bhabha atomic research centre
TRANSCRIPT
-""
Government of India
BHABHA ATOMIC RESEARCH CENTRE
BARC Founder's Day Special Issue
October 2001Issue No. 213
DEDICATED TO THEMEMORY OF
Homj Jehangjr Bhabha(J 909 - 1966)
Founder & Architect ofIndian Atomic Energy Programme
Editorial8tatf
CHIEF EDITORlli Vijai Kum...
MANAGING EDITORT.e. Balan
Computer Graphics & LayoutPAS. WaITi"E.R. P...ka,,"
on the web
Avai"'bk at
URL,http,lIwww.ha=«neUn
BARC NEWSIJETTERFounder's Day SpeciaUssue
Small-AngleNeutronScattering from MicellarSolutions 1V.K.AswalYaungFellowof Indian Academy of Sckncesfor theperiod2000-2005
RadiationChemicalStudies on BiologicallyImportantMoleculesin ModelSystems: Relevance to Biologyand Medicine , 7Soumyakanti Adhik"iInternatioua/ Union of Pure and Applied Chemistry (IUPAC) prizefor Young Chemist<
Geometric Phases, Foundations and QuantumInformationTheory 14ArUll Kum" Pati
i'f.S. Satyamurtby Award for Young Scientist< for the year 2000
Use of Modulation Transfer Function inDetermination of
Focal Spot Dimensions 19P,R. Vaidya
Ron Halmshaw Award for being"" b'flpaper published in thejournal INSIGHT (Nondestructive Teiting and ConditionMonitoring) in theyear 2000
A Novel Naturally Occurring Prodigiosin Analogue withPotential DNA Targetting Property 27Mahesh Subramanian and Ramesh Chander
Best Paper Prize in the International Conference on 'NaturalAntioxidant< and Free Radicals in Human Hcalth and Radiation
Biology' organized by Society for Free Radical Research (India/Asia)and International Society for Free Rad;'al Research (USA)
-_."'-"""" """"""-\"""'\\""'~"'.\\\"""_\\""',.\\\""'"CONTENTS
Fluxesand ResidenceTimeofDifferentToxicandTraceElementsin ThaneCreek 33S.K.JhaoraI.BestPaperAward in the SecondInternational Seminar on 'Analytical Techniquesin Monitoring theEnvironment~ DecemberIS-20, 2000
Encapsulation,CharacterizationandCatalyticPropertiesof UranylIons in MesoporousMolecularSieves 39K. Vidyaetal.Best OralPresentationAward bya researchscholarat 15' National Symposiumon Catalysisand Z'"Indo-PacificCatalysisSymposium,January 23-25, 2001
MolecularDynamicalSimulationsof theHighPressureTransformationsin OlCristobalile-SiD, 46NandiniGasgandSutindecM. SharmaBestPosterAward at the National Conferenceon 'ComputationalMaterials Science(NCCMSJ-2000:July27-29,2000
Biomedical Applications of Cell Electroporation 52S. H. Sanghvi et aI.
BestPosterPresentationAward in the Sectionof Biochemistry,Biopbysicsand MolecularBiology, sf{' Indian Science Congress, New Delhi, January 3-7, 2001
DetectionofListeriaMonocytogenesin Foods:ComparisonofColonyHybridizationTechniquewith ConventionalMethod 56
Anu KamatetaI.
3" BestPosterPaperPresentationAward in the First International Conferenceon'Global Sustainable Biotech Congress 2000 AD. :Nagpur, November 26, 2000-December I, 2000.
Modelingof DuctileFracturebyGursonModel 64M.K. Sasnalet aI.
One of the bestpapers in theposter sessionin 'National ConferenceonComputational Materials Science (NCCMS-2000J~ July 27-29, 2000, organized byMaterialsResearchSoeietyof India, Mumbai Chapter.
PheromonesintheManagementof MajorLepidopterousandColeopterousPestsof Cotton 77A.J.Tamhankatct. aI."Selected Titles" recommenoled by a Consortiumfor International Crop Proteetion
formed by the u.s. Department ofAgrieulture
EmissionfromChargeTransferStateofDye-SensitizedTiO,Nanoparticle.:A NewApproachtoDeterminetheBackElectronTransferRateandVerificationof MarcusInvertedRegime 94HirendraNath Ghosh
Ani! Kumar BoseMemorial Awardfor theyear 2000 by the Indian National ScienceAeatlemy,New Delhi.
AutomationandControl:TechnologySpin-OIls 101Y.S.MayyaDAE TechnicalExcellenceAwardfor theyear 1999
DetenninaUonOf3He"He RaUoUsing DoubleFocusingMass Spectrometer 112KA.jadhav et .1.B"t Paperprize in ff' ISMAS Symposium onMass Spectrometry, Demnber 7-9, 1999, IICT,Hyderabnd
ICP-MS-Improvements in DetectionLimits ; 115V.Nataraju et .1.Second.&st Paperprize in the ff' ISMAS Symposium onMass Spectrometry,Deumber 7-9, 1999, IIer, Hydn-abad.
FabricaUonof HighDensityTho" Tho,..Uo,andTho, - Puo, FuelPelletsforHeavyWaterReactors 120'U. Basaket .1.
B"t PaperAward in theAnnual Conferenceof Indian Nuclear Society(INSAC.2oo0) on"Powerfrom Tborium : Status, Strategiesand Directions'~BARC, Mumbai, June 1-2, 2000.
TRISUL- The Computational Tool for Strategic Planning of Thorium Fuel Cycles 124V. jagannathan et .1.
Best Pos~ Award at the Annual Conference of Indian Nuclear Society (INSAC-2000)
on "Power from Thorium: Status, Strategies and Directions'; BARc, Mumbai, June 1-2, 2000
Effectof DiluentontheTransportofAm(lII)fromNitricAcidMediumAcrossASupportedLiquidMembrane(SLM)UsingDimethylDibutylTetradecylMalonamide(DMDBTDMA)astheCarrier 132S.Sriramand V.K.Manchanda
YoungScientistAwardfor the Be<[Oral Pmentation at the 19' Conferenceof theIndian CouncilofChe<nists(2000)
PositronAnnihilationStudieson RadiationCrosslinkedPoly(N-isopropylacrylamide)Hydrogels""""' """"""""""""""""""""""" 138Anj.1i Pandaet .1.B"t Paperand Pr"entation at Trombay Symposium on 'RAdiationand Photochemistry(TSRP-2000)~ BARc,January 12-17, 2000.
StudiesonVoltammetricDetenninationof Galliumin DiluteHydrochloricAcidatGlassyCarbonElectrode 141jayshreeKamatet .1.B"t OralPr"entatism award in the Workshop-cum-Se<ninaron 'ElectroaualyticalChe<nistryandAliied Topics,EIAC 20oo~ BARc, Nove<nber27 to Dece<nber1,2000
Determination of Uranium
Electroanalytical Metho~sN. Gopinath et aI.Best Poster Presentation 41
andA1JiedTopks, EIAC
CONTENTS
, 143
-al Chesnistry
Thermallonisation Mass $1HighPerformance Liquid CN.M. Rautet al.
Bes. Oral Presentation
Goa, Decesnber 12-16, 2,
147
A Methodologyfor theby Prompt Gamma RayYogesh Scindiaet aI.
154
Small-Angle Neutron Scattering fromMicellar Solutions
V.K. AswalSolid Sta" Phy>ie<Diyi,ionBh,bru. Awmk R"",ch Cen'"
Abstract
Micellar solutions are the suspemion of the co!kJidol aggregate of lhe surfactant molecuks in aqueoussomtions. Thest"",ture (shape and size) and the numher density oftbeseaggregates, referred to as micelks,
depend on the molecular architecture of the surfactant molecule, presence of adoitives, and lhe solutionconditions, such as temperatnre, concentration etc. We have stndled the structures of variety of micellar
somlions of recent interest using the technique of small-angle neutron scattering (SANS) at /WIG. TheseinckJde the micellar solutions of conventional surfactants, mixed surfactants, hwck copolymers, and ueulysynthesized gemini ond mulli-headed surfactants. SANSisan idealtechniquefor thestndyofmicellarsolulionshecause contrast hetween the micelkand the soWent can he easily varied by deaterating either one of them.
Introduction
SCAITERINGPROVIDESAN IDEAL
for investigating the structure and thecs of the materials at microscopic scale
l I]. This field consists of a whole family of techniques
and small-angle neutron scattering (SANS) is oue of
these. Unlike conventiomd diffraction experiments,where the structure of a material is examined at atomic
resolution (- 1 A), SANS is used for studying the
structure of materials with a spatial resolution of -100 A. That is, SANS covers a length scale of particular
interest to a number of applied problems relating to
polymers, ceramics, biological systems etc. SANS has
been successfully nsed to determine the shapes and
sizes of particles dispersed in a homogeneous medium.
The particle could be a macromolecule (e.g. biological
molecule, polymer, micelle etc.) in a soivent, a
precipitate of material A in a matrix of another material
B, a microvoidin certain metal or a magneticinhomogeneity in a non-magnetic matrix [2]. We have
used the technique of SANS at BARC for investigating
the structures of variety of micellar soiutions. This
article gives a brief survey of the results of these
studies. The next section gives an introduction to the
small-angle neutron scattering. Section III gives anintroductionto the micellarsolutionand the SANS
results from the micellar soltttions are given in sectionIV.
Small-Angle Neutron Scattering
SANS is a diffraetinn experiment, which invoives
scattering of a monochromatic beatO of neutrons from
the satOple and me-JSuring the scattered neutron
intensity as a function of the scattering angle (Fig. 1).
"--I ,
nsmaO!o~,R \
~~'Lx-- . \.-- I""on ""-~"" ~-2-9--'-'
So".. IfA"""'
) X"'5X
E'O.OO'<N IJoIm29=f //
Fig} ScbematicdetaitsojSANSexjNri-t
The wave vector transfer Q (= 41tsinO/A., where A. is
the incide1tt neutron wavelength and 20 is the
scattering angle) in these experiments is small,
typicallyiu the range of 10' to 1.0 ,\:'. The wavelengthof neutrons used for these experiments usually being 4- 10 k. Since the smallest Q values occur at small
scattering angles (- n, the technique is called as
small-angle neutron scattering.
In SANS experimentone measures the coherentdifferential scattering cross-section (dLldQ) as a
function of wave vector transfer Q. For a system ofmonodisperse particles, it is given by
d'f; (Q) =n(p, - P,YV'P(Q)S(Q)do.
where n is the number density of the particles, P, and
Po are, respectively, the scattering length densities of
the particle and the solvent, and Vis the volume of
the particle. p(Q) is the intraparticle structure factorand is decided by the shape and size of the particle.
S(Q) is the interparticle structure factor, which
depends on the spatial arrangement of particle,
and is thereby sensitive to interparticle interactions.
In case of dilute solutions, interparticle interference
effectsare negligible, and S(Q) - I.Scattered neutron intensity in the SANS experiment
depends on (p,-p,J' - the square of the difference
125em 200 ~'"
ElnATION
between the average scattering length density of the
particle and the average scattering length density of thesolvent. This tenD is referred to as contrast factor. It is
equivalent to the contrast tenD in optics where it isdecided by the difference in the refractive indices of the
particle and the solvent. Due to the fact that the
scatteringlengthis negative(= - 0.3723x 10" em)forhydrogenand positive (= 0.6674 x 10" em) fordeuterium,SANSis ideallysuited for studyingthestructural aspects of hydrogenous materials, such as
micellar solutious. The contrast between the particle
and the solvent can be easily enhanced deuteratingeither the particle or the solvent.
Figure2 showsa SANSdiffractometerinstalledat theguidehallof Dhmvareactorat BARC. Neutronbeamfrom the guide is monochromatized by the BeD filter
[3]. The average wavelength of the monochromated
beam is 5.2 A. This beam passes iluough two sllts S,
(2 em x 3 em) and So (I em x 1.5 em) before it is
incident on the sample. Distance between S, and S, is 2
m and this gives an angular divergence of:!: 0.5'. Theangular distribution of neutrons scattered by the
sample is recorded using a one-dimensional position
sensitive detector. The sample to detector distance is
1.85 m. The (J range of the diffrdCtometer is 0.018 -
0.30 A' and it is suitable for sizes in the range 10 -1501,.
125(I'll
I
I
I
Fig. 2 A layout ufSANSdiffiacloffWt"alDhrnwreactm'
2
Micellar Solutions
Micellar solutions are the suspension of the colloidal
aggregates of the surfactant molecules in aqueoussolutions [4J. Surfactant molecules [e.g. cetyltrime-
thylammonium bromide (CTAB)] consist of a polar
bydrophilic head group and a long hydrophobic chain
.connected to the head group. The coexistence of the
two opposite types of behavior (hydrophilic and
hydrophobic) in the same molecule leads to the sell-
aggregation of the surfactant molecules in the solution.The aggregates are called as micelles. The typical size
of a spherical micelle is about 50 A and is made up ofabout 100 surfactant molecules. A schematic
representation of a surfactant molecule and a micelle is
shown in Figure 3.
SurfiK:tantMoleaile
I" =-,=" Hydrocaltlon tall_.-
~
~--50 A-
"g.} A SCJJemattc "roctare of a saifadant nwkwk aiuJ a
mi,,/k
The surfactant molecule is referred to as ionic or
noniornc depending on whether its head group ionizes
or notinthe aqueoussolution.Forexample,CTABandsodium dodecyl sulfate (SDS) are iornc surfactants andtriton x-IOO is a nornornc surfactant. SANShas been
used extensively to study the shapes and sizes of
the micelles [5]. The strength of SANSfor studying the
micellar solutions emerges from the fact that it is
possible to vary the contrast between the micelle and
the solvent by simply preparing the solution in D,Q
insteadofH,Q.
The study of micellar solutions is of interest from both
the point of view of basic research and the applications
[6]. The most important property of the micellar
solutions is their ability to solubilize the materials thatare otherwise insoluble in the water. This is relevant
for many industrial and biological processes. Forexample, the detergency involves the removal of oil or
dirt by the formation of micelles. Many colloidal
solutions are stabllhed hy the addition of surfactant
molecules, which are then adsorbed into the particle
surfaces and form a protective layer against
coagulation. Micellar solutions are also used in tertiary
oil recovel)' in the petroleum industry.
Micelles are formed by the delicate balance of
opposing forces: the attractive tall-tall hydrophobic
interaction provides the driving force for the
aggregation of surfactant molecules, while the
electrostatic repulsion between the polar head groupslimits the size that a micelle can attain [7]. As a result,
the characteristics of micelles are easily controlled by
the changes in the architecture of the surfactantmolecule as well as in the solution conditions. The
micelles formed are of varions types, shapes and sizes,
such as spherical, ellipsoidal, cylindrical or thread-like, disk-like etc. We have studied the structural
aspects of variety of micellar solutions nsing SANS.The
emphasis in these studies was to nnderstand the
reasons for the changes in the micellar shapes andsizes under the different solution conditions. In this
connection, the micellar solutions of different types of
surfactants, and the effect of solution conditions, such
as concentration, temperature, and presence of various
additives in these systems have been examined. Thestructures of micelles wheu there are two differeut
types of surfactants in the solution have also beeuexamined. The surfactants, which we have studied, are
the couveutional surfactants [8-11], mixed surfactants
[12,13], block copolymers [14,15], and the newly
synthesized gemirn [16-22] and multi-headedsurfactants [23]. In the following, results of some of
the above studies are given.
Results
Structures of Ionic Micelles in Presence ofEkctrolytes
The ionic micelles (e.g. crAB) are neariy spherical inpure micellar sulutiuns. These micelles become
eiongated and grow in iength on addition of
eiectroiytes, sucb as KBr, sodium salicylate (NaSal) etc.
The effect of different electrolytes is interestingly qnite
different. This provides one of the easiest ways for
practical applications to control the properties of the
micellar solutions by the addition of the electrolytes.
We haveused SANSto address some of the specificquestions in these systems [8-11J. For example, it was
not clear wby crAB or crAG micelles grow with the
addition of small quantities of KBr, but not with KClevenat high concentrations?SANSresultsfrom thesesystems in terms of the structures and interactions of
the micelles sbowed that differences in micellar growthof crAB or crAG in presence uf KCl and KBr areconnected with the different counterion sizes of Cl and
Br ions [8,9J. The smaller the bydrated size of the
counterion, higher will be its tendency to screen the
charge on the micelle, and hence the larger size of the
micelles. The other example, wbere we bave used theSANS is to understand the structures and theinteractions in the viscoelatic crABINaSal micellar
solutions [10,l1J. This system shows a striking double
peak bahaviour of the zero-shear viscosityas a function
of NaSal concentration. It is found that beyond the first
15
~z0108'"'"'" 50'"u
0~OO 0.15
F/g.4 ThecomparnonofSANSdatofrom 0.1 MGTACwitbKB'andKCI
0 -0.00
viscosity maximum micelles behave as living polytners.
In the living polytner regIme, micelles break andcoalesce on a time seale smaller than time scale of
diffnsional motion. The micelles are highiy
polydispersed iu dtis regIme and their lengthdistribution is exponential. These studies further
suggest tbat the variation in viscosity afier the first
viscosity maximum is connected with the chimge in theiutennicelle interactions.
Figure4 shows a typicalSANSdata from a micllarsolution of 0.1 M crAG to compare the effect of the
addition of KBr and KCl [9]. The correlation peak in
the data is an indication of strong repnlsive interaction
between the positively charged crAG micelles.
The peak usually occurs at Q" - bUd, wbere d is theaverage distance between the micelles. The peak shifts
to lower Q with KBr is an iodication of the growth of
the micelles in crAGlKBrsolutions. The broadening of
the peak is due to the screening of the repulsiveinteraction between the micelles in the presence of the
electrolyte. Tbe same is not the case in the crAC/KCl
solutions, wbere the peak broadens without a
siguificant shift in the peak position. This shows thatcrAG micelles do not grow with the addition of KCl.
The quantitative information about the structure and
the interactions of the mieelles is obtained by fittiug theexperimental data in terms of eq. (1) nsing suitable
models for P(Q) and S(Q). The solid lines in the
Figure 4 are tbe fit to the experimental data.
z 0
]15Z8~'0ij!~ 5u
Micellar Structure of Gemini Surfactants
Gemini or dimeric surfactants cousist of two
hydrophobic chains and two hydrophilic head groups
covalemjy connected by a spacer. Gemini surfactants
are called as the surfactants of the next generation
because of the number of exceptional properties that
they manifest. Additionally, the gentini fonnat allowsfor expanded structural diversity in surfactant
chentistry, as head groups, hydrophobic chains,spacers and counterious can be varied in search for
enhanced performance. We have studied in detail the
effect of (a) spacer length, (b) flexibllityvs. rigidity of
the spacer, (c) hydrophobicity vs. hydrophilicity of the
spacer and (d) role of change of the head group from
cationic to aniouic on the nticellar structures of gentini
surfactants [16-22J. Depeuding on the nature ofspacer and head groups, length of hydrophobic chains
and spacer lengths, various types of aggregates, such as
spherical, ellipsoidal, rod-like or disc-like nticelles,
have been observed. As an example, Figure 5 showsthe SANSdatafrom2.5mMnticellarsolutionsof 16-m-16,2Na gentini surfactants for spacer length m = 2, 4,6 and 10 [20]. The measurements were carried out at
100
~'5 mM 16-m-16,2Na
,.,.2~10
~E
i!. ",...~ ,-j,,~o.o,'\"'-0.01 0.1 02
a (1/A)
Fig.5 WlS daia.from micellar soto"ons ofGemioi surfacianis
wlih differeni spacer kmgths
enough low concentration to eusure the nticellar
solutious as dflute, Le. S(Q) - 1. Fig. 2 shows the
cross section (dVdQ) and the slope of the SANS data
at the low Q region (Q < 0.05.1:') decreases as the m
is increased. This suggests that nticellar structures are
widely different in these systems. For m=2 and 4, SANS
distributious are straIght lines in the low Q range of
0.01 to 0.05 .1:'. For m= 2, dVdQ varies as l/Q' and
for m=4, it varies as l/Q. These observations on Q
dependence of the cross section suggest nticelles aredisc-like for m=2 and rod-like for m=4. The small
values ofdVdQ at low Q region for m=6 and 10 is an
indication of smaller nticelies in these systems thanthose for m=2 and 4. It is fonnd that nticelles are
ellipsoidal for m=6 and 10.
Structural Studies of Mixed Micelles
Mixed nticeili2ation of surfactant is of practical interest
as surfactants used in applicatious are often mixtures
of homologous compounds or are contantinated by
impurities.SANSstudieson thesesystemsare usefultofind the compositionof the mixednticelles.Wehavestudied the structural aspects of mixed nticelles with
different types of surfactant molecules [12,13], Thesestudies include the mixed nticelles of
alkyltrimethylmnmonium halides, which differ in the
hydrophobicwi lengthor headgroupsize [J2]. SANSresults show the dependence of the size, aggregation
number and the interaction parameters of the mixed
nticelles on the molecular architecture of the mixtug
surfactants. It is found that the nticellar parameters in
mixed systems have values in between those for the
single snrfactant systems. Mixed nticelles of crAB andgentini surfactants produce an interesting systems
[13J. As mentioned in the earlier sections, whfie crABforms nearly spherical nticelles, gemini surfactants
depending on the spacer length fonn different types of
structures, such as disc-like, rod-like, and spherical,
SANSstudies indicate that the extent of aggregategrowih and the variations of shapes of the mixed
nticelles could be modulated by the type and the
amonnt of gemini surfactant present in these mixture.
It is seen with the short spacer length in the gemini
surfactant, the propensity of nticellar growih is
particularly pronounced.
Acknowledgement
[ thank Dr. P.S. Goyal for his gnidance and support.
I am grateful to Dr. M. Ramanadham and Dr. S.K.Sikka
for their encouragement and the interest in this work. [am also grateful to all the collaborators in this work for
theirhelp.
BARC NEWSLETTER Found,,', Day Spedal]"ue 2001
References
1. K Skold and D.l. Price (Editors), NeutronScattering,Parts A, B, & C, in MethodsinExperirnentai Physics, Academic Press, 1986.
2. Proceeding of the Xlth International Conference
on Srnall-Aogle Scattering, J. Appi. Cryst. 33,421-
866 (2000).
3. V.K Aswal and P.S. Goyal, Corrent Science 79,947 (2000).
4. Y. Chevalier and T. lornh, Rep. Prog. Phys. 53,279 (1990).
5. P.S. Goyal and V.K Aswal, Current Science 80,972 (2001).
6. J.M. Schnur, Science 262, 1669 (1992)
7. J.N. Israelachvli, Intermolecular and Surface
Forces, Academic Press, 1992.8. V.KAswal, P.S.Goyal, S.V.G.Menon and
B.A.Dasannacharya, PhysicaB 213,607 (1995).
9. V.K Aswal and P.S. Goyal, Phys. Rev. E 61, 2947(2000).
10. S.V.G. Menon, P.S. Goyal, B.A. Dasannacharya,
S.K. Paranjpe, R V. Mehta and R V. Upadhyay,
PhysicaB 213, 604 (1995).
II. V.K. Aswal, P.S. Goyal and P. Thiyagarajan, J.
Phys.Chern. B 102, 2469 (1998).
12. V.K. Aswal and P.S. Goyal, Physico B 425, 73(1998).
13. S. De, V.K Aswal, P.S. Goyal and S. Bhattacharya,
J. Phys. Chern. BIOI, 5639 (1997).
14. N. Jajn, V.K. Aswal, P.S. Goyal and P. Bahadur, J.
Phys. Chern. B 102, 8452 (1998).
15. V.K. Aswal, P.S. Goyal and P. Bahadur, Chern.
Phys. Lett. (Submitted).
16. S. De, V.K Aswal, P.S. Goyal and S. Bhattacharya,
J. Phys. Chern. 100, 11664 (1996).
17. V.K.Aswal, S.De, P.S.Goyal, S.Bhattacharya and
RKHeenan, Phys. Rev. E 57, 776 (1998).
18. V.K. Aswal, S. De, P.S. Goyal, S. Bhattacharya and
RK Heenan, J. Chern. Soc., Farday Trans. 94,
2965 (1998).
19. S. De, V.K Aswal, P.S. Goyal and S. Bhattacharya,
J. Phys. Chern. B 102, 6152 (1998).
20. V.K. Aswal, S. De, P.S. Goyal, S. Bhattacharya and
RK. Heenan, Phys. Rev. E 59, 3116 (1999).
21. S. De, V.K. Aswal, P.S. Goyal and S. Bhattacharya,
Chern. Phys. Lett. 303, 295 (1999).
22. V.K Aswal, P.S. Goyal, S. De, S. Bhattacharya, H.
Amenitsch and S. Bernstori!, Chemical Physics
Letter 329, 336 (2000).
23. J. Haldar, V.K. Aswal, P.S. Goyal and S.BhattachnryaAogew.Chern.Int. Ed. 40, 1228(2001)
Found", Day Special hm 2001
Radiation Chemical Studies on BiologicallyImportant Molecules in Model Systems:Relevance to Biology and MedicineSoumyahnti AdhikariIUd~,ion Chemimy & Chemi,," Dyn'mi~ Diyi.ionBhabhaAwmk """,,,h C,w,
SUBJEcrOF RADIATIONCHEMISTRYDEALS
I the chemical changes induced by high-
rgy radiations. The main elIect of radiation on
solutions is to produce excited states and free radicals
depending on the nature of the medium and energy of
radiation. By judicious choice of the medium and the
scavengers one can generate the desired excited state
and free radical. The techniques of pulse radiolysis and
,adiolysis have been employed to generate and study
free radicals. Radiation chemistry in model systetus
including biological model systems (e.g., proteins)
~I"em may tl1fOWlight on three fundamental queries:
1) ""hether these media can provide novel cataljiicenvironment?
2) Can radiation chemistry provide some information
regarding the physical properties of micro drople~
(e.g., sIze of water pool, location of the probes,etc)?
3) Does the medium mimic physlologicai situation?
In the present study, emphasis has been given tounderstand free radical reactions in different
environment with a variety of bio-mnlecules to address
the aforesaid queries. While a good number of systems
were covered in the award-wining thesis" oniy a brief
account of a few systems arc included in this briefarticle.The search started with the redox reaction of
bilirubin (BR), a good heme model, in micelles.
Bilirubin (BR), the tetrapyrrolic bile pigment is the end
product of heme catabolism.
