characterization of the skn7 ortholog of aspergillus fumigatus

www.elsevier.com/locate/yfgbi

Fungal Genetics and Biology 44 (2007) 682–690

Characterization of the SKN7 ortholog of Aspergillus fumigatus

Claude Lamarre a,*, Oumaıma Ibrahim-Granet a, Chen Du b,Richard Calderone b, Jean-Paul Latge a

a Unite des Aspergillus, Institut Pasteur, 25 rue du Docteur Roux, 75724 Cedex 15, Franceb Department of Microbiology and Immunology, Georgetown University Medical Center, Washington, DC, USA

Received 12 September 2006; accepted 22 January 2007Available online 30 January 2007

Abstract

Reactive oxidant intermediates play a major role in the killing of Aspergillus fumigatus by phagocytes. In yeasts, SKN7 is a transcrip-tion factor contributing to the oxidative stress response. We investigated here the role of afSkn7p in the adaptation of A. fumigatus

against oxidative stress. To analyze functionally the afSKN7 in A. fumigatus, we modified a quick PCR fusion methodology for targeteddeletion in A. fumigatus. The afskn7D mutant was morphologically similar to the wild-type strain, but showed a growth inhibition phe-notype associated with hydrogen peroxide and tert-butyl hydroperoxide. However, no significant virulence differences were observedbetween wild type, mutant and reconstituted strains in a murine model of pulmonary aspergillosis. This result indicated that an increasedsensitivity of A. fumigatus to peroxides in vitro is not correlated with a modification of fungal virulence.� 2007 Elsevier Inc. All rights reserved.

Keywords: Aspergillus fumigatus; Response regulator; afSKN7; Oxidative stress; Gene deletion; PCR-based fusion methodology

1. Introduction

Aspergillus fumigatus is a saprophytic filamentous fun-gus which ensures its survival and dispersion by the pro-duction of large numbers of conidia. The inhalation ofthese conidia in severely immunosuppressed patients canlead to serious life-threatening infectious complications(Latge, 1999). In a healthy host, innate immune cells (alve-olar macrophages and neutrophils) kill conidia and myceliathrough the production of Reactive Oxygen Intermediates(ROIs; Walsh et al., 2005; Philippe et al., 2003). Accordingly,the sensing of ROIs through signalling pathway(s)(Chauhan et al., 2006), and subsequent induction of anti-oxidant molecules (Rementeria et al., 2005), should playa role in fungal development in the host. Recent data haveshown that molecules of the two-component signal trans-duction pathway are important in sensing oxidativestress in fungal pathogens (Kruppa and Calderone, 2006).

1087-1845/$ - see front matter � 2007 Elsevier Inc. All rights reserved.

doi:10.1016/j.fgb.2007.01.009

* Corresponding author. Fax: +33 1 40 61 34 19.E-mail address: [email protected] (C. Lamarre).

Initially described in Saccharomyces cerevisiae, the two-component pathway contains different proteins that worktogether in a phosphorelay pathway consisting of a sensorkinase (Sln1p), a phosphorelay molecule (Ypd1p) and apair of response regulators (Ssk1p and Skn7p; Maedaet al., 1994; Posas et al., 1996; Ketela et al., 1998; Liet al., 1998; Posas and Saito, 1998). The Skn7 branch ofthis pathway is involved in a variety of processes. Mutantslacking the SKN7 gene are sensitive to oxidative stress suchas hydrogen peroxide (H2O2; Krems et al., 1996; Morganet al., 1997), tert-butyl hydroperoxide (t-BOOH) and men-adione (Morgan et al., 1997; Lee et al., 1999), and acuteheat stress (Raitt et al., 2000). Skn7p has been reportedto function also in the control of cell wall biosynthesis(Levin and Bartlett-Heubusch, 1992; Brown et al., 1993;Alberts et al., 1998; Li et al., 2002), cell cycle (Morganet al., 1995; Bouquin et al., 1999), and hypo-osmotic stressresponse (Tao et al., 1999). The yeast Skn7p is strictlylocalized in the nucleus of cells that are stressed orunstressed (Brown et al., 1994; Raitt et al., 2000; Luet al., 2003). Skn7p contains three well characterized

mailto:[email protected]

C. Lamarre et al. / Fungal Genetics and Biology 44 (2007) 682–690 683

domains: (I) the C-terminal receiver domain, homologousto bacterial two-component signalling proteins, modulatesthe activity of the protein by phosphorylation of a con-served aspartyl residue (D427; Brown et al., 1993; Morganet al., 1995). However, it has been reported that the oxida-tive stress response operates independently of receiverphosphorylation (Brown et al., 1994; Morgan et al.,1997). (II) A coiled–coil domain presumably involved inseveral protein–protein interactions, including self (Raittet al., 2000), Yap1p (Morgan et al., 1997), Rho1p(Alberts et al., 1998), Mbp1p (Bouquin et al., 1999), Hsf1p(Raitt et al., 2000), Crz1p, calcineurin (Williams and Cyert,2001), and Mog1p (Lu et al., 2004), and finally, (III) a heatshock factor-like helix-turn-helix DNA-binding domainwhich interacts with specific promoter regions of TRX2

(Morgan et al., 1997), SSA1 (Raitt et al., 2000), OCH1

(Li et al., 2002), GPX2 (Tsuzi et al., 2004), and CCP1

(He and Fassler, 2005).Orthologs of the S. cerevisiae SKN7 gene have been

reported for Candida albicans (Singh et al., 2004) and Cryp-

tococcus neoformans (Wormley et al., 2005; Coenjaertset al., 2006). The present study showed that the A. fumiga-tus ortholog (afSKN7) is associated with resistance to per-oxide but not to superoxide ion generating molecules suchas menadione. In addition, afSkn7p is not involved in fun-gal virulence.

