 1'[ ed. Delhi, Satish Serial Publishing House, pp 323-334.

16. Gupta S (2009) Biotechnology in horticultural germplasm management. In: Training Manual on Post-harvest Physiology of Fruits and Flowers. (eds. Arora et al.) IARI, New Delhi, pp 84-88.

17. Gupta S and Husnara (2009) Cryopreservation of in vitro explants using encapsulation-dehydration technique. In: A Laboratory Manual for In Vitro and Cryopreservation Techniques for Conservation of Plant Genetic Resources (eds. Sharma et al.) (4th Edition), NBPGR, New Delhi, pp 29-34.

- _______ ANNCALREPORT2009-10

18. Gupta Sand SK Dwivedi (2009) Conservation of genetic resources of Seabuckthorn. In: Seabuckthorn (Hippophae spp.J: The Golden Bush (eds. Dwivedi et al.) Satish Serial Publishing House, New Delhi, pp 337-346.

19. Gupta V and A Kak (2009) Seed testing protocols and seed standards for conservation. In: Training Manual on Conservation and Collection of Seed Germplasm of Medicinal and Aromatic Plants. NBPGR, New Delhi, pp 136-145.

20. Gupta V, K Srinivasan, A Kak and SK Sharma (2009) Significance of international day for biological diversity In: "Invasive Alien Species- A threat to Biodiversity". Indian Council of Agricultural Research, National Biodiversity Authority and Ministry of Environment and Forests Pub!., pp 100-107.

21. Hussain Z and DK Nerwal (2009) RAPD analysis of in vitro-conserved germplasm. In: A Laboratory Manual for In Vitro and Cryopreservation Techniques for COllserl'atiOll of Plant Genetic Resources (eds. Sharma et af.) (4th Edition), NBPGR, New Delhi, pp 43-47.

22. Joshi Vandana, SK Yadav, P Anitha, SP Singh and S S Ranga (2009) Utilization of genetic resources and benefit of plant introduction. In: Current Regulations and Policies for Access to Genetic Resources (Brahmi et af.) NBPGR, New Delhi. pp 153-l71.

23. Kak A (2009) Registration of germplasm: A soft protection In: Current Regulations and Policies for Access to Genetic Resources (eds Brahmi et af.) NBPGR, New Delhi, pp 104-110.

24. Kak A (2009) Seed moisture testing, drying and packaging for genebank conservation In: Training Manual on Conservation and Collection of Seed Germplas111 of Medicinal and Aromatic Plants. NBPGR, New Delhi,pp 146-153.

25. Khetarpal, RK and Kavita Gupta (2009) Invasive Alien Plant Pests and Diseases. In: Invasive Alien Species­A Threat to Biodiversity. Indian Council of Agricultural Research, Ministry of Environment and Forests and National Biodiversity Authority, pp 13-25.

26. Khetarpal RK, N Balaraman, SK Bandopadhyay, Kavita Gupta, RK Jain, J Kumar, AN Mukhopadhyay and KK Vijayan (2009) Status of Agricultural Biosecurity. In: State of Indian Agriculture. National Academy of Agricultural Sciences, NAS Complex, New Delhi, pp 151- 174.

27. Meghwal RR, NK Dwivedi and HS Gehlot (2009) Assessment of soluble contents in some promising mothbean germplasm accessions. In: Legumes in Dry Areas (eds Kumar et at). Indian Arid Legumes Society & Scientific Publishers, Jodhpur, pp 77-81. I '

28. Mishra SK, Ashok Kumar, JC Rana, Gunjeet Kumar and SK Sharma (2009) Potential donors for resistance against stresses in major agri-horticultural crops. In: Plant Disease Management for Sustainable Agriculture (ed. Shahid Ahmed), Daya Publications, New Delhi, 374p.

29. Nayar ER and Anjula Pandey (2009) Detection and identification of weeds in quarantine. In: Biosecurity and Biosafety Policies, Procedures and Issues (eds. V Celia Chalam et al), NBPGR, New Delhi, pp 236-

246.

30. Om Vir and Nazeer Ahmad (2009) Hybrid seed production technique in onion. In: Manual of Hybrid Seed Production Technique in Vegetable Crops, CITH. Srinagar, pp 34-46.