This molecule has been chosen because other than its
property of protecting Bovine Serum Albumin (BSA)
from copper-mediated denaturation', it also exhibits
COO",In,
nF
~~'H
"" NO'
"',c -)!,"oo 0'"li~' Co,
SIn"tuMofbt/;robin [3}
co"',illen,
»--O\
antioxidant activity. Stocker et al. have shown that BRcan act as antioxidant in vivo at a micromolar
concentration and can inhibit lipid peroxidation by
pero'll rAdicals', Pulse radiolysis study of BR using
primary radicals was initiated'" before the report by
Stocker etal.. Later several groups including us havetaken up the issue and extensive studies have been
carried out on the redox reactions of BR in aqueous
homogeneous, micellar media and in presence of the
carrier protein, hovine serum albumin (BSA).
The hydrated electrons react with BRfour times faster'
as compared to that in the pure homogeneous aqueous
solution. It is very interesting that the reaction of CO,
with BR is not detectable in homogeneous aqueous
solution under the pulse radlolysis condition. CO , , a
strong reducing agent with Eo (CO/CO,") = 1.8 V vs NHE
and its inertness towards BR is indicative of a higher
negative potential for the couple BR'lBR' in aqueousmedium. BR, being a highly reduced product, is much
more prone to oxidation than reduction. In crABmicellar media this reaction proceeds at an almost
Sf
f\i:r
OL-4 .J -2
1",,[crABI
-I
Fig! Dependenreof(A} t"'ykldand (B}fmmation mtecoostantoft"'B!?' ,pede, on t"'conrentmtionofCTAB
diffusion controlled rAte' The bimolecular rate
constant being 5.4 x 10' dm'm.'s'. In a plot of !!.
Absorbance (at 520 nm) versus [crAB] (Fig. I) atconstant dose and fixed BR concentration !!.
Absorbance increases as [crAB] increases but at a very
high concentrAtion of crAB, tbe rAte constants as well
as !!. Absorbance decrease probably due to alteration
in the micellar structure at a higber concentration of
crAB. The rate constant for the reaction of bydratedelectrons with BR in crAB micellar medium is more
!ban 10 times faster as compared to that of CO ,
radical. This sbows that these two species bebave
dilIerendy in this medium. Hydrated electrons can
penetrate the bydrocarbon core of tbe micelle and
attack tbe BR molecule dissolved in this region,
wbereas CO;. can not.
Tbe reaction of BR bas been extended in BSAsolution
(the protein is used as the biological
microbeterogeneous medium). It bas been observed
that BSA protects the bound BR molecule' from
oxidativeattackbyfree radicalslikeOH, CCI,OO,N"etc. Tbe competition kinetics plots can manifest the
protection of BR by BSA from free radical induced
damage. The equation by whicb the competitionkinetics is explalned, is as follows
a.D.O k[BSA]
o:n:- = klBRJ + 1
where O.D, and O.D. are the jields of the semi-oxidized
BR species in the absence and preseoce of BSA.k andk' are the bimolecular rate constants for the reaction of
CClpO radical with BSAand BR, respectively.
The open circles (Fig. 2) show the experimental
points, althongh a straight lioe can not be drawn
through these, comparison of these points with thecalculated line (llne a of Fig. 2) is snlIicient to show
that BR is protected to a considerable extent by BSA.Ata molar ratio of 1:1, the apparent kIk' is 2.46, i.e., in
the complex the reactivity of CCipO radical towardsthe BSAis more than double !ban that of BR bound to
the protein. N, radicals react io more or less similar
way to that of CCI,OO radicals with BSA-BRcomplex.The protection nf BR from the attack of this radical is
less than that in case of CCipO radicals (Fig. 2b andd). The calculated ratio of k and k' is 0.28 as
compared with 1.78 in the complex. In the case od
Br,- radical induced oxidation, the observed kIk' is2.55 whereas the calculated ratio of k and k' is 1.38
(Fig .2c). Hence, in this case the protection is less and
the lowest in the series of CCipO. and N, radicalinduced oxidation.
(I)
It has been concluded that biological
microheterogeneous environment can induce even
negative catalytic effect for the destruction of bio-
molecules by dilIerent free radicals, which can
otherwise complicate the situation.
.
'I/(01-4 .J -2 -I
1",,[crABI
,.
~0
~,.0
Ix10" 3xl0"
m.!ohn "BSA
FIg.2 eakuloredand expert_tal competition/;11",""plol
fm' lhe "",lion of BR(5xlO' mol dm') In lhe P"S'"" of
varying.amounts of BSA. The caku/ared plols ..(a) celpo ..
mdled, (h) N, mdlca( and (c) B', ,adieat "","on, The
expertmenlal plots ..(d) N, m<lica( (e) B', 'adlcat "","on,
Open "n;ks,/m' eel, 00 ,adlcal"ac"on,
To address the second point, a water-in-oilmicroemnlsion has heen used"", The microemnlsion
is composed of SDS/water/cyclohexaneil-pentanoL A
detailed discussion on this point has been presented ina recent review article", In a microemuision, there are
two sources of hydrated electrons; one is the
scavenging of excess electrons produced in the
hydrocarbon phase by the water pools and the other is
the direct radiolysis of water. Remarkably high lifetime
(20 ~s) for hydrated electrons has been obtained, In
general, these are two orders of magnitude higher than
those reported earlier in reverse micelies, The decay
kinetics of hydrated electrons has been empioyed todetermine the water pool size and iocation of the
probes, The variation of hydrated electron
concentration with time is given by :
kJ[e~,l, exp[-(ko +k, [QDI]exp[-~ [l-exp(-kq I)]]
,,(2)
where [e;I and [e,'I, are the hydrated electronconcentrations at time t and zero, respectively, ~ is thefirst order decay rate constant of the hydrnted electron
in the absence of solutes, k. is the bimolecular rate
constant for an exchonge process that Involves water
5xl0"
pool collisions, k. is the hydrnted electron decayconstant in the presence of solutes and n is the
average numher of solutes per micelie,
At any given time t, Po' the probability of finding zero
solute per micelie is given by
e ~q ]In pmenee of solul"
P 0 ~ eo, in absence of ,.Iutes
3)
Then following the Poisson distribution,
In Po~~~-[Q]/[WP] (4)
where [QI and [WPI are the concentration of the
solute and water pool, respectively, Hence a plot of In
Po versus [Q] gives a measure of the water poolconcentration which in turn gives the radins of the
water pools, assuming these are of spherical shape, Inour experiment we have measured the water core radil
from the electron decay in the presence and absence of
solute at a particnlar time window, Different solutes
used for this purpose are CuSO4,N,N-dimethylformarnide, CC4 and BSA, Foliowing
the procedure described, water core radil have
been determined for almost aft w, (wo= [waterl I
[surfactant» values using difierent solutes asmentioned,Earlier,an empiricalrelationbetweenwoand r as r = 1.5 w, had been proposed, In ourmeasurementsthe radilof the waterpoolare closeto1.5ww
Further, as the absorbance of the hydrnted electrons is
directly proportional to the concentration of e.,equation [21 reducesto
In('%)=kot+([r~J[I-exp(-1<qt)] (5)
where A" and A are the absorbances of the hydrnted
electrons at time 0 and time t, respectively, k, has beenevaluated after modifying equation 4 and by plotting In
!A;/A) versus [Q], Where A. and A are theabsorbances of hydrated electrons at tlme t in the
absence and presence of quenchers, respectively, As k.
varies as IIw; when solute is located in the water pooland varies as IIw,' when solute is located at theinterface we have determined the location of difierent
BARC NEWSLETTER Foundo's DaySpecio/ I"ue2oo1
solute in the microemulsion by following the decay
kinetics of the hydrated electrons [Fig. 31. It Itis been
shown that not only k, but bimolecular rate constants
calculated from k, for the reaction of the moieculeslike BSA and lysozyme (Lz) increases steailily as w.
increases in a NalSIII,O/cyclohexane/l-pentanol
S)'IeI11". Hence itltis been concluded that radiation
chemistry may be employed to determine the pbjsical
parameters of a microemulsion. In addition some
information regarding the reactivity of bio-moiecules in
a bio-mimicking enviromnent can also be predicted. It
may be mentioned that microcmulsion can also be a
potential catalytic medium for preparation of small
mono-dispersed metal clusters".
5.6
5.1
4.81.1 1.4 1.6
logw,
Fig 3 Yorio/ion of Wg ko witb Wg w,fo, tbe so/ate" (a) "",
(b) N,N-dlmetbytfonnamYk, (e) CoSO" (d) CCI,
Thitd poinl is to evaluate whether the micro-
heterogeneous media can really provide a bin-
mimicking environment. For dos purpose the afore-said mieroemulsion has been chosen as the model. The
exact role of p-carotene in cancer prevention is still
speculative, although it is lmown as an ubiquitous free
radical quencher, whereas retinolltis drawn extensive
attention for its cancer prevention activity. p-<arotene
is a lmown 'provitamin A' due to its conversion into
retinol by the enzyme dioxygenase via its central or
excentric cleavage. This has been demoostrated earlier
by in vivo tests with vitamin A deficient animals.Although the enzyme is present cltiefly in the intestine
and possibly in the liver, accumulation of vitamin A Itis
been surprisingly noticed in many tissues in mice. This
leads to the speculation as to whether it is possible that
vitamin A may also be derived from p-carotene by
some purely chentical protocol This question Itis been
addressed by focusing investigation on the interaction
of p-<arotene with reactive oxygen species in themicroemulsion". The transient absorption spectra
recorded at 50 I's foliowing the reaction of 00,00'
radical with all Imns p-carotene are shown in Fig.4.
<I
-0.10
300 900
Fig. 4 r'unslent ab""",.on spect'a ni"",tkd from an al,-
=(~~J::I,("fJx"/;!:/::::::'~~#mol dm' CCI,oJ 50 '" afi" the -pulse.Inset, lime rosolved aMNption .pectnJ w/tlnn a nmrow
wavelength "8ion ft»' the - obtaJn<d from un ""satal'aJed ml<roema/s/on (w. = 32) _tlon rootalolog I x
la' moldm" pearol..., 5xIO' mo/dm' CCI,at (a) 5; (b) 15;
ood(e)80",aj/",'beelectroofru~e.
Interestingly, in addition to the bleaching spectrum,
three distinct peaks were noticed. The difference in
kinetics for the formation and decay of these peakssuggest that they belong to three independenl species.
The first formed peak al 740 mn was ascribed to an
adduct of 00,00' radical and p-carotene. It is evident
in the inset thaI even at a higher time scale (15 I's),
growth of the transients continued. AIa comparatively
longer time scale (80 flS), when there was no CCl,OO'
radical present in the solution, the peak due to the
radical adduct started decreasing. However, the
growth at 840 mn due to [p-carotenej" continued
suggesting that dos is formed hoth by a direct route asexplained above and also through the intermediateradical adduct.
10
o.lofA
0.08
40 10060 80
tlme,"s
mol dm' eel, (A) fonaatt", (a) 740am; (b) 840am; aad
0.06A
Wavelength, nm
0.16fB (cJ.
500
(a)
1000 1500time,",
2000
(b)
50B
~., 40~~ 30]~ 20
~ 10 f0:
450 500 550Wovelength, nm
600
Fig 6 (A) Steady-state absmptton and (B) JlM",S,,"" sfW,"a ,'"anted afle>' conUnuous pulse i"adiation of an ai.-saluroled
mi"roemulsion (w, = 32) solution containing 5 , 10' mal dm' f3 carotenE. 5 x /0' owl dm' CCI" Cumulative dOSE 4.8 kGy(thiocyanate dosimelry)
The most striking feature of the present study was the
appearance of a new ahsorption band in the UVregionwith the maximom at 345 om. This peak was very
intense, appeared at a comparatively longer time scale
and was stable upto 5 InS, The oscilloscope traces of
the peak are sbown in Fig. 5 (A) c and (8) c, When the
solute was kept for 10 min, the solution started
showing an absorption in the same region as the
transient spectra, thereby indicating the formation of a
stable product.
To characterize the product, radiolysis was carried out
with large numbers of 50 ns pulses and the steady
state.absorption and fluorescence spectra were
recorded. Fig. 6 a show the steady-state absorption
spectra obtained from the microemulsion solution
containing 5 x 10' mol dm' ~-carotene and 0.1 mol
dm' eel, with a total irradiation dose of 4,8 kGy, A
broad. spectrnm beginniog at 280 om and culminatingat 380 nm with the peak around 305 nm was observed.
II
Spectral characteristics indicated strong resemhlance
with those due to retinol. In order to confinn tins, the
product was excited at 340 nm when a strongfluorescence spectrum with a maximum at 525 run
(Fig. 6 b) was ohtained. To optinalzethe maximum
yield of retiool, pulse radiolysis was carried out with
cootinuous pulse irradiation (total dose of 4.8 kGyaccording to tinocyanate dosimetry). A quantitative
assay of tbe product fonnation was also carried out
using standard calibration technique and at best 16-18% of retinol fonnation was noticed under the
optinalzed condition. Microemulsions can he a very
good model for studyiog hio-reactions for extrapolatiog
the results ioto physiology in some cases. Our study
confirmed the possibility of fonnation of retinol from
~-C via a noo-enzymatic oxidative pathway exhibiting
its role as an antioxidant. This nalght also explain the
presence of retinol in organs other than the intestine
and liver as found earlier with nalce.Hence, it can beconclnded that in some cases the nalcroemulsion can
really nalnalcthe physiological situation.
Future directiou
Living systems are extremely complex and the final
biological effects of radiation are results of complexprocesses occurring during and after irradiation. In
order to get a clear understanding of actual proce&'fs
occurring inside the living tissue it is necessary to have
specific models which can provide us with irdonnation
regarding specific pathways. In recent times,nalcroemulsions are being widely used for biochenalcal
studies. Still there is ample scope for future
researchers to study oxidatioo reactioos in
nalcroemulsions, though several studies are in
progress"'" in other model systems such as liposome,
nalcrosome, etc.
However, there is ooe area of radiatioo chenaleal
research that can be of immediate help in medicinal
chemistry. The importance of tins area has still not
been adequately understood. This field is the study of
pulse radiolysis of drugs and antioxidants in aqueoussolution. Many drug molecules undergo redox
reactions in biological systems. These can be
duplicated in pulse radiolysis studies. As a first stage,
the transieot species produced from the drug molecule
can be made to react with other biological molecules
in solution. This will give a very good idea of some
aspects of the physiology of these molecules. The next
step would be the study of the reaction of these
transients with living systems such as viruses and cells.
Instead of giving a numher of examples, we will give
two singie examples studied hy the authors. Thisshould adeqnately illustrate the importance of radiation
chemistry. The molecule, 3'-azido-J-deoxythynaldine
(AZf) is a derivative of thynalne and is the most widely
used drug in AIDS therapy. Unfortunately, the positiveanti -HN effectof the drug is oftenaccompaniedbyseveral side effects. However, to understand the side
effects, it is necessary to study the reactions of theoriginal molecule. It has been shown" that AZf upon
reacting with primary free radicals produces transient
species which can destroy many important biological
molecules like bilirubin, rivoflavin, etc., that may havesome relevance with the side effects associated with the
use of tins molecule io AIDStherapy.
The next example is the widely used medicine, folate,
which helps in preventing cardiovascular disease and
neural tuhe defects. Studies revealed, though
speculative but perhaps one of the most provocative,
new medical application of folate as a potential agent
for cancer prevention. Employing pulse radiolytic
kinetic measurements and blochenalcal assays inaqneous and liposomal media it has beeo shown that
folate has a good antioxidant property"" that may be
responsIble for the anti cancer activity at least to someextent.
Acknowlegements
The author acknowledgesDr. Tulsi Mukbe*e(Research Guide for the award thesis), Dr. Jai P. Mitud
for excellent support and all colleagues andcoflahorators who have contrihuted to the research
work in one way or the other.
References
1. S. Adhikari, Ph.D. thesis (Guide, Tulsi Mukbetjee),
Mnmhai Uuiversity, 20002. S. Adhikari, R. Joshi and C. Gopinathan,
BiochemicaetBiophysicaActa 1380,109,1998
3. R. Stocker, Y. Yamamoto, A. F. Me Douagh, A.NGlazer, B.N. Ames. Science. 235, 1043,1987
12
BARC NEWSLETTER Founder's Doy Special Issue 2001
4. D. J. W. Barber, J. T. Richards. Radia/. Res. 72,
60, 1977
5. E. J. Land, R. W. Sloper, T. G. Truscott. Radiat.
Res. 96,450,1983
6. S. Adhikari, S. N. Guha, T. P. Balan, C. Gopioathan.
Radia/. Phys. Chern. 43, 503, 1994
7. S. Adhik:ui, S. N. Guha, and C. Gapioathan. In/. f.
Chern. [(jnet. 26,903,1994
8. S. Adhikari, C. Gopinathan.lnl.f. Radia/. Bioi. 69,89, 1996
9. S. Adhik:ui, R. Joshi, C. Gopinathan. f. con. and
Int. Sci. 191, 268, 1997
10. S. Adhikari, R. Joshi, C. Gopinathan. Inl. f. Chern.
kinel. 30,699, 1998
11. S. Adhikari, R. Joshi, T. Mukhe~ee. f.lad. Chern.
Soc. 78, 75, 2001
12. R. Joshi, S. Adhik:ui, C. Gopioathan. Res. Chern.
In125, 393, 1999
13. S. Kapoor, S. Adhikari, C. Gopinathan, J. P. Mittal.
Mat. Res. Bull. 34, 1333, 1999
14. S. Adhikari, S. Kapoor, S. Chattopadhyay, T.
Mukhe~ee. Biophysical Chern. 88, 110,2000
15. H. Sprinz, S. Adhik:ui, O. Brede. Mv. con. In/.
Sei. 89, 313, 2001
16- S. Adhik:ui, H. $prinz, O. Brede. Res. Chern. In/.
2001, (in print)
17. R. Joshi, S. Adhikari, T. Mukhe~ee. Res. Chern.
Int. 2001, (in print)
18. R. Joshi, S. Adhikari, B. S. Palro, S. Chattopadhyay,
T. Mukhe~ee. Free Radical Biology & Medicine,
30, 1390,2001
19. B. S. Patro, S. Adhikari, R. Joshi, T. Mu~ee, S.
Chattopadhyay (communicated)
'§/;;" IJaka::iiAdhlkarl Is Ihe rec/pi;;;i'~j the p~;silglous internaU~nal- Union of Pure andAI>. (IUPAC)prize for Young Chemists. This prize has heen given to jive chemists "In a worldwide contest and he Is the only Indian to receive the aword for the year 2001. Theaward Is based on his thesis entitled "Radiation chemical studies on biological and other "Important molecules In micelles, mkroemuls/ons and aqueaus solut/ous", guided by Dr. TuIsIMukherjee, Head, llJuIlat/on Chemistry & Chemical Dynamtes DIvision, B.4RC.The award wasconferyd on DrAdhtkarl onjuly 1, 2001, at Brisbane, Australia.
Dr. Soumyakanti Adhikari. after completion of his formal education from the Visva BharatiUniversity, Shan/iniketan, West-Bengal,joined BARCTraining School in 1990 (31' batch). In 1991,he joined the then Chemistry Division. Since then he bas been involved in studying radiationchemistry of biokJgU:o/lyimportant molecules in micro heterogeneous media. He bas publishedseveral papers in mpoted Interoational journols. His recent interesl is on mechanislU: aspects ofanti<>xidantac/ivity of naJurallyoccurring compounds.
13
BARC NEWSLETTER Found,,'s DaySpeciol/ssue200/
Geometric Phases, Foundations and
Quantum Information TheoryArun Kumar Pari
nw"rial Ph}"i", Di""ionBhahhaA,.mic "'=u-ch Cc.."
Abstract
Twentieth century physics has witnessed many conceptual breakthroughs and discoveries, most of which
started right at the beginning of the centary. Starting with the devekJpment of special and general theory of
relaJivity and qaantum mechaulcs, there have been numerous developments in last century. Neverthekss,
talking about quantum mechanics which ruks entire micro-physical world, nrost of its foundaJions were laid
in the early part of last milknium. Though quantum theory is <me of the finest theory, itsfoundaJionaJ aspects
are not yet weD undersWod. In spite of several diffu:u/Jies, quantum theory has predk:[ed many new effects tbaJ
have been verified from time to time over many years. The auJhor's area of research can he hroad/y c/assifkd
into three topk:s of fundamento/ importance. One is theory of Geometrk: Phases, second is FoundaJionaJ issues
of quantum theory and third is Quantum Computation and Information theory.
Geometric Phases in Quantum Theory
THE BEAUlY OF A PHYSICAL OONCEPT IJES IN ITS
simplicity with which it enters a theory and
elegancy with which it encompasses variety of
fields. A new major discovery reafiy took place in 1984,
when Sir M. V.Berry found a geometric phase or the so
called "BerryPhase" in adiabatic qnantum systems. We
know that all the information abont a physical system is
cootained in the wave function. It is simply an extra
phase acquired by the wave function when the
parameters of the Hanilltonian are slowly changed
along a closed path. It is geometric because it is local
gange invariant, does not depend on the energy
eigenvalue but depends only on the geometry of the
path traversed in the parameter space. It is non-
integrable in natnre, thereby attributing a memory to aquantum system. This is one of the profonnd
discoveries in quanttnn theory in recent times- This
paved the way for nnderstanding several pbenomena
ranging &om quanttnn Hall effect, &actional statistics,
lDagIlus forces in snperl1nidity to solar neutrinos inastrophysics.
My aim was to nnderstand and interpret the non-
adiabatic geometric phase using simplified geometric
concepts like "length" and "distance" inherent to the
Hilbert space and projective Hilbert space of a
quantnm system- Geometrically, the stIle is a point inthe projective Hilbert space and the evolution is a
cnrve. Our formalism nniquely brings out the manner
in which the geometric phase depends on the geometry
of the path. I was the first to explicitly show that the
geometric phase reafiy depends on the geometry of the
path by relaring it to the manifestly geometric conceptslike the "length" of the curve and the "distance"
function in the projective Hilbert space of the quantum
system. This study provides a new nnderstanding,
interpretation and calculatinnal tool for the noo
diabatic geometric phase [1,4,5].
Subsequently, I have generalized geometric phase fornon-cyclic, non-nnitary and non-SchrOdinger
evolutions of quantum systems. A gange potential
description of genera1ized geometric phase was
lacking. 1 have defined a gange potential whose tineintegral yields the exact geometric phase for arbitray
14
non-cyclic evolutions [9,12]. Further, I asked if the
generalized geometric phase can be defined from the
idea of paths. I introduced a new concept called
"reference-distance" frmction and proved that the
generalised geometric phase arises dne to a hasicdifference between "reference-distance" and the usual
"distance" function [10].
We have applied the non-adiabatic geometric phase
theory in dispersive fibers and argued that it can reveal
the statistics of the input light, contray to the general
belief that first order interference does not yield the
statistics of the input light [8). In Josephson junction
system we have proved that the supercurrent is
proportional to the "distance" function for a DC
junction. We have given geometric meaning to the
Cooper-patr density and relative phases and viewed
Josephson effectgeometrically [16].
A long standing problem in many-body system is to
understand the damping of collective excitations.
Recently, a many-body Fermi system bas been treated
in terms of a single-particle in an effective mean-field
undergoing adiabatic deformation. By expressing the
cyclic and non-cyclic geometric pbase as tlme-
correlation functions, we bave related the geometric
phases to the imaginary part of the susceptibility. Since
later quantity is related to dissipation, this work
provides a quanta! origin of the damping in collective
excitations for the first time [17]. Furfher, we bave
shown that geometric pbase is related to quantummetric tensor and derived a fluctuation-correlation
theorem [21].
We bave developed the theory of open-path Berry
pbase and provided a new gauge potential wbose line
integcal gives the Berry pbase. We studied its semi-classical limit and established the connection between
Hannay angle and Berry phase using adiabatic-
coherent state formalism. By expressing the Berry
phase as a commutator between projection operatorand its differential we have studied its classical limit
using Wigner formalism. Our theory provides for the
first time an operational definition of Hannay angle for
open path [20].
All the previous work on geometric phases has beeo
focused 00 quantum systems described by pure states.
if a systemis in a pure state then one can associate a
wave function to it. Recently, we have generalized the
concept of geometric phase for mixed states. if a
quantum system has not been prepared in a definite
pure state but weighted sum of various pure states with
appropriate probabilities (due to our ignorance), then
it is described by a mixed state. Mixed states can arise
in variety of situations. if we have a composite system
in an entangled state and have access to only one
subsystem, then the subsystem is described by a mixed
state. Using our definition of pbase we define parallel
transport condition for mixed state and introduce a
notion of geometric phase. Furfher, in the special cases
our definition reduces to the pure state definition of
geometric phase [28].
Foundations of Qnantum Theory
Natural laws look comprehensible if formolated in a
simplest way with the help of fundamental constants. In
special theory of relativity we have the fundamental
constant c. The existence of c and principle of causality
say that the maximum value of velocity for any material
particle is limited by the speed of light. In quantum
world also all the particles obey this universal speedlimit. However, there was no known limit on the
acceleration of a particle either in special relativity or
in quantum theory. I have shown that by combining
nncertatnty principle and principle of special relativity,there exists a limit on the acceleration of a particle [2].
This fundamental limit provides understanding to
several phenomena in quantum world. For example, it
explatns for the first time Bohr's postulate that why
electrons in energy eigenstate do not radiate [3].
It was known that photon cannot be localized precisely.
if one could find a localized state of photon, then there
will be a violation of the special theory of relativity.
Neverfheless, one can localize a photoo only optimally.
For an optimally Iocalised photon the position operator
has non-commuting components. I gave a new
interpretation to position operator and predicted non-
abelian Aharonov-Bohm effect for optimally localised
photons, which can provide a direct test for the
existence of photon position operator and the extent of
localisability [14].
In the context of quantum Zeno effect, I have shown
that cootinuous observation in Yon Neumann type
15
BARC NEWSLETTERFo.nh, DaySpecioJ Issue 2001
measurement is nol possible. There is a limit on Ibe
frequency of measuremenl coming from Ibe geometryof the quantum state space [13]. Furlber, I have
predicted a uew effect called quantum Zeno phase
effect. It says that in Ibe limit 01 bigb freqoency 01measuremenl of some observable of Ibe system, Ibe
development of geometric phase is inhibited. Thus,repeated observation erases Ibe memory of a qnantum
system and could have implicatiou in preserving Ibe
phase coherence of a quantum system undergoingmeasurement process. The qnantum Zeno Phase effect
has been proved using Von Nemnann's projectionpostubte as well as a continuous measuremenl model[15J.