2. Materials and methods

2.1. Strains and media

The A. fumigatus wild-type (WT) strain used in thisstudy was CBS 144-89. The WT and afSKN7 reconstituted(HISafSKN7) strains were maintained on 2% malt agarslants, whereas the afSKN7 disrupted (afskn7D) strainwas maintained on the same slants supplemented with75 lg ml�1 of hygromycin B (Sigma) at room temperature.Conidia were produced from cultures grown on 2% maltagar slants for 4–7 days at 37 �C, and recovered by vor-texing with 0.05% aqueous Tween 20 solution. Homoge-nous conidial suspensions of each strain were collectedfollowing filtration through a 40-lm-pore-size filter(Falcon).

2.2. Nucleic acid manipulation

Genomic DNA was extracted as described by Girardinet al. (1993). Total RNA was extracted in screw-cap micro-centrifuge tubes containing one volume of 1 mm diameterglass beads, one volume of 1% SDS, and 1.2 volumes ofphenol pH 5 (Prolabo) using a Fastprep apparatus(3 · 30 s, power 4.0 at 4 �C; BIO 101). For cDNA synthe-sis, contaminant DNA was removed from RNA samplesby DNase treatment (Amersham) and purified using theNucleospin kit (Macherey-Nagel) according to the manu-facturer’s instructions. For Southern and Northern blotanalysis, 10 lg of XbaI-digested (Roche) genomic DNA

or 25 lg of total RNA, respectively, were sized fractionatedon 0.7% agarose and 1% formaldehyde–agarose gels, andblotted onto a positively charged nylon membrane(Hybond-N+, Amersham).

2.3. Determination of afSKN7 full-length cDNA sequence

The full-length afSKN7 cDNA sequence was determinedby sequencing the amplicons obtained from RT- and rapidamplification of cDNA ends (RACE) methodology. The 5 0

RACE and 3 0 RACE System for Rapid Amplification ofcDNA Ends (Invitrogen) was followed according to themanufacturer’s instructions. The sequences of afSKN7-spe-cific primers were as follows: 5cSKN7.1: 5 0-ATTATTTGCTGTCAGTAGATGCTCGCCAGA-3 0; 5cSKN7.2:5 0-TGTTGCAGGAACTGATGAGAGTTCAGAAGA-3 0; 3cSKN7.1: 5 0-CGACCTGATTCTGATGGATATCATCATGCC-3 0; 3cSKN7.2: 5 0-TATTCGCCAATTTGACCGAACTCCTATCAT-3 0.

2.4. Construction of the afSKN7 deletion and

complementation cassettes

The deletion and complementation cassettes used in thiswork were constructed by PCR fusion with a methodadapted from Davidson et al. (2002). All primer positionsare illustrated in Fig. 1a and b. To disrupt the afSKN7

gene, we replaced it with the Escherichia coli HPH geneobtained from the pAN7.1 plasmid (Punt et al., 1987).Hygromycin-resistant transformants were selected for fur-ther study. Site specific recombination was ensured byassociation with the HPH gene of an approximately 1 kbup- and downstream afSKN7 flanking fragments. In a firstPCR round (Fig. 1a), upstream (amplicon 1) and down-stream (amplicon 2) afSKN7 gene fragments, and hygro-mycin B resistance cassette (amplicon 3) were amplifiedfrom WT genomic DNA and pAN7.1 plasmid templates,respectively. Amplicon 1 was amplified using primers 5-SKN7-5 (CCAGGGTCATACTCCGTAACTTGTTGCTTT) and 5-SKN7-3 (TCGTGAATCTTTTACCAGATCGGAAGCAATTAGTCCATCTTGTTAGCCTCAGGACAGCAG), amplicon 2 with primers 3-SKN7-5(TGGTGCACTCTCAGTACAATCTGCTCTGATACCTCAATTATACAATGGCCGACCCTCTTT) and3-SKN7-3 (AGCTAGCCGATATGCAGACCAAGTTAATGG) and amplicon 3 with primers hpSKN7-5(CTGCTGTCCTGAGGCTAACAAGATGGACTAATTGCTTCCGATCTGGTAAAAGATTCACGA) andhpSKN7-3 (AAAGAGGGTCGGCCATTGTATAATTGAGGTATCAGAGCAGATTGTACTGAGAGTGCACCA). The PCR conditions were the same as described inthe section above. Primers 5-SKN7-3, 3-SKN7-5,hpSKN7-5 and hpSKN7-3 were 60 bp chimeric oligonucle-otides, containing at the 5 0-end a reverse complementsequence (5-SKN7-3 with hpSKN7-5, and 3-SKN7-5 withhpSKN7-3) for PCR fusion. The three resulting PCR prod-ucts were gel-purified and used as substrates for a second

Fig. 1. Strategy for generation of afSKN7 deletion and complementation cassettes using a PCR fusion protocol. (a) Deletion cassette. Amplification ofamplicons 1 and 2 from genomic DNA, and amplicon 3 from plasmid pAN7.1, followed by the fusion of these three DNA fragments using primers5-SKN7-5 and 3-SKN7-3. (b) Complementation cassette. Amplification of amplicons 4 and 5 from genomic DNA, followed by fusion of these twofragments using primers 5-SKN7-5 and 3-SKN7-3.