31. Pandey Anjula and E R Nayar (2009) Access and utilization of crop wild relatives. In: Current Regulations and Policies for Access to Genetic Resources, (eds. Brahmi et al), NBPGR, New Delhi, pp 69-80.

32. Pandey R, N Sharma and R Chamola (2009) Cryopreservation of garlic shoot tips from cloves. In: A Laboratory Manual for In Vitro and Cryopreservation Techniques for Conservation of Plant Genetic Resources (eds. Sharma et al.) (4th Edition), NBPGR, New Delhi, pp 23-24.

33. Pandey R, N Sharma and R Chamola (2009) Preparation of cryoprotectant solutions and media for cryopreservation. In: A Laboratory Manual for In Vitro Qlld Cryopreservation Techniques for Conservation of Plant Genetic Resources (eds. Sharma et at.) (4th Edition), NBPGR, New Delhi, pp 19-

22

GENrRA.L INfURMATIO. 171

34· Panis B, A Agrawal, DPS Meena, RP Yadav and RK Tyagi (2009) Methods used for cryopreservation of Musa germplasm. In: A Laboratory Manual for In Vitro and Cryopreservatioll Techniques for Conservation of Plant Genetic Resources (Fourth Edn). National Bureau of Plant Genetic Resources (eds. Sharma et al.) New Delhi, India, pp 35-42.,

35. Raina Archana Peshin, SK Pareek and Ashok Kumar (2009) "Phytochemical Evaluation of the Medicinal Plants" In: Training Manual on "Conservation and Collection of Seed Gennplasm of Med/L" w ' and Aromatic Plants" NBPGR, New Delhi.

36. Randhawa GJ and Shashi Bhalla (2009) Biosafety issues in use and exchange of transgenics. In: Legumes for Ecological Sustainability (eds. Massod Ali et al.), 461-479 pp. Indian Society of Pulses Research and Development, IIPR, Kanpur, India.

37. Sarker A, SK, Mishra, NK Gautam, and SK Sharma (2009) Widening the genetic base of lentil in South Asia through the use of exotics. In: Legumes for Ecological Sustainability (eds. Ali et al). Indian Society of Pulses Research and Development, IIPR, Kanpur, 378-391 pp.

38. Sharda VN, RK Agrawal, DK Arora, BK Gosh, WS Lakra, H Pathak, YS Ramakrishna, GGSN Rao, NH Rao, SK Sharma, SM Virrnani and KPR Vittalm (2009). Natural Resources. In: State of Indian Agriculture (eds. Mangla Rai et al.), National Academy of Agricultural Sciences, New Delhi, pp 35-92.

39. Sharma N, Pandey R and Chamo1a R (2009) Cryopreservation of in vitro shoot tips using vitrification method. In: A Laboratory Manual for In Vitro and Cryopreservation Techniques for Conservation of Plant Genetic Resources. (eds. Sharma et al) (4th Edition), NBPGR, New Delhi, pp 25-28.

40. Sharma SK and IS Bisht (2009) Khadhya utpadan aur paryavaran ke sandarbh main padap jaiv-vividhata wa jaiv-praudhyogiki. In: Behtar paryavaran ke liye bhartiya krishi (Hindi) (eds. Kaundal), IARI, New Delhi, pp 62-75.

41. Sharma SK and P Brahmi (2009). Sustainable Management of Plant Genetic Resources in India. In: Training Manual on Biosecurity and Biosafety: Policy, Procedure and Issues (eds. VC Chalam et al), NBPGR, New Delhi, pp 1-10.

42. Sharma SK, Arjun Lal and Vandana Tyagi (2009) Current Mechanisms in Exchange of Plant Genetic Resources In: Souvenir and Abstracts, Genetic Resources (eds. Tyagi et al.) Indian Society of Plant Genetic Resources, NBPGR, New Delhi, pp 63-79.

43. Sharma SK, JC Rana and Om Vir (2009) Utilizing plant genetic resources for enhancing farm income in the north western Himalayan agro-ecosystem. In: Proceedings of 9th Agricultural Science Congress: Technological and Institutional Innovations for Enhancing Agricultural Income, June 22-24, 2009, SKUAST, Srinagar, pp 17-30.

44. Sharma SK, K. Srinivasan, P Brahmi and V Tyagi (2009) Plant Genetic Resources Management in India In: Souvenir. International Conference on Grain Legumes: Quality Improvement, Value addition and Trade IIPR Kanpur, pp 35-40.