There is a remarkable difference between a classical
and a quantum system. For classical system Ibe value ofa physical quantity ex;sts prior to measuremenl--which
is an element 01 reality independenl 01 any lbing else.
However, in qnantum world an element of reality isbroughl to -ce only after measurement Prior to a
measurement only potential values of an observable
esist. Einstein, Podolsky and Rosen argued lllat realityand locality leads to Ibe conclusion Ibat quantum
Ibeory is incomplete. It was John Bell who poinled oulthat one can put certain constraints on correlation if
IDeality and reality criteria hold It was found that
qnantum Ibeory violates Ibese constraints (now called
Bell ineqna1lties). I have proposed an experimenl on
how to test Bell's inequality for four spin-half particlesusing Aharouov-Casher (AC) effect. ACeffect refers to a
phenomenon where a particle carrying magnetic
moment is inIIuenced by a line charge situated at a
distlnt point Though, locally Ibe particle experiencesno lorce, Ibe wave function acquires a phase shift. The
phase shift can be seen in Ibe spin correlationmeasurements of two pairs of entangled particles. This
correlation violates Bell's inequality [18].
Quantum Information and Computation
Recenlly, Ibere has been anolber revolution in
information processing capability that arises due to Ibe
laws of quantum mechanics. Last couple-of-years have
witnessed exciting discoveries in quantnm computation
and information Ibeory where linear superposition and
qnantnm entanglement play key role in information
processing. Linearity 01 qnantum evolution glves extra
power to qnantum computer and at Ibe same time putslintitations on some basic operations. It turns out Ibat if
Ibe classical communication channel is supplemented
wilb qnantum clnnmel, Iben Ibere are certain thingspossible, which cannot be done only wilb classicalclnnmel.
I have been working in Ibis area for last Ibree years. As
Ibe rule suggests, I will present Ibose papers Ibat have
been published during my presence in India. (In mypresentation for NSS memorial award of IPA 2000, Ihave skipped alllbe papers that have been publishedbetween August 1998 to August 2000 as I was abroadduring that time.)
In qnantum information Ibeory entangled state playa
privileged role. If we have a composite quantnm system
in a pure state consisting of many subsystems, Iben a
generic pure stale is in an entangled state. Entangled
state is a one that cannol be written as product 01
individual states for Ibe subsystems. For bipartitesystems in general Ibere always exist Schmidt
decomposition for all waveftmctions such Ibat Ibe
reduced density matrices have equal spectrum. This
helps us to manipulate quantum states and 10 quantify
entanglement of such systems. For Uipartite systemsIbis do not hold I have provided a necessary andsufficient condition for Ibe exjstence 01 Schmidt
decomposition for Uipartite systems. This shows that
one can use von Nenmann entropy of Ibe partial densitymatrix as a measure of entanglement for such Uipartitesystems [30].
Anolber remarkable use of qnantum entanglement ispreparing a desired state of yonr choice at a remote
place. Suppose, Alice' laboratory is in Mnrnbai and
Bob's is in NewYork. Alice wants to prepare an atom
in some definite state in Bob's laboratory. Instead ofsending whole preparation procedure, Alice can
prepare an atom of her choice in Bob's place bysending just one clnssical bit to Bob. I have put forwardIbe idea 01 remote state preparations and remote state
measurement lor qnantum bits (qubits) [3IJ. A qubit
is a two-state quantnm system, such as an atom, or a
linear superposition of horizontal and vertical photon,
or could be linear superposition 01 neutron spin-upand down state. It was shown that wilb Ibe use
ofaSPin-singIetstate and one classical bit Alice can
t6
remotely prepare certilln class of qubits. With the sameresource Alice can ask Bob to simulate any single
particle measurement outcome at a remote place. Thiswill be useful in many practical aplications.
Another mysterious feature of quantum world is the
interference of a single quantum particle if it Lspassed
through a Young's duuhle slit set-up. The quantum
interference phenomena demonstrate that the particles
in quantum world are not ouly panticles but alsobehave like waves. This is the famous wave-particle
druilityin quantum theory. A:;Feynman has pointed out
"this is the only mystery"'. In general if a quantum
particle finds alternate possibilities then the total
possibility is calculated by sununing the amplitudes
corresponding to each alternatives and taking itsmodulus. This reproduces the correct quantum
interference but 00 body knows why it is so. The
question we have asked, is it possible to observeinterference between two independent, and incoherent
particles after they have passed through two
independent double slits or two independent Mech-Zender interferometer set-ups? We found a way to do
that! We proposed a new interferometer set-up to swap
the coherence from one set of interfering paths to
other two paths that have no common origin, and yet
they behave as if they have come through a single
double-slit set-up. This phenomenon is called
coherence s'Wapping.This will open up the study ofwave-particle dualityfrom a new angle.
Our present research is an ongoing exploration of
mysteries and surprises in quantum world.
References
1. Relation between "Phases" and "Distances" in
Quantum Evolntions, A. K. Pati, Phys. Lett. A. 159(1991)105:On the Maximal Acceleration and Maximal Energy
Loss, A. K. Pati, ILNuvo Cimento B 107 (1992)
895.
A Note on Maximal Acceleration, A. K. Pati, Euro
Phys. Lett. 18 (1992) 285.
Geometric Phase, Geometric Distance and Length
of the curve in Quantum Evolution, A. K. Pati, J.
Phys. A: Math & Gen. 25 (1992) L 1001.
2.
3.
4.
5. Interpretation of Geometric Phase via Geometric
Distance and Length during eyclic evolution, A. K.
Pati and A.Joshi, Phys. Rev. A,47 (1993) 98.
6. A Geometric Meaning to the Probabilities of aTwo-State Quantum systems, A. K. Pati and A.
Joshi, Euro Phys. Lett. 21 (1993) 723.
7. On Phases and Length of the Curves in a Cyclic
Quantum Evolution, A. K. Pati, Pramana J. of
Phys.42 (1994) 455.8. Geometric Phases with Photon statistics and
Squeezed Light for dispersive fibers, A.Joshi, A.
K. Pati and A. Banedee, Phys. Rev. A. (1994)5131.
9. Gauge-Invariant Reference Section and GeometricPhase, A. K. Pati, J. of Phys. A: Math & Geu. 28(1995) 2087.
10. New Derivation of the Geometric phase, A. K.
Pati, Phys. Lett.A 202 (1995) 40.11. Geometric Phase for a Finite Diniensional Hilbert
Space Harmonic Oscillator, A. K. Pati and S. V.Lawande, Phys. Rev.A 51 (1995) 5012.
12. Geometric aspects of Non-Cyclic Quantum
Evolutions, A. K. Pati, Phys. Rev. A 52 (1995)2576.
13. Lintit on the Frequeney of Measurements in the
Quantum Zeno Effect, A. K. Pati, Phys. Lett. A.215 (1996)
14. Photon localisation, the Pryce Operator and the
Aharouov-Bohm Effect, A. K. Pati, Phys. Let!. A.
218 (1996) 5.
15. Effect of measurement on the Geometric phase
during Evolution of a Quantum system, A.K.Pati
and S. V. Lawande, Phys. Lett. A 223 (1996) 233.
16. Geometry of the Josephson Effect, J. S. Anandanand A. K.Pati Phys. Lett.A 231 (1997) 29.
17. Adiahatic geometric phases and Responsefunctions, S. R Jain and A. K.Pati, Phys. Rev. Lett.
80 (1998) 650.
18. Testing Bell's ineqnallty nsing Aharonov-Casher
effect, A. K.Pati, Phys. Rev.A 58 (1998) RI.
19. Geometry of the Hilbert space and the Qnantum
Zeno effect, A. K. Pati and S. V. Lawande, Phys.
Rev. A 58 (1998) 831.
20. Adiahatic Berry Phase and Hannay angle for Openpaths, A. K. Pati, Annals of Phys. 270 (1998)178.
17
21. Fluctuation, time-correlation function and
geometric phase, A. K. Pati, Phys. Rev. A 60(1999) 121.
22. The issue of phase in quantum measurement
theory, A. K. Pati, Acta Phys. Siovaca 49 (1999)567.
23. Quantum superposition of multiple cloues and
the novel cloning machine, A. K. Pati, Phys. Rev.Let!.83 (1999) 2849.
24. Uncertainty relation of Anandan-Aharonov and
Intelligent states, A. K. Pati, Phys. Let!. A 262(1999) 296.
25. "Assisted clonig" and "orthogonal-
complementing" of an unknown state, A. K. Pati,
Phys. Rev. A 61 (2000) 022308.
26. Impossibility of deleting an unknown quantum
state, A. K. Pati and S. L. Braunstein, Nature 404
(2000)164.
27. Probabilistic exact cloning and probabilistic no-
signalling, A. K. Pati, Phys. Letl. A 270 (2000)103.
28. Geometric phases for mixed states in
interferometry, E. Sjoqvist, A. K. Pati, A. Elrert, J.
S. Anandan, M. Ericsson, D. K. L. ai, and V.
Vedral, Phys. Rev. Let!. 85 (2000) 2845.
29. Quantum no-deletion priuciple, A. K. Pati and S.
L. Braunstein, Curro Sci. 79 (2000) 1161.
30. Existence of Schmidt decomposition for tripartite
system, A. K. Pati, Phys. Letl. A 278 (2000) 118.
31. Minimum cbits for remote preparation and
measurement of a qubit, A. K. Pati, Phys. Rev. A
63 (2001) 014302. Interference due tocoherence swapping, A. K.Pati and M. Zuknwski,
J. Phys.-pramana 56 (2001) 393.
IffAronKutna' PaNof Tbeo.-eticalPhysicsDivision,BARC,was evnfemJdthe litleofHoMnJryResea"hF,llow hytheSenale Of the Unilwsity of Wales in thes<hool of Info .-mati on, Bang"', UK H, hasatso - s,leel,d asanMsocial,
ofCen"" fa, Phito~ophy and FoundoUons ofSeien" (CPPS), New Delhi. Iff PaN has - w",kingin thefronti<N'aroasof physics such as Gwnwlrie Phases, !,}uantum Mechanics &!,}uanlum Computation and Info.-matton Theory. H, was a
nwmb<Noflsaac Newton Imlitule ofMathemaUealSelen", Cambridge, UKandanwmbm-ofUK!,}uanlum CompuUngNelw",k. He has ",eiced 'Young Physicist" aw",d in the ye'" 1996 from Indian Physical Society (IPS), KolkataJ", his
original evntribuUon 10 the theory ofGenwetrle phases. H' hasa.o bwn elected as an Msociale of Indian Academy ofS<i- (/AS),BangalnroJ", the yea' 1998-2001.
\8
Use of Modulation Transfer Function
in Determination of Focal SpotDimensionsP.R. VaidyaAvorn', Fil,h O'"','cnBh,bh, Awrn', R"""h Con'"
Abstract
The modulation transferfunction (MTP)has been used in the imagingfield to evaluatefidetity of imaging system<in reproducing different spatial frequencies. It has been usedfor similar purpose in radiographic imaging also.As the focal spot size has an infiuence on the resolution of a system it should be expacted to hiflueuce MTFtoo.Sucb qualitative linkage between focal spot size and MTFhas been known. Thispaper demonstrates definitiverelationship between the two which wads to a simpw technique to obtain focal spat dimension from tbe spatial
frequency at which MTFbecomes zero or undergoes a minimum. This approach is applied to conventional andmicrofocns X-ray units. MTPcurves are drawn by three different methads viz. tbe hasic method, the PFTof linespreadfunction (LSP)andfrom the derivative oftbe edge spreadfunction. Results were compared with resolution(star) pattern method and were found in agreement. except with a bias towards overestimation in the case ofmicrofocal spots when £SFmethad is used. The metbod gave lmver values as compared to pin how method forconventioad units.
Introduction
E MODULATIONTRANSFERRlNCl10N (MTF)
a method of describing the respooseof anJL imagiogsystemto differeot spatialfrequeociesio
the image. It is closely related to the line spreadfunction (/.SF) whicb is the responsefunction of animagiog systemto an impul" input. Tbe MTF is alsoknown as frequencyresponsefunction or tlte opticaltrdllSferfunction.As the focal spot dimensionis closely
linked witlt tlte frequency response"", it is expectedtltat there is a linkage betweenfocal spot dimensionand the MTF corve of a radiography system.This hasbeeoinvestigatedin somepublications0'.» .
In the presentwork we haveused the first zero or thefirst minimaof tlte MTFcurve to estimatethe focal spotdimensionof tlte indostrial X-raytubes.The method isapplied to conventional (macrofocal) as well asmicrofocal X-raytubes, for ditectional and panoramictargets. It is also verified on X-ray tubes of oilier
laboratories, which have reported about their focussizes and had also provided MTFcurves in tlteirpublications but have not looked for tlte correlation.Three different metltods of drawing MTFcurveswereadoptedandall were found to satisfythe relationship.
Theory
The frequencyresponsefunction for a rectangularX-ray target with a unllorm intensity was shown byMorgan '" to beequal to
FRF= sinr n fa (i/!!,..:LdJ.!In fa(djd,+d,)]. (I)
Where d, and d, are respectivelysource-to-objectandobjcct-to-fihn distances, a is tltefocalspotsizeand fis the spatialfrequency.Thisis sinalarto an opticalsystembecanse the Fourier transformof a slitwitltwidtltais(sin n fain fa), an expressionidentical
19
Founda', Day Speciall"ue 2001
to eq. (I). As the Fourier transform itself is a frequency
response spectrum, it can be said that the X-ray focal
spot has the same effect as the slit has in an optical set-
up. The value of FRF (or MTF) will he zero where
frequency is such that the argument of sine function is
eqnalto 1t or its multiples. I.et the frequencyf (at the
ohject phme) be I, for that condition:
then,
hence
1t f,a(d/d, + d,) = n 1t
a=n[(d,+d,)/d,]llfo
Conversely, it can be argued that if MTF is zero at a
freqnency 1" then fo must satisfy Eqn.(2). With f" d,and d, being known, one can find focal spot size a.
Though any value of 'u' should give the value of a, as
the frequency takes higher harmonic values, the firstzero (n=1) can be used for calculations of the focal
spot. Instead of the object phme frequency, one can
also nse image frequency \ for calculation. F,=I,/M
where M is the magnification factor and is equal to
(d,+d,)/d,.
Therefore, focal spot a = focal spot a = I/f,x did,(3)
This can also be written as 1/\ ( M-I)
Here f,is the spatial frequency in the image plane wben
MTFis zero. This approach can be applied todetermine the focal spot size of macrofocus as well as
microfocus units.
MTF has a multiplicative property. In X-ray imagingapplication, the total MTF is composed of the MTF of
the focal spot and the MTFof the film. It is given as:
MTF(total) ~ MTF(film) x MTF(focal spot)
For the purpose of finding focal spot dimension we
need to work with MTF (f.s.) which can be found only
at a magnification greater than unity. This is because
the focal spot influences the transfer function only
through geometric unsharpness, which occurs at a
non-unity magnification. The MTF (film) is obtained
from a contact image. MTF(film) does not undergounotima or minima. Therefore the first zero or
minimum observed in the MTF(total ) occurs
exclusivcly ou accouut of MTF(l.s.). Heuce it is
adequate to work with the MTF (total) rniber than
separating MTF(film) and MTF (I.s.) at least for the
present purpose. This will also be shownexperimentally.
Experiments and Resnlts
Three different methods were used to get MTF curves
in order to verify the proposition.
(2)
by fundamental method of taking amplitudes of
various spatial frequencies on line pattern image,
by taking fast Fourier transform (FFT) of line
spread function (!.SF) obtained from a slit image.
by obtaining edge spread function and
differentiate it to get !.SF : then take FFT as (ti)above.
Every time, a star pattern was imaged with identical
parameters, to compare the MTF method results with
tbose obtained by the star resolution method.m In
addition to the above, we tested the proposition on the
MTF curves available in the published work of other
researchers, where focal spot size also was available.
By the basic convention, the optical density should be
converied to radiant exposure for finding the MTFandthe !.SF. However, we have confirmed that the dose-
density relationship is strictly linear for typical
industrial radiographic films and hence linearisation of
densIty values is redundant as the amplitude axis in
MTFcurve is to be normalised in any case.
Fundamental method
Huttner's line resolution pattern having spatial
frequencies from 0.25 lp/mm to 10 Iplmm wasimaged on medium speed film at a direct
enlargement ratio of xZ(d, = d,). Conventional(macrofocus) tube, microfocus rod anode and
microfocal directional target were employed. The
image was scanned using Joyce-Loeble scanning
microdeusitometer at the slit width of 20Jlm. This slit
width satisfies the Nyquist criterion of sampling rate
even for the highest frequency of 10 Iplmm.
Figure I shows the OTF curves for the three X-ray
targets employed. The pbase is sbown to be negativewhere the pattern image demonstrates reversal of
optical deusity. ( Such curves giving phase information
are actually called optical transfer function rather than
MTF, which displays only absolute value of thetransform "'.)
20
-
;::: "g"3 "
;-\,i-"i---,:,,--;:,~--..IMAGE FREOOENCY IIp;mmJ
-201
Figl OTF<ou""g_.wdforusiogvariousfroquend€s
The focal spot was calculated hy the eqn. (3). Take for
example, curve B for the microfocal rod anode. The
frequency f, In the image plane is 1.3 lp/mm where thecurve cut., the x-axis. For the magnification of x2 ,
source to ohject distance d, is equal to the object to
film distance d" Hence fncal spnt a = 1/(1.35
lplmm) = 0.74 mm. The other values obttined in
simihu way arc given in Table 1. It can be noted thatthe MTF curve for the microfocal directional target
docs not touch 2ero or minimnm at 10 Ip/mm, thereby
thefocalspotissmallerthanlOOfim.
Table I : FncaI Spot Size obtained by
Optical Transfer Function Method
(N" Tin tbefreqwm",~d, MTFdidootsoow"""'" mini"","",beyondtbes""'.)
Line Spread Function Method
!.'iF was obttined for three different types of X-ray units
by exposing a narrow slit onto a film. Slits of five
different widths of 20 fim to 1O0fim were employed,
which were made out of highly straight and
rectangniar sfaiuless steel jaws of 4 mm thickness.
Images were taken at magnifications xl (contact), x1.5
and x2. Slit radiographswere scanned on themicrodensitometerwitha slitof 20 fim widthto obttinthe !.'iF. The scans gave !.'iF which were digitised andMTFwas obttined by nsing the fast Fourier transform
(FFT) programme on a personal compnter using the
mathematical package ORIGm - Microcal version 4.1.
A Hanning window was used for taking FFT. The
Sampling interval for FFTwas kept same as the interval
used for digitising the curve. The digitising interval for
the curve,in turo, was equal to slit widthused inmicrodensitometer scamting. This is important for
obttinlng correct results because the highest frequency
conttined in FFT cnrve depends upon the samplinginterval.
One of the X-ray units was of panorantic type and
hence the projected focal spot was linear in shape -very narrow in one direction and long in the other.
Sizes in both these directions were imaged by the slitsin the direction perpendicular to the dimensions of
interest. That is, the length dimension of the spot was
assessed by the slit tr'.msverse to the line and width by a
slit parallel to the linear dimension of the foens. Slits
with different widths were employed for microfocus
unit for studying the effect of slit width on the result.
Spatial frequency (lp/mm)
Fig2 MTFformicrofocusuoUuslogI3Fof50~stu
Figure 2 shows the FFT of !SF for 50 fim slit atcontact (xl) and x2 magnifications for a microfocusunit. Contact FFTis MTF(film) whereas curve 2, at x2,gives MTF(total). MTF(f.s.) is obttined by dividing thecurve 2 by curve I, which is given as curve 3. As canbe seen, the minimum on curve 2 and 3 occurs at the
21
Table 2 : Comparison of Resolution Method and MTFFirst Zero Method
same frequency, because the film alone has much
higher response at every spatial frequeucy till the end.Figure 3 gives MTF curves for conventional X-ray tube(nominal focus size O.4mm) where MTF (film) is
much higher than MTF(Total ) which then is notdistinguishahle from MTF(f.s.). These results show thatthere is no need to divide the curves for further work.
Table 2 shows the results obtained by this method fordifferent X-ray targets and theIr comparison with thefocal spot size obtained by the star pattern method inthe same direction.
0.0Do :'.Ii .. II 10
IMAGEFREQUENCYIIo/mm)..
Fig3MTF fo,conwntionnl ani/using LSFof 1001's/It
Edge spreadfunction route
An image trace of a knife-edge object is calIed edge
spread function (ESF). This is similar to step afunction response in electroulcs. It has been shown'"
that ESFis nothing but summation (or integration) ofthe line spread functions across the edge. Therefore it
is possible to acquire LSF by talting derivative of
the ESF.There are certain advantages in using an edge
N.A.,No'oppUwbk
rather than a slit. For a given focal spot size an
optimum slit width is required. The derivative of ESF
yields the finest compatible slit for the given focus. AnEdge has lesser inaccuracy as compared to fine slit if
the placement under the beam is not very accurate. A
vertical edge of highly polished surface having 4 mmthickness was exposed and MDM scan was taken. It
was differentiated on a PC after digital smoothening
wherever required. Figure 4(a) shows the edge trace
at x2 magnification which is differentiated to get theLSFin Figure 4(b). Focal spot size for the microfocus
unit then obtained from the zero as in Figure 5. The
lower half of Table 2 gives the comparison of results
obtained by ESF route with the resolution patternmethod.
MTFcurves of other authors
In order to verify the method on larger number of X-
ray tubes with wider range, MTFcurves avatinble in the
literature were used to find the focal spot size. Thiswas compared with the focal spot size mentioned in the
same papers. Gould and Genant'" while comparingMTF curves qualItatively with the focal spots, have
measured spot sizes by pin-hole method at different
locations in the X-ray beam viz. at centre, towards the
anode and towards the cathode. They have also
published corresponding MTF curves (for example
Figure 6). Using these published curves pertaining to
two different tubes, focal spot sizes were assessed by
the first zero method. Results are given in Table 3,
along with one other X-raytube from K.Doi'"'.
22
00
.~-,-~'" 00'-
~~.~~
Didance
Fig.4(o) Edge t"""fo," mtm>fomlunit
--1.0
0.1
.ZO.Ilo.,«
a~0.0
0 ~ "~
Frequency (lp/mm)
Fig.5MTFfo,LSFof Fig.6
-,.. -Iv. -K>OO-I~ "~ .""",'" .-
r0.'0.' 0.' 0,'Distance
Fig4(b) lliFobtatn,dbydifferonttattonofFig4(0)
"
~ '0i=
z 0 ...
~~«.J a:" UI0 II. 0.4
1~~~ All
0;
Fig6MTFcu'""fm-earlterpublished wo,k- ["""'f""""(3)[
1.0'
---------
~ 0.6
! 0.4
0.8-
0.2
0_0 ~ -,~"0 5 10 15 2520
Fceqo,"o, Ilp/mml
Figo7MTFfo, 40 J' slitlliFexhlbtttngomtnlmum
23
BARC NEWSLETTER Founder's Day Special l=e 2Of/l
Table 3: Application of MTF Method to X-ray Tnbes of Other Authors
RSIAxial
Discussion
Results from each of the four methods are discus5ed
here separately.
The focal spot sizes found by the fundamental method
of plotting MTF, using line resointion pattern of various
frequencies, is in close agreement with values obtained
by star resolution method. This is expected as both the
approaches are based on the S31De principie. The
frequency at which the MTF is zero is the same where
the lines in the resolution pattern give blnrred contrast.
Both the approaches are derived from the Morgan's
fomnla (eqn.I). The rod anode used was a panorantic
target; here as well as in LSF method; panorantic
targets do give variability of results. This is prnbably
due to ring shape of such targets. The segments of
equal arc lengths on the riug give increasingly smaller
projected lengths, from the centre towards the edge, as
seen by the slit. However, the change is not linear with
the linear distance. This gives rise to a corresponding
non-linear variation in radiation intensity received at
the object, from across the target, thus aIIecting the
!.SF. More work is required to study the behaviour of
panorantic targets as even in the star method they often
give odd patterns.
The first part of the Table 2 gives FFT results of the line
spread function derived from the slit images.
-variatffiii-
-20
+7
-20-26-10-33
Agreement is very good for conventional directional
targets. Even for panorantic target, the axial dimension
of the spot is in excellent agreement with the star
pattern value. For the transverse size of the spot, !.SF
was takenat onlyxU magnification.It gavea focussize much smaller than expected. It could be doe to the
small magnification used; the other reason could be as
discus5ed in 4.1. More work is required to study
behaviour of panorantic targets as even in the star
method they sometimes givequeer patterns.
Four different slit-widths were used (20, 50, 100,
500,,) in the case of the microfocus uult. fur
obtaining the LSFs. But all have given rn::uiy the
same result of 90" for focus size. This value is
higher than that observed by the star method.The reason for this is the broad slits. Just as a
fine hole is required in the pin-hole method, avery narrow slit must be used in the case of
microfocus mbes as the focal spot is too fine. An
excessively broad slit has its own MTFwhich gets
introduced in the total MTF. ideally the MTF
(fucal spot) should be corrected for thiscontribntion; it was not done here.. A finer slit
poses difficulties in aligmuent and loss inradiation intensity at the 6lm plane. In the
absence of a very fine slit !.SF can be obtained by
24
BARC NEWSLETTER Founder's DoySpecial/ssue 200/
the derivative of the edge spread function, which
would automatica1lysimulate the finest possible sbtThis is seeu in the uext sectiou.
The second half of the Table 2 shows the results
arrived at hy using the derivative of the edge spread
function. It gave very good curves and results for the
microfocal X-ray large! (Figures 4 and 5). This
supports the argument that the edge can substitute for
a very fine slit Although it is not shown in the Table,
but we treated 100 I'm slit as two independent edges
and derived a focal spot size by that route. It showed
the focal spot size to be 50f1m, close to what single
edge has given.
In the case of a conventional unit some noise wasobserved on the /.SF curve derived &om ESF.
Either the ESFor /.SF were digil3lly smoothened
to get the result Five different combinations of
smoothening operations were used. The resuh
giveu in the table is average of the five with thestandard deviation, which is reasonably smali.
