ORIGINAL ARTICLE

Cannabinoids Decrease the Th17 InflammatoryAutoimmune Phenotype

Ewa Kozela & Ana Juknat & Nathali Kaushansky &

Neta Rimmerman & Avraham Ben-Nun & Zvi Vogel

Received: 17 June 2013 /Accepted: 15 July 2013# Springer Science+Business Media New York 2013

Abstract Cannabinoids, the Cannabis constituents, are knownto possess anti-inflammatory properties but the mechanismsinvolved are not understood. Here we show that the mainpsychoactive cannabinoid, Δ-9-tetrahydrocannabinol (THC),and the main nonpsychoactive cannabinoid, cannabidiol(CBD), markedly reduce the Th17 phenotype which is knownto be increased in inflammatory autoimmune pathologies such asMultiple Sclerosis. We found that reactivation byMOG35-55 ofMOG35-55-specific encephalitogenic T cells (cells that induceExperimental Autoimmune Encephalitis when injected to mice)in the presence of spleen derived antigen presenting cells led to alarge increase in IL-17 production and secretion. In addition, wefound that the cannabinoids CBD and THC dose-dependently(at 0.1–5 μM) suppressed the production and secretion of thiscytokine. Moreover, the mRNA and protein of IL-6, a key factorin Th17 induction, were also decreased. Pretreatment with CBDalso resulted in increased levels of the anti-inflammatory cyto-kine IL-10. Interestingly, CBD and THC did not affect the levelsof TNFα and IFNγ. The downregulation of IL-17 secretion bythese cannabinoids does not seem to involve the CB1, CB2,PPARγ, 5-HT1A or TRPV1 receptors. In conclusion, the resultsshow a unique cannabinoid modulation of the autoimmunecytokine milieu combining suppression of the pathogenic

IL-17 and IL-6 cytokines along with boosting the expressionof the anti-inflammatory cytokine IL-10.

Keywords Cannabinoid . EAE . Encephalitogenic Tcells .

IL-17 . IL-6 . IL-10

Introduction

Cannabinoids present inCannabis extracts (e.g. in hashish ormarijuana) and the endocannabinoids’ (eCB, i.e. ananda-mide and 2-arachidonoylglycerol) have been shown to exertpotent anti-inflammatory activities in various experimentalmodels of inflammation and neuroinflammatory diseases(Nagarkatti et al. 2009; Tanasescu and Constantinescu2010). Multiple sclerosis (MS) is one of the most commonautoimmune neurodegenerative diseases with unclear triggerand still missing therapeutic solutions. The disease is drivenby lineages of self-reactive T cells falsely primed by antigenpresenting cells (APC) to target components of the CNS, inparticular myelin (van Zwam et al. 2009). These processesresult in neurodegeneration and progressing disabilities suchas limb weakness, muscle spasms, visual disturbances andothers (Sospedra and Martin 2005). Cannabinoids wereshown to alleviate the pathological changes in the murinedemyelinating disease, experimental autoimmune encepha-lomyelitis [EAE] (Lyman et al. 1989; Maresz et al. 2007;Kozela et al. 2011), which is a commonly used model of MS(Shevach 2011). These activities of cannabinoids may in-volve either CB1 receptors present on neurons or CB2 re-ceptors present mostly on immune cells as shown usingthe major Cannabis-derived CB1/CB2 ligand, Δ-9-tetrahydrocannabinol (THC) (Mackie 2005; Maresz et al.2007). However, cannabinoids were found also to act viamechanisms that do not involve CB1 or CB2. For example,cannabidiol (CBD) is a major non-psychoactive Cannabisconstituent with very low CB1/CB2 receptor affinity

E. Kozela (*) :A. Juknat :N. Rimmerman : Z. VogelThe Dr Miriam and Sheldon G. Adelson Center for the Biology ofAddictive Diseases, Sackler Faculty of Medicine, Tel AvivUniversity, Tel Aviv, Israele-mail: ewa.kozela@weizmann.ac.il

N. Kaushansky :A. Ben-NunImmunology Department, Weizmann Institute of Science, Rehovot,Israel

Z. VogelNeurobiology Department, Weizmann Institute of Science,Rehovot, Israel

J Neuroimmune PharmacolDOI 10.1007/s11481-013-9493-1

(Showalter et al. 1996) showing potent immunomodulatoryand anti-inflammatory properties including suppression of cyto-kine and chemokine secretions, immune cell proliferation, mat-uration, migration and antigen presentation (Izzo et al. 2009;Booz 2011). Interestingly, targets outside of the endocan-nabinoid system were suggested to mediate its effects includingtransient receptor potential vanilloid type 1 (TRPV1) ion chan-nel (Hegde et al. 2011), nuclear peroxisome proliferator-activated receptor type γ (PPARγ) (O’Sullivan and Kendall2010) or serotonin 5-hydroxytriptamine 1A (5-HT1A)(Mishima et al. 2005) receptors. Recently, we reported thatCBD administered systemically diminishes the CNS immuneinfiltration, microglial activation, axonal damage and motordisabilities in the EAE model of myelin oligodendrocyte glyco-protein (MOG)35-55-immunized C57BL/6 mice. CBD alsodiminished theMOG35-55-induced proliferation of autoreactiveencephalitogenic T cells in culture (Kozela et al. 2011).However, little is known about the mechanisms by which can-nabinoids affect the inflammatory autoimmune processes.

IL-17 cytokine, produced by a specific class of helper/effectorautoreactive Tcells defined as Th17 (Harrington et al. 2005), hasbeen suggested to serve as a critical factor in autoimmunediseases (Kebir et al. 2007; Fouser et al. 2008). Th17 cellsdifferentiate from naïve CD4+ T cells after a maturational pro-cess induced by antigenic stimulation (e.g. byMOG35-55) in thecritical presence of IL-6 and TGFβ (Zhou et al. 2007; Veldhoenet al. 2006) and other accessory cytokines such as IFNγ orTNFα (Maddur et al. 2012). It has been shown that myelin-specific Th17 cells interact with neuronal cells in demyelinatinglesions (Siffrin et al. 2010) and that deficiency or neutralizationof IL-17 delays the onset of EAE and reduces the severity of thedisease (Komiyama et al. 2006). Human studies showed that IL-17 levels were increased in sera, cerebrospinal fluid and at thesites of lesions of MS patients (Matusevicius et al. 1999).

We have established an autoreactive MOG35-55-specificencephalitogenic T cell line that expresses T cell receptorsspecific for MOG35-55 peptide and proliferates in responseto MOG35-55 stimulation (Ben-Nun and Cohen 1982;Kozela et al. 2011). Adoptive transfer of these encephalito-genic T cells to healthy animals results in rapid and severeEAE clinical symptoms (passive EAE model) (Shevach2011; Yura et al. 2001). The high pathogenicity of these Tcells is due to their ability to transmigrate through the bloodbrain barrier and to recruit other immune cells such asmonocytes, microglia and endogenous MOG35-55-specificB cells with accelerated autoantibody production (Sospedraand Martin 2005; Wekerle 1999). Moreover, following re-covery from acute disease, memory T cells remain function-ally intact in the peripheral immune system and, upon acti-vation, evoke repeated disease episodes (Kawakami et al.2005). Thus, such autoreactive, memory T cell lineages havebecome candidate targets in a search for treatments for T celldriven inflammatory autoimmune pathologies.