684 C. Lamarre et al. / Fungal Genetics and Biology 44 (2007) 682–690

round of PCR in order to fuse these three separate frag-ments into a deletion cassette using primers 5-SKN7-5and 3-SKN7-3. PCR conditions are as described above,except that the elongation time was doubled to 6 min.The resulting major PCR product was used to transformthe WT strain with or without gel purification of thePCR product. We transformed 106 protoplasts with

20–25 lg of deletion cassette DNA (equivalent to a totalof 10 PCR reactions in our experimental conditions).

The complementation cassette was constructed with thesame method and allowed the insertion of a 6· his-tag atthe 5 0-end of the afSKN7 gene. In a first PCR round, twoPCR fragments were generated (Fig. 1b): upstream (ampli-con 4) afSKN7 flanking fragment was amplified using


primers 5-SKN7-5 and 5-HIS-3 (TCCGAGTACGAAGGGTCTTCCAAGTGGTGGTGGTGGTGGTGCGATCCTCTCATTCTTGTGCAACAAATGAACTAGTTAGAGACATTCCACGAAATATGTG), and a second frag-ment composed of the afSKN7 gene with the downstreamafSKN7 flanking fragment (amplicon 5) amplified withprimers 3-HIS-5 (CGTGGAATGTCTCTAACTAGTTCATTTGTTGCACAAGAATGAGAGGATCGCACCACCACCACCACCACTTGGAAGACCCTTCGTACTCGGAAATCGTTCG) and 3-SKN7-3. Primers 5-HIS-3 and3-HIS-5 are 100 bp chimeric oligonucleotides containingthe his-tag sequence and a reverse complement sequence.The two resulting PCR products were gel-purified and usedas substrates for a second round of PCR performed to fusethese two separate fragments into a complementation cas-sette using primers 5-SKN7-5 and 3-SKN7-3. The resultingmajor PCR product was gel-purified and used to transformstrain afskn7D.

2.5. Deletion of the afSKN7 gene and construction of a

complemented afskn7D::afSKN7 strain

Transformation of A. fumigatus was performed usingthe protoplast procedure previously described (Pariset al., 1993). Correct integration of the deletion and com-plementation cassettes was first confirmed by PCR usingprimers verif5 (CATTAGACTTCCCCTCCACCATCATCATC) and verif3 (AATCTGGAGCATTCCGCACTTTCAATAGTT) and by Southern blot hybridization.

2.6. Phenotypic tests

The effect of the afSKN7 deletion was evaluated on1.5% agar YPD plates. We tested the sensitivity of theafskn7D mutant to various stress conditions: (1) growthat 45 �C and heat shock (70 �C up to 15 min); (2) cellwall inhibitors such as caffeine (1 mM); sodium orthovan-adate (up to 10 lM); calcofluor white (up to 50 lg/ml)and SDS (up to 0.02%); (3) osmotic stress induced byNaCl (1.5 M), mannitol and sorbitol (2 and 2.5 M),and (4) oxidants such as H2O2 (up to 6 mM), t-BOOH(up to 0.6 mM), menadione (up to 0.16 mM), diamideand diethyl maleate (up to 2 mM). Five microliters ofa conidial suspension containing 105–106 conidia wasspotted on YPD agar plates and incubated at 37 �C for48–72 h.

2.7. Killing of conidia by immunocompetent alveolar

macrophages

This experiment was assessed as previously described(Chabane et al., 2006). Briefly, immunocompetent micewere infected with 106 FITC-labeled conidia for 24 h.Mouse alveolar macrophages (MAMs) were harvestedand the percentage of conidia killed by MAMs wasassessed microscopically. Three experiments wereperformed.

2.8. Killing of mycelium by immunocompetent neutrophils

The killing of mycelium was performed using the XTTmethod, as previously described (Chabane et al., 2006).Briefly, 0.2 ml of human PMNs (2.5 · 104 cells/ml) inRPMI-1640 containing 2.5 · 104 germinating conidia wasadded per well. After 24 h at 37 �C under CO2, the neutro-phils were lysed and 0.2 ml of XTT+PMS solution (Sigma)was added. Growth inhibition for each strain was calculat-ed based on colorimetric measurements. Two experimentseach with three replicates per strain were completed.

2.9. Virulence assays in immunocompromised mice

Virulence of the mutants was assessed in a mouse modelof experimental aspergillosis (Philippe et al., 2003). Briefly,6–8-week-old OF1 mice were immunosuppressed with25 mg of cortisone acetate (Sigma) injected intraperitoneallyat day �3 and 0, and inoculated intranasally with 2 · 106

conidia. Survival of mice was followed twice daily over aperiod of 14 days. Two independent experiments withcohorts of ten mice were performed.

2.10. Statistical analysis

Variance analysis and Kaplan–Meier survival analysiswere performed using the JMP software. Average ± stan-dard deviation values were computed. Significance forany analysis with a p value <0.05 is indicated.