45. Sharma SK, S Sardana, Neeta Singh, and SK Mishra (2009) Managing diversity of legumes at genetic, species and ecosystem levels. In: Legumes for Ecological Sustainability (eds. Ali et al). Indian Society of Pulses Research and Development, IIPR, Kanpur: 292-310.

46. Sharma SK, SK Mishra, NK Dwivedi, NK Gautam and Gopala Krishnan S (2009) Genetic resources and its role in improvement of arid legumes. In: Legumes in Dry Areas (eds . Kumar et al). Indian Arid Legumes Society & Scientific Publishers, Jodhpur, pp 34-41.

47. Singh B, Usha Dev, PC Agarwal and KD Joshi (2009). Detection and Identification of Plant Pathogenic Bacteria. In: Training Manual on Seed Health Testing. (eds. Dev et al.). NBPGR, New Delhi, pp 49-72.

174

48. Singh N (2009). Factors affecting seed storage and longevity In: Training Manual on Conservation and Collection of Seed Germplasm of Medicinal and Aromatic Plants. NBPGR, New Delhi, pp131-134.

~ __ ANNUAL REPORT2009-IO

49. Singh SB, A K Singh and K Pradheep (2009) Exploring the genetic diversity for forage crops in westem parts of Jammu division of J&K, India. In: Proc. National Symposium on Achieving Millennium Development Goals: Problems & Prospects, Bundelkhand University, Uttar Pradesh, pp 14-18.

50. Srinivasan K (2009) Seed Storage behaviour and their conservation strategies. In: Training Manual on Conservation and Collection of Seed Germplasm of Medicinal and Aromatic Plants. NBPGR, New Delhi, pp 83-97.

51. Srinivasan K and V Tyagi (2009) Genebanks and conservation vis-a-vis Access to Genetic Resources In : (eds. Brahmi et al.) Training Manual on Current Regulations and Policies for Access to Genetic Resources. NBPGR, New Delhi. pp 18-32.

52. Tyagi RK (2009) Seed genebank management and documentation. In: Training Manual on Conservation and Collection of Seed Germplasm of Medicinal and Aromatic Plants. NBPGR, New Delhi, pp 71-81.

53. Tyagi RK and A Agrawal (2009) Conservation strategies in the present intellectual property regime. In: Training Manual on Current Regulations and Policies for Access to Genetic Resources (Eds. Brahmi et al) NBPGR, New Delhi, pp186-21O.

54. Tyagi V and S Gupta (2009) Intemational Treaty on Plant Genetic Resources for Food and Agriculture (ITPGRFA) and its Implications on Access to PGRFA. In: Training Manual on Current Regulations and Policies for Access to Genetic Resources. (eds. Brahmi et al). NBPGR, New Delhi. pp 140-152.

55. Tyagi V, K Gupta and Arjun Lal (2009) Issuance of Import Permit and Phytosanitary Certificate. In: Training Manual on Biosecurity and Biosafety: Policies, Procedures and Issues (eds. Chalam et al), NBPGR, New Delhi, pp 343-347.

56. Venkataraman K, A Agrawal and RK Tyagi (2009) Biodiversity and Biological Diversity Act, 2002. In: Alien Invasive Species - A Threat to Biodiversity (eds. Shanna et al), ICAR, NBA and MoEF, pp 55-83.

57. Verma Nidhi M (2009) Specific Issues for Exchange of Genetic Resources: Material Transfer Agreement (MTA), Material Acquisition Agreement (MAA). In : Training Manual on Current Regulations and Policies for Access to Genetic Resources (eds. Brahmi et al), NBPGR, New Delhi, pp 172-185.

58. Yadav OP, IS Kherwal, KN Rai, D Kumar, A Henry, HR Mahela, BB Singh, G P Dixit, SBS Tikka, S Acharya, JB Patel, ZS Solanki, SR Kumhar, BR Choudhary, P Joshi, NK Dwivedi, S Gopala Krishnan, MM Anwer, RK Kakani, MP Rajora, SK Jindal, PR Meghwal, TA More and RS Singh (2009) Genetic Resources and Improvement of Crops, Seffd spices, Grasses, Trees and Horticultural Crops for Arid Zone. In: Trends in Arid Zone Research in India. (eds. Amalkar et ai), CAZRI and Evergreen Printers, Jodhpur, pp.238-277.