In this work, using an autoreactive MOG35-55-specificencephalitogenic T cell line, we have studied the effects ofCBD and THC on the production and secretion of IL-17 andof several cytokines known to be critical for Th17 induction.We show that these phytocannabinoids decrease the Th17phenotype, a result that explains the cannabinoid beneficialactivities in EAE and in other inflammatory autoimmunepathologies.

Materials and methods

Reagents

Lyophilized MOG35-55 peptide [MEVGWYRSPFSRVVHLYRNGK] purchased from GenScript (Piscataway, NJ,USA) was reconstituted in sterile PBS and the stock solutionstored in −20 °C. THC and CBD were obtained from theNational Institute on Drug Abuse (Baltimore, MD, USA).The CB1 receptor antagonist, SR141716, was obtained fromTocris, Ellisville, MO, USA. The CB2 antagonist, AM630,was purchased from Cayman Chemical, Ann Arbor, MI,USA. GW9662 (PPARγ antagonist), capsazepine (TRPV1antagonist) and WAY-100635 (5-HT1A antagonist) wereobtained from Sigma (St. Louis, MO, USA). WAY-100635was dissolved and applied in H2O, GW9662 and AM630 inDMSO and SR141716 and capsazepine in EtOH. The finalconcentrations of EtOH or DMSO in the various experimentsdid not exceed 0.1–0.2 %. All antagonists were applied30 min before the administration of CBD or THC.Propidium Iodide (PI) was purchased from Sigma. Foetalcalf serum and other tissue culture reagents were obtainedfrom Biological Industries (Kibbutz Beit HaEmek, Israel).

Encephalitogenic T cell line

TheMOG35-55-specific Tcell line was established from lymphnode cells of C57BL/6 female mice that had been primed10 days earlier with MOG35-55 emulsified in CompleteFreund Adjuvant as previously described (Kozela et al. 2011).This T cell line has been maintained in vitro in RPMI-1640containing 5 % foetal calf serum and supplemented with 10U/ml IL-2 (Peprotech Inc, Rocky Hill, NJ, USA), 2 mM L-glutamine, 100μg/ml streptomycin, 100U/ml penicillin, 50μMβ-mercaptoethanol, non-essential amino acids and 1 mM sodi-um pyruvate with alternate stimulation with MOG35-55 every14 days as previously described (Ben-Nun and Cohen 1982;Kozela et al. 2011).

Enzyme-linked immunosorbent assay (ELISA)

The MOG35-55-reactive encephalitogenic T cell line wascultured in 24-well plates (0.25×106 cells per well) together

with splenic APC; 5×106 cells/well). APC were isolatedfrom spleens of 8-week naïve male C57BL/6 mice justbefore plating. Lysis of erythrocytes in APC preparationswas performed using ACK solution (150 mM NH4Cl,10 mM KHCO3 and 0.1 mM EDTA, pH 7.2) (Mustafaet al. 2008). The mixture of T and APC was cultured inRPMI-1640 containing 2.5 % foetal calf serum andsupplemented with 100 μg/ml streptomycin, 100 U/ml pen-icillin, 2 mM L-glutamine and 50 μM β-mercaptoethanol.CBD or THC at final concentrations of 0.1, 1 or 5 μM ortheir vehicle (0.1 % EtOH in RPMI-1640) were added to thecells just before the addition of MOG35-55. After 24 hincubation (at 37 °C in 5 % CO2 humidified air) the cell-conditioned media was collected, spinned down for 10 minat 2,000 rpm and analyzed for IL-17A (from here on definedas IL-17), IL-6, TNFα and IFNγ concentrations by ELISAusing specific antibodies and the procedures recommendedby the supplier (R&D Systems, Minneapolis, MN, USA).The incubation time of 24 h was chosen based on prelimi-nary time-response experiments which showed that this timepoint yielded the maximal amount of secreted cytokines(data not shown). Doses of antagonists were chosen basedon preliminary studies and the highest dose (out of testedrange) not affecting the MOG35-55-induced IL-17 releaseby itself was chosen for further experiments. The presence ofserum in the culture media did not interfere with the ELISAassays. Similarly, there was no effect of the vehicles of thevarious compounds on the MOG35-55 induced IL-17 levels.

RNA extraction and quantitative PCR (qPCR)

Co-cultures of spleen-derived APC with encephalitogenic Tcells were pretreated with CBD or THC at 5 μM and imme-diately stimulated with MOG35-55 (5 μg/ml). The cells wereharvested after 8 h, spun down for 10 min in 2,000 rpm andthe cell pellet subjected to RNA extraction and for qPCRanalysis as reported earlier (Juknat et al. 2013). The cDNA ofeach specific gene was amplified using a pair of specificprimers given in Table 1. Quantification was performed by“the comparative cycle of threshold method” with β2-

microglobulin (β2MG) gene product for normalization(Juknat et al. 2013). The qPCR runnings were repeated 3times using mRNA preparations from independentexperiments.

FACS analysis

Cell death was analyzed using the PI incorporation assayfollowed by flow cytometry (FACS). PI incorporation wasalso analyzed within the sub-populations of immune cells asdifferentiated by staining the T/APC co-cultures for CD4+(T cells), CD19+ (B cells) and CD11b+ (monocytes). Cellswere incubated with MOG35-55 with or without CBD(5 μM) or THC (5 μM). Twenty four h later the cells werespun down (5 min at 2,000 rpm) and washed twice withFACS buffer (PBS containing 0.5 % of BSA). AfterCD16/32 blocking for 30 min, the cells were washed withFACS buffer and samples were incubated for 1 h with anti-mouse FITC conjugated anti-CD4 (clone H129.19), FITC-anti-CD19 (clone 6D5) or FITC-anti-CD11b (clone M1/70)antibodies (all at 1:100 concentration). The antibodies wereobtained from BioLegend (San Diego, CA, USA). The cellswere then washed 3 times and resuspended in 500 μl ofFACS buffer. Five μl PI from stock solution of 1 mg/ml werethen added to each sample and 15 min later FACS analysiswas run using BD™ LSR II flow cytometer (BD Company,Franklin Lakes, NJ, USA).

Statistical analysis

Data are expressed as the mean ± s.e.m. of 3 independentexperiments and analyzed for statistical significance usingone way analysis of variance (ANOVA), followed byBonferroni or Dunnett’s post-hoc tests. p<0.05 was consid-ered significant. Graph Pad Prism program (La Jolla, CA,USA) was used for statistical analysis of the data. Thestatistical analysis of all ELISA data was performed as per-cent values with MOG35-55-induced secretion of cytokinespresented as 100 % of the effect.