3. Results

3.1. Analysis of the afSKN7 gene sequence

The sequence of the A. fumigatus afSKN7 gene(Afu6g12520) was obtained from the A. fumigatus genomeproject page (http://www.tigr.org/tdb/e2k1/afu1/). The2028 bp long open reading frame predicted a 597-amino-acid protein which contains homologous DNA-bindingand receiver domains, typical of response regulators oftwo-component signalling systems. However, several rea-sons led us to think that the TIGR afSKN7 gene sequencewas erroneous. When compared to other SKN7 orthologs,i.e., S. cerevisiae, C. albicans and C. neoformans, theafSkn7p was the only protein where the first methioninewas located in the conserved DNA-binding domain(Fig. 2a for comparison to the S. cerevisiae Skn7p). More-over, a 31-amino-acid peptide (Afu6g12510) identified bythe TIGR database, located 116 bp upstream of theafSKN7 putative ATG start codon (Fig. 2b), contains a10 amino acid sequence found at the beginning of the con-served DNA-binding domain of known SKN7 orthologs(Fig. 2c), suggesting that this hypothetical peptide couldbelong to the afSkn7p sequence. Finally, a Northern blotanalysis of afSKN7 detected a single mRNA species esti-mated at 2.6 kb, nearly 800 bp longer then the 1.8 kb TIGRafskn7 cDNA sequence (Fig. 2d), suggesting a 5 0-and/or

http://www.tigr.org/tdb/e2k1/afu1/

Fig. 2. (a) Schematic representation of amino acid alignment between Skn7p of S. cerevisiae and A. fumigatus. DNA-binding, coiled–coil and receiverdomains are indicated by light-grey, grey and black boxes, respectively. Gaps introduced by the alignment in Skn7p of S. cerevisiae are represented by thinlines. Arrows in the receiver domain indicate the conserved aspartyl residue along with the surrounding amino acids. (b) Schematic representation of openreading frames surrounding the A. fumigatus afSKN7 locus in chromosome 6. The direction of the arrow indicates the orientation of the gene. Accordingto the A. fumigatus sequencing project page, (1) was annotated as a AhpC/TSA family protein (Afu6g12500), (2) as an hypothetical protein (Afu6g12510),and (3) as an elongation factor eif-2b (Afu6g12530). (c) Amino acid alignment of the Skn7p of S. cerevisiae (ScSkn7p), C. albicans (CaSkn7p),C. neoformans (CnSkn7p) and the A. fumigatus hypothetical protein Afu6g12510 (Af peptide). Numbers at both ends of sequences indicate where thoseamino acids are located in the sequence. The arrow indicates the first residue of the DNA-binding domain of the S. cerevisiae Skn7p according to Williamsand Cyert (2001). (d) Northern blot of total RNA from wild-type strain treated 30 min with 1 mM H2O2, and probed with a labelled afSKN7 genomicfragment.


3 0-end incomplete gene sequence. In order to obtain thefull-length nucleotide sequence of the afSKN7 gene, thecDNA was amplified using RT- and RACE PCR methodsas described in the materials and methods. This analysisconfirmed that the afSKN7 open reading frame contained2028 bp, interrupted by four introns of 77, 50, 52 and55 bp (starting at nucleotide 73, 294, 1235 and 1477,respectively). RACE methodology identified a long 3 0-un-translated region (3 0UTR) of 643 bp and a short 5 0-un-translated region (5 0UTR) of 81 bp. The translatedsequence was predicted to encode a 597 amino acid proteinshowing substantial sequence similarity to the SKN7 geneof S. cerevisiae, mainly located in the DNA binding andreceiver domains (70% identity/81% similarity and 48%identity/65% similarity, respectively). The latter domainalso included the conserved aspartyl residue (D391)thought to be the site of phosphorylation (Fig. 2a). Acoiled–coil region was also identified using COILS pro-gram (Lupas et al., 1991). A short 44 amino acid sequencejust downstream of the conserved DNA binding domainalso showed a high identity/similarity percentage (50%identity/73% similarity). A survey of the TIGR web sitedatabase showed that the afSKN7 was unique in the gen-ome of A. fumigatus, as confirmed by Southern blot analy-sis using the afSKN7 flanking regions as probes (Fig. 3c).

3.2. Deletion and complementation of the afSKN7 gene

Construction of cassettes for the generation and comple-mentation of a chromosomal mutant was based on a two

step PCR fusion protocol that required a total of six prim-ers for only four independent PCR (Fig. 1a). Preliminaryassays have shown that two parameters are critical forthe success of this fusion PCR protocol: (I) the size ofthe primers must be 60 bp (30 bp on each fragment) com-plementary between the 3 0-end of fragment 1/5 0-end offragment 3 and 3 0-end of fragment 3/5 0-end of fragment 2with a melting temperature of 70 �C, and (II) the Advan-tage II Taq polymerase must be used, because duringPCR amplification this enzyme does not add an ‘‘A’’ atthe 3 0-end of amplicons, avoiding putative mismatch dur-ing the final fusion PCR amplification. Best transformationefficiency was obtained when using a deletion cassette with>1 kb flanking regions (data not shown). Deletion ofafSKN7 gene was confirmed by PCR (Fig. 3b) using verif5and verif3 primers positioned outside the up- and down-stream afSKN7 flanking fragments (Fig. 3a) and by South-ern blot hybridization, with the restriction enzyme XbaI(Fig. 3c). Our data confirm that a single insertion intothe genome occurred by the displacement of the nativebands to the expected positions in mutant strain(Fig. 3c). To restore the wild-type phenotype, we also usedPCR fusion and obtained the same efficiency as statedabove for the construction of afSKN7 deletion mutant.After transformation and selection on YPD plates supple-mented with 1 mM H2O2, seven clones resistant to H2O2

and sensitive to hygromycin were randomly selected.PCR and Southern blotting confirmed the excision of theHPH gene and the restoration of the wild-type phenotype(Fig. 3a, b and c, see strain HISafSKN7).