59. Yadav S, P Suneja and Z Hussain (2009) Biochemical techniques in plant genetic resource management. In: Quality Enhancement: Conventional and Molecular Approaches, (eds. Yadav et al), IARl, New Delhi, pp 132-135.

60. Yadav S, P Suneja and SK Mishra (2009) Biochemical and Phytochemical Evaluation for Enhancing value of Genetic Resources. In: Training Manual on Current Regulations and Policies for Access to Genetic Resources. (eds. Brahmi et al), NBPGR, New Delhi. pp 118-126.

61. Yadav S, P Suneja and SK Yadav (2009) Genetic Resources for Quality Enhancement. In: Quality Enhancement: Conventional and Molecular Approaches. (eds. Yadav et al), IARI, New Delhi, p 127.

62. Yadav SK and Z Abraham (2009) Access to Spices and Condiments: Current Challenges. In: Training Manual on 'Current Regulations and Policies for Access to Genetic Resources. (eds. Brahmi et al), NBPGR, New Delhi. pp 217-227.

19.15.3 Popularl Technical Articlesl Technical Bulletin

1. Bhandari DC, ER Nayar, Anjula Pandey, R Srivastava, KC Bhatt, AK Singh and SK Shanna (2009) Exploration and Germplasm Collection. National Bureau of Plant Genetic Resources, New Delhi, p12.

GENERAL I~ORMATIOI\i 175

176

2. Chaudhury R and SK Malik (2009) Pollen Cryopreservation- simple and cost-effective. ICAR News 15 (1): 7.

3. Chaudhury R, SK Malik and J Joshi (2009) Cryostorage of tree-borne oilseeds. ICAR News 15 (3): 4-5.

4. Dwivedi NK (2009) "Bimariyan ka niwarak: Aonla" (In Hindi). Niramay Jeewan. 13(2): 15-16.

5. Dwivedi NK (2009) "Gharelu Arand" (In Hindi). Niramay Jeewan. 13 (4): 25-26.

6. Dwivedi NK (2009) "Sawashth Lambi Vmar Ka Raj: Bhringraj" (In Hindi). Niramay Jeewan. 13 (6): 29-30.

7. Dwivedi NK (2009) "Chandrasool (Ashalilya)." Niramay Jeewan. 13 (8): 19-20.

8. Dwivedi NK (2009) "Guno se Bharpoor Jadi-buti:Ashwagandha". Niramay Jeewan. 13 (9): 21-22.

9. Dwivedi NK (2009) "Tandrushti Ka Khajana: Sainjana". Niramay Jeewan. 13 (11): 17-18.

10. Dwivedi NK (2009) "Vidhara: Ek Poushtik Jadi-buti". Niramay Jeewan. 13 (12): 15-16.

11. Gupta Kavita, RK Khetarpal and SK Sharma (2009) Invasive Alien Species: A Threat to Biodiversity. NBPGR, New Delhi, 6 p.

12. KK Gangopadhyay, SK Yadav, Gunjeet Kumar, BL Meena, and SK Mishra (2009) Mooli - Swad, Salad aur llaj (In Hindi). Phalphool: January -February ank - 1: p. 13-14.

13. Negi KS (2009) Bean ek upyogi phasal hai pahari kastkaron ke liye. Nainita! Samachaar 22(17): 07.

14. Negi KS, KC Muneem, P S Mehta and AP Raina (2009) Lavender ke kheti bahut dhan deti hai. Pha! PllOOI 30(3): 12-14.

15. Negi KS, PS Mehta, AS Rana, KC Muneem and SK Verma (2009) Is kaddu mein bare bare gun. Phal Phool 30(4): 8-10 & 12.

16. Pradheep K, VD Verma, JC Rana and Ram Chander (2009) Promising wild ornamental plants. Indian Horti 54(6): 14-15.

17. Pradheep, V 0 Verma, J C Rana and BP Singh (2009) Pepino: A new fruit for Himachal Pradesh. Rashtriya Krishi 4(1): 35-36.

18. Phogat BS, HL Raiger, RP Dua and SK Sharma (2009) Kuttu ki Vaigyanik Kheti. Kheti (Hindi), Sept. 2009, pp.9-11.

19. Raina P Archana (2009) Sugand Bhi, Tel Bhi. Pha!-PhuI30(7): 35-37.

20. Raina P Archana, M K Parashiva Murthy and S K Mishra (2009) Aloe: a pharmacy in a plant. India1l Horticulture 54(2): 36-37.