Table 1 Sequences of primers used for qPCR amplification of selected gene products

Gene Accession number Forward Reverse

β2MG NM_009735 AGTTCCACCCGCCTCACATTGAAA TCGGCCATACTGGCATGCTTAACT

IL-17A NM_010552.3 AGCAAGGAATGTGGATTCAGAGGC ACAAACACGAAGCAGTTTGGGACC

IL-6 NM_031168.1 GAGGATACCACTCCCAACAGACC AAGTGCATCATCGTTGTTCATACA

TNFα NM_013693.2 TCTCATGCACCACCATCAAGGACT ACCACTCTCCCTTTGCAGAACTCA

IFNγ NM_008337.3 AGCGGCTGACTGAACTCAGATTGT ACTGCTTTCTTTCAGGGACAGCCT

IL-10 NM_010548.2 CCTTTGCTATGGTGTCCTTTC GGATCTCCCTGGTTTCTCTT

Results

THC and CBD decrease the secretion of IL-17from MOG35-55-stimulated T/APC co-cultures

Addition of MOG35-55 (5 μg/ml) for 24 h to T cells co-cultured with spleen derived APC (T/APC co-culture) in-duced a vast secretion of IL-17A (measured by ELISA, fromhere on defined as IL-17) reaching the level of 99±27 pg/ml(p<0.001; assigned as 100 % activation). A much smalleramount of IL-17 (11±4 pg/ml) was detected in the culturemedia of non-stimulated T/APC. This amounted to 11 % ofthe IL-17 detected following incubation with MOG35-55(Fig. 1a). Neither CBD nor THC affected this small levelof IL-17 secretion from non-stimulated T/APC. On the otherhand, pretreatment with either CBD or THC markedly de-creased the MOG35-55-stimulated IL-17 secretion.Figure 1b shows the dose dependency of the effects of thetwo cannabinoids. CBD at 0.1 μM inhibited IL-17 secretionby 29 % (p<0.05), 1 μM by 56.5 % (p<0.001) and 5 μMCBD almost completely abolished the MOG35-55-effect(by 87 %, p<0.001). THC had a similar dose–response andreduced IL-17 secretion by 7 % at 0.1 μM, 60 % at 1 μM(p<0.001) and by 88 % at 5 μM (p<0.001).

The secretion of IL-17 following MOG35-55 activationwas found to be dependent on the presence, in the sameculture, of both encephalitogenic T cells and APC. Theamount of IL-17 detected in the medium of APC culturedalone was very low reaching only 8 % (8±1 pg/ml) of theamount detected in the medium of MOG35-55-stimulatedT/APC co-culture. Neither MOG35-55 at 5 μg/ml nor com-bination of MOG35-55 with CBD or THC affected this basalIL-17 concentration in conditioned media of APC cells cul-tured alone (14±4, 10±1 and 11±1 pg/ml, respectively).Similarly, relatively low concentrations of IL-17 were de-tected in the medium of encephalitogenic T cells cultured for24 h without APC. The cannabinoids did not affect this basallevel of IL-17 secretion in either the presence or absence ofMOG35-55 (Fig. 1c).

THC and CBD decrease the secretion of IL-6from MOG35-55-stimulated T/APC co-cultures

Co-culturing of APC with MOG35-55-specific encephali-togenic T cells for 24 h resulted in a large increase in IL-6secretion (compared with APC or T cells alone) thatreached 1,116±289 pg/ml. For comparison, the levels ofIL-6 in non-mixed cultures were 65±23 pg/ml in APCconditioned- and 51±14 pg/ml in T cell-conditioned media,respectively (Fig. 2). Stimulation of the MOG35-55-specific encephalitogenic T/APC co-cultures with MOG35-55 resulted in a significant increase of about 2-fold in secretedIL-6 as compared to non-stimulated T/APC cell co-cultures

(Fig. 2a, p<0.01). The MOG35-55-induced IL-6 secretionwas inhibited by 5 μM CBD and by 5 μM THC by 48 %(p<0.01) and 63 % (p<0.01), respectively. Thus, at thesedoses, CBD and THC decreased the MOG35-55-inducedsecretion of IL-6 to the level observed in non-stimulatedT/APC co-cultures. Neither CBD nor THC significantly af-fected the levels of IL-6 secreted in the absence ofMOG35-55stimulation.

THC and CBD do not affect the secretion of TNFα and IFNγfrom MOG35-55-stimulated T/APC co-cultures

Low levels of TNFα were detected in conditioned mediumof spleen derived APC or encephalitogenic T cells culturedseparately for 24 h. The addition of MOG35-55 alone or incombination with CBD or THC did not affect these valueseither in APC cultured alone or in MOG35-55-specific T

Fig. 1 CBD and THC decrease IL-17 secretion from MOG-stimulatedencephalitogenic T cells co-cultured with spleen derived APC. (a)Encephalitogenic T cells were stimulated with MOG35-55 (5 μg/ml)for 24 h in the presence of spleen derived APC with or without CBD orTHC, at the indicated concentrations. Cell free media was subjected toELISA for IL-17, MOG35-55-induced IL-17 secretion is expressed as100 %; ANOVA F(5,12)=52.6, p<0.001; (b) Dose-dependent inhibi-tion by CBD or THC of IL-17 secretion from MOG35-55-stimulated T/APC co-cultures; ANOVA F(3,8)=28.43, p<0.001 and F(3,8)=31.88,p<0.001, respectively. (c) APC or T cells were cultured separately in thepresence or absence ofMOG35-55with or without CBDor THC.ANOVAfor APC F(3,8)=0.35, p>0.05; ANOVA for T cells F(3,8)=0.32, p>0.05;Dunnett’s post hoc test. *p<0.05, **p<0.01, ***p<0.001 vs MOG35-55only stimulated T/APC

cells cultured alone (Fig. 3b). Co-culturing APC with T cellsfor 24 h resulted in a 2–3 fold increase in TNFα levelsreaching 158±110 pg/ml. Neither the addition of CBD orof THC affected TNFα secretion from these co-culturedcells. Upon stimulation of T/APC with MOG35-55, TNFαlevels increased significantly reaching 1,003±176 pg/ml

(p<0.001; expressed as 100% in Fig. 3a). However, contraryto the results obtained for IL-17 and IL-6, CBD and THC didnot significantly affect the MOG35-55-induced TNFα secre-tion. The reduction in the secretion of TNFα amounted toonly 9 % and 13 % by CBD and THC, respectively.

Similar results were obtained for IFNγ. Very low levels ofIFNγ were detected in the medium of spleen derived APC orMOG35-55 encephalitogenic T cells cultured separately for24 h (Fig. 3d). The addition of CBD or THC did not affect thisbasal secretion of IFNγ in APC or in T cells cultured alone inthe presence or in the absence of MOG35-55. Co-culturingAPC with T cells for 24 h resulted in a large increase in IFNγlevels, reaching 2,650±580 pg/ml. The addition of MOG35-55 to the T/APC resulted in a further increase in IFNγ secre-tion reaching 4,800±345 pg/ml (expressed as 100 % inFig. 3c). The addition of CBD or THC did not significantlyaffect the amount of IFNγ secretion in either MOG35-55-stimulated or non-stimulated cells.

CBD and THC modulate cytokine mRNA expressionin MOG35-55-stimulated encephalitogenic T/APCco-cultures

qPCR analysis was performed on mRNA preparations isolatedfrom T/APC co-cultures stimulated with MOG35-55 and treat-ed with either CBD or THC for 8 h. The results reveal highlyupregulated levels of mRNA for IL-17A, IL-6, TNFα, IFNγand IL-4 following MOG35-55 stimulation (Fig. 4). CBD andTHC decreased the expression of IL-17AmRNA transcripts by78 % (p<0.001) and 66 % (p<0.001), respectively (Fig. 4a).