Fig. 3. (a) Restriction maps of genomic fragments containing the afSKN7 wild-type allele (WT), the E. coli HPH containing the afskn7 disrupted allele(afskn7D), and the his-tagged afSKN7 reconstituted allele (HISafSKN7). Grey boxes indicate the afSKN7 5 0- and 3 0-flanking sequences used forhomologous recombination. The sizes of the relevant DNA fragments (bp) generated by PCR amplifications, for selection of transformants and by XbaIgenomic DNA digestions, to verify the unique insertion of the disruption cassette, are indicated. Sites of the PCR primers and XbaI sites used areindicated. (b) Deletion of the native afSKN7 was indicated by the single amplicon at 4938 bp for the afskn7D strain, and amplification of the native (WT)and his-tagged restored (HISafSKN7) SKN7 gene was indicated by amplification of a single amplicon at 4584 and 4611 bp, respectively. (c) Southern blotof genomic DNAs from the same three strains that were digested with XbaI and probed with [a-32P]dCTP labelled afSKN7 5 0- and 3 0-flanking genomicfragment.


The PCR fusion protocol developed shortened consider-ably the time needed to construct a mutant in A. fumigatus

since the 25 lg of deletion cassette was obtained in lessthan 2 days. Moreover, since the two genes mostly usedfor selection of dominant resistance markers during mutantconstruction in A. fumigatus (hygromycin B and phleomy-cin) are regulated by the same promoter and terminator,primers designed to amplify the resistant gene (hpskn7-5and hpskn7-3) for the construction of the disruption cas-sette were functional on both genes (data not shown forphleomycin).

3.3. Phenotypic analysis

The A. fumigatus afskn7D strain did not show any differ-ence in growth rate with the WT and reconstituted strainsafter incubation for 48 h at 37 �C (Fig. 4a–d) and 45 �C(data not shown) or under heat shock at 70 �C on YPDplates (data not shown). No morphological differenceswere seen between the conidia or mycelia morphologiesand the level of conidiation of mutant and WT strains(data not shown). In addition, the susceptibility of the

afskn7D strain to caffeine, sodium orthovanadate andcalcofluor white was identical to the WT strain (data notshown), while a slight sensitivity to SDS for the mutantwas observed when compared to the WT and reconstitutedstrains. No growth differences were seen between mutantand WT strains in the presence of high molar NaCl, man-nitol or sorbitol (data not shown). In contrast, the sensitiv-ity of the WT and afskn7D strains to oxidants was different.Although no differences in sensitivity between strains wereobserved for menadione (Fig. 4b), diethyl maleate and dia-mide (data not shown), an increased sensitivity to H2O2

(Fig. 4c) or t-BOOH (Fig. 4d) was observed for the afskn7Dstrain when compared to WT and reconstituted strains.

3.4. Virulence of afskn7D mutant in murine model and

sensitivity to phagocytes

The conidial killing by alveolar macrophages obtainedfrom animals at 24 h post-infection was estimated in threeindependent experiments. No significant differences(p < 0.05) were seen for the killing of the conidia of theWT, afskn7D and reconstituted strains. The percentage of

Fig. 4. Colonies of A. fumigatus WT, afskn7D and HISafSKN7 strains (a: 105 conidia in 5 ll, centrally inoculated; 72 h at 37 �C; b, c, d: 106 conidia for48 h at 37 �C) after addition of different concentrations of (a) SDS; (b) menadione; (c) H2O2 and (d) t-BOOH. Concentrations indicated represent the finaldrug concentration in the YPD agar in % v/v for SDS and in mM for menadione, H2O2 and t-BOOH.


killing obtained was, respectively, 82 ± 10%, 88 ± 7% and81 ± 6%. Similarly, the in vitro mycelial sensitivity tohuman neutrophils was not significatively different(p < 0.05) between all strains. In the conditions tested,mycelial death estimated as a percentage of the controlby XTT measurements for the WT, mutant and reconsti-tuted strains was respectively, 36 ± 5%, 35 ± 6% and34 ± 5%. Finally, in a murine model of pulmonary asper-gillosis, Kaplan–Meier analysis showed that no differencewas observed in the survival rate of mice, based on twoindependent experiments. An LD50 was determined forall experiments after 2–5 days and found to be similar forall strains.

4. Discussion

Reactive oxidants are the main toxic metabolites pro-duced by phagocytes to fight A. fumigatus (Philippe

et al., 2003). Lowering the level of phagocytic ROIsimpaired the phagocyte killing activity, leading to invasionof the lung and disease. The fungal response regulatorSKN7 is involved in resistance of yeasts to oxidants andvirulence (Singh et al., 2004; Wormley et al., 2005; Coenja-erts et al., 2006). Since no information existed for moldorthologs, we decided to determine the role of this genein the human pathogenic fungus A. fumigatus.