21. Raina P Archana (2009) En Aushidhiya Phasalo Ko Jaane Phal Plzul 30 (3): 6-8.

22. Raiger HL, RP Dua, BS Phogat and SK Sharma (2010) Parvatiya kshetron main Elday (Job's tear) utpadan badane ki unnat takniki. Krislzi Today (in Hindi), Feb., 2010, pp. 26-27.

23. Raiger HL, RP Dua, SK Shanna, BS Phogat and MC Bhandari (2010) The First Variety of Tumba: 'Mandha Marudhara' (,RMT 59') released. Indian Farmillg, Feb. 2010, pp. 13-15.

24. Raiger HL, BS Phogat, RP Dua and SK Sharma (2009) Alp prayukta dalhani phaslon ki unnat kheti. Kheti (in Hindi), 62(4): 32-34.

25. Raiger HL, BS Phogat, RP Dua and SK Sharma (2009) Improved varieties and cultivation practices of rice bean. Intensive Agriculture, pp. 16-20.

26. Raiger HL, RP Dua, BS Phogat and SK Sharma (2010) Vnderutilized Vegetables for Sustainable Vegetable Production. Agricul. Today, March, 2010, pp. 56-57.

27. Raiger HL, BS Phogat and RP Dua (2009) Alp prayukt phaslon ki unnat kheti (khadhya suraksha). Kheti, October, 2009, pp. 24-32.

A~I';l.rAL REPORT200.) 10

28. Raiger HL, RP Dua. BS Phogat RS Rathi and Y Ravindrababu (2009) The first variety of jatropha 'Chhatrapati' released. Indian Farming. June. 2009, pp. 21-23.

29. Raiger HL. RP Dua. BS Phogat and SK Sharma (2009) Alp prayukt dalhani phaslon ki unnat kheti (July. 2009). Kheti, pp. 21-23.

30. Raiger HL, BS Phogat and RP Dua (2009) Alp prayukt phaslain banam khadhya suraksha. Unnat Krislzi, July-September, 2009, pp. 9-11.

31. Rana MK and SK Sharm~ (2009) Padap Janandravyon ke prabandhan main jaiv praodhigiki. Krishi Today (in Hindi), Sept., 2009, pp. 48.

32. Rana JC and Ajay Kumar (2006) Upakshit Fasllain - Poshak avam Aushdhiya Guno kee khan. NBPGR Regional Station, Shimla, pp 28.

33. Santosh Kumari and TP Singh (2009) Chana ekkisevee sadee kee ek mahatavpuran phasal. Pusa Surbhi p. 12-16.

34. Singh MK, RS Rathi, BS Phogat, HL Raiger and RP Dua (2009) Madu meh rogiyon ke liye nai asha Pltal Phool (March-April, 2009). pp. 32-33.

35. TP Singh (2009) Buwai samay ka chane ke gene prarupuon main source sink santulan par prabhaw. Rashtriya Sangoslztee ka karayavrat. pp. 136-141.

36. TP Singh (2010) Global warming ka prakarite par prabhav. Klzad Patrika 51 (1): 33-36.

37. Verma SK, RR Arya, KS Negi, Muneem KC and Mehta PS (2009) Uttaranchali kagazi nembu-Ek yatra. Him Prabha p 41-44.

38. Verma VD, K Pradheep, JC Rana and Ram Chander (2009) Fuyu: A promising non-astringent persimmon for central western Himalayan region. Indian Farmer's Digest 42(1): 21-22.

39. Yadav SK, SK Sanwal, PK Singh and SK Singh (2009) "Sadabahar sabzi tree tometo·'. Plwl Phool., Jan­Feb pp 33-34.

40. Yadav SK, SK Sanwal, PK Singh and SK Singh (2009) "Treebean ek bahupyogi vraksha". Phal Phool May­June. pp 36-37.

19.15.4 Souvenir and Abstracts

I. Sharma, SK, RK Khetarpal. Kavita Gupta. Arjun Lal (eds)(2009). Invasive Alien Species- A Threat to Biodiversity. Indian Council of Agricultural Research, Ministry of Environment and Forests and National

Biodiversity Authority. p 107.