Fig. 2 CBD and THC decrease IL-6 secretion from MOG35-55-stim-ulated T/APC co-cultures. (a) T/APC co-cultures were stimulated withMOG35-55 (5 μg/ml) for 24 h in the presence of APC with or withoutCBD or THC. Cell free media was subjected to ELISA for IL-6concentration. MOG35-55-induced IL-6 secretion is expressed as100 %; ANOVA F(5,12)=7.32, p<0.01; (b) APC or T cells werecultured separately with or without MOG35-55 and with or withoutCBD or THC. ANOVA for APC F(3,8)=3.81, p>0.05; ANOVA for Tcells F(3,8)=3.33, p>0.05; Dunnett’s post hoc test. **p<0.01

Fig. 3 Neither CBD nor THC affect the secretion of MOG35-55-induced TNFα and of IFNγ from T/APC co-cultures. (a), (c) T/APCco-cultures were stimulated with MOG35-55 for 24 h with or withoutCBD or THC. Cell free media was subjected to ELISA for TNFα andIFNγ. MOG35-55-induced TNFα and IFNγ secretion is expressed as100 %. ANOVA for TNFα F(5,12)=11.13, p<0.001 and for IFNγ

F(5,12)=6.95, p<0.01 (b), (d) APC or T cells were cultured separatelywith or without MOG35-55 with or without CBD or THC. ANOVA forTNFα F(3,8)=0.41, p>0.05 for APC and F(3,8)=0.39, p>0.05 for Tcells; ANOVA for IFNγ F(3,8)=0.76, p>0.05 for APC andF(3,8)=0.29, p>0.05 for T cells; Dunnett’s post hoc test. *p<0.05,**p<0.01 vs control non-stimulated T/APC co-cultures

Similarly, the IL-6 transcript was decreased by CBD by 46 %(p<0.001) and by THC by 26% (p<0.01; Fig. 4b). In agreementwith the results obtained by the ELISA, TNFα and IFNγmRNAlevels were not significantly affected by either CBD or THC(Fig. 4c and d). Interestingly, CBD potentiated by 120 % thetranscription of the anti-inflammatory cytokine IL-10. THChad asmaller effect and increased it by 42 % (Fig. 4e). The amount ofIL-10 mRNAwas not affected by the addition of MOG35-55.

Searching for putative cannabinoid targets

Neither the CB1 antagonist SR171416 nor the CB2 antago-nist AM630 reversed the CBD- and the THC-suppression ofMOG35-55-induced IL-17 secretion (Fig. 5a). These resultssuggest that the inhibition of MOG35-55-induced IL-17secretion by either CBD or THC is to the most part aCB1/CB2 independent process.

Fig. 4 Effects of CBD and THCon mRNA expression of IL-17and other cytokines. T/APC co-cultures were stimulated withMOG35-55 (5 μg/ml) for 8 hwith or without CBD or THCand mRNAwas extracted andassayed by qPCR for (a) IL-17A,(b) IL-6, (c) TNFα, (d) IFNγ and(e) IL-10. MOG35-55-inducedmRNA level for all cytokines isexpressed as 100 %. One-wayANOVA followed by Dunnett’spost hoc test; (a) IL-17AF(3,8)=134.1, p<0.001; (b) IL-6 F(3,8)=50.54, p<0.001; (c)TNFα F(3,8)=13.3, p<0.001;(d) IFNγ F(3,8)=7.9, p<0.01;(e) IL-10 F(3,8)=58.69,p<0.001. #p<0.05, ##p<0.01,###p<0.001 vs control non-stimulated cells. **p<0.01,***p<0.001 vs MOG35-55stimulated cells

As mentioned earlier, TRPV1 channels (Hegde et al.2011), PPARγ receptors (O’Sullivan and Kendall 2010)and 5-HT1A receptors (Mishima et al. 2005) were previouslysuggested to mediate the effects of CBD in other experimen-tal systems. However, we found (Fig. 5b) that neitherWAY100635 (a 5-HT1A antagonist), capsazepine (a TRPV1antagonist), or GW9662 (a PPARγ antagonist) interfere withCBD-induced suppression of IL-17 secretion in MOG35-55stimulated encephalitogenic T/APC co-cultures.

Phytocannabinoid induced cytotoxicity

As shown in Table 2 the total cell number in the T, APC andT/APC cultures (in RPMI-1640 containing 5 % foetal calfserum) was not significantly affected by the 24 h exposure tocannabinoid treatment.

Cell cycle arrest or pro-apoptotic effects of cannabinoidswere proposed to contribute to their immunosuppressiveproperties (for review see Rieder et al. 2010), including thechanges in cytokine secretion. Cell death was evaluated incontrol and treated T/APC co-cultures after 24 h incubationby measuring the number of PI stained cells within thepopulations of CD4+ T cells, CD19+ B cells or CD11b+monocytes using FACS method. CBD and THC treatment of

MOG35-55 stimulated T/APC co-cultures resulted in a mi-nor, but significant, increase in the number of PI + cells(by 5.9 % and 6.6 %, respectively). CBD was observed toslightly increase cell death in CD4+ T cells and CD19+ Bcells, THC increased cell death in B cells, while neither ofthe two significantly affected the viability of CD11b+ mono-cytes (Table 3). Thus, we assume that the minor changes incell death following cannabinoid treatment do not signifi-cantly contribute to the observed cannabinoid regulation ofMOG35-55-induced cytokines.

Discussion

The key finding of this report shows that the two majorcannabinoids present in Cannabis, the psychoactive THCand the non-psychoactive CBD, decrease the productionand secretion of IL-17 from activated pathogenic myelinspecific T cells derived from MOG35-55-immunized EAEmice. The signature cytokine of Th17 cells, IL-17, has beenstrongly linked to the pathogenesis of MS and other inflam-matory autoimmune diseases. IL-17 has been reported toexert direct cytotoxic activity (Siffrin et al. 2010) and to beelevated in patients with MS (Matusevicius et al. 1999).Previously we have shown that CBD administered systemi-cally to MOG35-55-immunized mice at the onset of EAEdisease ameliorated the severity of the EAE clinical symp-toms and in parallel diminished axonal damage, microglialactivation and T-cell recruitment into the spinal cord. Inaddition, CBD reduced the MOG35-55 induced T cell pro-liferation in vitro (Kozela et al. 2011). Thus, the presentresults suggest that the cannabinoid-induced decrease inIL-17 secretion may be responsible for these CBD effectsin MOG35-55 immunized mice (Kozela et al. 2011) and forsimilar effects of THC in other EAE studies (Lyman et al.1989; Maresz et al. 2007). To our knowledge this is the firstreport showing suppressive effects of THC and CBD on theautoantigen specific Th17 cell phenotype.

In this study we have used an in vitro model ofautoantigen (MOG35-55) activated encephalitogenic T cellsco-cultured with APC. The observed pattern of cytokinesecretion in response to MOG35-55 closely reflects changesaccompanying inflammation and demyelination in EAEmice and MS patients. This includes MOG35-55-specificsecretion of IL-17 accompanied by increases in co-stimulatory IL-6, TNFα and IFNγ cytokines and no (orminor) changes in the anti-inflammatory cytokine IL-10(Link 1998). Indeed, the induction, maintenance and expan-sion of Th17 cells are strictly dependent on the presence ofvarious innate cytokines secreted by APC. Interleukin-6orchestrates a series of downstream signaling pathways lead-ing to the terminal differentiation of auto-reactive T and B-cells (Wekerle 1999; Barr et al. 2012). Ablation of IL-6

Fig. 5 Inhibition of IL-17 secretion does not seem to involve CB1/CB2,PPARγ, TRPV1 or 5-HT1A receptors. (a) T/APC co-cultures were stimu-lated with 5 μg/mlMOG35-55 for 24 h with or without CBD or THC in thepresence of CB1 antagonist (SR141716) or CB2 antagonist (AM630) added30min prior toMOG35-55 and cannabinoids. Cell freemedia was subjectedto ELISA for IL-17. MOG-induced IL-17 secretion is expressed as 100 %.ANOVA F(9,17)=100.5, p<0.001 (b) T/APC co-cultures were pre-treatedwith antagonists for TRPV1 (capsazepine), PPARγ (GM9662) or 5-HT1A(WAY100635) 30 min before MOG35-55 stimulation in the presence orabsence of CBD. ANOVA F(8,18)=64.53, p<0.001. Bonferroni post hoctest. ***p<0.001, ns non-significant

expression diminishes the propagation of Th17 cells andresults in resistance to EAE (Samoilova et al. 1998). Thus,the cannabinoid-induced decrease in IL-6 production andsecretion observed in the MOG35-55 stimulated T/APC co-cultures may contribute to the EAE ameliorating effectsobserved in vivo following CBD or THC administration(Lyman et al. 1989; Maresz et al. 2007; Kozela et al. 2011).