The analysis of the A. fumigatus afSKN7 gene has leadto an unexpected finding. The mRNA size was almost0.8 kb bigger then the TIGR afSKN7 gene sequence. Rese-quencing the afskn7 cDNA finally confirmed the position-ing of the afSKN7 translation start and stop sites. Theimportant size difference observed between the cDNAannotated by the TIGR’s sequencing project and the lengthof transcript obtained by Northern analysis was due to the643 bp-long 3 0-untranslated region (3 0UTR). To have anorder of magnitude of the 3 0UTR gene length in


A. fumigatus, we randomly sequenced over 60 independentclones (representing 20 genes) of a cDNA library construct-ed with mRNA purified from resting conidia as templateand oligo(dT) as a primer for cDNA synthesis. The inter-genic 3 0UTR length variation ranged from 50 to 375 bp,with an average value of 170 bp. These results are in agree-ment for the 3 0UTR average length (237 bp) found in fungi(Mignone et al., 2002). The 643 bp afSKN7 3 0UTR isalmost three times longer then the average fungal 3 0UTR.The 81 bp-long 5 0UTR found in the afskn7 mRNA indicat-ed that only 35 bp separate the STOP codon of the hypo-thetical protein encoded gene (Afu6g12510) and thetranscription start site observed for afSKN7 by 5 0 RACE.

We know little about the RNA motifs located in the3 0UTR of genes, even though that they affect mRNA sta-bility and subcellular localization. Two recent studies havefocused upon creating a catalogue of 3 0UTR motifs. Xieet al. (2005) compared 17,700 3 0UTRs belonging to human,mouse, rat, and dog genomes and identified 60 3 0UTRmotifs. None of these motifs were found in the afSKN7

3 0UTR. Shalgi et al. (2005) analyzed the 3 0UTR sequencesof S. cerevisiae genes and derived a catalogue of 53sequence motifs. Two of these motifs were found in theS. cerevisiae SKN7 3 0UTR sequence, but none were presentin the afSKN7 3 0UTR. Nevertheless, the S. cerevisiae

3 0UTR length was estimated to be 761 bp, which is in thesame range as that of the A. fumigatus 3 0UTR sequence.The role of the 3 0UTR length in the stability of afSKN7

transcription remains an open question.In A. fumigatus, the afskn7D strain was more sensitive to

H2O2 and t-BOOH than the WT. However, the sensitivityobserved in the A. fumigatus afskn7D mutant was notobserved with other oxidants, since the mutant was as resis-tant as the WT strain to menadione, a superoxide aniongenerating compound (Caricchio et al., 1999). Similarresults were also observed for the skn7D mutants of C. albi-

cans (Sorger and Pelham, 1988; Singh et al., 2004) andC. neoformans (Wormley et al., 2005). In addition, S. cere-visiae Skn7p activates the expression of several importantgenes involved in resistance to H2O2 such as catalase,superoxide dismutase, and thioredoxin (Morgan et al.,1997; Lee et al., 1999). Functional complementation ofthe yeast skn7D mutant with the afSKN7 gene shouldnow be undertaken to verify that the SKN7 gene of theyeast and A. fumigatus display the same function.

In spite of the peroxide sensitivity of the afskn7Dmutant, no difference in virulence was observed in a murinemodel of pulmonary aspergillosis, as for its resistance tokilling by alveolar macrophages or neutrophils in vitro.These results can be explained by the fact that sensitivityto peroxides in vitro cannot be translated into a virulencedefect in A. fumigatus. Similar results were found with cat-alase mutants of A. fumigatus (Paris et al., 1993) that aremore sensitive to H2O2 than WT in vitro but are as patho-genic in our model of experimental murine aspergillosis. Ithas been shown that mice with a myeloperoxidase (MPO)deficiency, resulting in a lack of oxidant production from

H2O2, are not susceptible to aspergillosis (Aratani et al.,2002), whereas mice with a defect in the NADPH oxidasecomplex in phagocytic cells, therefore defective in superox-ide anion production, are highly susceptible to A. fumigatus

(Dennis et al., 2006).These results in total suggest a more important role for

O2� in killing A. fumigatus than peroxides (Chabane

et al., 2006; Tekaia and Latge, 2005), especially sinceA. fumigatus has an exquisite sensitivity to menadionewhen compared to pathogenic yeasts. This hypothesis ispresently being tested by disrupting superoxide dismutasegenes that are the first enzymes able to inactivate the ionsuperoxide.

Acknowledgments

This research in part was supported by an NIH-NIAIDJohn E. Fogarty International Center grant (5R03TW001597) to J.P.L. and R.C.

References

Alberts, A.S., Bouquin, N., Johnston, L.H., Treisman, R., 1998. Analysisof RhoA-binding proteins reveals an interaction domain conserved inheterotrimeric G protein beta subunits and the yeast responseregulator protein Skn7. J. Biol. Chem. 273, 8616–8622.

Aratani, Y., Kura, F., Watanabe, H., Akagawa, H., Takano, Y., Suzuki,K., Dinauer, M.C., Maeda, N., Koyama, H., 2002. Relative contri-butions of myeloperoxidase and NADPH-oxidase to the early hostdefense against pulmonary infections with Candida albicans andAspergillus fumigatus. Med. Mycol. 40, 557–563.

Bouquin, N., Johnson, A.L., Morgan, B.A., Johnston, L.H., 1999.Association of the cell cycle transcription factor Mbp1 with the Skn7response regulator in budding yeast. Mol. Biol. Cell. 10, 3389–3400.

Brown, J.L., North, S., Bussey, H., 1993. SKN7, a yeast multicopysuppressor of a mutation affecting cell wall beta-glucan assembly,encodes a product with domains homologous to prokaryotic two-component regulators and to heat shock transcription factors. J.Bacteriol. 175, 6908–6915.