2. Tyagi RK, Bhag Mal, SK Shanna, RK Khetarpal, Pratibha Brahmi, Neeta Singh, Vandana Tyagi, Sunil Archak, Kavita Gupta and Anuradha Agrawal (eds) (2009) National Symposium 011 Recent Global Developments in the Management of Plant Genetic Resources, 17-18 December 2009. Souvenir and Abstracts. Indian Society of Plant Genetic Resources, New Delhi, 368 p.

19.15.5 Plant Germplasm Reporter

1. Arjun Lal, Pratibha Brahmi, Deep Chand, Vandana Joshi, Vandana Tyagi, Nidhi Verma, SK Yadav, SP Singh and Surender Singh. Plant Germplasm Reporter (2009) Vol 8, No.3, 2008. NBPGR, New Delhi 169 p.

2. Arjun Lal, Deep Chand, Pratibha Brahmi, Vandana Joshi, Vandana Tyagi, Nidhi Velma, SK Yadav, SP Singh and Surendc;r Singh. Plant Gennplasm Reporter (2009) Vol 8. No.4, 2008, NBPGR, New Delhi 129 p.

3. Arjun La], Deep Chand, Pratibha Brahmi, Vandana Joshi, Vandana Tyagi, Nidhi Verma, SK Yadav, SP Singh and Surender Singh. Plant Gennplasm Reporter (2009) Vol 9, No.1, 2009, NBPGR, New Delhi 103 p.

4. Bhatt KC, Anjula Pandey, ER Nayar, Rakesh Srivastava, DC Bhandari, Shashi Kant Sharma, NS Panwar. Rakesh Singh, Rita Gupta and OP Dhariwal Plant Gennplas111 Reporter (Indigenous Collections) (2009),

NBPGR. New Delhi.

Gf< "ffiRAL INFORMATIO'\1 177

19.15.6 Crop Catalogue, etc. \

I. Dua RP, HL Raiger, SK Mishra, SK Sharma and OP Dahiya (2009). A catalogue on multilocation evaluation of pigeonpea gennplasm (kharif 2(05), NBPGR, New Delhi, 315 p.

2. Dua RP, HL Raiger, SK Mishra, SK Sharma and OP Dahiya (2009). A catalogue on multilocation evaluation of chickpea germplasm (Rabi 2005-06), NBPGR, New Delhi, 402 p.

3. Dua RP, HL Raiger, SK Mishra, SK Sharma and OP Dahiya (2009). A catalogue on multilocation evaluation of pigeonpea germplasm (kharif 2006), NBPGR, New Delhi.

4. Dua RP, HL Raiger, SK Mishra, SK Sharma and OP Dahiya (2009). A catalogue on multilocation evaluation of chickpea germplasm (Rabi 2006-07), NBPGR, New Delhi.

5. Mahajan RK, HL Raiger and SK Mishra (2009). Germplasm characterization and evaluation of field crops (Kharif 2(08), NBPGR, New Delhi, 387 p

6. Mahajan RK, HL Raiger and SK Mishra (2009). Germplasm characterization and evaluation of field crops (Rabi 2007-08), NBPGR, New Delhi, 224 p.

7. Mahajan RK, HL Raiger and SK Mishra (2009). Germplasm characterization and evaluation c:>f horticultural crops (Rabi 2007-08), NBPGR, New Delhi, 403 p.

19.15.7 Booksl Manuals! Annual Report! Teaching aids

1. Arjun Lal, Kavita Gupta and Vandana Tyagi (2009) Annual Report 2008-2009. National Bureau of Plant Genetic Resources, Pusa Campus, New Delhi, 171p.

2. Bhalla Shashi, V Celia Chalam, Arjun Lal and RK Khetarpal (2009) Practical Manual on Plant Quarantine. National Bureau of Plant Genetic Resources, New Delhi, India, p. 204+viii

3. Brahmi Pratibha, RC Agrawal and SK Sharma (2009) Guidelines for Filling Applications of Plant Varieties for Registration under the Protection of Plant Varieties and Farmers' Rights Act 2001. National Bureau of Plant Genetic Resources, New Delhi, pp. 162.

4. Brahmi Pratibha, Vandana Tyagi, SK Yadav, Vandana Joshi, Anita Pedapati and Arjun La1 (2009). Training Manual on Current Regulations and Policies for Access to Genetic Resources. National Bureau of Plant Genetic Resources, New Delhi 110012.339 p.