Another key finding of this study is that CBD, and to alesser extent THC, appear to be potent inducers of the expres-sion of IL-10. IL-10 is one of the main anti-inflammatorycytokines restraining EAE processes (Rott et al. 1994;Tuohy et al. 2000) via reduction of Th17 phenotype (Zhanget al. 2011). Indeed, increased expression of IL-10 accom-panies recovery from EAE/MS following established first linetherapies (group I interferons and glatiramer acetate) and is in

correlation with decreased levels of IL-17 (Stern et al. 2008;Zhang et al. 2011). Along this line, CBD and THC werereported to increase IL-10 secretion in murine T cell-mediated diabetes (Weiss et al. 2006) and in activatedsplenocytes (Newton et al. 1998). The stronger CBDupregulation of IL-10 expression over the effect observedwithTHC is in agreement with our recently published genomeexpression study using LPS-activated microglia showing thatCBD exerts much stronger regulation of gene expression thanTHC (Juknat et al. 2013).

It is important to note that in our model IL-17 is secretedonly in response to MOG35-55-stimulation and is not affect-ed by the mere mixing of encephalitogenic T cells with APC.However, co-culturing of these T cells with APC caused asignificant increase in the levels of IL-6, TNFα and of IFNγ,probably as a result of cell-cell contact activation (Burger2000). The secretion of IL-6, TNFα and IFNγ was furtherpotentiated following MOG35-55 stimulation. Interestingly,CBD and THC reversed only the MOG35-55 induced in-crease of IL-6 while not interfering with the cytokine induc-tion resulting from the co-culturing itself. This observationshows that the cannabinoids selectively affect the autoantigen-induced IL-6 secretion.

CB1/CB2 receptors are major targets for THC. CB1/CB2were also suggested to mediate some of the activities of CBD(Ligresti et al. 2006; de Filippis et al. 2008) despite itsgenerally acknowledged negligible affinity toward both re-ceptors (Showalter et al. 1996). However, in our handsneither CB1 nor CB2 antagonists interfered with THC- orCBD-inhibition of IL-17 secretion from MOG35-55-activated T/APC co-cultures. This is in agreement with ourprevious work and with other reports showing that the anti-inflammatory effects of cannabinoids do not seem to involvethe CB1/CB2 pathways (Puffenbarger et al. 2000; Kaplanet al. 2003; Kozela et al. 2010, 2011; Rimmerman et al.2013). CB1/CB2 antagonists used in our and in a numberof previous studies have been shown to exhibit inverseagonist properties (Pertwee 2005). Thus, to fully confirmthe CB1/CB2 independent effects of studied cannabinoids,

Table 2 Total cell number is not significantly affected by MOG35-55and cannabinoid treatments. T cells, APC or T/APC co-cultures werestimulated with MOG35-55 for 24 h with or without CBD or THC(5 μM). One way ANOVA results are presented in the table

Cell type and treatment Cell number [106/ml]

T cells 0.33±0.04

+ MOG 0.31±0.05

+ MOG+CBD 0.28±0.03

+ MOG+THC 0.24±0.05

ns, p>0.05; F(3,8)=0.71

APC cells 7.5±0.3

+ MOG 7.8±0.6

+ MOG+CBD 7.9±1.0

+ MOG+THC 6.3±0.9

ns, p>0.05; F(3,8)=1.02

T/APC cells 5.7±0.6

+ CBD 7.2±0.5

+ THC 6.6±0.5

+ MOG 6.5±0.9

+ MOG+CBD 6.2±0.7

+ MOG+THC 6.0±1.0

ns, p>0.05; F(5,12)=0.54

Table 3 Effect of CBD and THC on death of immune cell subpopulationsin MOG35-55-stimulated T/APC co-cultures. MOG35-55 (5 μg/ml) andCBD or THC (5 μM)were added together to T/APC co-cultures. Cells wereharvested 24 h later and stained with fluorochrome-linked antibodies for Tcells (CD4+), B cells (CD19+) and monocytes (CD11b+), followed by PI

incorporation and flow cytometry analysis (n=3−4). The number of PI-positive cells in control non-stimulated T/APC co-cultures was subtracted inall cases. ANOVA followed by Dunnett’s post hoc test was as follows: TotalPI+: F(3,11)=16.78, p<0.001; For CD4+ F(3,12)=25.20, p<0.001; ForCD19+ F(3,11)=10.05, p<0.001; For CD11b+F(3,8)=1.42, p<0.05

MOG35-55 CBD + MOG THC + MOGAVG ± SEM [%] AVG ± SEM [%] AVG ± SEM [%]

Total PI+ 0.8±1.1 5.9±0.9** 6.6±0.9**

CD4+ T cells 7.0±1.4# 14.3±1.2** 6.8±1.4

CD11b+ monocytes 2.6±4.5 7.0±3.0 7.5±2.6

CD19+ B cells 2.5±1.3 9.2±1.0* 10.8±2.7**

# p<0.01 vs control, non-stimulated cells, *p<0.05, **p<0.01 vs MOG35-55 stimulated cells

newly available neutral cannabinoid antagonists will be ap-plied in the future.

Several other receptors such as PPARγ, TRPV1 and 5-HT1A were suggested to serve as targets for CBD. PPARγreceptor, regulating cell differentiation, metabolism and im-mune function was shown to mediate the effects of CBD inulcerative colitis inflammation (de Filippis et al. 2011), β-amyloid related neuroinflammation (Esposito et al. 2011) andother models (for review see O’Sullivan and Kendall 2010).CBD was observed to block ion channel receptors TRPV1 insomemodels including Tcell-mediated acute hepatitis (Hegdeet al. 2011). Neuroprotective activities of CBD were shown toinvolve a 5-HT1A receptor (Mishima et al. 2005; Pazos et al.2013). Interestingly, this classical neurotransmitter plays alsoan important role as a regulator of immune signaling (Ahern2011). However, using specific antagonists we could notdemonstrate involvement of PPARγ, TRPV1 and 5-HT1A inCBD inhibition of IL-17 secretion in MOG35-55-stimulatedT/APC. Thus, other receptor targets should be considered e.g.GPR55 or GPR18 (Rimmerman et al. 2013). It is important tonote that due to the highly hydrophobic nature of the cannabi-noids, their activities may include non-receptor modulation ofcell membrane fluidity as well as effects on lipid rafts localiza-tion and composition (Hillard et al. 1985; Rimmerman et al.2011). Indeed, disruption of lipid rafts integrity was shown toaffect T cell receptor signaling and IL-17 secretion (Saeki et al.2009). Moreover, well described CBD modulation ofoxidative/nitrosative stress in inflammatory conditions and/ordecreasing the breakdown of endocannabinoids (this way pro-moting their immunoregulatory properties) may play a role inthe observed effects (see Booz 2011 for detailed review).