Brown, J.L., Bussey, H., Stewart, R.C., 1994. Yeast Skn7p functions in aeukaryotic two-component regulatory pathway. EMBO J. 13, 5186–5194.

Caricchio, R., Kovalenko, D., Kaufmann, W.K., Cohen, P.L., 1999.Apoptosis provoked by the oxidative stress inducer menadioneVitamin K3 is mediated by the Fas/Fas ligand system. Clin. Immunol.93, 65–74.

Chabane, S., Sarfati, J., Ibrahim-Granet, O., Du, C., Schmidt, C.,Mouyna, I., Prevost, M.C., Calderone, R., Latge, JP., 2006. Glyco-sylphosphatidylinositol-anchored Ecm33p influences conidial cell wallbiosynthesis in Aspergillus fumigatus. Appl. Environ. Microbiol. 72,3259–3267.

Chauhan, N., Latge, J.P., Calderone, R., 2006. Signalling and oxidantadaptation in Candida albicans and Aspergillus fumigatus. Nat. Rev.Microbiol. 4, 435–444.

Coenjaerts, F.E., Hoepelman, A.I., Scharringa, J., Aarts, M., Ellerbroek,P.M., Bevaart, L., Van Strijp, J.A., Janbon, G., 2006. The Skn7response regulator of Cryptococcus neoformans is involved in oxidativestress signalling and augments intracellular survival in endothelium.FEMS Yeast Res. 6, 652–661.

Davidson, R.C., Blankenship, J.R., Kraus, P.R., de Jesus-Berrios, M.,Hull, C.M., D’Souza, C., Wang, P., Heitman, T., 2002. A PCR-basedstrategy to generate integrative targeting alleles with large regions ofhomology. Microbiology 148, 2607–2615.


Dennis, C.G., Greco, W.R., Brun, Y., Youn, R., Slocum, H.K., Bernacki,R.J., Lewis, R., Wiederhold, N., Holland, S.M., Petraitiene, R., Walsh,T.J., Segal, B.H., 2006. Effect of amphotericin B and micafungincombination on survival, histopathology, and fungal burden inexperimental aspergillosis in the p47phox-/- mouse model of chronicgranulomatous disease. Antimicrob. Agents Chemother. 50, 422–427.

Girardin, H., Latge, J.P., Srikantha, T., Morrow, B., Soll, D.R., 1993.Development of DNA probes for fingerprinting Aspergillus fumigatus.J. Clin. Microbiol. 31, 1547–1554.

He, X.J., Fassler, J.S., 2005. Identification of novel Yap1p and Skn7pbinding sites involved in the oxidative stress response of Saccharomy-

ces cerevisiae. Mol. Microbiol. 58, 1454–1467.Ketela, T., Brown, J.L., Stewart, R.C., Bussey, H., 1998. Yeast Skn7p

activity is modulated by the Sln1p-Ypd1p osmosensor and contrib-utes to regulation of the HOG pathway. Mol. Gen. Genet. 259,372–378.

Krems, B., Charizanis, C., Entian, K.D., 1996. The response regulator-likeprotein Pos9/Skn7 of Saccharomyces cerevisiae is involved in oxidativestress resistance. Curr. Genet. 29, 327–334.

Kruppa, M., Calderone, R., 2006. Two-component signal transduction inhuman fungal pathogens. FEMS Yeast Res. 6, 149–159.

Latge, J.P., 1999. Aspergillus fumigatus and aspergillosis. Clin. Microbiol.Rev. 12, 310–350.

Lee, J., Godon, C., Lagniel, G., Spector, D., Garin, J., Labarre, J.,Toledano, M.B., 1999. Yap1 and Skn7 control two specializedoxidative stress response regulons in yeast. J. Biol. Chem. 274,16040–16046.

Levin, D.E., Bartlett-Heubusch, E., 1992. Mutants in the S. cerevisiae

PKC1 gene display a cell cycle-specific osmotic stability defect. J. CellBiol. 116, 1221–1229.

Li, S., Ault, A., Malone, C.L., Raitt, D., Dean, S., Johnston, L.H.,Deschenes, R.J., Fassler, J.S., 1998. The yeast histidine protein kinase,Sln1p, mediates phosphotransfer to two response regulators, Ssk1pand Skn7p. EMBO J. 17, 6952–6962.

Li, S., Dean, S., Li, Z., Horecka, J., Deschenes, R.J., Fassler, J.S.,2002. The eukaryotic two-component histidine kinase Sln1p regu-lates OCH1 via the transcription factor, Skn7p. Mol. Biol. Cell. 13,412–424.

Lu, J.M., Deschenes, R.J., Fassler, J.S., 2003. Saccharomyces cerevisiae

histidine phosphotransferase Ypd1p shuttles between the nucleus andcytoplasm for SLN1-dependent phosphorylation of Ssk1p and Skn7p.Eukaryot. Cell 2, 1304–1314.

Lu, J.M., Deschenes, R.J., Fassler, J.S., 2004. Role for the Ran bindingprotein, Mog1p, in Saccharomyces cerevisiae SLN1-SKN7 signaltransduction. Eukaryot. Cell 3, 1544–1556.

Lupas, A., Van Dyke, M., Stock, J., 1991. Predicting coiled coils fromprotein sequences. Science 252, 1162–1164.