Results in Table 3 pertain to the X-ray tubes of other
authors as mentioned earlier. Figure 6 gives MTFcurves for one such tube. The dotted line is
extrapolation done by us. The values ohtained by MTF
first zero method are ali smalfer by about 20% as
compared to the pin-hole method. However, pin-hole
method is known to give higher estimates. It is notknown whether and what corrections the authors have
applied. Their method of plotting MTF is also notknown. The nature of the MTF curve for transverse
direction in GE larget is different in that it bas a
minimum as well as a zero. A Simibr graph was
obtained in the case of a /.SF for a 50 I'm slit in our
laboratory for microfocal unit It indicates a bi-modalshape of the source. This could have happened alsodue to contribution of the transverse dimension of the
focus, il the abgument is imperfect. As the zero is
distinct and fobows immediately after the minima,
frequency value at the zero is considered forcalculations. This is ouly an empirical conclusion;more work is needed to sort ou!Such behaviour.
Sometimes the MTFcurve does not take zero value, hut
undergoes ouly a minima. In these cases calculation
will be based on the frequency at which the minima
occurs. One such example is given in the Figure 7
which is ohtained &om /.SFof a 40 I'm slit imaged by a
conventional panoramic large! (axial direction). Herethe MTF curve does not take an exact zero value, but
rons quite close to it. As the magnification used was
x1.5 and \ is 5.6 lplmm, the focal spot should be(1/5.6) x (1/0.5) ie 0.36 mm, the value obtained also
by the star method.
The presence of a minima instead of a zero could be
due to many reasons. If the /.SF is noisy then the high
frequency component may be more in the MTF, not
permitting it to vanish, where otherwise it would have
been zero. The other likely source is the discrete
sampling. Take for example, the dotted part in the
curve B in the fig.1. The solid curve B touches zero
becanse it is an OTF curve taking negative amplitudevalues also. The dotted extension is the MTFand hence
takes ouly absolute values. As the exact frequency
where it is to be zero is not the part of the sample, MTF
begins to rise before touching the x-axis. This type of
situation can also come when the digital transform is
taken on a computer. The FFf softwares do not
sample aU the points on the curve but at discrete
intervals. Then the frequency corresponding to the
zero response can be missed out and MTF can rise
again. But in any case, it is observed that frequency of
the first minimum gives satisfactory results il a zerodoes not occur.
In general, dimensions ohtained from nine different X-
ray tubes and 17 target orientations show that the MTFmethod gives results reasonably close to the other
methods. This method has an advantage over the
method based on resolution pattero, that it can be
employed even at higher X-ray energies, where thinlead strips in the resolution pattero are penetrated.
Conclusion
It is possible to find the focal spot dimension of an X-
ray unit using the lowest spatial frequency at whichMTFis either zero or minimum. The MTFobtained by
three different methods, namely the fundamental route
of imaging various spatiaI frequencies, taking FFf of
the line spread function (LSF) and obtaining /.SF by
differentiating the edge spread 'function (ESF),
generalfy showed similar results when compared withthe results ohtained by resolution test method.
25
However,in the caseofmicrofocaltargets,ESFmethodof obtaining MTF was found to give more accurate
values. The method when applied to the publishedcurves of other workers showed lower values as
compared to the pin-hole method of finding the focalspot size.
Acknowledgement
The author is grateful to Mr S. Mukhopadhyay fordiscussions held with him, to Mr. B.P. Patil and Mr.
IlN. Chandrasekharan for their help in accuratemicrodensitometry He is also thankful to Mr. P.G.
Kulkarni, Head, Atomic Fuels Division for the
permission to publish this work.
Reference
1. RH. Morgan, Frequency response function. Am.
JI. Roen!., 88,no.1, p 175-186 Quly'62)
2. P.R Vaidya, Determination of the focal spot size of
microfocos X-ray tubes by means of resolution
test chart. INSIGHT,Vol. 41, No.4, April 1999.
3. Rohert G. Gould, Harry Il Geoan!, Qualitative and
Quantitative comparison of two microfocus
tuhe imaging systems, Radiology 138, p.I95(1981).
4. Il Doi, Il Rossman,Evaluation of focal spotdlstrihution hy lIMS value and its effect onhlood vessel imaging in angiography,Proc.Symp.Appl.of OpticalInstru in Medicine- 111,SPIE Proc. Vol.47 at Palo Vardes, CA,p. 207-213(1975).
5. GreyJ.E., Trefler M.,Focal spot measurementfor
quality control putposes using A random object
distribution, Proc. Symp. Appl of Optical1nstru.
In Medicine -IV, SPIEvo1.70,Sept.1975
6. Erik Inglestam, Technical Note, jl. Op!. Soc. Am,51,1441 (1961).
7. C.£ Mees and T.H.James, Theory ofphotographicprocess, McMillan &Co.,(1966)
8. Il Doi, OTFs of the focal spot of X-ray tube. AmJI. Roen!. <)4,No.3, p. 712 (1965).
Mr P.R. Vaidya did his B.Se in Physicsfrom the Gujarat University and later MSc in Physicsfrom theUniversity of Bombay. Hejoined theAtomic Fue/$Division, BARC,in 1970from the 13thbatch of TrainingSchool He workEd on Quality Controi of nuckar fUe/$for 2 years and then on ultrasonic testing foranother 3 years. Since 1973 he has been 0/$0 assodated witb the use of radiation in NDThy way ofgamma spectrometry and radiography. He obtained Level II and Level III in radiography from theInternationalAtomic EnergyAgency (/ABA).
Mr Voidyo bas eqnal experience in the industrial and researcb aspects of radiography. He bas stamlardized radiographyprocedures for nuckar fue/$ and various systems of nuckar reactors.Real time radiographyset-up configured hy him in1985formid-term examination of irradiatedfUel of research reactor ClRUSwas thefirst of its kind anywhere, using theindustrial radiography unit. He bas extensive experience in the use of microfoeus X-r<ryunit for industrial applicationand R&D purposes. Measurenumt of focal spot is consifkred a difficuft probkm in microfoeal radiography. Theaccompanying paper published in the journal iNSiGHT(Non destructive Testing and Condition Monitoring, Vol42, M<ry2000) offersomesomtion to theprobkm. Thepaperbas been given theR.lIAlMSHA W AwardoftheBritishinstituteofNOT
for being the best paper published in the journal iNSiGHT during the year 2(J()(), on any aspect of radiography and radiowgy.
The work is one part of his Ph.D. dissertation. Mr Vaidya has 45 publications, incmding four on X-r<ry focal spot size
measurenumt techniques, in national and international journais and Conferences.
26
A Novel Naturally Occurring ProdigiosinAnalogue with Potential DNA TargettingPropertyMahe,h Suhmmanian
B;o-O,g'o;, D;y;,;oOBh,bh, Awm;, R~""h Cm'"
and
Rame,h Chander
Food T,chnology D;y;';noBh,bh, Awm;, R"",ch C,nne
[EREIS A BURGEONINGINTERESTIN SMALL
rganic molecules that are capable of bindingnd cleavingDNA as these can be used in the
design and development of new drugs, synthetic
restriction enzymes, DNA footprinting agents etc.'"
Towards this end, the redox potential of a variety of
metal ions have been exploited for the development of
DNA cleaving agents." However, possibly the organiccompoundsplaymoreimportantrolesas theynotoulyprovide multitude binding interactions with the target
DNAbut alsoensnresthe reqniredelectrontransferviatheir intrinsic chemical, electrochemical and
photochemical properties.'" Some of the well-knownDNA cleavers like DAPI, furamidine, bleomycin etc.
bind preferentiallyto the A-T rich sequencesof DNAand show mixed binding interactions at different
sequences. The polypyrrole natural compounds like
the tarnbjarnine alkaloids and the microorganism-
derived pigments, prodigiosins can efficiently cleave
DNAvia an oxidative process. Recently, a red pigment
was obtainedfromthe Micrococcussp. isolatedfromsterilized dehydrated shrimp. The compound
possessed a novel tripyrrole structure where the third
pyrrolemoietywas attachedto the bipyrrolenucleusthrough its nitrogen atom, a N-alkylated analogue of
prodigiosin (1). Our interest in the compound 1
stemmed from its probable DNA targetting properties.
It was envisaged that while its planer bipyrrole nuclens
maybindDNAby intercalatinn,the ringnitrngensand
the methoxyl substituent provide hydrogen bonding
sites that could contribute tn gronve binding mode',
features similar to bleomycin."" Due to the
susceptibility of polypyrroles for easy oxidation',compound 1 was expected to show nuclease activity in
the presence of a snitable redox active metal ion. Such
activity could then be used to determine whether it
interacts with DNA in a sequence-specific manner. To
test our hypothesis, the DNA targeting activities of 1were examined. It was found that 1 binds with DNA
efficiently and facilitates copper-mediated DNA
cleavage by a process that does not require any
external reducing agent. This behavior differs from that
of most of the well known DNA cleaving agents and
implied that DNA may be a therapeutic iocus for 1.
0 \
~ NY={°~
l:Y~27
BARC NEWSLETTER Found,,'s Day Special /s=e 2001
Resulls and Discussion
DNA Binding
Compound I has strong absorption bands (SOl and
537 nm) in the visible region that are well suited for
DNAbinding studies. The ability of 110 bind DNAwasdetermined with IN-Visible spectroscopy. As shown in
Fig. 1-3, addition of po1y[G-CI, po1y[A-TI. and calfthymus DNA(cf -DNA)in increasing amounts 10a fixed
concentration of 1 (20 I'M) led 10 gradual reductions
in the intensity of both the absorption bands of free 1.In addition, a minor red-shift (1.5-3 nm) of the bands
were also noted. All these data clearly suggested
efficient binding of 1 with DNA and DNA segments.
More interestingly, the hypoehromicity induced by
binding of 110 po1y[G-C), was significantly high while
hg. / InlmlcJion of I wtIb poIy[G-Cf " Increanng amounts
ofpoly(G-C), (1.5 pIIa1/qucts) wasadJedloZO pill in /0mM HEPESbuff" pH 7.1 in _of/OO mM NaCl
those with Cf-DNAand po1y[A-TI.were similarandmueh less in maguitude. Based on these observations,
a G-C speeifie binding of I was apparent. This was
confirmed by quantitative analysis of the IN-visible data
which permitted determination of the intrinsic binding
constln~ based on the site-exclnsion model.' The
eqnilibrium binding constants (10 in respective cases
were derived (Fig- 4) by titrating 20 I'M of 1 with
increasing amounts of Cf-DNA,poly[A-TJ. and polylG-
CI" added in different base p:Dr aliquots as indicated
in the Fig. 1-3. Regression an:Dysis in all the cases
showed linear fits indicative of a singie mode binding
of 1 with DNA. As anticipated, the K-yajue for G-G
domain binding was 4-6 fold than those for bindingwithA-T domain.
Wnot...thi.ml
/';g.1 1,"""",lionofI w#bpoly[A-Tj,. Increanng
anwuntsofpoly(A-T), (5 pIIa1/qucts) wasadJedroZO
pill in /OmM HEPESbuffe.PH7.1 In_of/OOmM NaCl
28
Fig. 3/nl"",tion ofl with CT-DNA./na-easing
amountsofCT-DNA (6 pM aIiqu<>l,) was added 10
20 pM/in IOmMHep"buJJ"PH 1.2 inp",en"
of/OOmMNaCl
UnwmrolbMhftrD~bl~mg
Compound 1 posse&<e.<unfused aromatic ring systems
bearing cationic charge at physiological pH. The
cationic property of 1 appears to be critical for its
efficientbinding with DNAwhich is also reflected from
reduction of the binding constant values with increased
pH (6.5 vs 8.5). The binding constant values of 10' M'
was much lower than those of typieal interca1atorswhieh show K values 10'-10' M'.' This argued in
favour of a non-interealative, groove hinding of 1 withDNAvia ion-pair interaction. Weakening of the hindingwith increased NaCl concentration (100-500 mM)further confirmed it. All these results were consistent
with the importance of the cationie charge of 1 for its
DNA binding.
Binding of 1 to DNA was also accompmded by
precipitation which continued even in the presence of
orgmdc solvents (20% vlv) like DMSO and acetone.
'ii
'"Z<>
* ~!
f ()N AI XI!'
Fig.4.Delerminationof I'" biiiding,on;ranl'(KjDNA Kcr.DNA 1.1X10""'Po~(A.T), t.8XIO',"'Po~(G-C), 6.7X10'M'
These results were surprising as we anticipated that
DNAbinding would facilitate water soiubility. However,in view of Rizzo's result", it is tempting to speculate that
1 might show a conformational preference in binding
with DNA. Thus, if the ~ form of 1 is the preferred
binding conformation, then the pK, of the boundcompound would drop below the pH of the solution
causing its precipitation.
DNA Cleavage
The ahility of 1 to mediate DNAcleavage was assessed
using agarose gel electrophoresis and supercolled
plasmid pBR 322 DNA (Form I). The assay were
canied out in the presence of several redox active
metals like Cu(lI), Fe(lIl), Ni(lI) and Zn(lI). Asshown
in Fig. 5a, strand scission of DNAcould be effected only
in presence ofCullI) (lane 3). The data in ianes 2 and
3 demonstrated that both Co(lI) and 1 were required
29
BAR!:: NEWSLETTER Found,,'s Day Special Issue 1001
Fig. 50 Ability oJdifferenl "",tal ions 10 Induce DNA ,w""'ge
InpnmmwoJ1. KelaxaUon oJFm'mIDNA by I lopros_oJdiffenmt "",tal ions Kea<:tion -- (20 pI. total voIum8)
conIaJrwd 200 og oj Form I DNA In 10mM HEP1iS baffm', pH
7.4, 75 mAl Naa and 10-""""",, % ClIp' Ckovage wascarriedou/a/37'CJ...60mln.Lane/, DNA + 50 pM Cu"Lane2, DNA+50pM CtI',1
Lane 3. DNA + 50 pM Fe"
Lane4,DNA +50pMFe",l
Lane 5, DNA + 50 pM Nt'
Lane~DNA +50pMNt"1Lane 7, DNA + 50 pM Zo"Lane8, DNA + 50 pM Zn",1
E
Fig. 5b. T;"", dependent DNA ,wmage by cupric 100 and 1,
KelaxaUon oj supe.wlkd plasmid DNA (F- I) by 50 pMCtI',1 a/ 37 'C. Kea<:tion m"<luros (20 pI. total uolu"",)
conIaJrwd 200 ng oj Fonn I DNA In 10 mAl HEP1iSbaffm', pH
7.4,75mA1NaaandIO-uolu""'%ClIp<,Lane I, DNA +50pMCrI'
Lane 2, DNA + 50 pM 1Lane 3-7, Ckavage afle<-0, 30, 60,90 and 110 min I,",ubaUonwilb50pMCtI',1
for the deaV',,!:e. The deavaj!e was complete with
equimolar concentration of Co(D), while lowering the
Co(D) concentration progressive1y redoced the extent
of DNA str:md scission, Following the deavaj!e over aperiod of 30-90 min (Fig. 5b ), it was observed that
single strand cleavage was complete within 30 min,
while significant double-strand DNA (dsDNA) deavaj!eappeared after -90 miD. Lanes 5-7 show all threeforms of DNAwhich is a classical evidence of dsDNA
deavaj!e.~
To gain further insight into the mechanism of the DNA
deavaj!e especiaUy with respect to the involYelUentof
oxygen-derived reactive species, the experitnent was
a1s0 carried out in the presence of various scavengers
of reactive oxygen species. Fig. 6a shows (Iane 4) thatthe hydroxyl rodical scavenger, DMSO could not
prevent the DNAdeavaj!e, indicating non,partidpation
of this freely diffusible rodical in the reaction. This was
further confirmed" from the fuct that extent of cleavagewas dependent on the NaCl concentration (data not
shown), Superoxide dismutase a1so had little effect
(Iane 6) on the course uf the process, Thus, thesuperoxide rodical ion was neither directly responsible
for the strand scission'" nor in reducing Co(II).'"
Catalase, the enzyme responsible for the
disproportionation of H,O, completely inhibited thedeavaj!e (Iane 5), Based on these resuI~ the cleavage
was found to be oxidative wherein the intermediacy of
peroxo compound could be inferred. The metal
chelator EDTA could prevent the deavaj!e (Iane 3),
while sodimn azide, the singlet oxygen quencher" had
a margin:Il effect in preventing the DNAscission (Iane7).
All these data indicated that the Cu(lI) binding by 1 is
essentiul and that H,O, is involved in mediating DNA
deavaj!e, Mecbanistically, it appears that doting its
interaction with Co(n), the polypyrrole moiety nf 1
gets oxidized to a n,rodical cationic intermediate
generating CuO), Since the rate couslants of
dimerization of bipyrrole rodical cation in water are-10' 1M's", one fute of the intermedi2te derived from
1 would be its dimerization, Oxidation CoO)
by molecular oxygen would lurrtish CurD) and
superoxide rodical ion, the lauer producing H,O, via
30
Fig 6a Mochanisim oftbe DNA ckavage by cupric ion and 1.
Relaxation of tbe Fmm I DNA by 50 pM Ca"-1. R",dion
mixtu"" (20pL totaloola",,) coataind200ngofFonaIDNA
in 10 mM llEPES bulf". pH 7.4. 75 mM NoCI and 1O-oolu",,%
CH,cN Cleavage was camed oul at 31 C fa' 60 min.
Lane I, DNA oWne
Lane2, DNA + 50 pM Cu"-1
Lane 3, Lane 2 + lOOmM EDTA
Lane 4. Lane 2 + 1M DMSO
Lane 5. Lane 2 + 1000 VlmL Catalase
Lane~ Lane2 + 1000 VlmL SOD
Lane 7. Lane2 + lOOmMNaN,
Fig.6b Int"""dlaryofCaprou, ion. Relaxation ofSUf"<x#kd
p/m;mid DNA (Fona I) by 50 pM Ca"-I at 37 'C. Readionmixta", (20 pL totaI vola",,) contained200 agofFona I DNA
in 10 mM HEPESbalf", pH 7.4. 75 mM NaCI and IO-vola"" %
CH,CN.Lane I, DNA oWne
Lane2. DNA +50pMCu"-1
Lane 3. Iane2 + 50 pM Ncm:uproine
Lane 3.lane2 + lOOpM Ncm:uproine
disproportionation. Finally oxidation of CU(I) with H,o,wonld lead to a copper-oxo species that initiates the
DNA cleavage as is known with prodigison and
tambjamine." The involvement of Cu(I) was directiy
proved by carrying out the DNAscission experiment in
presence of increasing amounts of neocuproine, a
Cu(I)-specific chelator. As shown in Fig. 6b, presenceof neocuproine rednced the DNA damage in a
concentration dependent manner.
Considering that compounds that facilitate dsDNA
cleavage are known to possess cytotoxic and anti-
tumour properties, componnd 1 appears to be a
promising candidate as anti-cancer agent. Besides
cleaving DNAwithout the need of any reducing agents,it induces dsDNA damage which is considered more
difficnlt for the cells to repair than single strand
cleavage. Furthermore, although a large number A-T
specific DNAbinders are known, designing compounds
to recognize G-C sequence is more challenging.Moreover, most of the the G-Cspecific binding agentsbind via intercalative modes. From all' these
perspectives, the discovery of 1 is very significant as it
binds with G-C sequence of DNA via ionic interactions.
Based on the resnlt' presented in this paper,
compound 1 might provide unique probe of nucleic
acid sequence-dependent molecnlar recognition.
References
1. a) Hillman, R. E.; Dandhker, P. J.; Barton, J. K.
Angew. Chern. Int. Ed. Eng/., 1997,36,2714. b)
Dupureur, C.; Barton, J. Ii. In Comprehensive
Supramdecular Chernistry, (Ed. Lehn, J. -M.) ,
Pergamon, New York, 1997, vol. 5, 295.2. a) Nordeo, B.; Lincoln, P.; Akerman, B.; Tuite, E.
10 Metal Ions in Biological Systems: Probing of
Nucleic Acids by Metal Ion Compkxes of Sma"
Mokcuks, (Eds. Sigel, A.; Sigel, H.), MereelDekker, New York, 1996, vol. 33, 177. b) Sigman,
D. S.; Majumder, A.; Perrin, D. M. Chern. Rev.,
1993,93,2295.
3. Wilson, W. D.; Li,Y.; Veal,J. M.Adv. DNASpecifu:
Reagents, 1992, I, 89.4. a) Lui, S. M.; Vanderwall, D. E.;Wu, W.; Tang, X.-
J.; Turner, C.J.; Kozarich, J. W.; Strubbe, J.,j Am.
31
BARC NEWSLETTER Found,,'s Day Sp<eioJ [<sue 20fJ[
Chem. Soc., 1997,119,9603. b) Mao, Q.; Fulmer,
P.;Lui, S. M.;Vanderw:ill, D.E.; Wu, W.;Tang,x.
-J.; Turner, C. J.; Kozaricb, J. W.; Strubbe, J.,f.Am. Chem. Soc., 1997, 119, 9603. and ref. citedtherein.
5. PaIil, A. 0.; Heeger, A. j.; Wudl, F., Chem. Rev.,
1988,88,183.
6. McGhee, J. D.; yon Hippe!, P. H., f. Mol. Bioi.,
1974,86,469.
7. Haq, I.; Uncoln, P.; Sun, D.; Norden, B.;Chowdhury, B. z.; Chairs, J. B. f. Am. Chem. Sac.
1995,117,4788.
8. Rizzo, V.; Morelli, A.; Plnciroli, Y.; Sciangula, D.;
D'Alessio, R.,f. Pharm. Sci., 1999,88,73-9. a) Povirk, L F.; Wuber, W.; Kohnleln, W.;
Hutchinson, F., NiJdeic Acids Res., 1977, 4,3573. b) Drak, J.; 1wasawa, N.; Danishefsky, S.;
Crothers, D. M., Proc. Natl Acad. Sci. u.S.A.,
1991, 88, 7464. c) Branum, M. E.; Que, L., Jr.
JBIC 1999, 4, 593.10. Lu, M.; Guo, Q.; Wmk, D. J.; Kallenbatcb, N. R.,
NucfeU:Aclds Res., 1990,18,3333.
ll. a) Dix, T. A.; Hess, K. M.; Medina, M. A.; Sullivan,
R. W.; Tilly, S. L.; Webb, T. L. L., Biochemistry,
1996, 35, 4578.) (ll. b) Tbederabn, T. B.;Kowabara, M. D.; Larsen, T. A.; Sigman, D. S.,f.
Am. Cham. Soc., 1989,111,4941.
12. U, Y.; Trush, M. A.; Yager, J. D., CarcinogetUISis,1994,15, 1421.
13. Borah, S.; Melvin,M. Llndquis~ N.; Manderville, R.
A., f. Am. Cham. Soc., 1998, 120, 4557.4562.
c Mr. MabeshSubramanianjoinedthe BARC TrmnlngSchool In 1997 (41" Batch) qftercompletlng
his M. Sc. In M/crohiology from M. S. Un/vers/ly, vadodara. Subsequently, he joined the Bio-
Organic DIvision and has been working on oaturolly occurring radiomodifiers especiallyavailable from plants of Ayurvedic importance. His other interest Is mechanistic studies on the
Interaction of b/oact/ve compounds with various exogenous/endogenous reactive DXJge7Jspecies.
Dr. Ramesh Chander joined the Food Techa%gy Division In 1975 after gradunt/ngfrom the Iff
Batch of BARC Training Schaol. His work pertains to development of safe, shelfstable meat and
meat products using hurdle techa%gy. He Is also working on Inhlhitlon of lipid peroxIdatlon In
mdiatlon processed meats by using navel natural antioxidants. His major contribution Is
development of ArtIjU;ia1 Viral Envelopes for targeted Intracellular delivery of peptldes, enzymes,
toxins and gene constructs for wbich he halds us and European patents.
.~
32
Fluxes and Residence Time of DifferentToxic and Trace Elements in Thane Creek
S. K Jha, G. G. Pandi" S. B. Chavan and B. S. NegiEnviwnmem~ A",.,mem Diyi,ionBh>bh, Mamie R"",cl, Cm",
Introduction
OXICANDTRACEELEMENTSAREINTRODUCED
into aqnatic environments as a result of various
processes. The sources are geologic,]weathering, effluent discharge from indnstries, nse of
metal and metal components, leaching from dump and
leaching of fertilizers, atmospheric deposition and
auim,] excretion and the discharge of human sewage.
These toxic elements tend to be trapped in creek andaccnmulate in sediments. Elevated concentration of
trace and toxic elements such as Cn, Fe, Pb, Zn in the
Creek ""ter was reported by sever,] worker (Patel et
al. 1985b; Bosale 1991; Mirajkar et al. 1995).
Concentration of hea\Y metals in sediments usualiy
exceeds those of overlying water by 3 to 5 orders of
magultude. There are various routs by which sediment
metals reach the biota. With snch high concentrations
the bio avaliabdity of even a minnte fraction of total
sediment metals assumes considerable importance.
Toxic and trace elements enter Thane Creek from river
run off and throngh direct industrial and sewage
discbarge from different discharge chanuels. While ali
toxic and trace elements are natnraliy present in the
creek sediment it is their presence at elevatedconcentration, which presents a potenti'] threat to
aqnatic life (Turner 1990). The present study has been
carried ont in a creek near Mnmbai City,which is one
of the most heavily populated and industrialized cities
of India. The creek, known as 'Thane Creek', separates
the Ishmd CIty of Mumbai in the west from themaiuland in the east and houses indostrial area at a
distance of about 25 Km north--east of Mumbai city.
The bay could be considered as an estuary duringsouthwest monsoon period aune-September, rainIali
200 em), when the land drainage and river run-offs arc
considerable. During this period salinity drops down to
about 4'/00' During the rest of the year the salinity is
maintained in accordance with the ingress of seawater
(maximum 38'/00)' This area is also highly Bioproductive (Patel et al., 1979) and yields about 2 to 3
thousand metric tones of fish aunualiy. This area was
developed by the state Government esseutialiy for the
chemical industries towards the begiuning of the sixties
and at present about 25 large industries and about 300
medium and smali scale units using hazardouschenticals are located out of 2000 nnits. The main
water source for the industrial consumption is MillC.
The industrial area utilizes about 45000 m'/day of fresh
water. The effiuent discharge -treated and untreated
amounts to 2875ti m'/day i.e. 64% of the totalindustrial effiuents generated in Thane Creek area.
Except few major industries, medium and smali scale
industries discharge their treated or untreated effiuents
through the unlined surface drains to Thane Creek. In
addition to this domestic sewage discharges fromsuburbs of Mumbai Citymeet the Thane Creek from the
west side. In addition, atmospheric faliout from the
chimneys and stack and vehicle exhausts estimated to
be 22000 Vday over the city, reach the creek afterwashout.
In an attempt to deterntine the pollution history and to
assess the fate of heavy metals detailed investigation has
been made in core samples collected from ThaneCreek.