In contrast to the non-CB1/CB2-mediated effects of thesecannabinoids, it should be noted that the endocannabinoidanandamide shows immunosuppressive effects in EAE viaactivation of CB1 and CB2 receptors (Benito et al. 2007;Correa et al. 2011). Moreover, CB2 was shown to mediateanandamide-induced decrease in IL-17 production inPMA/Ionomycin-activated naïve human T cells (Cencioniet al. 2010) and in peripheral blood of EAE mice (Correaet al. 2011). These results show that the beneficial effectsof exogenous and endogenous cannabinoids in autoim-mune pathologies may be mediated via different receptorsand/or pathways.

Interestingly, the two phytocannabinoids studied here didnot affect the MOG35-55 induced TNFα and IFNγ mRNAand protein, molecules that are known to serve as key acces-sory cytokines in Th17 maintenance and expansion (Madduret al. 2012). Indeed, previous reports showed a decrease inboth cytokines following either CBD or THC treatments invarious activated immune cells and inflammatory modelsincluding T cell mediated murine diabetes and murine rheu-matic arthritis (Malfait et al. 2000; El-Remessy et al. 2006;Weiss et al. 2006). However, it should be noted that TNFα and

IFNγ seem to have a different role in MS (and EAE) com-pared with other autoimmune diseases. Thus, despite thesuccess of anti-TNFα therapy in T-cell mediated rheumatoidarthritis (Feldmann and Maini 2010), clinical trials with anti-TNF antibody in MS were terminated as a result of diseaseexacerbation (Lenercept Multiple Sclerosis Study Group, andthe University of British Columbia MS/MRI Analysis Group1999). Moreover, TNFα administration was shown to provideprotection from EAE (Liu et al. 1998).

The role of IFNγ is also not clear. A pro-inflammatoryrole of IFNγ in the course of MS (including enhancement ofantigen exposure by APC and disruption of blood–brainbarrier) was reported in animal and human studies (Link1998; Petereit et al. 2000). On the other hand, the functionaldisruption of IFNγ was shown to result in enhanced deteri-oration of EAE mice (Billiau et al. 1988; Ferber et al. 1996)and MS patients (Panitch et al. 1987). Moreover, IFNγapplication ameliorated EAE (Willenborg et al. 1996) andsuppressed Th17 and IL-17 secretion (Harrington et al. 2005;for review see Steinman 2007).

Indeed, it is now widely acknowledged that MS is not asingle disease but includes many clinical phenotypes thatdiffer in dynamics, symptoms, severity and pathophysiology(Lucchinetti et al. 2000). It seems that CD4+ T cell pheno-types are more heterogeneous and flexible than previouslyrecognized and the original concept of T cell triade withabsolute lineage-defining transcription factors (master regu-lators) and single signature cytokines, such as Th1, Th2 andTh17 is being slowly questioned (Sospedra andMartin 2005;Steinman 2007; Oestreich and Weinmann 2012). It appears,that the CD4+ T cells may differentiate into various effectorphenotypes co-expressing various signature and innate cyto-kines and key transcription factors whose combination de-cides on the final functional capabilities of the CD4+ T cellsubsets of pro- and anti-inflammatory functions (Abromson-Leeman et al. 2009). Thus, changing the balance in thesecytokine networks towards suppressive mode rather thandampening individual cytokines appears to be a promisingapproach in the treatment of MS. In light of the abovefindings, CBD and THC seem to exert a desirable profileof cytokine regulation that includes suppression of key pro-autoimmune cytokines (IL-17 and IL-6), and boosting anti-inflammatory factors (IL-10) while not affecting cytokinesof ‘double sword activities’ (e.g. TNFα and IFNγ).

In summary, we report here that the cannabinoids CBD andTHC decrease the synthesis and secretion of IL-17. This sup-pression of Th17 activity is accompanied by additional cytokine-specific modulation of the complex autoimmune milieu, whichultimately pushes the system to an anti-inflammatory mode.

Acknowledgments This work was supported by the Dr Miriam andSheldon G. AdelsonMedical Research Foundation. A.J. is supported bythe Israeli Ministry for Absorption in Science.

Disclosure statement The authors declare that they have no conflictof interest.

References

Abromson-Leeman S, Bronson RT, Dorf ME (2009) EncephalitogenicT cells that stably express both T-bet and ROR gamma t consis-tently produce IFNγ but have a spectrum of IL-17 profiles. JNeuroimmunol 215:10–24

Ahern GP (2011) 5-HT and the immune system. Curr Opin Pharmacol11:29–33

Barr TA, Shen P, Brown S, Lampropoulou V, Roch T, Lawrie S, Fan B,O’Connor RA, Anderton SM, Bar-Or A, Fillatreau S, Gray D(2012) B cell depletion therapy ameliorates autoimmune diseasethrough ablation of IL-6-producing B cells. J Exp Med 209:1001–1010

Benito C, Romero JP, Tolón RM, Clemente D, Docagne F, Hillard CJ,Guaza C, Romero J (2007) Cannabinoid CB1 and CB2 receptorsand fatty acid amide hydrolase are specific markers of plaque cellsubtypes in human multiple sclerosis. J Neurosci 27:2396–2402

Ben-Nun A, Cohen IR (1982) Experimental autoimmune encephalo-myelitis (EAE) mediated by T cell lines: process of selection oflines and characterization of the cells. J Immunol 129:303–308

Billiau A, Heremans H, Vandekerckhove F, Dijkmans R, Sobis H,Meulepas E, Carton H (1988) Enhancement of experimental aller-gic encephalomyelitis in mice by antibodies against IFN-gamma. JImmunol 140:1506–1510

Booz GW (2011) Cannabidiol as an emergent therapeutic strategy forlessening the impact of inflammation on oxidative stress. FreeRadic Biol Med 1054–1061

Burger D (2000) Cell contact-mediated signaling of monocytes bystimulated T cells: a major pathway for cytokine induction. EurCytokine Netw 11:346–353

Cencioni MT, Chiurchiù V, Catanzaro G, Borsellino G, Bernardi G,Battistini L, Maccarrone M (2010) Anandamide suppresses pro-liferation and cytokine release from primary human T-lymphocytes mainly via CB2 receptors. PLoS One 5:e8688

Correa F, Hernangómez-Herrero M, Mestre L, Loría F, Docagne F,Guaza C (2011) The endocannabinoid anandamide downregulatesIL-23 and IL-12 subunits in a viral model of multiple sclerosis:evidence for a cross-talk between IL-12p70/IL-23 axis and IL-10in microglial cells. Brain Behav Immun 25:736–749

De Filippis D, Iuvone T, D’Amico A, Esposito G, Steardo L, HermanAG, Pelckmans PA, de Winter BY, de Man JG (2008) Effect ofcannabidiol on sepsis-induced motility disturbances in mice: in-volvement of CB receptors and fatty acid amide hydrolase.Neurogastroenterol Motil 8:919–927

De Filippis D, Esposito G, Cirillo C, Cipriano M, De Winter BY,Scuderi C, Sarnelli G, Cuomo R, Steardo L, De Man JG, IuvoneT (2011) Cannabidiol reduces intestinal inflammation through thecontrol of neuroimmune axis. PLoS One 6:e28159. doi:10.1371/journal.pone.0028159

El-Remessy AB, Al-Shabrawey M, Khalifa Y, Tsai NT, Caldwell RB,Liou GI (2006) Neuroprotective and blood-retinal barrier-preserving effects of cannabidiol in experimental diabetes. Am JPathol 168:235–244

Esposito G, Scuderi C, Valenza M, Togna GI, Latina V, De Filippis D,Cipriano M, Carratù MR, Iuvone T, Steardo L (2011) Cannabidiolreduces Aβ-induced neuroinflammation and promotes hippocam-pal neurogenesis through PPARγ involvement. PLoS One6:e28668. doi:10.1371/journal.pone.0028668