Maeda, T., Wurgler-Murphy, S.M., Saito, H., 1994. A two-componentsystem that regulates an osmosensing MAP kinase cascade in yeast.Nature 369, 242–245.

Mignone, F., Gissi, C., Liuni, S., Pesole, G., 2002. Untranslated regions ofmRNAs. Genome Biol. 3, 1–10.

Morgan, B.A., Bouquin, N., Merrill, G.F., Johnston, L.H., 1995. A yeasttranscription factor bypassing the requirement for SBF and DSC1/MBF in budding yeast has homology to bacterial signal transductionproteins. EMBO J. 14, 5679–5689.

Morgan, B.A., Banks, G.R., Toone, W.M., Raitt, D., Kuge, S., Johnston,L.H., 1997. The Skn7 response regulator controls gene expression inthe oxidative stress response of the budding yeast Saccharomyces

cerevisiae. EMBO J. 16, 1035–1044.

Paris, S., Monod, M., Diaquin, M., Lamy, B., Arruda, L.K., Punt, P.J.,Latge, J.P., 1993. A transformant of Aspergillus fumigatus deficientin the antigenic cytotoxin ASPFI. FEMS Microbiol. Lett. 111, 31–36.

Philippe, B., Ibrahim-Granet, O., Prevost, M.C., Gougerot-Pocidalo,M.A., Sanchez Perez, M., Van der Meeren, A., Latge, J.P., 2003.Killing of Aspergillus fumigatus by alveolar macrophages is mediatedby reactive oxidant intermediates. Infect. Immun. 71, 3034–3042.

Posas, F., Wurgler-Murphy, S.M., Maeda, T., Witten, E.A., Thai, T.C.,Saito, H., 1996. Yeast HOG1 MAP kinase cascade is regulated by amultistep phosphorelay mechanism in the SLN1-YPD1-SSK1 ‘‘two-component’’ osmosensor. Cell 86, 865–875.

Posas, F., Saito, H., 1998. Activation of the yeast SSK2 MAP kinasekinase kinase by the SSK1 two-component response regulator. EMBOJ. 17, 1385–1394.

Punt, P.J., Oliver, R.P., Dingemanse, M.A., Pouwels, P.H., van denHondel, C.A., 1987. Transformation of Aspergillus based on thehygromycin B resistance marker from Escherichia coli. Gene 56, 117–124.

Raitt, D.C., Johnson, A.L., Erkine, A.M., Makino, K., Morgan, B.,Gross, D.S., Johnston, L.H., 2000. The Skn7 response regulator ofSaccharomyces cerevisiae interacts with Hsf1 in vivo and is required forthe induction of heat shock genes by oxidative stress. Mol. Biol. Cell.11, 2335–2347.

Rementeria, A., Lopez-Molina, N., Ludwig, A., Vivanco, A.B., Bikandi,J., Ponton, J., Garaizar, J., 2005. Genes and molecules involved inAspergillus fumigatus virulence. Rev. Iberoam. Micol. 22, 1–23.

Shalgi, R., Lapidot, M., Shamir, R., Pilpel, Y., 2005. A catalog ofstability-associated sequence elements in 3 0 UTRs of yeast mRNAs.Genome Biol. 6, R86.

Singh, P., Chauhan, N., Ghosh, A., Dixon, F., Calderone, R., 2004. SKN7

of Candida albicans, mutant construction and phenotype analysis.Infect. Immun. 72, 2390–2394.

Sorger, P.K., Pelham, H.R., 1988. Yeast heat shock factor is an essentialDNA-binding protein that exhibits temperature-dependent phosphor-ylation. Cell 54, 855–864.

Tao, W., Deschenes, R.J., Fassler, J.S., 1999. Intracellular glycerol levelsmodulate the activity of Sln1p, a Saccharomyces cerevisiae two-component regulator. J. Biol. Chem. 274, 360–367.

Tekaia, F., Latge, J.P., 2005. Aspergillus fumigatus, saprophyte orpathogen? Curr. Opin. Microbiol. 8, 385–392.

Tsuzi, D., Maeta, K., Takatsume, Y., Izawa, S., Inoue, Y., 2004.Distinct regulatory mechanism of yeast GPX2 encoding phospholipidhydroperoxide glutathione peroxidase by oxidative stress and acalcineurin/Crz1-mediated Ca2+ signaling pathway. FEBS Lett. 569,301–306.

Walsh, T.J., Roilides, E., Cortez, K., Kottilil, S., Bailey, J., Lyman, C.A.,2005. Control, immunoregulation, and expression of innate pulmonaryhost defenses against Aspergillus fumigatus. Med. Mycol. (Suppl. 1),S165–S172.

Williams, K.E., Cyert, M.S., 2001. The eukaryotic response regulatorSkn7p regulates calcineurin signaling through stabilization of Crz1p.EMBO J. 20, 3473–3483.

Wormley Jr., F.L., Heinrich, G., Miller, J.L., Perfect, J.R., Cox, G.M.,2005. Identification and characterization of an SKN7 homologue inCryptococcus neoformans. Infect. Immun. 73, 5022–5030.

Xie, X., Lu, J., Kulbokas, E.J., Golub, T.R., Mootha, V., Lindblad-Toh,K., Lander, E.S., Kellis, M., 2005. Systematic discovery of regulatorymotifs in human promoters and 3 0 UTRs by comparison of severalmammals. Nature 434, 338–345.

characterization of the skn7 ortholog of aspergillus fumigatus

Documents