5. Chalam, VC, Kavita Gupta, Shashi Bhalla, Rajan and RK Khetarpal (eds) (2009) Training Manual on Biosecurity and Biosafety: Policies, Procedures and Issues prepared for the ICAR sponsored Winter School from 14 January to 3 February 2009, NBPGR, New Delhi p 397.

6. Dua RP, Raiger HL, Phogat BS and Sharma SK (2009) Underutilized Crops: Improved Varieties and Cultivation Practices. All India Coordinated Research Network (Underutilized Crops), NBPGR, New Delhi pp.66.

7. Dua RP, HL Raiger, BS Phogat and SK Sharma (2009). Annual report of All India Coordinated Research Network on Underutilized Crops (2008), pp. 400.

8. Kak A, K Srinivasan and SK Sharma (2009) Plant Germplasm Registration (2005-2008). NBPGR (lCAR), New Delhi.

9. Kak A, C Pandey, S Pandey and V Gupta (2009) Training Manual on Conservation and Collection of Seed Germplasm of Medicinal and Aromatic Plants. NBPGR, New Delhi.

10. Radhamani J and SK Sharma (2009) Genetic Resources of Groundnut (Arachis hypogaea L.) in India: Conservation and Management, NBPGR, New Delhi.

11. Sharma SK, A Agrawal, R Chaudhury, RK Tyagi, R Pandey, N Sharma, S Gupta, SK Malik: and Z Hussain (eds.) (2009) A Laboratory Manual for International Training Course on In Vitro and Cryopreservation Techniques for Conservation of Plant Genetic Resources (Fourth Edn). NBPGR, New Delhi, 47 pp.

178 ___ ~ _ ANNUAL REPORT 2(X)9.10

19.15.8 Radiol TV talks

I. Dr SK Verma delivered a radio talk on " Citrus Phal Paudhon Ki Bagwani .. at AIR, Almom. UK on February 04,2009.

2. Dr KS Negi delivered a radio talk on "Jari Booti uttpadan evam vaigyanik drishtikon" at AIR, Almora, UK on March 02, 2009.

3. Dr PS Mehta delivered a radio talk on .. Uttarakhand mein chaiti dhan ki vaigyanik kheti" at AIR, Almora, UK on March 02, 2009.

4. Dr PS Mehta delivered a radio talk on "Chaitki dhan mein khar patwar niyantran evam nirai dudai" at Kisan Vani, AIR, Almora, UK on May II, 2009.

5. Dr PS Mehta delivered a radio talk on "Dhan ke phasal mein kharpatwar niyantran evam urvarak prayog" at Kisan Vani, AIR, Almora, UK on July 08, 2009.

6. Sh KC Muneem delivered a radio talk on "Dhan ke phasal ko hanikarak kiton se bachaye" at Kisan Vani, AIR, Almora, UK on August 07,2009.

7. Dr KS Negi delivered a radio talk on "Vagyanik beejon se badalta krishi nivesh" at Kisan Vani, AIR, Almora, UK on August 10, 2009.

8. Sh RR Arya delivered a radio talk on "Phal udyano mein katai chatai tatha sashaya kriyayein" at Kisan Vani, AIR, Almora, UK on November 07,2009.

9. Dr PS Mehta delivered a radio talk on "Gehun ke phasal mein sichaye evam khar patwaar niyantran" at Kisan Vani, AIR, Almora, UK on November 23, 2009.

10. Dr JC Rana in delivered radio talk on "Biodiversity and Alien Invasive Weeds" on the occasion ofIntemational Biodiversity Day on May 22. 2009.

19.16 Empowerment of Women

Session on Stress Management: A Session on Stress management was organized by the Women's Cell of NBPGR on October 12,2009. Dr Prem Lata, Principal Scientist, Division of Agriculture Extension, Indian Agriculture Research Institute, New Delhi gave an interactive lecture on how to manage stress in our daily lives. The lecture was very useful and she gave good tips to manage stress and remain stress-free. In his address during the Session, Director NBPGR Dr S K Sharma emphasized on the need for organizing more of such sessions on general topics which would be of interest and would help all the staff of NBPGR in improving their health and working.