Feldmann M, Maini RN (2010) Anti-TNF therapy, from rationale to stan-dard of care: what lessons has it taught us? J Immunol 185:791–794

Ferber IA, Brocke S, Taylor-Edwards C, Ridgway W, Dinisco C,Steinman L, Dalton D, Fathman CG (1996) Mice with a disruptedIFN-gamma gene are susceptible to the induction of experimentalautoimmune encephalomyelitis (EAE). J Immunol 156:5–7

Fouser LA, Wright JF, Dunussi-Joannopoulos K, Collins M (2008)Th17 cytokines and their emerging roles in inflammation andautoimmunity. Immunol Rev 226:87–102

Harrington LE, Hatton RD,Mangan PR, Turner H, Murphy TL,WeaverCT (2005) Interleukin 17-producing CD4+ effector Tcells developvia a lineage distinct from the T helper type 1 and 2 lineages. NatImmunol 6:1123–1132

Hegde VL, Nagarkatti PS, Nagarkatti M (2011) Role of myeloid-derived suppressor cells in amelioration of experimental autoim-mune hepatitis following activation of TRPV1 receptors bycannabidiol. PLoS One 6:e18281

Hillard CJ, Harris RA, Bloom AS (1985) Effects of the cannabinoids onphysical properties of brain membranes and phospholipid vesicles:fluorescence studies. J Pharmacol Exp Ther 232:579–588

Izzo AA, Borrelli F, Capasso R, Di Marzo V, Mechoulam R (2009)Non-psychotropic plant cannabinoids: new therapeutic opportuni-ties from an ancient herb. Trends Pharmacol Sci 30:515–527

Juknat A, Pietr M, Kozela E, Rimmerman N, Levy R, Gao F, CoppolaG, Geschwind D, Vogel Z (2013) Microarray and pathway analysisreveal distinct mechanisms underlying cannabinoid-mediatedmodulation of LPS-induced activation of BV-2 microglial cells.PLoS One 8:e61462

Kaplan BL, Rockwell CE, Kaminski NE (2003) Evidence for cannabi-noid receptor-dependent and -independent mechanisms of actionin leukocytes. J Pharmacol Exp Ther 306:1077–1085

Kawakami N, Odoardi F, Ziemssen T, Bradl M, Ritter T, Neuhaus O,Lassmann H, Wekerle H, Flügel AJ (2005) Autoimmune CD4+ Tcell memory: lifelong persistence of encephalitogenic T cell clonesin healthy immune repertoires. Immunology 175:69–81

Kebir H, Kreymborg K, Ifergan I, Dodelet-Devillers A, Cayrol R,Bernard M, Giuliani F, Arbour N, Becher B, Prat A (2007) HumanTH17 lymphocytes promote blood–brain barrier disruption andcentral nervous system inflammation. Nat Med 13:1173–1175

Komiyama Y, Nakae S, Matsuki T, Nambu A, Ishigame H, Kakuta S,Sudo K, Iwakura Y (2006) IL-17 plays an important role in thedevelopment of experimental autoimmune encephalomyelitis. JImmunol 177:566–573

Kozela E, Pietr M, Juknat A, Rimmerman N, Levy R, Vogel Z (2010)Cannabinoids Delta(9)-tetrahydrocannabinol and cannabidiol dif-ferentially inhibit the lipopolysaccharide-activated NFkappaB andinterferon-β/STAT proinflammatory pathways in BV-2 microglialcells. J Biol Chem 285:1616–1626

Kozela E, Lev N, Kaushansky N, Eilam R, Rimmerman N, Levy R,Ben-Nun A, Juknat A, Vogel Z (2011) Cannabidiol inhibits path-ogenic T cells, decreases spinal microglial activation and amelio-rates multiple sclerosis-like disease in C57BL/6 mice. Br JPharmacol 163:1507–1519

Lenercept Multiple Sclerosis Study Group, and the University of BritishColumbia MS/MRI Analysis Group (1999) TNF neutralization inMS: results of a randomized, placebo-controlled multicenter study.Neurology 53:457–465

Ligresti A, Moriello AS, Starowicz K, Matias I, Pisanti S, De PetrocellisL, Laezza C, Portella G, Bifulco M, Di Marzo V (2006) Antitumoractivity of plant cannabinoids with emphasis on the effect ofcannabidiol on human breast carcinoma. J Pharmacol Exp Ther318:1375–1387

Link H (1998) The cytokine storm in multiple sclerosis. Mult Scler4:12–15

Liu J, Marino MW, Wong G, Grail D, Dunn A, Bettadapura J,Slavin AJ, Old L, Bernard CC (1998) TNF is a potent anti-inflammatory cytokine in autoimmune-mediated demyelination.Nat Med 4:78–83

Lucchinetti C, Brück W, Parisi J, Scheithauer B, Rodriguez M,Lassmann H (2000) Heterogeneity of multiple sclerosis lesions:implications for the pathogenesis of demyelination. Ann Neurol47:707–717

Lyman WD, Sonett JR, Brosnan CF, Elkin R, Bornstein MB (1989)Delta 9-tetrahydrocannabinol: a novel treatment for experimentalautoimmune encephalomyelitis. J Neuroimmunol 23:73–81

Mackie K (2005) Distribution of cannabinoid receptors in the centraland peripheral nervous system. Handb Exp Pharmacol 168:299–325

Maddur MS, Miossec P, Kaveri SV, Bayry J (2012) Th17 cells: biology,pathogenesis of autoimmune and inflammatory diseases, and ther-apeutic strategies. Am J Pathol 181:8–18

Malfait AM, Gallily R, Sumariwalla PF, Malik AS, Andreakos E,Mechoulam R, Feldmann M (2000) The nonpsychoactive canna-bis constituent cannabidiol is an oral anti-arthritic therapeutic inmurine collagen-induced arthritis. Proc Natl Acad Sci 97:9561–9566

Maresz K, Pryce G, Ponomarev ED, Marsicano G, Croxford JL, ShriverLP, Ledent C, Cheng X, Carrier EJ, Mann MK, Giovannoni G,Pertwee RG, Yamamura T, Buckley NE, Hillard CJ, Lutz B, BakerD, Dittel BN (2007) Direct suppression of CNS autoimmuneinflammation via the cannabinoid receptor CB1 on neurons andCB2 on autoreactive T cells. Nat Med 13:492–497

Matusevicius D, Kivisäkk P, He B, Kostulas N, Ozenci V, Fredrikson S,Link H (1999) Interleukin-17 mRNA expression in blood and CSFmononuclear cells is augmented in multiple sclerosis. Mult Scler5:101–104

Mishima K, Hayakawa K, Abe K, Ikeda T, Egashira N, Iwasaki K,Fujiwara M (2005) Cannabidiol prevents cerebral infarction via aserotonergic 5-hydroxytryptamine1A receptor-dependent mecha-nism. Stroke 36:1077–1082

Mustafa A, Gillmeister L, Hernandez WP, Larsen CT, Witonsky S,Holladay SD, Kerr RP, Ahmed SA, Santo A, Gogal RM Jr(2008) Viability and function in lymphocytes cultured from thehorse, chicken, and mouse: effects of different leukocyte enrich-ment techniques. J Immunoass Immunochem 29:370–389

Nagarkatti P, Pandey R, Rieder SA, Hegde VL, Nagarkatti M (2009)Cannabinoids as novel anti-inflammatory drugs. Future MedChem 1:1333–1349