Samples Collection, Preparation andAnalysisThe eutire Creek was divided iuto three zones as showu
in Fig 1. The samples were collected using a gravity
corer, its iuner and outer diameters being 5.2 and 6.0
33
em respectively. The length of the core collected with
the help of an adjustahle piston rod with silicone
packing ranged from 21 to 59 em. The gravity-coringunit was lowered as slowly as possihle Into the
sedimen~ to prevent lateral motion of the pressurewave created hy the descent of the corer. One core
each was collected from zone-I and zone-2, whereas
two core samples were collected from zone-3. The
collected cores were extruded vertically and sliced at 2
em intelY.us and care was taken during coring toensore minimum disturbance of the sediment water
interface. All the samples were freeze-dried,
homogenized and stored for analysis.
The determination of ""Pb content is based upon the
measorement of the gr.mddanghter ""Po, which is
assnmed to be in secolar equilibrium with its parent.The basic radiochemical procedure involved successive
leaching of the sediment samples with aqua regia, theresidual solids were filtered off and solution was dried
and converted to chloride with concenlI"ated HC!. The
final solution was taken in 0.5M HCl and Po was
deposited spontaneously on a silver disc. Yield tracer
"'Po was added to each sample prior to acid digestion.
Activities of ""Po along with the ~Po tracer were
measored by Alpha Spectrometry using a silicon
surface barrier detector connected to a moltichannel
analyzer.
The determination of elemental concentration in the
sediment core samples were carried out using Energy
Dispersive X-ray Fluorescence (EDXRF) technique forelements Fe, Co, Zn and Pb, which has been, described
elsewhere Qha et al., 1999b). The Mn, Cr wereanalyzed by AAS.The standard APHAmethods were
followed for analysis of toxic and trace elements in the
water by AAS(APHA,1985).
Result and Discussion
The concentration depth profile of Pb, Zn, Cu, Fe, Mnand Cr is shown in Figure 2. The surface concentration
of Cr in zone 2 and zone I is 121-126 ppm comparedto 37-71 ppm in zone 3 of Thane creek sediment
compairedto the average total Cr concentration in V.K.
estuarine sediments (Bryan and Langston 1992) which
r.mges from about 32-200 ppm. Apart from slight
deviation in zone-2 concentration profile values of Fe is
constant throughout the entire core. The depth profileof Cu, Zn, Mn and Pb shows gradual increase in
concentration as we move from bottom to the top ofthe core. This variation in concentration is more or
less similar in trend but magnitude of variation is more
in zone 2. We attribute these increases mainly tocontributions to the creek sediment from industrial
eftluent discharge and from sewage.
The deposition of clemental flux entering the creek at
different location was calculated as a prodnct of the
elemental concentration (mg/g) in each section of the
core with average mass sedimentation rate (gem' y')from the respective location. If the cores extended for
enough back in time beyond cultural pollution it wouldbe possible to derive local base level concentrations forthese elements and determine more recent fluxes to the
sediments. For Pb the total flux is 2.5 and 1.8 x 10'
gcm'y' in zone I and zone 3 compared to 11.9 x 10'
gcm'y' in zone 2. Assuming that the net concentration
for the bottom segmen~ is close to the baselineconcentrations, we calculated recent net fluxes for
these clements. The calculated recent net fluxes above
the corrected background for Pb, Zn, Cu, Cr, Mn andFe are listed in Table-I. The values for recent net
deposition rates can be compared to those for total Pb
(0.4-1.1) x lO'gcm'y'andCuof (0.6-1.4)xlO'
34
j' I ',', .\I) /j '\ ,
i,,
'
!
( \ /
I
\ \
I"
,,
\\
, / '." If'! /
I(
'
",
'\!I '/
C=ol! ,I(
0 50 '00 '
C",.""~~:" (ppm:OO
,,',. Co, '". Fb. C,
Flg2a Coaeentmtioa oJtmc"kment, in ca," colkction
fromzonE.ioJThmwC",k
/ j
I '"!-~
~(00
,'00c","'"O,o(ppml
Lentration in %
Fig2' CancentmtiaaaJtmceekmentsincu,"colkcted
Jrom zanE.3 oJThaa, croek
I"iQ <0
c""""",,, (ppml
Fig2b ConcentmtioaaJtmcoekmentsinc""colkcted
JromzonE.2aJThancCroek
I 0
I '"
'110.1\~ <0-
\ . Co'0"
. '0
. n,
. c,
3001
-~
~I
I
I
'j'
. ,'",,(
. 'oo,,'
. '00"
"" 500 eoo ,00 800
Fig.2d Coaeentm"an oJMn in co," colkctedJrom dijJ",ent
zonE,aJThanEC,"ek
35
BARC NEWSLETTER Founder's Doy Speciol Issue 2001
Table 1: Description of sampling locations along with linear and masssedimeotation rate and Oox of ""Pb in Thane Creek
Table 2: Recent net Ooxes of different elements in Thane Creek
gcm~'y' obtained by Matsumot and Wong (1977) in
cores of marine Fjord in New Pacific with simibr
sedimentation rates between 0.09 and 0.27 gcm~' y'and "'pb Ouxes of 1.9-5.1 dpm cm'V, In case of Thane
creek with a sedimentation Me of 0.06-0.20 gem' y'
and "'Pb flux of 0.433 dpm cm'V and calculate excess
flux of (O.l2-0.86)xlO' gernY indicates the highest
value of net fluxes ahnut background are observed forPh in wne 2.
Under the assumption of cnnstant "'pb deposition Me,
constant sediment accumulation and with no post
depositional ndgration, the sedimentation rate fromvertical distribution of excess "'pb in core can
he ohtained OM at ai, 1999a). Table 2 gives theldescription of sampling location and linear and mass
sedimentation - OM at el., 1996) at each location.From the table Ii mean "'Pb flux in the surfucjal
sediment from the core is 2 times iower than the
reported values (Lewis 1977). The mean global
atmospheric "'Pb is ahnut 0.Ot65 Bq cmY with a
inventory of ahnut 0.53 Bqern". The mean
abnospheric flux of "'ph in Mnmbai is about 0.025 Bq
em' y~'with an inventory of about 0.80 Bqcm'. Lewis
shows that "'Pb eflectivcly retained by the soil and its
removal is very low JrnI)'result in tbe lower mean ""Ph
flux becansc of preferential attachment of "'pb witbsoil in catchment area. The varIation of "'Ph flux in the
creek ndght be caused by nearby watershed
The most meaningful comparison is obtained for the
flux ratio of stable lead and radio lead F./ F "'. bynonna1izing the excess Pb fluxes to the fluxes of radio-
lead, which have been corrected for decay, most
dillerences in sedimentation processes are eliminated
Both should have behaved physically and chendca1lysindlarly. Furthermore the "'Pb deposition appears to
36
Conclusionbe constant for a region and probably for a broad
latitude band and indications are that atmospheric "'Pb
and pollutant Pb are well mixed. Thereby making ""Pb
~'a usefu] tracer. Fig. 3 gives the flux rotio F.I F_"".
in the cores from different zones. The rAtio in the zone
3 might be considered close to hackground value
reminder representing various stages of anthropogenic
contrihution.
'-1
.~I
F. POII"d""dl"',"F"., .E'~"""PO"",,"II",",im'"'
Figj Comparison oJmlios F.IF"~Jo,,wes.from
diffenmt Weolions in Thone C,,'ek
Analysisof toxic and trace elements abundance in the
water colunm was carried out (Inter ageucy projectreport 1998) at three diflerent occasions i.e. in the
month of February, May and October of the same year.The variation of concentration found in these three
measurement in the water samples are 56.6 and < 10
J.lg/lfor Pb, <178 J.lg/lfor Cu, 55.6 J.lg/l and 6.3 J.lg/l
for Zn, 141 and 3 J.lg/l for Cr, 117 and 5 J.lg/l for Fe
and 58.6 and 11 J.lg/l for Mn. Total residence time inthe water colunm were estimated (Henson and
Gruendhng, 1977) using the water column contentdivided by total flux to the sediment, iterately averaged
over several residence times assuming the complete
mixing of the water column. The ,".uue of residencetime obtained show a low residence time for the Fe and
Mn followed by Pb and Cu.Which is consistent with the
assumption that particulate are main sequestering
agent. A high residence time for the Cr and Zn wasobtained.
The data clearly shows that several chemically distinct
events have effected Thane creek and the timing of
these events was reasonahly well defined .The intensity
of deposition chronology diflers in three zones. The
observed pattern of variation in the concentrations of
Pb, Zn, CU,Cr, Mn found greater than the sediments
from non-polluted areas. The increase in the
deposition rate of toxic elements above natural level
may he due to local Industrial effiuent discharge fromIndustrial helt of Thane Creek.
References
1. APHA, (1985). Standard methods for theexamination of water and wastewater, Part 703,
American public health association, Washington
DC, 1985.
2. Bhosale U. (1991). Heavymetals pollution around
the Island City of Bombay, India. Chemical
Geology90: 285-305.
3. Bryan, G.W. and Langston, W.J. (1992).Bioawtilability, accumulation and effects of heavy
metals in sediments with special reference to
United Kingdom estuaries: a review. Environmental
Pollution 76, 39-131.
4. Henson, E.B. and Gruendhng, G.K. (1977). The
tropic status and phosphorous loading of lake
Champhtin. EPA Ecological Res. Series No. EPA-600/3-77-106.
5. Lewis, D.M. (1977). The use of ""Pb as a heavy
metal tracer in the Susquehanna River system.Geochim. Cosmochim. Acta 41,1557-1564.
6. Matsumoto, E. and Wong, C.S. (1977). Heavymetal sedimentation in Saanich Inlet with ""Pb
technique. J. Geophys. Res. 82, 5477-5481.
7. Mirajkar P., MoHyR, Kulkarni V.V.,Bhosale V.M.
and Krishnamoorthy T.M. (1995). Preliminary
studies on the distribution of heavy metals in
Thane Creek ecosystem in relation to industrial
effiuent discharges. Proceedings of 4' National
Symposium on Environment, Madrns, February1995.
8. Patel, B., Patel, S. and Balani, M.C. (1979).
Biological responses of a tropical coastal
ecosystem to releases from electro-nuclear
37
BARC NEWSLETTER Foundcr's Day Special l"ue 2001
insl2llations. Biological implications ofradionuclides released from nuclear iudustries
(proc. SymposiumVienna, 1979), IAEA,335-349.
9. Patel, B., Bangera V.S., Patel S. and Balaoi M.C.
(1985). Heavy metals iu Ibe Bombay Harbour
Area- Marioe Pollution Bulletin, 16, 22-28-
10. Report on Inter Agency Project, Assessment and
lIlWtIgement of heallb and environmental riskfrom industries in Trans Thane Creek area (India
casestudy),1998.
II. Jha S.Il, Krishnamoorthy T.M. and Pandit G.G.
(1997). Recent Sediment AccumuJation Rate In
Thane Creek Using'. Pb Teclutique. IAEA-SM-349,pp_15S-159.
12. Jha S.Il, Krishnamoorthy, T.M., Paodit G.G.,Narnbi
IlS.V. History of accumulation of mercury and
nickel in Thane Creek, Mumbai, using "'ph dating
technique. The Science of Ibe Total Environment
236 (l999a) , pp. 91-99.\3. ]ha SK, Chavan S.B., Pandit G.G., Krishnarnoorthy
T.M. and Negi B.S. (1mb). Hen')' metal gee-
accnmuJation paoern in coastal marine sediment
near Airoli region of Trans Thane Creek
procetalings of Ibe Eighlb National Symposium on
Environment, Kalpakkam. 26-28.14. Turner, DR. The chentistry of metal pollutants in
water. In:Harrson RM, editor. Poliution:Causes,
eRects, controls. Cambridge: Royal Society of
O1emistry, 1990:19-32.
About/lteaulllO's... '.' "< '" ,<,'/(
Dr, s, K Jha joi",d Envirom"""Ia/
Asseswuml DIvision (£AD), /WIC, aftercompleting his MoSc. In hunganlc
Cbem;,/ry from Patna lJn"-'sity and
after g=hmJing througb BAR.C.Tnnning Sd>ooI in 1988. H;, ..nJer
""'* on pbysiro-cbem/co1bebavW", of
"'NP in mari", environ_1 earned b;,Pb.D. from Mumbol University. SttWe lben, Dr Jha bas cornedout extensiw "'eo",b w",., on many ",peets ofenviron_tat problems using Nuc/ea, Anotytlco1 Techniques.
AI preren~ be ;, wor/dng on sedJ_tation 01Ie, beboviou>-and Jh=s of dlffenml po/IuIanJs affectIng marl",
environmenl ofMumbal city- H;,fteId of In- o1sc IndoMs
use of nudsm tecbniques for mooltaring of - and ""'"elements In diffenml environnumtat samjJks.
Dr. (Ms) G. G. Pandit fol",d £AD, In
1981 after graduatlngfrom 24' hatch of/WIC Trolnlng S<hao1 $be oblalmid
MS<. (o.ganic CbemU/ry) fromlJn"-'sityofMumbailn 19fKJandPb.D.
(-J from Un"-'sity of MumbalIn 1990 for her tbes/s entttkd 'Source
Recondl/atlon of _beric Hydrocarbon". Herspecta/Ualwn Inctwks _toP_I and slamlord/zation of
melhmlowgies fo, monitarlng of vorious m-ganlc ponulantssuch '" vokotik organic compounds (Voes), potycycllcoromatlc lrydrocmbons (PAlls) and orgono cb/orl", pesilckks
in /be diff- environnumtat-- AI preren~ she ;,
w",.klng on characterization and risk assessment of persistent
°'8°nlc ponulan" (POPs) In 1",100, and outdoor aerosols and
In c"",tat marine environ_to Her /kid of in",",sl also
Inclwks speciation of mercury in marl", envfronmenl.
Ms £ B. Cbavan joimid £AD, in 1998 ajla-
completing her graduation In Pbysics fromMum/rai lJn~ty. $be " <1SStJdatedwltlr use
of nuc/em and ,.fald techniques (EDXRFandlNM) 10' the measumrnmt of toxic and troro
ew-ts of environmental sampks. At
p,.senl, she ;, working on geacbem/co1 peculiarities ofsedi_" In lbe c=tol marl", environmenl around Mumbai
dty.
lh'. B. £ Negijoirnid/WICln l'J69ajla-
rornpkting one year training OOUI'SQofTrolnlng Division. He oblalmid ph.D.
degn<efrom Mumbal University In 1988.He bas been associated with the_topmenl and use of nuc/em and,./awd tecbniques (EDXRFand lNAA),systems for /be measunmumJof kJxic
and In"'" elements of environmenJa/ samples (ai,parliculotes, solI, fly ash, roo/, eIc.) and sta1ist/co1 an4lysis of/be - to identify po/bJtton scnuces. lk ;, o1sc Involved inlhe R & D actIvIties retold 10 the onland and moo made
,adlonuc/ides In environ_tal sampks like air fillers, dryand wet deposition samPks collected at vorious s"'"PlingstatIons spread aD over the country and anoiysed at low kwt
rodIoactivity measunmumJ Ia/roratary of £AD. The laborotory
ts being upgraded under his supervision wIJ/r advance '1-
tobondJe_cboIlengesln/bejkld
38
Encapsulation, Characterization andCatalytic Properties of Uranyl Ions inMesoporous Molecular Sieves
K. Vidya, S.E. Dapurkar aud P. SelvamDep",rnem of Chernimy.lodi,o [""i.." ofT~hoology, Murnb,i
aud
S,K. Badamali, D, Kumar aud N.M, GopraAppliedChernimy Divi,ion,Bh,bM A,orni, R"e"oh Cenoe
Abstract
Occlusion of u,anyl ions (UO,") in the chanlW~ of mesopo'ous MCM.41 and MCM.48 ITWkcula, sieves was
accomplished using di,"ct template ion.exchange method, and the sampks wm cha,acterized by XRD, FUR,
DRUV.VIS, and fluo,"scence spectmscopy. A shift ia u=o st,"tching IR band (LlY = -]4 em-'), and the
appeamnce of brand and diffused bands in tbefilMescenee spect,a (48a-620 nm) of the UO,"- exchanged
samples indicate a definite ekctmnic interaclion of va," species with the silicate (""i-O-) surface. This
hiferenee is coN'Oho,ated by DRUV- VIS ,"sults. Cakinalion in ai, / N, at 820 K ,"suited in the foNOOlion of
weD-dispersed a-U,ola-U,o. lTWieties, accompanied by a mal'gina/ decrease in the concent'ation of VO,"
gmups. The binding of VO," species to mesopomus materials framewo,k ~ilWd intact even after
cakinalion. The ITWkcula, sieves Waded with omnium oxide species showed app,"ciabk activity, both fa, the
oxidation of co and fa' ndsmption/decomposilion of CHpH.
Introduction
,POROUS MOLEClJLARSIEVES HAVEreceived wide attention because of their
diversified applications as shape selectivecatalysts, adsorbents, ion-exchangers and also inremoval nf heavy metal ions, radionuclides andorganics from effiuents [1-3]. The well defined(tunable) pore sizesand the large pore openingsofthese molecular sieves render them unique hostmaterials for occlusion/anchoring of large moleculesor that of reactivemetal complexesin their channels.
The incorporation of specific functional groups ontothe wallsof the channelsin thesemolecular sievesthns
serves as an important step In heterogenizing thehomogeneouscatalyst;')'Stems. In considerationthaturanium (i.e., uranyl ions or uranium oxides) mayserve as promising oxidizing catalyst owing to itsvariahle valencestatesvis-a-visvacantforbitals [4,5],
we haveattemptedthe encapsulationof uranyl species(VO,") in the mesoporesof hexagonalMCM-41andcnbic MCM-48molecular sieves. Theemphasiswas to
achievea well-dispersedcatalystsystemfor oxidationreactions. Earlier studies in this direction concern
dispersion of uranium oxides over dense oxide
supportssuchasAI,O" TiO" SiO,MgO,etc. [6].
In the present investigation, we adopted a directtemplateion-exchangemethod [7J for the entrapment
39
BARe NEWSLETTER Founder's Day Special !SS"' 200!
of uranyl species (UO,") in the mesopores of MCM-41
and MCM-48silicates. The samples in the as-synthesized, as-exchanged and corresponding calcinedronns were characterized by varions techniques such
as X-ray dil!raction (XRD), induced coupled plasma-
atomic emission spectroscopy (ICP-AES), foorier
transform infrared spectroscopy (Fr-IR), diffnse
re.tlectance ultraviolet-visible spectroscopy (DRUV-
VIS), and flnorescence spectroscopy. The catalyticperformance of these materials was evaluated for
model reactions, viz., oxidation of GO and
adsorption/decomposition of CH,OH over
temperature range 373-773 K.
Experimental
SyntbesisofMCM-41 andMCM-48
The mesoporous MCM-41 and MCM-48 silicates were
synthesized hydrothermally as per the procednre
described elsewhere [8,9]. The typical gel (molar)
composition was 10 SiO,: I.35(CTA),o : 0.75(TMA),O
: I.3Na,0 : 68011,0for MCM-4I,and IOSiO,:3.0(CTA),0 : 2.5Na,0 : 6OOH,O for MCM-48. The gels
were crystallized in tefton-lined stainless steelautoclaves at 373 K for I and 3 days for MCM-41 and
MCM-48, respectively. The solid prodncts ohtaioed
were washed with distilled water severn! times, filtered,
and dried at 353 K, and were designated as as-
synthesized samples.
Preparation ofUD,"- exchangedMCM-41 andMCM.48
The entrnpment of uot ions in the mesoporonsmaterials was carried ont by contacting I g sample of
as-synthesizedMCM-41or MCM-48 with 80 ml ofaqueons uranyl acetate solution (0.035 molar) at a pHof 4.0, under constant stirring at 323 K. Different
loadings of uranium were achieved by varjing contact
time, 12-54 h. A saturation loading of 00," ion wasreached in around 20 h time using hoth as-synthesized
MCM-41 and MCM-48. The latter, however showed a
higher saturation uranium uptake (- 53 WI % ofuranium as metal) compared to MCM-41 (43 WI %).
The details can be seen elsewhere [ 10]. For the
experiments carried out in the present study, the
samples with the saturation uranium loading wereutilized. The solid mass after decantation was washed
repeatedly, fnllowed by filtration and drying at 353 K
for 5 h. The 00," - exchanged samples were calcined
first in N, for 1-2 h and then for 6 h in air at 823 K.
The eftect nf calcination in N, on the nxidatinn state of
occluded UO:' species was also evalnated.
Characterization
Powder XRD patterns of the ion exchanged and
calcined samples were recorded in 28 region nf 1-10'
on Rigaku diffractnmeter using a nickel filtered Cu Ka
radiation. The scan speed and step size was 0.2' min-'
and 0.02' respectively. The dil!raction patterns were
also recorded in higher 28 region (10-&) in order
to identify the bulk uraninm phases. Fr-IR spectra in
mld IR regionwere recordedon a JASCOmodel-610spectrometer at a resolution of 4 em" and nsing 6 WI%
nf a sample in a compressed KBr pellet Fnr eachspectrom 100 scans were co-added. UV-fluorescence
spectra were obtaioed on a Hitachi, F-4500fluorescence spectrophntometer, using amonochromated 310 nm radiation for excitation and a
UV-35 filter to cut off this radiatinn in emlssion
spectrum. DRUV-VISspectra of uranium containing
samples were recorded nn a Shimadzu UV-260
spectrophotometer.
The catalytic activity was determined in pulse mode
using a tubular quartz reactor (8 mm o.d.) in a
temperature range of 473-773 K and at ambient
pressure. A catalyst charge nf ca. 150 mg was loaded
in the reactor in between quartz wool plugs. While thecatalyst was maintaioed under He flow (30 ml min'),
successive pulses (500 ~ each) of feed mixture
(GO:O,= 2:1) were introduced at a desIredtemperature. In the case of experiments involving
methanol decomposition, reactant feed mixtore was 9
vol% of methanol vapor in argon. The time interval
between two poL,es was around 30 min. Prior to the
run, the catalyst was activated at 623 K uuder He and
0, flow. A Chemito model-8510 gas chromatograph,equipped with thermal conductivity detector and
Porapak-QS I SperOC3l'bcolomo, was employed for on-
line analysis of the reactant and prodoct species.
40
Results and Discussion
XRDstudies
XRDpatterns of both as synthesizedand VO,hexchanged MCM-4I showed typical reflections 100,
110,200, and 21O in the range 2-5', characteristic of
MCM-4I [8]. Similarly, the XRD pattern of as-
synthesized MCM-48 and corresponding DO,"-exchanged sample showed two major reflections at 211
and 220, in addition to six minor reflections 321, 400,
420,332,422, and 431 In the range 3.5 to 5.0', typical
of MCM-48 [8]. However, a decrease In the intensity
of the reflections was observed in case of VO,"exchanged samples [1O] indicating a partial loss of
crystallinity. This could be attributed to the partial
hydrolysis of =5i-0-5i= linkages of the mesoporons
silicate network during the exchange process. Nodiffraction reflections due to uranium (bulk oxide)
phases were detected in the as-exchanged samples.
Upon calcination, weak reflections at d = 4.t5, 3.39,
2.62,2.07, 1.96, and 1.75 A were observed, which can
beindexedfora-V,O, OCPD5CardNo.24-1172).Theformation of this uranium oxide phase may be
attributed to the dehydroxylation of the uranyl
oligomers, followed by oxidation. It may be noted that
in addition to DO:' ions, abundance of other
hydrolysed species/oligomers such as (VO,),(OH):'
and (VO,),(OH);in uranyl solution has been reported
d
w.w,"""",""",,')
p;g. I INR speel'a a/MCM-4& as-synthesWd (a) UO,"-
",changed (b), and UO," exchanged and caldned (c). The
vaI",s tn penmthests indicate the abMban" """'s.
under the concentration and the pH conditions used in
the present study [11,12]. The samples calcined
exclusively in N, attnosphere indicated the formation of
a-V,O, (d = 3.43, 3.t3, 2.88, 2.71, 1.92, 1.63, and
1.54A;]CPDSCardNo.15-4).
FUR studies
Typical!'f-IR spectra of uuloaded, VO:'- exchanged,
and VO,h- exchanged and calcined MCM-48are shownin Fig. 1. Corresponding data for MCM-4I are shown
in Fig. 2. In the IR spectra, the absorbance values of
the selected bands are reported in parentheses for a
comparativeevaluationof their intensities. The IRbandsat -2922 and 2852 em' are typicalofCTA'(v,")group. The major bands appearing between
1230-459 em' are attributed to various stretching (v,
,,) andbending(8,.,,) frequenciesof =5i-0-5i=linkages. The band at 960 em-' is due to defect sites
(=Si-O X'; whereX'=Na',CTKorH'). Allthesebands are characteristic features of the MCM-4I and
MCM-48 silicate framework [13]. Au additionallR
band appearing at -902 em-' in the VO,h- exchangedsamples of MCM-48 or MCM-4I (Figs. Ib, 2b) tuay be
attributed to v 0-0stretching vibrations of uranyl species
[14J. The bands appearing at 1543,1460 em' (v_)
and 676 em' (8,,) are characteristic of tbe acetateions [IS].
dd
I
Wave,mmh" ('m')
Fig. 2FF-lRspectm a/MCM-41,as-synthestzed (a) UO,"-
exchanged (b). and UO,"- exchanged and cak;,wd (c).41
As reported widely [16], the UO," groups are lInear,
and in uranyl acetate they exhibit a strong absorptionband at -930 em" due to asymmetric u=o stretch; the
corresponding symmetric vibration expected at -856
cm"is observed only in very thick samples, It is well
documented that the u=o stretcrung frequency in aurAnyl compound changes with the ligand and a
reIationsrup exists between this freqnency and the u=obond distance [14], A red shift of - 30 em' in this
band, as seen in Figs, Ib and 2b, thus indicates a
perturbation of adsorbed uranyl ions, arising from
their bonding (through oxygen of uranyl group) with
the mesoporous framework, hence weakening the u=obond, On calcination, these bands are seen in the
nearly at the same frequencies when the acetate groups
are removed completely (Figs, Ie, 2c), The intensity of902 em' band, however, decreases marginally on
calcination (Figs, Ie, 2c), indicating that a part of
DO," groups transform to other urAnium oxides duringthe calcination process, as is evident from XRD data,
Fromthe relativeintensitiesof VC"at 2922 em' andv,~ at 906 em", as seen in an earlierstudy [10], it is
evident that the attachment of UO," ions isaccompanied with the progressive removal of crA'
ions, It may thus be inferred that the anchoring of the
uranyl group occurs via direct replacement of templateions, as is brought out in Ref. [10J in detail,
UV-Pluorescence studies
The UV-fluorescence study (Fig, 3) provides important
information regarding the form in wruch uranium is
present in the mesopores, Corves (a) and (b) present
the representative fluorescence spectra of UO,"-exchanged MCM-48 before and after calcination,respectively, For a comparison, the fluorescence
spectrum of ur.myl acetate is shown in inset. It givesrise to several well defined and sharp eutission bands
in the 47lf-590 nm r.mge, wruchare assignedtotr-.msitions between vibrAtional level of first excited
electronic state (v' = 0) to vibratiooallevels of ground
electronic state (v" = 0, I, 2, 3, 4, 5) of uranyl ions
[17J, On the other hand, UO,"- exchanged MCM-48
shows considerably broad and overlapping emissinn
bands between 484-620 nm (cnrve), Apart from that,
all the band positions are shifted to rugber wavelength,
"~~~
400 500 700600
Wavelength (nm)
Fig. 3 Fluo"""""" sf'€'l,a of MCM-4& ao;'- ,",banii'd (a)ao:-- ,"changed and cald""d (hi Excitalwn wavelength,3JOnm,
wruch is an indication of weakening of the uranyl
(U=O)linkages,TlUscan beenvisagedto happenas arcsnlt of an interAction of UO," ions with the silicate
(~Si-O- groups) matrix, as discnssed above, A
decre-JSe in the intensity of the emission bands after
calcination (Fig, 3b) is consistent with our IR data
suggesting the transformation of some of the UO,"
species giving rise to non-fluorescent uranium oxides,
the presence of wruch is also revealed by XRDdata, A
comparison between Figs. 3a and 3b show a small but
reproducible blue shift (/1),,=-7 nm) in the
wavelength of the ennitted mdiation after calcination of
the as-exchanged sample. TlUs could be tentatively
ascribed tn their less constrained environment after the
removal of template ions. Further, as in case of IR
result, sinalar fluorescence behaviour was observed in
the UO,"- exchanged MCM-41 samples.