;

19.17 Budget and Expenditure incurred for the financial year 2009-10 (Rs. in lakhs)

A: NON PLAN

Head Allocation Revised Allocation Expenditure

Estt. Charges 2402.88 2373.6 2373.61

Wages 47 46.4 46.39

OTA 0 0 0

TA 8.42 7.89 7.89

Cont. 244.55 264.65 264.63

Works 47.96 110.76 110.76

Total .

2750.81 2803.3 2803.28

B:PLAN

Head Allocation Revised Allocation Expenditure

TA 19.32 19.32 19.31

Cont. 1025.18 1023.1 1023.1

Works 200 200 199.99

G@ffiR\LINFORMATION _____________ ~ 179

HRD' 4.5 4.82 4.82

Total 1249 1247.24 1247.22

C : AICRP - UUC

Head Allocation Revised Allocation Expenditure

TA 0.8 0.8 0.79

Cont. 11.4 11.4 11.4

Remittance 87.8 87.8 87.8

Total 100 100 99.99

Annexure 1: Meteorological data (temperature in degrees Celsius and rainfall in mm) at NBPGR Regional Stations

Station Parameter Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec

Akola Max temp 31.9 35.0 38.1 42.2 42.7 39.2 30.7 31.7 33.2 33.6 30.0 29.0 Min temp 15.2 17.4 21.0 24.2 28.4 27.4 24.0 23.8 23.4 18.6 16.6 13.6 Rainfall 0.0 0.0 2.3 0.0 42.1 141.2 216.7 72.3 39.6 67.8 102.8 14.7

Bhowali Max temp 19.28 20.13 22.21 28.95 28.08 30.16 26.6 26.69 25.69 24.25 20.26 20.50 Min temp 2.92 3.0 6.00 10.00 14.04 16.36 18.69 17.34 15.45 9.25 5.69 1.91 Rainfall - 70.0 20.0 28.0 38.2 88.0 208.0 437.2 364.4 223.0 27.0 6.0

Cuttack Max temp 28.9 32.5 34.2 37.0 35.7 36.9 30.5 32.1 32.1 31.3 29.7 27.9 Min temp 17.3 20.1 21.8 24.9 25.5 26.5 27.1 26.7 26.1 22.9 20.1 15.9 Rainfall - - - - 217.9 63.1 526.2 318.4 311.9 81.4 53.6 -

Hyderabad Max temp 30.2 33.9 36 38.86 40.26 36.25 32.03 31.24 31.40 31.03 29.56 28.48 Min temp 13.7 16.8 18.5 23.65 26.41 24.82 23.43 23.26 22.21 19.47 18.10 14.05 Rainfall 0 0 0 0.40 0.60 2.70 1.80 6.80 5.50 3.20 1.00 0.20

Jodhpur Max temp 12.3 14.5 19.2 22.7 29.2 28.7 27.7 27.1 25.9 20.9 16.3 13.9 Min temp 25.7 29.8 35.4 38.9 42.6 40.0 36.9 36.1 38.2 36.8 30.9 27.2 Rainfall - - 02.80 00.40 21.60 21.4 115.2 44.1 06.5 - - -

Shillong Max temp 21.50 24.05 26.94 28.48 28.06 27.74 28.95 27.92 28.96 27.38 24.29 20.9 Min temp 7.92 9.29 12.30 16.70 17.40 18.70 20.72 20.09 19.40 16.16 11.64 8.53 Rainfall - - 40.20 56.30 381.50 256.90 419.00 504.40 367.50 141.40 0.70 -

Shimla Max temp 7.4 7.5 9.9 13.7 16.5 18.6 18.3 17.5 16.2 13.3 9.7 8.7 Min temp 15.5 16.8 19.6 23.8 26.4 28.3 25.0 24.2 24.0 21.9 18.0 16.2 Rainfall 12.7 15.5 40.4 0.8 32.1 75.0 218.5 235.7 240.5 1.8 8.6 0.0

Thrissur Max temp 32.8 35.1 35.1 34.0 33.0 30.0 28.6 30.2 30.0 32.0 31.5 31.8 Min temp 21.9 22.1 24.4 25.3 24.8 23.7 22.8 23.2 23.2 4'.2 23.7 23.9 Rainfall - - 29.0 16.5 179.5 565.0 985.8 421.4 276.0 166.8 180.6 42.7

180 A "JNL AI. Rf'PORI 2009-10