Newton C, Klein T, Friedman H (1998) The role of macrophages inTHC-induced alteration of the cytokine network. Adv Exp MedBiol 437:207–214

Oestreich KJ, Weinmann AS (2012) Master regulators or lineage-specifying? Changing views on CD4+ T cell transcription factors.Nat Rev Immunol 12:799–804

O’Sullivan SE, Kendall DA (2010) Cannabinoid activation of peroxi-some proliferator-activated receptors: potential for modulation ofinflammatory disease. Immunobiology 215:611–616

Panitch HS, Hirsch RL, Schindler J, Johnson KP (1987) Treatment ofmultiple sclerosis with gamma interferon: exacerbations associat-ed with activation of the immune system. Neurology 37:1097–1102

Pazos MR, Mohammed N, Lafuente H, Santos M, Martínez-Pinilla E,Moreno E, Valdizan E, Romero J, Pazos A, Franco R, Hillard CJ,Alvarez FJ, Martínez-Orgado J (2013) Mechanisms of cannabidiolneuroprotection in hypoxic-ischemic newborn pigs: role of5HT1A and CB2 receptors. Neuropharmacology 71:282–291

Pertwee RG (2005) Inverse agonism and neutral antagonism at canna-binoid CB1 receptors. Life Sci 76:1307–1324

Petereit HF, Richter N, Pukrop R, Bamborschke S (2000) Interferongamma production in blood lymphocytes correlates with disabilityscore in multiple sclerosis patients. Mult Scler 6:19–23

Puffenbarger RA, Boothe AC, Cabral GA (2000) Cannabinoids inhibitLPS-inducible cytokine mRNA expression in rat microglial cells.Glia 29:58–69

Rieder SA, Chauhan A, Singh U, Nagarkatti M, Nagarkatti P (2010)Cannabinoid-induced apoptosis in immune cells as a pathway toimmunosuppression. Immunobiology 215:598–560

Rimmerman N, Juknat A, Kozela E, Levy R, Bradshaw HB, Vogel Z(2011) The non-psychoactive plant cannabinoid, cannabidiol af-fects cholesterol metabolism-related genes in microglial cells. CellMol Neurobiol 31:921–930

Rimmerman N, Kozela E, Levy R, Vogel Z, Juknat A (2013) Cannabi-noid signaling through non-CB1, -non-CB2 GPCR targets in mi-croglia. In: Abood ME, Sorensen RG, Stella N (eds)Endocannabinoids: actions at non-CB1/CB2 cannabinoid recep-tors. Springer, New York, pp 143–171

Rott O, Fleischer B, Cash E (1994) Interleukin-10 prevents experimentalallergic encephalomyelitis in rats. Eur J Immunol 24:1434–1440

Saeki K, Fukuyama S, Ayada T, Nakaya M, Aki D, Takaesu G, HanadaT, Matsumura Y, Kobayashi T, Nakagawa R, Yoshimura A (2009)A major lipid raft protein raftlin modulates T cell receptor signal-ing and enhances th17-mediated autoimmune responses. JImmunol 182:5929–3597

Samoilova EB, Horton JL, Hilliard B, Liu TS, Chen Y (1998) IL-6-deficient mice are resistant to experimental autoimmune encepha-lomyelitis: roles of IL-6 in the activation and differentiation ofautoreactive T cells. J Immunol 161:6480–6486

Shevach EM (2011) Animal models for autoimmune and inflammatorydiseases. In: Coligan JE, Kruisbeek AM, Margulies DH, ShevachEM, Strober W (eds) Current protocols in immunology. JohnWiley & Sons, New York, pp 15.0.1–15.0.5

Showalter VM, Compton DR, Martin BR, Abood ME (1996) Evalua-tion of binding in a transfected cell line expressing a peripheralcannabinoid receptor (CB2): identification of cannabinoid recep-tor subtype selective ligands. J Pharmacol Exp Ther 278:989–999

Siffrin V, Radbruch H, Glumm R, Niesner R, Paterka M, Herz J,Leuenberger T, Lehmann SM, Luenstedt S, Rinnenthal JL, LaubeG, Luche H, Lehnardt S, Fehling HJ, Griesbeck O, Zipp F (2010)In vivo imaging of partially reversible th17 cell-induced neuronaldysfunction in the course of encephalomyelitis. Immunity 33:424–436

Sospedra M, Martin R (2005) Immunology of multiple sclerosis. AnnuRev Immunol 23:683–747

Steinman L (2007) A brief history of T(H)17, the first major revision inthe T(H)1/T(H)2 hypothesis of T cell-mediated tissue damage. NatMed 13:139–145

Stern JN, Keskin DB, Zhang H, Lv H, Kato Z, Strominger JL (2008)Amino acid copolymer-specific IL-10-secreting regulatory T cellsthat ameliorate autoimmune diseases in mice. Proc Natl Acad SciU S A 105:5172–5176

Tanasescu R, Constantinescu CS (2010) Cannabinoids and the immunesystem: an overview. Immunobiology 215:588–597

Tuohy VK, Yu M, Yin L, Mathisen PM, Johnson JM, Kawczak JA(2000) Modulation of the IL-10/IL-12 cytokine circuit byinterferon-beta inhibits the development of epitope spreading anddisease progression in murine autoimmune encephalomyelitis. JNeuroimmunol 111:55–63

Veldhoen M, Hocking RJ, Atkins CJ, Locksley RM, Stockinger B(2006) TGFbeta in the context of an inflammatory cytokine milieusupports de novo differentiation of IL-17-producing T cells. Im-munity 24:179–189

van Zwam M, Huizinga R, Melief MJ, Wierenga-Wolf AF, van MeursM, Voerman JS, Biber KP, Boddeke HW, Höpken UE, Meisel C,Meisel A, Bechmann I, Hintzen RQ, ’t Hart BA, Amor S, LamanJD, Boven LA (2009) Brain antigens in functionally distinctantigen-presenting cell populations in cervical lymph nodes inMS and EAE. J Mol Med (Berl) 87:273–286

Weiss L, Zeira M, Reich S, Har-Noy M, Mechoulam R, Slavin S,Gallily R (2006) Cannabidiol lowers incidence of diabetes innon-obese diabetic mice. Autoimmunity 39:143–151

Wekerle H (1999) Remembering MOG: autoantibody mediated demy-elination in multiple sclerosis? Nat Med 5:153–154

Willenborg DO, Fordham S, Bernard CC, Cowden WB, RamshawIA (1996) IFN-gamma plays a critical down-regulatory rolein the induction and effector phase of myelin oligodendrocyteglycoprotein-induced autoimmune encephalomyelitis. J Immunol157:3223–3227

YuraM, Takahashi I, SeradaM, Koshio T, Nakagami K, Yuki Y, KiyonoH (2001) Role of MOG-stimulated Th1 type “light up” (GFP+)

CD4+ T cells for the development of experimental autoimmuneencephalomyelitis (EAE). J Autoimmun 17:17–25

Zhang L, Yuan S, Cheng G, Guo B (2011) Type I IFN promotes IL-10production from T cells to suppress Th17 cells and Th17-associatedautoimmune inflammation. PLoS One 6:e28432

Zhou L, Ivanov II, Spolski R, Min R, Shenderov K, Egawa T, Levy DE,Leonard WJ, Littman DR (2007) IL-6 programs T(H)-17 celldifferentiation by promoting sequential engagement of the IL-21and IL-23 pathways. Nat Immunol 8:967–974