DRUV- VIS studies
The DRUV-VlSspectrA of UO,"- exchanged MCM-41
and MCM-48 areshown in enrves a and c of Fig.4,
42
I.)
Id)
10)
Ib)
700
Fig 4 DRUV-VISsjJe<t'aof UO;'- ",changd MCM-41 (a),UO:'-",chaogedand rnldnedMCM-4l (b), UO:'-exchaoged
MCM-48 (e), UO,"- ",changed and calcined MCM-48 (d), and
.,anylacetawdibyd,awM,
respectively, For a comparison, the spectrum of uranyl
acetate is ineluded (curve ej, which shows thecharacteristic structure due to electron-vihration
interaction, typical of VO," moiety [18], The distinct
structure of the uranyl spectrum with sharp bands isascribed to definite transitions from electronic leveLs
coupled to o=v=o vibrations [18], The comparisnn
of spectra nf the VO,"- c)<cbanged sample with that of
nranyl acetate reveals that the VO," exchangcd
samples also exist in the hexavalent state in the form of
VO," species, It is also observed that the spectra of
VO,"- exchanged samples may be attributed to the
bonding of =Si,O' units to linear o=v=o molecules in
the equatorial plane forming a ucanate type of localstructure, similar to an observation reported eLsewhere
[18], Figures 4b and 4d show the DRUV-VlSspectra of
VO,"- exchanged and calcined MCM-41 and MCM-48
samples, It is observed that the maximum appearing at
-430 nm in VO,"- exchanged MCM-41 shifts to a
shorler wavelength in the corresponding calcinedsample (-42Inm), Similarly, a shift from - 430 tn
-424 nm is observed for the VO,"- exchanged MCM-48. It has been generally agreed that the nature of blue
shift of the visible and the near infrared bands may be
taken as a measure of the metal-ligand covalent
bonding [191, This hypsochromic shift seen in Figs.4b and 4d could therefore be taken as a refle<:tionon
the stability of the VO," species in the mesoporous
matrix due to a strong interactioo between VO," and
the =Si-O- sites, as mentiooed above.
Catalyst tKtivity studies
In order to evaluate catalytic activity of the uranium
containing mesoporous molecular sieves, two model
reactions, vi", oxidation of CO and adsorption /
decomposition of CH,OH were chosen for study overthe temperature range of 373-773 K. Typical results
obtained for uranium containing (53 wt %) MCM-48
are presented here in brief,
70
60(b)
50
~ 40d0§ 30~§ 20u
10
300 400 500 600 700 800 900
Tempem!", , (K)
Fig, 5 Catalytic oxidatioo of co """' MCM-48 (a) and UO,"-
",changedandrnidned MCM-48 (h),
43
BARC NEWSLEITER Fonnh's DoySpecio/ Issue 2001
co oxidation: The 1mU1iumcontaining MCM-48
showed considerably high catalytic activitycompared to
hostMCM-48,as shownin dataofFig.5. Around60%of CO dosed in a pulse over uranium containing MCM-
48 converted to CO,at a temperature of 770 K (curve
b), the corresponding yield over host MCM-48 being
less Ihan 10 % (curve a). Also the activity onset
temperature is relatively low in the 1mU1iumcoutaining
molecular sieve. This oxidative activity can be
aDributed to the definite role of vot ions and/or
oxides for the conversion of CO to CO" in agreementwith the literature [20J.
-- - ;
to
~. 6]:;- 40;:;:
0 I -, '. . , I
L500 600 700 gr;; I
-- Temperature ~ -.JFig 6 Reaction products Joo-nwd on exposure oj mEthanol
potses over "0,"- exchanged and co/doodMCM-48 0) CO" b)
CO, mule) CH,
Melband adsorplwn/deromposilion : A higheramount of methanol was adsorbed/reacted over
uranium containing-MCM-48 compared to the hostmatrix. While uo umeacted methanol was eluted wheu
successive 6 to 7 pulses of methanol (14.8I'mol each)were dosed over 1mU1ium loaded sample at
temperatures in range 470-770 K, about 25,11, and 5
volume percenl of methanol was eluted from each of
these pulses, when introduced over MCM-48 at
temperatures of 470, 570, and 770 K,respectively. The
reaction prodnct' were also dilleren!. Thus, whilereaction over MCM-48 predominantly gave rise to
formation of dimethyl ether (- 1.7 mol %) at
temperatures above 670 K, the reaction products over
uranium containing MCM-48 were CO, CO, and CH,.
The product distribution for reaction of CH,OH overur.mium containing MCM-48 as a function oftemperature is shown in Fig. 6- The dillerence in
catalytic behavior of two samples can be attributed to
the dillerence in the catalyst nature. In case of MCM-
48, due to the presence of weakly aridic 5Si-OHgroups, the products obtained are catalyzed by an acid
pathway. On the contrary, in uranium containing
MCM-48, the reaction is cataiyzed by an oxidativeroute, yielding CO, CO" andCH.121J.
Conclusions
In the present investigation, the successful entrapment
of VO:- ions within the mesopores of MCM-41 andMCM-48 is demonstrated. MCM-48 was found to be
trapping higher amount of VO:- ions Ihan MCM-41.
Under the experimental conditions, it was observed
that both MCM-4I and MCM-48 sufler a partial loss in
crystallinity, even though the structure does nol
coUapse. Both FT-IR and fluorescencestudiesindicated the binding of VO:- ions onto the silicate
surface, possibly via an interaction betweeo =Si-O- and
the VO:- ions. Upon calcination, VO:- moieties are
partly converted to 1mU1iumoxide species (a-V,O,! a-
U,O,), which are dispersed within the mesoporonsmatrix. Further, the results of cataiytic oxidation of CO
and adsorption/decomposition of CH,OH indicate that
the entrapped VO:' ions and/or oxides may serve as
potenllii1 candidates for the selective oxidationreactions. Further study is in progress to corroboratethese claims.
Acknowledgements
Authors thank Mr. S. Varma, Mr. B. Dhavekar, Ms. M.
Artita and Ms. M.R Pat for their help in recording FT-
lR and fluorescence spectra. This work is supported
by the Board of Research in Nuclear Sciences,
Department of Atomic Energy, Mumbai under aContract No. 98137131/BRNS/1049.
References
1. Stein, B.J. Melde, RC. Schroden, Adv. Mater. 12
(2000) 1403.
2. K.Mollcr, T. Bcin, Chern. Mater. 10 (1998) 2950.
3. A.Corma, Chern. Rev. 97 (1997) 2373.
4. C.A. Cohncnarcs, Prog. Solid State Chcrn. 15(1984) 257.
5. Collette, V. Dcrcmincc-Mathien, Z. Gahelica, J,B.
Nagy,E.G.Derouanc ,J.J. Verhist, J. Chern. Soc.,
Faraday Trans. 83 (1987) 1263.
6. H. Collette, S. Maroie, J. Riga, J.J. Vcrhist, Z.Gahcllca, J,B. Nagy, E.G. Dcrouane, J. Catal. 98
(1986) 326.
7. S. Dai, Y. Shiu, Y. Ju, M.C. Burieigh, J-S tin, C.E.
Barnes, Z. Xue,Adv.Mater. 11 (1999) 1226.
8. J.S. Beck, J.C. Vartuli, W.J. Roth, M.E.Leonowicz,KD. Schmidtt, C.T.-W. Chu, D.H. Olson, E.W.
Sheppard, S.B. McCullen, J.B. Higgins, J.L.
Schienker, J. Amer. Chern. Soc. 114 (1992)10834.
9. S.E. Dapurkar, S.K Badamali, P. Scivmn, Catal.
Todny,68 (2001) 63.
10. K Vidya,S.E. Dapurkar, P. Sclvmn, S.K Badnmali,N.M.Gupta,Microporous MesoporousMater. (reviscd).
11. C.R. Ro, D.C. Doero, CanadnJ. Chcrn. 63 (1987)
1100, and references cited therein.
12. R Amadelli, A. Maldotti, S. Sostero, V. Carassiti,J,
Chern. Soc., Faradny Trans. 87 (1991) 3267.13. cor. Chcn, H-X, ti, M.E. Davis, Microporous
Mater. 2 (1993) 17.
14. K Nakamoto, IniIared and Rmnan Spectra of
Inorganic and Coordination Compounds, JohnWilcy &Sons, New York, 1978.
15. S.V. Ribttikar, M.S. Trtica, J. Serb. Chern. Soc. 63
(1998) 149.
16. E. Rabinowitch and RL. Belford, " Spectroscopy
and Photochemistry of Uranium Compounds",
Pcrgmnon, Oxford, 1964.17. S. G. Schuhnan, " Molecular Luminescence
Spectroscopy Methods and Applications: Part I",
John Wiley& Sons, New York, 1985.
18. L. Sacconi, GJ. Giannoni, J. Chern. Soc. (1954)2368.
19. C.K.Jorgensen, Prog.lnorg. Chcrn. 4 (1962) 73.20. F. Nozaki, I. [nami, Bull. Chern. Soc. Jpll 45
(1972) 3473J.M. Tatibouet, AppI. Catal. 148
(1997) 213.
Oraip,.e;=t/o~'A;ard by a research s<bola'ft;1,1"Indo-Padjk CatalysIs Symposlum,january
Aboullb.autb""..." , -" . " ..-.
Narendra Moban Gupta (Ph.D. in Chemistry, Agra University) joined BARC in 1966 through l' batch of
Training School Since then he has contributed to a numher of basic research and deveifJpment related
areas of catalysis, surface science and solid state chemistry. He was President of the Catalysis Society ofIndia (1995-1997) and also served as a member of international Catalysis Congress for a term 1996-
2000. He is on various important official committees of BARC and was also responsihle in the
organization of a number of symposia and conferences on the subjects of Catalysis and Wafer Chemistry.
He bas more than 125 publicationsand2 hooks to biscredit. Presentry, DrGuptaisiksignatedasHend,AppliedChemistry
Division, BARC.
DarmeshKumar (M.Sc. Chemistry, UniversityofMumhai) isa research schatar (DAEfebshiP), working
in Applied Chemistry Division since February 2000 on a project "Preparation, Characterization and
Catalytic Properties of Modified Molecular Sieves".
Dr Sushanta Kumar BodamaJi (Pb.D. Chemistry, ll~ Mumhai) works in Applied Chemistry Division as a
Dr KS. Krishnan Research Associate-2000 (DAE-ERNS). His researcb interests include deveifJpment of
meso porous molecular sieves for catalytic applications and bast-guest chemistry.
45
BARC NEWSLEITER Found,,'s Day Speeim/ssue 200/
Molecular Dynamical Simulations of theHigh PressureTransformations in aCristobalite - SialNandini Gatg and Surinder M. ShannaHigh P=ure Ph"i" O1vi,iooBh,hh, A'omic R"",ch Ce","
Abstract
Stalic and dynamic blgb pressure experiments reveal tbaJ the hebavWur of a-cristoba/i/e SiD, tkpends on the rate of
stress Wading. To understand tbis hebavlour we bave carried out extensive trWlecular dynamIcs simulations. Tbe
response to sbock Wadlug was simulated by raising the pressure and temperaJure simnllaneoustr and instantaTwonsiy
to the expected Hugonlot valtiIJs. Shock simulations aIang the Hngonlot patb of porous cristoba/ite revealed tbaJ alpha
cristobalite transforms to a new six coordinated crystalline phase beyand 16 GPa, 14/03 K Tbts transformation to
the crystalline phase is very sluggisb and proceeds via a disordered phase. Our simulations show tbaJ hetween 16 GPa
and 18 GPo, even after equilibraling for a very long time, the disorder persists. On SJJdden release of pressure, tbis
disordered state is retained In agreement witb the experimental observations under sbock conditions.
SiliCAANDITSPOLYMORPHSARE IMPORI'ANT
geological materials found abundantly in the
earth's IlliUltle and therefore the high pressure!Je!LavjQII1"of these compounds is of considerable
importance. At low pressures. most of these mineralsexist in comer linked framework structures and
display a typical intrinsic behaviour of S1-0 linkages.
CristobaJite, the minecal of interest in the present study,
is a high temperature polymorph of silica and is often
found in volcanic rocks. lIS idealized structure at high
tewmperatures is cubic (P-phase) which, on lowering
the temperature, completely and displacively converts
into a tetragonal form (a-phase, also called lowcristobaJite).
High pressure behaviour of a cristobaJite displays
distinct differences when it is subjected to shock' and
static' pressures. Graiz et ai' observed that when
powder specimens of a-cristobalite were shocked to
28.2 GPo, the recovered samples were almost
completely amorphous. However the specimens
shocked to pressures lower than 22.9 GPa retained
their origimd structure'. In contrast, under static high
pressures, depending on the degree of non hydmst:!tic
stresses present, low cristobalite displays several
intermediate aystaIJine ~ aystaIJine phase
transitions. In a hydrostatic environment it transforms
from alpha to a 'slishovite like' phase at 18 Gpa'.
Theoretically the high pressure behaviour of a-
cristobalite has been investigated by molecular
dynamics simulations (MD)" and toed energycalculations'. MD calculations of Tsuneyula" et aI
showed that a-cristobalite, transforms to an
orthorhombic phase (Qucm) at 16.5 GPa whichfurther transforms to stishovite at 23 GPa. However
neither of these theoretical studies imply a pressure
induced amorphization of cristobaJite.
To understand the atontic mechanism of some of these
structnral phase transfornt:!tions in cristobaJite under
high pressure we hase carried out det2iled MD
simulations. Our simulations are likely to be morerealistic and less sensitive to MD cell dimensions as we
use a large macroceU having an order of magnitudemore atoms than used in the earlier MD studies
Molecular dynamical simulations (MD) presented here
46
were carried out using a mudified" Nose-Hoover (N, P,
T) algorithm for variable cell size and shape.
Equations of motion were integrated every 2 fs usingVerle!'s algorithm. The MD cell was considered
equilibrated when the fluctuations in temperature,
pressure, volome and total energy of the system were
iess than 0.001%. To minimize the effect of periodicboundary conditions most of the simulations were
carriedoutusinga largemacrocellhaving8x8x6 unit
cells of a-cristobalite (4608 atoms)" The stuiing acristobalite structure (P = 0.1 MPa and T = 300 K)
was obtained hy equilibratiog the experimeotallyknown coordinates of this structure" At each
temperature and pressure the system was equilibrated
for - 40ps and the atomic coordinates, volume and
pressure of the macrocell were averaged over several
thousand time steps. However at pressures and
temperatures where a phase trdllsformation takes
place, equilibration was curried ont until thethermodymurOc quantities converged.
For representing the hehaviour of shocked samples,
simulations were carried out at P and T corresponding
to the shock Hugoniot of porous a-cristohalite. P, T
along the Hugoniot were calculated using jump
conditions with the initial density of the samples as1.44 gm/cm' which is same as in the samples used by
Gratz et al'. These simulations were carried out usingthe BKS" pair potentials. In these simulations, the
temperature and pressure were suddeuly raised to the
reqnired value. Table 1 gives the summury of P and Tconditions at which simulations have been carried out.
Also to make a contact with the results of recovered
samples after shock loading one must evaluate the
effect of residual temperatures on shock relense. In
the absence of knowledge of these residual
temperatures we arbitrarily reduced the P and T at c
anddto 0.1 MPaand T = 1200K, 1000 K,500K
Table 1 Simulation conditions along the Shock Hngoniot
10.013.416.318.119.920.922.4
T956.1
1196.61410.11542.61682.91755.91869.1
Release
47
BARC NEWSLElTER Found,,',.Day Special ["ue 2001
Results and Discussion
As mentioned above, the shocked state was generated
by sudden increase of pressures and temperatures tn
the values expected in the experiment. As the
experiments were carried out on powder samples it isreasonable to treat the material as being under
isotropic press]lfe. In a sense this simulationrepresents the effect of mean stress loading and thus
ignores the effect of the deviatoric stresses if any. Evenin doing so there is no way to ensure that the
thermodynamic variables P and T in the simulationsiocrease in the same manner (revebrations) as in the
experiments". In this sense the present resuits shouid
be taken to represent the gross features rather than the
quantitative measure.
Simulations were carried out at a few representativemes of pressnres and temperatures listed in table 1.
Below the point c (p=16.3 GPa, T= 1410.1 K) the
macrocell equilibrates reasonably fast and the
crystailine state continues to exist in the ex.phase.However at c and d, (16.3 GPa, 1410.1 K and 18.!
GPa, 1542.6 K) the ex-phase evolves very slowly to the
new structure. It took - 750 ps for the new structure
to stabilize. This new cI)'talline structure as well as all
the other eqnilibrated structures beyond the point c intable 1 have six Si-Q coordination. However various
structures differ from each other in terms of the
crystalline order. Also the time taken for the final
states to equilibrate reduces significantly at P, T points
higher than d. For example, at 22 GPa, 1869 K
eqnilibration could be achieved in - 60 ps.
The final state at 16.3 GPa, 1410.1 K had a disordered
Cmcm structure despite equilibrating for a very long
time. This is shown in Fig.1(a). However it was
observed that on equilibrating the system well beyond500 ps there was the emergence of a disordered
stishovite like phase. This phase continues to remaindisordered on release of pressure and after annealing
at the residual temperatures of 500 K and 300 K. The
diffraction patterns were computed for all these
different thermodynamic conditious. It was observed
that the disorder in the Cmcm structure at 16.3 GPa,
1410.1 K increased on release of pressnre, which was
indicated by a significant increase in the diffused and
non Bragg Ukc scattering observed in the computed
diffraction pattern. From these simulations it is evident
that at these temperatures and pressures there areseveral phases with comparable energies. Once the
structure goes into the disordered stishovite phase it isnot able to attain the ordered stishovite like structure
even on eqnilibrating for a long time. Since in shock
experiments the sample is subjected to the peakpressure only for a few micro seconds, the material
may not have sufficient time for the emergence of the
stishovite phase. Therefore these results may be taken
to correspond to the amorphous phase observed in the
shock experiments. These simulations also show that
00 release of pressure and tempemture, the disordered
phase has 5.2 SI.O coordination. However it is
possible that if this recovered disordered phase is
annealed at a higher residual temperature, this Si-Q
coordination may revert to fnur fold.
Fnr thermodynamic conditions beyond d (l8.! GPa,
1542.6 K), the eqnilibrated states display theemergence of crystalline order. Though all these
pha,es have six Si.O eoordioation, the degree of frozen
disorder decreJSes from e to g (Table 1). Figs. lIb)
and 1(c) show the results of simulations at 19.9 GPa,
1682.9 K. The eqnilibrated phase when projected on
(100) plane shows almost perlect order. However
when projected on (000 plane, one can discern the
remnants of disorder. The cI)'talline part of this phaseis 'stishovite like'. At still higher P and T (22.4 GPa,
1869.1 K) the remaining disorder reduces dmmatically
as shown in Fig.1(d). Here also the crystalline phase is'stishoviteUke'.
Under compression, particularly the non-bonded
atoms, cannot be brought closer than some limiting
value without an excessive cost in terms of energy.When the energy of compression of these distances
become comparable to the cohesive energy differences
between the structures, the initial structure becomes
unstable. A survey of large number of materials
indicate that the extreme limiting value of 0---0 is 2.6A. It is imeresting to note that just before the transition,
the sites at which the transformation is triggered, werethose where the non bonded 0...0 distances were -
2.42 A I.e lower than the extreme limiting distance.Therefore, our simulations show that the nucleation for
the phase transformation starts at the sites where 0-..0
distances arc highly constrained.
Found,," Day Speciall"ue 2001
(0) (100IviewolI4I0K, 16:3 GPo
(,) 11001-011682.9K, 19.9 GPo
(b) 100 II view 01 1682.'JK, /9.9 GPo
Figl Stmclu", aflhe new pho", 01 diff","1 P, T along the ,bock Huganial
(d) [0011-011869.1K,22.4GPo
(0) lOp. (b) 22P'
49
(c) 24p,
BARC NEWSLETTERFound"'s Day Special Issue 2001
(d)26ps
Analysisof the evolutionary history of Fig.lb, Ie and Id
shows that IX-cristobalite transforms to this 'stishovite
like' phase through an intermediate disordered Cmcm
like phase. Fig.2 shows the structur3l evolution from
IX -phase to stisbovite as predicted in our simulations.
Fig. (2a) shows that at 20 1'5 the structure is alphaphase. One can dearly discern a bond making between
SI (silicon) and 05 (oxygen) and bond breakingbetween SI and 02 22 ps (Fig.2b). After a time
interval of 26 ps 02 and 06 coordinate to SI and the
structure then relaxes to almost perled order at 28 ps.
The struclUre is almost Cmcm at 24 1'5.It was seen thatafter the transformation was initiated at 22.4 GPa,
1869.1 K it was over within 8 1'5. These results show
that no diffusion is necessary to bring about a
transformation from IX cristobalite to stishovite phase
through the Cmcm phase. A slight local atontic
rearrangement is all that is needed to cause the
structural change.
Summary of the simulations at different thermodynamic
conditions has been plotted in FJg.3. It is clearly seen
that though beyond 16 GPa alpha phase transforms to a
disordered phase, and it transforms to a stisbovite like
phase beyond 18 GPa. The difference in the observed
and calculated pressure of amorphization may dep
end significantly on the pair potentials. In addition this
Ffg2 (0-8)
.I
~.(.)28ps
difference may also arise from the differences in the
rate of increase of pressure and temperature in two
different settings".
"00-
:- :::.':".:::: -\
,.,...'.......
....;:y.'<:;:-;;;",.;.' I
.'{,
;; ."",..i.! "'~
,/\
::/----- ,~0i "P~I."I
FIg.3 Slmu/aJIons cmrled out at /be ~'"' andjn"eSS#reSmarlted(4)( V) -/beBSllmatedP& Tfor/beexperlmenIs'
However qualitatively we have shown that alpha
cristobalite transfonns to a disordered phase when
subjected to sndden pressures beyond 16.3 GPa,1410.l.Itwasalsoobserved that in contrast with the
50
calculated behaviour of the disordered state at 18.1
GPa, 1542.6K, the stishovite like structure at 19.9 GPabecame tuore ordered when annealed at 1200 K, 1000
K, and 500 K after release of pressure. Calculated
Bragg peaks are found to be the sharpest after
annealing at 500 K. These predictions should
encourage more experiments on shock loading of
cristobalite to higher pressures.
Acknowledgements
Authors acknowledge many useful suggestions anddiscussions with Dr. S.K.Sikka.
Bibliography
1. A.J. Gratz LD. DeLoach, T.M. Clough and W.J.
Nellis. Science, 259:663, 1993.
David C. Palmer and Larry W. Finger. Amer.
Miner., 79:1,1994.
Though the x-ray diffraction TEMand SEMstudiessuggested no amorphization below 22.9 GPa, the
Raman spectra of samples shocked to 18.2 GPaand 22.9 GPaalso indicated broad features.
Massaki Yamakata and Takehiko Vagi. Technical
report, [SSPUniversityofTokyo, 1996.
2.
3.
4.
5. S. Tsuneyuki M. Tsukada and H. Aoki. Phys. Rev.Lett., 61: 869,1988.
6. Shinji Tsuneyuki Yoshito Matsni Hideo Aoki andMasaru Tsukada. Nature, 339:209, 1989.
7. John S. Tse and Dennis D. Klug. J. Chem. Phys.,
95:9176,1991.
8. Nitin R Keskm and James R. Chelikowsky. Phys.
Rev. B, 46:1,1992.
9. M.B. Boisen Jr. and G.V. Gibbs. Phys. Chem.
Miner., 20:123, 1993.10. S. Melchionna G. Ciccotti and B.L Holian. Mol.
Phys., 78:533, 199311. We made a choice of 8x8 unit cells in the basal
plane to avoid bypassing the Cmcm phase.12. P.J. Heany C.T. Prewitt and G.V. Gibbs, editors.
smCA. Miner. Soc. America, 1994.
13. B. W. H. van Beest, G. J. Kramer and R. A. van
Santen, Phys. Rev. Lett. 64:1955, 1990.
14. In the recovery capsule of the experiments,
impact pressure is achieved through a
reverberating shock wave. Ouly 50 % of the final
pressure is achieved with the first shock wave. As
we used the single shock jmnp conditious to
simulate P and T, the temperatures used in the
present simulations may be somewhatoverestimated.
Ms. Nandini Garg did her postgraduation inPhysicsfromRavishanker University, Raipur, MP, in the
year 1989. She was the recipient of the university gold rrwdal for securing l' position in her MSc
examination. She graduated from the 3/' hatch of BARC Training School and joined High Pressure
Physics Division of BARC. Since theu she has heen working on high pressure phase transformations in
different materials.
Dr. Surinder M Sharma joined BARC through the 11' hatch of Training School. His research interests
are hehaciour of materials under static as wen as dynamic highpressures. He was awarded the Homi
Science & TecbtUJwgy award in 1996andMedai of Materials Research &Jciety of India in 1998.
5t
Biomedical ApplicationsElectroporationS. H. Sanghvi, V. W. Bedekar and K. P. Mish",Jc.di"ion BiologyDivbionBh,bha A<omicR"""h Cell'"
of Cell
Abstract
Application of high intensity short electrical pu~es to hlologlcal ceUs induces dramatic transientpermeahilization of outer membrane presumably by implantation of micropores. This aikJws incorporationof drugs, enzymes, antibodies and other molecules of interest into ceUsproviding a new pathway to cenloadingfor goal-oriented applications in cen biology,medicine and hiotechnology. More recently, membraneelectroporation has successfuny heen used to deliver anti-cancer drugs to certain tumor ceUsincluding thasekrumm to display drug resistance. Combined treatment of electroporation and chemotherapeutic drug totumor ceUsresults in enhanced kintng, which holds a promise in improving cancer therapy. Electricfieldinduced cen alignment and jUsion of ceUsin in vitro offers a novel technique to uchieve '!/ftcient cenfusion,which hasfouud application in monoclooal antihody production by byhridoma. In addition, electroporationbased gene transfer has opened a new approachfor genetic manipulation of a variety of hiological ceUs.Followingelectroporation seeeralprotein metabolites aud other small molecules hove been incorporated intoa recipient cen offering a potentialfor many biomedical applications.
Introduction
ELECfROPORATIONINVOLVESEXPOSURE
ells to brief high ioteosity electrical pulses,
;h produces dramatic transieut iucrease iu
membrane permeability allowiog entry of otherwiseimpermeaot molecuies/drugs ioto cell ioterior. This
has become ao important biophysical method for
introduction of a variety of exogenous hioactivemolecules into a number of cells. Electric fieid induced
increased membrane permeability is generally believed
to arise due to formation of ndcropores in the plasmamembrane, which are found to reseal within seconds
to minutes under cootrolled experimental conditions.Using human red celis, Chinese hamster ovary and
ascites tumor cells, we have demonstrated that
magnitude of induced membr.me permeability isgoverned by varioos factors sucb as fieid parameters
(e.g. voltage, pulse shape and duration ete.) cell type,
suspension medium, thermal conditions dnring and
post pulse incubatioos. Studies on electroporation of
normal as well as tumor cells are actively being
pursued in our laboratory including combination with
radiation and/or chemotherapeutic drugs. World over
research is rapidly progressing on electroporation of
marmnallao, plant and ndcrobial cells for fundamental
nnderstanding as well as for developing goal-directed
biomedical applicatioos. Present communication
briefly describes electroporation based emerging
technologies for practical applications such as electro-
gene transfer, electrodelivery of anticancer drugs intotarget tumor cell and electroencapsuiation of drugs.
Methodology and Instrnmentation
A Biological Cell Electroporator designed anddeveloped in our laboratory has been osed topermeabilizemarmnaliaocells such as erythrocytes,thymocytes, tumor cells etc., which providesexponentiallydecayingpulses of variableamplitudesand pulse dnration. The equipment is capableofdeliveringpulsesofvariableamplitudeswithpulse
durations ranging from microsecond to millisecond. A
prototype of square pulse generating facility has heendeveloped for more efficient electroporation, which is
currently under testing. Moreover, design work has
heen undertaken to develop a biphasic pulseelectroporator with operation in auto and manual
modes to achieve symmetrical poration of cells for
efficient tomor killing especially for in vivo tomormodel experiments.
A prototype cell fusion set up has been assembled to
investigate effects of various AC and DC field
parameters on cell alignment and cell fusion. Present
studies are limited to fundamental aspects of fusion ofred blood cells.
Electroencapsulation
In our laboratory electroencapsulation into human red
blood cells has been studied extensively, which has
potential therapeutic use in delivery of radio-labelled
and anticancer drugs into target organs. Encapsulation
stodies on electroporated mouse red cells showed that
injection of loaded red cells encapsulated technetium
99m or anticancer drug, methotrexate (MfX)
substantially concentrated in the liver (>70%) of
mouse suggesting a possibility of organ specifictargeted delivery of drugs. Results from other
laboratories have shown potential of
electroencapsulsted inositol hexaphosphate (IHP) in
red cells in improving tissue oxygenation duringcardiopulmonary bypass operation in patients with
respiratory problems. Another significant developmentin drug delivery in cardiology using loaded red cells is
encapsulstion of antiproliferative agent such as PGI2
with the goal of reducing restenosis after blood vessel
injury.
Electrogene Transfer
Membranepresentsa natoralbarrier for the entryofforeign molecule/gene into cells. Transientpermeabilization of membrane by electroporation has
opened a new possibility of introducing DNA/genesinto
a variety of cell. Success of tltis method in cell
transformation in vitro has been amply demonstratedand it has become a routine procedure in cellular
and molecular biological experiments. Considerable
research has been devoted to electroporation mediated
gene transfer in vitro and retuming the manipulated
cells to meet specific medical objective of correctingthe defects cells / organs of patients with certaindiseases. In western countries clinical triais are
undergoing to ameliorate bleeding disorder by deliveryof encapsulated defective factors IX and VIII in
hemophilia A & B human patients.
Electrofusion Of Erythrocytes
Usually two cells can be fused when they are brought in
contact by dielectrophoretic force, which aligns cells
into long chains called pearl chalns. This occurs when
weak but continuous inhomogeneous ACelectric field
is applied in an appropriate medium containing the
cells. Aftercells are aligned in tight cootact a stroog but
brief DC pulse is applied which induces cells to fuse by
the process of intermixing of electro-perforated
membranes. Experiments in oor laboratory have showothat for the same field conditions suspension of cells inisotonic sucrose and manitol solutions accelerated the
process of chain formation and increased the percent
efficiency of cell fusion. Pearl chalo formation is
quantitatively dependant on the AC field parameters
such as frequency, voltage and resistivity of suspensionmedium.Figure1 showsa typicalchaloof humanredcells suspended in isotonic manitol exposed to ACfield.
FIg! Human red ceUs suspended In manUol und subjet;/ed /0
AC!k1d. Freq. ,200 kHz, AmpUO vp-p
Electro-Delivery Of Anticancer Drngs
Combinationof electroporationand drugtreatmentoftumor cells called electrochemotherapyis a novel
53
BARC NEWSLETTER Founder's DaySpedol /ssue2()()/
approach for developing more effective cancer thernpy.
This method takes advantige of membrane
permeabilization by electric pnlses to facilitate the
entry of anticancer drugs into the target tumor cell.Under controlled conditions it has been shown
possible to electropermeahilize tumor cell membranemaking it more responsive to drug action both in vilroas well as in vivo.
Flg.2 _Ie "'fJrosentat/on oj drug and ekH:lropcralwotroalmenl w lu"",, ceO
In particular, electropornJion has been sbown to
facilitate uptake of bleomycin (BLM) into recipient
cells in suspension and in culture cells, BLM is a
cbemothernpeutic drug frequently used clinically in the
treatment of many solid tumo" and ntdignantlymphnmas. In clinic, therapeutic effectiveness of anti-
tumor drugs is lintited by the low drug uptake intotumor cells and eIIInx of drugs from the resistant
tumor cells. Therefore, a higher dose of drugs is
required to increase cytotoxicity in clinical practice formore effective cancer trealment. Researchers aim to
pontentiate the effect of anti-ancer drugs allow doseminimizing undesirable side effec1S.
Electrochemotherapy allows to reduce the total dose of
drugs considerably and perntits larger amount of drug
to enter tumor cells producing lrulXimumcytotoxicity.
It is hoped that further active research will enable
apply this techoology to human cancer patients,
Clinical trials using certain drugs are under progress in
several western countries for treatment of specifictumor.
Future Prospects
Cell electropornJion has moved from Iaboratoty to
practical applications. Electroporation research
continues to witness rapid advances in fundamental
undentanding of the phenomenon and emergence ofnewer techoologies for applicatious in biotechoology,
molecularbiologyand medicine.In virroresearchisdirected to determine and optimize facto" that
increase efficiency of membrane electropornJion.
Medical applications, among othe", are turning out
especially prontising. Clinical applicatiou of
electropornJion in cancer thernpy is reaching close topatient treatment and potential feasibility has been
shown in many other applications. However,
developmeut of suitable electrode applicators and
electropulse generato" for clinical settings remains a
cltillenge. Research on transdennaI electro-drng
delivety is beconting a hot topic in systentic and skinmedical research. Electro gene therapy, electro-cell-
fusion, electrosterilization of food, electro drug
delivety, electro-transformation of nticrohial cells are
some of the developing technologies based ou
membrane electropornJion. However, much remains tobe undentood concerning molecular mechanism of
membrane permeahiliazation, which evidently isnecessary for the success of preseut technologies and
further new developments.
'henJistry, 'ICa'flipUsTNe~~
54
Dr KP.Misbra joined Biomedical Group ofBARC in 1969 after graduating tbrough Ii' Batch ofBARC
Training School He obtainedMSc. degree in Chemistry fromAliahabad University in 1968 aad Ph. D.
from Gujarat University in 1979. His research interests involve investigations on free radical
mechanism of radiation damage to biolngical systems emplnying biophysical tecbniques sucb as
fluorescence, magnetic resonance techniques etc. He has extensively investigated radiabiolngical
and biophysical aspects of radiation oxidative damage to mammalian cells and their membranes
with an emphasis on fundamental mechanisms relevant to cancer radiotherapy. He has designed and develnped suitabk
liposomes for targeted delivery of anticancer drugs and radiolobelkd compounds to recipient cellsl diseased organs. In
addition, Dr Misbra has made significant contrihutions in undersianding tbe mokculor mechanism of celi membrane
ekctroporation emplnying indigenously designed and fahricated Biolngical Celi Eketroportor. Presently, be is Head of
Celiulor and Free Radical Radiation Biolngy Section actively pursuing research on radiation and ekctroporation indueed
cytotoxicity to normal and tumor cells with a goal to understand underlying mechanism of ceO kiUing for improving
cancer radiotherapy.
Mr S. H. Sangbvi joined BARC in 1961 in Ekctronies Division and acquired M. Sc. degree in Physies on
"Studies of quantitative ekctromyographic signals in musck from diagnostic consideration" from
Mumbai University in 1980. Design and deselnpment of biomedical instruments has been his major
research interest. He has develnped microprocessor based EkctromyograPh System and Magnetic
Stimulotor. Currently, be is involved in deselnping Biphasic Medical Ekctroporator and doing Ph. D.
work on "Magnetic and Ekctrical fleld effect on celMar system to deselnp device for biomedical applications" under
goldanceafDr. K P. Mishra, Radiation BiolngyDivision.
Shri ~w. Bedeharjoined BARC in 1965 after campkting mplnma in Radio Engineeringfrom Bombay
Technical Board, Mumbai. He is involved in supervising and maintaining radiation facilities in tbe
Ioboratory. He has been associated with the design and deselnpment ofBialngical CeUEkctroporator.
55
Detection of Listeria Monocytogenes inFoods: Comparison of ColonyHybridization Technique withConventional MethodAnu Kama' and D. R. BongitwarFood TechnologyDivi,iooBh,bh, AtomicR"""h C,ot"
and
K.K. Ussuf
Nud,~ Agncul"",, ,od Bio"chnology Divi,;ooBh,bh, Atomic R"""h Ceo",
Abstract
A fragment of hlyA region, essential in intraeeOular survival of Listeria monocytogenes was lahekd with
'PdCTPhy randomprimerlahelingandusedas aprobeto detect L.monocytogenespresentinfood hycoklOYhybridization. This detection method was compared with conventional one hy screening sixty twosampks of vegetabks, fISh and meat procured from weal markets. Food sampks were examined at
various stages of enrichment. Tbese food samPks were transferred to nitroceOukse filters in a gridfo,""to detect L.monoeytogenes hy cokiny hybridization using the hlyA gene probe hy ernpkJying stonderdprocedure. Lmonoeytogenes was not found in any of the sampks of meat and fish but in number ofsampks of vegetabks like coriander koves, tomatoes and cabbage it was detected; but only afier anenrichment step. The validity of the method was examined further hy using other spectes of Listeria as wenas non Listeria cultures. As compared to the conventiored metbod of detection of L. monocytogenes ,cownyhybridization wasfoond to he kiss laborious and kiss lime consuming. However, to get positive signals inautoradiogram, minimum ceOconcentration of ltfqfulml was neededfor both saline andfisb homogenatesampks. The cowny hybridization technique was more sensitive tbun the conventiored method fordete<tion of L. monocytogenes in some vegetabks. By empkJying both the methods the efficiency ofradiation treatment in eliminating L.monoeytogenes was seen in vegetabks like tomatoes and corianderwaves.
LlSTERIA MONOCYl'OGENES IS A GRAM POSITIVE,
non-sporulating foodborne pathogen. It isubiquitous in nature. As a result, L.
monoeytogenes contanUnation occurs in a
variety of foods, sucb as milk and milk products, raw
meat, seafoods and vegetables (Farber and
PeterkinI99I). Consumption of contaminated foodscan cause severe and often fatal infection in the
susceptibie people (Farber and Peterkin 1991).
Therefore, this orgarusm bas been of major concern in
the foodindustryin recentyears.A routineanalysisoffood samples for detection of L. manoeytogenes is an
essential step in determining the quality of food. India
is one of the major seafood exporting conntries
(MPEDAI999» and is concerned about the presence
of L.monoeytogenes as recently, more and more
importing countries examine consigmnents for the
presence of this pathogen.
56
BARC NEWSLETTER Founder's Day Special Issue 2001
The current methodology for detoction or nummlion
of L 11IOIIO<)'Wgenesnsually involve primary
enrichmen~ secondo1y selective enrichment, isolationon selective medium and finally confirmation of the
Listeria by using a battery of biocbemical tests whicb
requires about 8-10 days. Also based on the
biochemical rests, it is often difficult to differentiate L
_Iogenes from L. innocua or virulent strains of
L 11IOIIO<)'Wgenesfrom avirulent ones. Thus, theconventional method is cumbersome, skilled and
labour intensive as well as time cousuruJng. Therefore,
there is a need to develop a rapid, reliable and simple
method for detection of L.monneytogenes. Such a test
would be useful in screeulng at a time a number of
samples. Our experience doring small-scalesurveillance studies for Listeria by employing prevalernstIIldard methods like USlDAlPlD.S (UK) in various
foods is confusing. This organism was not detected infnod of au1mal source like meat, fish and their
products (Kama! and Nair 1994) but was found in
some samples of ice cream and vegetables (Warke el
aI. 2000, Pingulkar et al. 2001)
DNAprobe hybridization technique provides a specific,
rapid and reliable way to identify the fnodboroe
pathogens (Datta 1990; Notermans and Wernars 1990;Walcott 1992; Bandek.r eI al 1995). Colony
hybridization is more suitible method for screening a
large number of food samples at a time. Although the
polymerase cbain reaction (PeR) is also reported to be
a powerful technique for detection of Listeriamonneytogenes (Almeida & Almeida, 2000), it detectsboth vial>leand non-.;able cells. Practically this is less
significant from fnod safe!j' point of view. Consideringall the above mentioned problems encountered in the
conventional methods; the focus ms been in the last
few years on the use of recombinant DNAtechniques to
detect Lmonocytogenes (Datta et al. 1987). The Food
and Drug Administration (USFDA) was the first to
develop a DNAprobe for L monocytogenes by using am-uJent gene, the hemolysin and has shown that non
hemolytic L monocytogenes could not be detected
by this probe (Datta eI all987; Gava1chineI all992).
Thereafter Mengand elal (1988) cloned the hilA gene
in pUC18 to gel pLis3 (Mengand eI al 1989) andshowed its essential role in inttacellular survival and
therefore in virulence of L. monocytogenes by gene
complementation of a non hemolytic mutant (Cossarl
et aI 1989). Using southern hybridization technique
they claimed specificity of ht,A gene probe for
L.monneytogenes (Mengaud et alI988). in this study,this fact was further explored to detect
L.monocytogenes in various foods using a sitnple
colony hybridization (CII) technique using b/yA gene
probe. Total sixty two samples of vegetables, fish and
meat procured from local market were screened at
various stages of enrichment for the presence of
Lmonocytogenes by both conventional and CIItechniques. Both the methods are comparable in
detecting L.monorylogenes and in some vegetables CHtechnique was observed to be more sensitive than theconventional one.
Materials and Methods
Food samples: Ten samples of fish (mackerel, Bombay
duck, shrimp and golden anchovy), 44 samples ofvegetables ( coriander leaves, tomatoes, carrot,
cabbage and beet root and 8 meat samples wereobtained from different markets in Mumbai(india).
FISh and meat samples were brou.&btto the laboratoryin ice containers. Samples, in 25 g were analyzed for
the presence of L 11IOIIO<)'logenesby .standard
procedure given in Bacteriological Analytical Mannal (FDA,1984) as well as colony hybridization.
Chlorine treatment.. The fresh coriander leaves were
procured from local market: These were then washed
in running tap water. One .set of coriander leaves was
given CbIorine water (250 ppm) dip treatment for 10min at ambient temperature. Coriander leaves of
untreated and Cl, treated sets were air-dried and
packed,(25 g) in the polyetbelene hags (22 em x 15
em) with blotting paper padding for absorbing
moisture during storage at 8::100 C.
Gamma irradiation: Chlorine water treated and
untreated coriander leaves in pouches were exposed to
gamma radiation at mehing ice temperature at 1 kGy
dose in package imIdiator (Atomic Energy. CanadaLimited., Canada) at the. dose rate 0.06 kGy I
min.(1AEA 1977). Fresh washed tomatoes packed in
polyethelene bags were also irradiated at 1 kGy doseand stored at 8-100 C.
57
Treated coriander leaves and tomatoes were stored at
8-100 C for two weeks and were analysed by standard
procedure and hly Agene probe method.
/Ja(;terial cultures.. CnItnres of Listeria were obtained
from Dr. Hof (Klinikum dr Stadt Manheim, Germany)and Dr. Mclauchlin (PHIS Central PnblicHealth
Laboratory, London, NW9 5HT U.K.) Yersinia
enterocolitica 5692 and Escherichia coli 0157.. HI9
were obtained from Dr. Hitchins (USFDA) and the
Czechoslavak Collection of micro-organisms Bmo,Czchoslovakia respectively. Bacillus cereus and other
organisms are food isolates from onr collection. plis 3
(pUCI8 containing hly A gene) was a kind gift from
Dr. Cossart (pastenr Institnte, France). Strains of all the
cnItnres were growo in Brain Heart Infusion (BH!)broth and maintained io the same medium at
refrigerating temperatnre.
Isolation of Listeria monocytogenes ..For Isolation of
Listeria from food samples standard USFDA!PHIS
procedures were adopted (Kamat and Nair 1994).
Food samples were snbjected to cold enrichment io
BID at 4-10" C followed by selective enrichment in
listeria Enrichment Broth (LEB) at 31 C and plating00 listeria Selective Agar (LSA). In case of PHIS
procedures primary enrichment io I % buffered
peptone water at 30"C was followed by secondary
enrichment in listeria Selective Broth (ISB). The
presumptive positive listeria colonies from LSAplates
were further identified to species level on the basis oftheirbiochemicalreactions(FDA1984).
Inoculation of fish samples. Fresh fish was
eviscerated and muscle piece was aseptically
ioocnlated by immersiog it in the salioecontaining 10'
cfu I g cells of L.monocytogenes (1708 &35152) at
ice water temperature (Kamat and Nair, 1995). A 10%
homogenate of fish was diluted io sallne and calcnIated
amounts were used for CH experiment. The respective
dilutions were simnItaneously plated on Standard Plate
Count Agar (SPCA), iocubated overnight at 31c forenumeration of bacteria.
Preparation of~P labeledDNAprobe.. Theplis 3plasmid containing bly A gene was digested byrestriction enzyme EcoR! (Mengaud et al.1989) and
the fragment «lIill) containing approximately 500 bp
coding region of h/yA was separated by low melting
agarose gel electropboresis. Tbls fragment was, .then
precipitated by alcohol, labeled with"P by raodom
primer labeting method, and used as a probe(SambrooketalI989).
DNA colony hybridization.. For colooy hybridization,the bacterial strains under test were growo overnight at
31c io the BID broth and spotted (l0f'! ) ou the agar
plates. After overnight incubation at 31c colonies ofvarious cultnres (18-20 uumbers) were transferred to
nitrocellulose filters (HATF.085 25, 0.451'M Millipore
Corporation, Bedford, MA01730.) io a grid form and
subjected to hybridization procedure described bySambrook et al (1989). Probes with specific activityof5xlO'c p m/m! were used
In case of samples; broth samples under enrichment
stages from various foods, 10 1'1 portions of the broth
were transferred on nitrocellnIose papers andprocessed for CH as mentioned above.
Results And Discussion
Specificity of tbe hlyA gene probe.. ResnIts of colony
hybridization usiog "P labeled plis 3 with 6 standard
Listeria monocytogenes, 5 food isolates, other listeria
species and non - listeria organisms are show that io(Table!) all strains, hemolytic as well as non -
hemolytic L. monocytogenes, were positive whereas
all other listeria species and bacteria of other genuswere negative under optimum bybridization conditions.
These resnIts corroborate the findings of specificity of
hlyA gene probe observed by Mengaud et al (1988) io
detection of L.monocytogenes by Southernhybridization. Further the essential role of bly A gene in
intracellnIarsurvivalof L.monocytogenes nsioggenecomplementation of a non-hemolytic mutant has beenrevealed (Cossartetal 1989).
Sensitivity. The resnIts oi the sensitivity ofL.monocytogenes 35152 & 1708 strains io salioe and
fish homogenate show that to get positive signals ioautoradiogram,the lO'efu!m!were neededfor bothsallne and fish homogeoate samples. These
observations coiocide with the reported fioding that" P
labeled probes routinely detect approximately 10' to10' bacteria (WalcottI991).
58
Table 1: Response of bacteria to DNA colony hybridization nsing laYa gene probe
Table 2: Screening of food samples for L monopytogenes using colony hybridization and culturemethod
LSA - Listeria selective agar
a - Nil- No Listeria mmwcytogenes detected
59
BARC NEWSLETTER Founder's DoySpeciol/,,", 200/
Table 3 : _on of L momx;ytogenes in irradiated and unirradiatedtomatoes and coriander leaves byHlya gene probe and conventional method
4
+
+
L -Iogenes notdetected - -
60
IILEB+
+
+ +
++ +,+ ++
+ +
+ ++ +
++ +
Screening of food samples.. Table 2 gives the resultsof comparison of CH with cultnre method for
identification l. monoeylogenes. None of the samples
tested bas sbown presence of L. monoeylogenes on
direct plating on L.S.A.and both the methods required
an enrichment step for a positive detection of thepathogen
Fish and meal.. Lisleria monoeylogeneswas not~olated from any of the 6 fresb fisb and 5 meat
samplestestedbyeitherthe USFDAIPHLSmethodorCH method. Thos, these findiogs support our previous
reports describing the absence of L. monoeylogenesin seafood and meat from local markets (Kamat andNair 1994).
Vegelables .. Tbe presence of L.monacylogenes wasdetected by botb the metbods,in 4 ont of 8 carrot
samples and lout of 2 beet roots by both the methods.
On the other band in case of other vegetables such as
coriander leaves, cabbage, and tomatoes; overall
higher number of l. monoeylogenes positive samples
were found when determined using CH procednre
verses the culture method. It ~ pertinent to mention
here that many researchers have experienced the
difficultyin recovering L. monacylogenes from food bythe prevalent routine procedures. (Farber and
Peterkine 1991) because foods under analysis contain
large' mixed naicrobial population which hamperrecovery and identification of l.monacylogenes. Some
reports have revealed that the presence ofprednnainating Lisleria species varied with the method
adopted for the isolation ( Pini and Gilbert 1988;
IIamat and Nair 1994). A recent stndy demonstrated
that in the enrichment broths commouly used, the
growth of l. innocua is favoured when grown together
with l. monacylogenes (petran and Swanson 1993).
On the other hand, CH procedure, as developed by
targeting a specific gene in the pathogen, ~ morespecific (Table I)
Trealed! bradialed
Tomaloes .. Table 3 shows the comparative results of
the detection of l. manacylogenes in 4 samples ofunirradiated as well as irradiated tomatoes using bothCHand conventional method. It can be noticed that 3
out of 4 unirradiated tomato samples showed presence
of L. monoeylogenes by CH method. However, its
presence was not detected in two samples by the
conventional method. On storage at 15' C for 15 days
also two out of four samples showed the presence of.
L. monoeylogenes when determined by CH method
but not by conventional method. Also application of
both the methods, did not detect the pathogen inirradiated tomatoes even aber cold storage.
Coriamwr leaves.. As can be seen from Table 3 when
analysed by routine conventional method, 3 out of 5
samples of leaves (control) exhibited presence of
l.monoeylogenes. On the other hand by CHprocedureall the samples including other two were also noticed
to be L. monacylogenes positive. Higher efficacyof CH
procedure in detectiug L. moMeylogenes was also
observed in Chlorine water treated leaves. However,those coriander leaves which received radiation
(lkGy) did not show the presence of
l. monoeylogenes.
In conclnsion the present stndy demonstrated that
detection of L.. monoeylogenes in food by CHmethod,
using hly A gene probe, is a less !aborions and less
time consunaing techmque than the routine cultnre
method. The hly A gene probe method was more
sensitive in identiJYingL.monacylogenes in vegetables
and can also be applied to other foods. Thedocumented worldwide evidences of the presence of l.
monacylogenes in raw vegetables and animal origin
food and their association in outbreaks coupled withtheir ability to grow at refrigeration temperatnre has
given rise to the concern from public health point of
view (Farber and Peterkin 1991). In ~ backgrounddevelopment of a sensitive detection method such as
CH method is significant in assessment of quality of
food for export as well for internal consumption.
Acknowledgments
The authors thank Dr. Cossartfor the kind gifi ofpLis3containing hly A gene.
References
I. Almeida PF, AlmeidaRCC (2000) A PCRprotocolusing inI gene as a £argetfor specific
61
BARC NEWSLETTER Founder', Day Special I"ue 2001
Food12. Mengaud J, Vicente MF , Chenevert J, Moniz-
PereiraJ, GeoiIroyC, Gicque1-SanzeyB, Baquero
F, Perez-Dial Je, Co5sart P (1988) Expression in
Escherichia coli and sequence anaJysis of thelisteriolysin 0 determinant of Liskria
monneytogenes Infect fmmun 56: 766-772
13. Mengaud J, Vicente MF, Cossart P (1989)
Transcriptional Mapping and Nucleotide sequence
of the Liskria monocytogerws bIy A region revea1strUctural features that may be invoMd in
regulation Infect fmmun 57(12) :3695-3701
14. MPEDA (1999): The Marine Product Export
Development Authoritj>India ,pp203
15- Notermans S , Wernars K (1990) Ewluation and
interpretation of data obtlined with inununO1lSSa)'
and DNA-DNA hybridization techniques Int JFood Microbiol 11: 35-50
16. Petran RL, Swanson 1M J (1993) Simultaneous
growth of Listeria monocyrogenes and L
innocua J Food Prot 56: 938-943
17. Pini PN,GilhertRJ (1988) A comparisonof twoprocedures for the isolation of
Listeriamonocyrogenes from raw chickens and
softcbeese In J Food Microbiol7: 331-337
18. Pingulkar K, Kamal, AS ,Bongirwar DR (2001)
Microbiological qnality of fresh !eafy vegetables,
salad components and read -to -eat salads: an
evidence of inhibition of Listeria monocytogenesin tomatoes Food Sci nutriion 52 : 15-23
detection of Listeria monneytogenesControl I: 97-101
2. Bandekar JR , Ussuf KK, Nair PM (1995)Detection. of So/monel/ae in chicken and fish
samplesusingDNAprobe} FoodSafety15 :11-19
3. Cossart P, Vicente MF, Mengaud }, Baquero F,
Perez-Diaz, JC, Berche P(1989) [jsteriolysin 0 is
essential for virulence of Lisleria monocylogenes: direct evidence ohtlined hy gene
complemeruation Infect Immun 57: 3629-3636
4. DattaAR,WntzBA,Hill,WE (1987) Detectionof
hemolytic listeria monneytogenes by using DNA
colony hybridization Appl _n Microbiol53:2256-2259
5. Datta, AR (1990) Identification of foodhorne
pathogens by DNAprobe hybridization techniques
DevlndMicrobioI3ISuppI5:165-173
6. Farber }M , Peterkin PI (1991) Liskria
monocylogenes, a food borne pathogenMicrobiol Rev55: 476 -511
7. FDA (1984) Bacteriological Analytical Manual ,6'
edo, , Association of Official Analytical Chemists,Arlington, VA
8. Gavalcbin}, Landy K, Batt CA (1992) Rapid
Methods for the detection of Listeria, In:
MoleculAr Approaches 10 Improving Food
Quality and Safety, (BhalnagarD, ClevelandTE,ods) VanNorsbmd,Reinhold,NY, ppl89-204
9. IAEA(1977) Mannal of food Irradiation Dosimeuy
TechnicalReport SeriesNo 178 IAEA, Vienna,Austria
10. Kamat AS,Nair PM (1994) Incidence of Lisleria
species in Indian seafoods and meat } Food Safety14:117-130
11. KamalA, Nair PM (1995) Gamma Irradiation as a
means to eliminate L monocylogenes from frozen
chicken meat J Sci Food Agric 69: 515-422
19. Sambrook J, Fritscb EF, Maniatis T (1989)
MoleculAr Cloning; A Laboratory Manual t"edo, ColdSpring Harbor, NY
20. WalcottMJ(1991) DNA-basedrapidmethodsforthe detection of foodhorne pathogens J FoodProtect 54: 387-401
21. WarkeR, KamatA ,KamatM, ThomasP (2000)Incidence of pathogenic psychrotrophs in ice
creams sold in some retlil outlets in Mumbai,India FoodControl 11:77-83
62
Dr. (Ms.) Anu S. Kamat joined Food Technology Dtvision of BARC in 1967 after her graduation inMicrobiology/Chemistry from Mumbai University. Since then, sbe has been involved in research on
developnumt of radiation processes for highly perishabk food commadities like fish aad meat. She
obtaiand her MSc. and thereafter Ph.D. (Biochemistry) for her thesis entitkd "Stndies on Germination
and Radiation Resistance of Bacterial Spores". Her research work comprises of the toPics such 'as
applicaiion of radiation technology for enhancement of shelf life of seafoods and meat, surveillance of
locaUy availabk foods like seafoods, meat and meat products, vegetabks and other ready to eat
vegetabks and dairy products for presence of newly emerged food borne pothogens like listeria monocytogenes andYersinia
enterocolitica Contaminaiion of these organisms in seafoods and meat bas great significance from their export point of
view. She has shown that application of low dose radiation successfaUy eliminates them. Her field of specialization is
microbial safety of food in general and irradiated food in particuiar. At present, sbe 'is engaged in development of
combination processing treatment of radiation and Higb pressure to control of bacterial spor., contamination at
practicaUy feasibk doses. &sldes this, she is associated with two MEA projects and she is the chief Investigator of one of
them, viz "Stndies on Microhiological Analysis of Seafoods and their Products for Export with special reference to Human
Bacterial Pathogens for Improvement of Seafood Export". During her research tenure, she has attended many
nationaVinternational seminars and earlier she received the hest paper awards at three occasions, Based on the references
ofherscWntific publications in nationaVinternationaijournals, her biography sketch has been sekctedfor inc/wiion in the
15' edition, 1998 World's Who Who, published by Who's Who in America; and Marquis Who's Who.
Dr. D.R, &ngirwar obtained his B.Tech, degree In ChemicaiEngineeringfromNagpur University in
1963. Hejoined l' batchofBARC Training School and then joined the erstwhik Biochemistry & Food
Technology DIvision, BARC. In 1976, he was awarded the doctoral degree in Engg. & Technol. by
Nagpur University for his dissertation on 'Improved Dehydration Processes in Food Peservation'. At
present, he is Head, Food Technology Division and Project Manager, Foad Irradiator Project, BARC,
Dr, &ngirwar has tna<k significant contribution in the areas of radiation preservation offoods and
design, construction ond installation of radiation processing facilities, aUied worksbop machinery
aad food processing equipnumt, Besides designing and developing processes for food preservation
like osmotic drying, freezing drying, defatting of peanuts/soybean, soiar drying technique for farmers and traders, he is
vigorously pursuing programs for consumer acceptance of radiation-processed foods witbin the country. He has heen
chiefiy responsibkfor installation oflndia'sfirsi radiation processingfacility for processingfood at BARC 1967. He is alsoinstrumentalfor design, construction, installation and commissioning of country'sfirst ever demonstration facility FOTON
for processing ofpoiato, onion and other low dose products at Lasalgaonin Maharashtra. Dr.Bongirwar is the recipient ofGardner's Award instituted hy AFST(I) and Yezdi Award of AU India Food Preserver's Association. He bas extensively
travelkd abmad on various assignments like MEA felhwship, Indo-German Bilateral agreement, etc, visiting the US,
Germany, Canade and South-East Asian countries and participated as an expert at FAO/IAEA/W1IO conference and other
naiionaVinternationai forums representing DAB, Dr. &ngirwar is closely associated with numerous professional scientific
bodies like lVS, IN~ lARP, NAAlIlII, AFST(I) and Indian Society for Nuckar Techniques in Agriculture & Biology, He is a
Felhw of Indian Institute of Chemical Engineers and Cryogenic Council He is an examiner for Ph.D & M Tech. Degrees of
In: Mumbai and II~ Kharagpur, University ofMumbai and SNDT University, Mumbai, He has authored monograph on 'Food
Preservation by Irradiation' and a technical document on 'Radiation Processing of Foods' as a guideline to set up a
radiation processing plant. Dr.Bongirwar has more than Ioopublications to his credit in nationaiasweUasinternationai
journals and are widely cited. Dr. &ngirwar is the President of AFST(I), Mumbai Chapter for the current year (200I-O2).
.~
Dr KK Ussu! another co-author of this paper, has kft BARC.
63
BARC NEWSLETfER Found.,~ DoySpeciol I"ue 2QOI
ModelingModel
of Ductile
M.K. SamaI, B.K. Dutta and H.S. KushwahaR~,m'SofuyDimionBMb'"Ammi,R<=ud>Cenu<
Fracture by Gurson
Abstract
The most sennas limitation of the classico1 fracture mecbanlcs ts the nou-transferahillty of the specimen daJa
'" /be component kveI. This </Iff/cullyts ImgeIy 0IIeTC011Wby the dmnage mecbanics, which rruxleIthe drop Inload 'carrying capacity of a maIeriaI with /be Increase In plastic strain. Such modeling ts done consideringnudea/ion, growth and coalesceru;eof /be voids In a maIeriaI f-ng large-sco1eplastklty. /'be maIeriaIconstitutiverruxleItsmodified'" considersuchpbenomeni<Aftnile _In-house IWICCOikAWJAMbasbeen devekJped based on such prine/pm. The constitutive rruxleIlntroduced by Gurson and nrodified byTvergaardand Needkman bas been implenwnled In this code. The code bas been tested, verified and usedanaryslng number offracturespeelmens and Piping components InIWIC and aIMPA, Stuttgart. The Indian andGermanpiping materials have been consldeved In lhese analyses. Some of the results obtained by this code andcomparison wIth experi~ results arepresented in tbls paper to show the usefulness of dmnage mecban""In analysIng reallife power plant components wIthflaws,
Introduction
THE INFLUENCEOF CRACKTIP CONSTRAINTON
ductile1'racture resistance is of major coucem in
the assessmeut of strucnual integrity employing
conventional fracnue mech:mics concepts. Constraint
is a structurai feanne, which inhibits pblstic Rowand
causes a higher Iriaxiality of stresses. Experimentalresults show that the conventional single-p meter
criteria (such as J-integcai or crack-tip opening
'displacementCTOD) is unable to describeductilecrack growth satisfactorily. The specimen size and
geometry bave a pronounced effect nn the fractureresistance curve. The continuum damage mech:mics is
one alternative approach to solve this problem, This
involves simulation of the failure process using a
constitutive relationship representing nticroscopic
rupnue processes. As a resnl~ these models (alsocalled nticro-mech:mical models) are able to consider
implicitly the pbysical effect of constraint on thefracture resistance. The crack initiation and the
propagation occur with the local degradation of the
material loosing completely its load carrying capacity.
This is characterized using a critical vaiue of the void
voiume fraction f,over a characteristics distance~. The
advantage of sucb modeling is that the correspondingmaterial p meters can be nsed for analyzing
specimens and real life components of any geometry.
The required nticro-mecbanical p meters are
deterutined from the simple tensile tests of notched
bars, metallographic study of the material, and
comparison of experimental and numerical simulation
curves of smooth and notched tensile specimens.
A finite element BARC code .wlMM (JMTERIAL[MMAGE MODEIlNG) bas been developed using the
principles of damage mech:mics. The Gurson-Tvergaard-Needleman material constitutive model has
beenincorpocated.Thecode bas beennsed in BAReand at MPA to analyse number of fracnue specimens
and piping components made up of Indian and German
materials. In the following, some resnlts are presented
64
Found,,', Day Special!"ue 2001
to demonstrate the stress state dependency ofJ-resistancecnrves with the help of this code. Theresolts are presentedfor two Gennan materials DINStE460 (ferritic material) and DIN X6CrNiNb18 10(austeniticmaterial). Thedetailsoftheir propertiesare
givenin references[I] and [5). Fivedifferent typesoffracmre specimenshavebeenanalyzed.Theseare crT)
(compact tensioo), SE(B) (single edged notchedbend), M(T) (middle tension), SE(T) (Single Edgednotched Tensile) and DE(T) (Donble EdgedNotchedTensile) specimens respectively. The resolts of astrajghtpipehavinga IZ2"circumferential throngh-wallcrack havebeenalso presentedto show the analyticalcapabilityof the code.This pipehasbeentestedaj MPAunder an internal pressure of 16 MPa and increasingbeudingmoment.The analysishasbeencarried out ona super-computerat MPAas part of an Indo-GermanBilateralproject on 'Transferabilityof specimendatatocomponentlevel'.
Modified Gurson Model for Ductile
Tearing
Basedon theworkof Berg[Z](whichshowsthataporousmediumis governedby thenormalityrole),Gorson [3) deriveda constitutivemodel '. formaterialscontainingeither cylindricalor sphericalvoids.
<'i"ij"'M,f)=~+2.j'LJ' cosJq"'; }-1+q,(f'f)=o"M '12"M
Here" =(.!.~ ~ )'is the macroscopiceffectiv;" 2'"
stress, '"=""-~"""" represents the stress deviator.
and aM is the flow stress of the matrix material. The
above yield function rednces to von-Mises yield
criterion for ( equals to zero. Tvergaard [4Jintroduced the parameters q, and q, in order to bring
the predictions of Gurson model closer to theexperimental values. The function (0 was introduced
by Tvergaardand Needieman [4) to model more rapidloss of material stress carryingcapacity after theoccurrence of voids coalescence. This function is
expressed as follows.
( = f fod <I,
=f,+~=~(J-fJ fod;' f,
The function becomes more predominant once void
volumefraction 'f exceedsa critical value 'f;. Thecompletelossof load carrying capacityoccnrsatf=~.Theoltimatevoidvolumefractionin that conditionis
(=(~)=I/q,. The increase in void voiume fraction isdue to combined effect of void nucleation and growth.
The mathematical expressions for modeling these
processes can be found in reference [4J.
BARC Inhouse Damage Mechanics Code'Madam'
A finite element based computer code hax been
developed in BARC for structural safety analysis of
power phmt components. The code has been tested
and verified agajnst number of case studies and also by
participating in an international benchmark round
robin exercise conducted by GRSS (Germany). Some of
the sallent features of the code are as follows.
I. Finite element based cnde.
Z. Considerations of Z-D (plane str:Un and
axisymmetric) and 3-D structures.
3. Availabilityof 8-nodediso-parametricelementsformodeling Z-o structures and Zo-noded brickelements for 3-D strnctures.
4. Availabilityof ZX2 and 3X3 gauss point
integrations.
5. Analytical capability of elastic, elastic-plastic and
damage mechanics.
6. Use of von-mises yield criteria, Prandtl-Renss flowrole and isotropic str:Uo hardening for
conventional elastic-plastic analysis7. Use of Gorson constitutive model and associated
flow role for damage mechanics analysis.
8. Solution of nonlinear equilibriumconditionbyRik's method (arc length method) or Newton-Raphson method depending upon the user'schoice.
9. Availabilityof followingfoursolversfor solutionofsimoltaneonsequntions.
a. Activecolumn profile solver.b. Frontal Solver.
65
c. Preconditioned conjngate gradient (PCG) solver.
d. Sparse Solver.
Anyone of these solvers can be used depending upon
the user's cboice.
10. Availability of rontines as post-processor for
computing2-D/3-D J-integralnsing EDImethodand critical void growth nsing Rice-Tracey integral.
Gurson Material Parameters for DamageMechanics Analysis
Tbe Gurson material parameters reqnired for the
analysis are as follows.
1. lnitialvoidvolnmefraction'~'.2. Critical void volnme fraction at coalescence 'f,'.
3. Final void volume fraction 'I'.
4. Voidvolume fraction at saturated nucleation '~'.
5. Mean value of strain for nucleation 'E,' (for stcaincootrolled nucleatioo).
6. Standard deviatioo of strain for oocleatioo 's,'.
7. Tbe constan~ q" 'h and q,.8. Critical length parameter 'I,' (reqnired for tbe
analysis of cracked specimens) and9. The ultimate modified void volume fraction at
fracture ,('.
Tbe values of the parameters~, f" E" s" land (for tbe
preseot materials are determined by a bybrid
methodology of metallograpbic study, experiment on
tensile tes~ and subsequent numerical analysis. Thevalues obtained for materials StE460 and X6CrNiNbare
as follows.
mm and reduced diameter at groove is 10 mm. The
sketch of the specimen is shown in Fig. 1. The finite
elemeot mesh of the specimen is sbown in Fig. 2. Theanalyses bave beeo done for two different notch radii of
4mm and IOmm. The experimental resul~ have been
taken from reference [IJ. The parameter f, bas beendetermined focusing particularly the point of sudden
drop in load-diametral contraction (MJ) curves for
both the grooved specimens. Tbis poiot in the load-MJ
curve is primarily iniluenced by the value of f,. Acomparison of the experimeotal load-diametral
contraction (MJ) curve with the oumerically simulated
curve for both the grooved specimens are shown io Fig.3 and Fig. 4 respectively for StE460 material. Tbe value
of 'f,' has been found to be 0.021 through this exercise.
For the stainless steel X6CrNiNbmaterial, the notched
tensile specimens have the same dimensioos except
tbat the three notch radii of 2, 4, and 8mm have been
considered. Following the similar procedure, tbe
parameter f, bas beeo found out to be 0.05 for thismaterial. A comparisoo of experimental and oumerical
analysis resul~ of the notched teosile specimens for the
stainless steel material are also showo io Figs. 5, 6 and7 for different groove radii.
Expressions "sedDetennination
for J-Integral
Tbe J-integral in damage mechanics analysis is
generally calculatcd using the energy concept. Tbe
expressions for J-integral for a CT specimen, a TPB
specimen and a straight pipe are given below.
Analysis of Notched TensileSpecimens and Determination of VoidVolume Fraction at Coalescence
The values of critical void volume fraction at
coalescence 'f,' shown above bave beeo determine
danalysing a number of round ootched tensile bars
usingcodeMADAM.Thisis a widelyusedpracticeforthe determination of f,. Tbe nominal cross sectiooof the grooved tensile specimens bas a diameter of 18
P&reompacttenswn (cr).peetmens
The J-integral is evaluated from the area under the
load-displacement curve at a particular crack growth
using ASTMstandard formulae given below.
J=J {l-~ )-~ {I-~ )0 (W-ao) - B..(W-ao) (W-aoJ
Here U is the area under load vis de1Jectioo curve, W is
the width of the specimen, B, is the net thickoess,
66
Founda', Day Spedol /"ue 2001
Fig. 1 A ""lcbed ten""Hpedmen (D=/8mm, d=1Omm, 1,=5D, ,=notcb ro<J;mJ
ill
Fig. 2 Flnl18ekmentme.sboftbe",,"bed ten,;kspecimen Ixwing4mm ""teb mdins.
~.ooooW
,"
I""OOd.","U.m.~'(&)'"mml
Fig. 3 Load vi, rodacUon in dianw"" en"" fo, tbe ",,"bed
l8usik 'fJeeimen wltb 4mm ",,'eb ,adim
rnoooollJ
)0000
" "... .",...u.~..0
0.0
1'"~"""O'm",,"".ml
Fig. 4 Load e/s "daction in dianw""en"" ""tebedlendk
specimen wltb 10 mm ""teb mdim
67
Founda', Day Special /"u, 2001
.~.--l'o-¥'
=f"""'1
~OE"'hj ~- ---r--- --~'---"-
00 La >0OWn.t...!con_",n mrum
"""'r""'"
""'"§~z.....S..J
->~--
Experiment
~.
o~.
.;; ,..-.---IE~~~"!,L_.~___,---,_.,.,-
--~---
3.0 4.0
Fig 5 Load,;'Dianwl,alconlmdlon ",roenJanntchedt<m'lk'lmdnwnoJ2mm notch ,adlm (MaWriaIX6C'NINh)
6Effl4T-
'aM~
i4aM-I,
~H
"",,.f"
--i . I~._-~ : "\~' !-}';."'Jg,E;.Q6' i_. \
~oo" ..' FEManalysis "',IE-. --
oE+<Jol~ ";~-~ r---' ;' ~~-10 2.0 . ,0.0 . Dmmetm] contractJOllIO nnn
"0IiZ.5
]
'"
-:4., "
~ {~ --...
\.'I.
,.C
Fig. 6LoadoMJlanwlmi conlmet/on ",roeoJa notched 1",,[1£ 'pednwn oJ4 mm notch ,adlm (MaterlalX6C'NlNb)
68
Found,,', Doy Sp,cial/"ue 200/
--~~~l/. I";:~,,",. ,I I:\'-
, iIII
IHI
I
"'-I
6E""-, ~- --
j ~--~r--
56",,-1- 0,---"----
~Z.5O11"..J
4Effi4
36""
2B"" ',-:-. . , .'1GmoonP~frFEM"',~ I1
0-1,,0&06 . I I
t"O05' .
1n.-QOO$5~~~j-,IE""
OE<OO0,0 1.0
Fig. 7Loadv/'Diamet,a/crmt,aclioncurveofanotchedt,",ilespeci_of8mm notch,adiu, (MaterialX6C,NiNb)
1\ . \,I \ -n
~j1\I{v U\'\~ ~.'" w\L LI
Fig. 8A Compact rendon ,paci- (W"5Omm,a"33-25mm, B"25mm, B~"2Omm, H"6Omm, L"625mm,
20% 'idE-grooved)
~'
\.~- "
FEManalySiiI~.\...
2,0 3,0Diametral cootraction in nun
T4,0 5.C
Fig 9 Finile element me,h of a compa'" _ton 'peci-
69
BARC NEWSLETIER Foun<kr's DoySpecio/Issue 20f)1
1]=2+0.522.0-a"IW) and y=(0.75. 1]-1). (ASTME1152)
For three-point-bend (TPB) specimen
For deepcracked specimen,the expressionis sameas
shownabove,exceptthat the wlue of I] is taken as 2.For other a/w specimens,the IT is taken as the areaunder load vIs CMOD curve. In such cases, theexpressionfurJ is asfollows.
~J = Bn.~ -GO)
Where 1]=3.5-1.42*(a/w) whered 'a' is the currentcrack length
For pipes wi1h 1hrougb-wall cin:umferential Oaw
uoder four point bending load:
Ii",
Jpl = f3 fp.dop/0
Here2P is the totalload, 6. is the plasticdeflection,
13 = -h'(cj))/ Rt.h(cj)) ,R is the mean radios of
p~ In
mm,h(cj))=[cos(cj)/4)- O.Ssin(cj)/2)], tisthe thickness In nun and $ is the total crack angle of
the through-wall circunderential crack.
Analysis of Compact Tension Specimens
All the Gurson material parameters shown above have
beenused In the numerical simulationof crT)specimens havIng 20% side grooved. The cr specimen
dimensioos are In accordance with the ASTM standard.
The sketCh of the crT) specimen is shown In Fig. 8.
The FE analysishas been done osing MADAM code with
phme sirain formulation. The mesh is shown in Fig. 9.
The unknown critical length parameter 'I,' has been
detenuined comparing the numerically simulated J.,..rue with the experimental wlue. The J-integral at
each load step has been calculated usIng the above
expressions. The results are shown in Figs.lO and 11
for the material StH460. From these analyses, the
critical length parameter ~ has been found outtobeO.l1mmforStH460andO.lOmmfor X6CrNiNb
materials. These have been used as the crack tip mesh
size In the subsequent analyses of other fracture
specimens and also in the analysis of a 3-D straight
pipe with circunderentiJIJ crack.
Analysis of Other Fractnre Specimens
A number of other fracture specimens of different
geometries have been aI1alJzed to compare their J-resistance curves. The varioos specimens considered
are M(T), SE(T), DE(T), and SE(B). The mesh near
the crack tip is similar to that of CrT) specimen shownabove. Appropriate boundary conditions have been
imposed for various specimens. Few sample results are
presented here for demonstration. 'Fig. 12 and 13 show
the comparison of experimental and numerical J.curves for SE(B) specimen for stH460and x6CrNiNb
materials respectively. A similar comparison is shnwn
in Fig. 14 for M(T) specimen having StH46oferritic
steel material. All these figures shnw reasonableagreement between experiments and the numerical
simulations. Fig. 15 shows the comparison of all the
predicted J. curves for five fracture specimens for
stH460 material The crack tip stress triaxiality
dependency ofJ-R curve may be seen In this figure.
Analysis of StraightCircumferentialFlaw
Pipe With
To demonstratethe osefu1nessof damagemechanicstoanalyse real life power plant components, the results
are presented here for a straight pipe with
circumferential ftaw. The straight p~, which was
tested at MPA (Stuttgart), has a 122' circumferentialthrough-wall crack. The component is loaded with
interrud pressure of 16 MFa and inCl'e:lsing bendingmoment. The Gurson parameters for x6CrNiNb
material shown above are osed for this purpose. A
simple sketch of the pipe is shown in Fig.l6. The
fatigue pre-crackproffie is shown in Fig.1? The sketch
of the _rirnentalloading setup is shown in Fig. 18.
The finite element mesh of the pi~ was prepared using
PATRANsoftware.Onefourthofthe pi~ wasanalyseddue to symmetIy. The finite element mesh of the pi~ is
shown in Fig. 19. A comparison of ~taI and
computed results of different parameters is shown inFigs.20(a-d).
70
BARC NEWSLETTER Found.,', Day Special /',ue 2001
Fig 10 Compari,on ofexpari-td and rompawd load,/,load paint dejkclion "'"'" of a ,tand",d C('I'J,peeimen
FiglI Compa"'an ofExparimentd and compared/. "'""
fa.materia1StE460.,ingC('I'J ,peei-
700
600
~.I :::.= 300~
200
100
00.0 0.5 1.0 1.5 2.0 2.5
le,"ok Ext.n'ion(A~)in\" mj
Fig.}2 Compari'on afExperimental and computedJ,cu""'fo.SE(B) ,peel- (a/w=O49)fm-materia1SIE460
71
Founda', Day SpecialI"ue 2001
"OO
l
~ ~-
2000 " . _7--- -
'_,."00 ,- ,,---'
j ,...;H - ' - ,I, ,-- . - ..- --- H- - '~ ,-' .,', --- -'~- T;;'-/' '.- ,
i :r~'~=~~~-~ ..1
...,.. ,...= ."".'~'""=. .J
,,"': ."; .,-=~H~~~~=! HClad<aro..th in1m!- 6 T~--i
8
FigI3Cotnparlson oJnu_calandexperimEntaIJ-ro,i,tancecuroe J,;, a SE(B) ,pecimEn un,"" throe point bending Wad(MatertalX6CrNiNb, MfA ExpertmEnt No. ABV097)
800
700
rnt :::~. 400... 300
200
1 00
IC'U.E,"o.,'".(Ao".mm I
Fig. 14 Comparison oJExperimEntai and computedJ,caroesji;rM(T) specimEn bavlngalw=0.49J,;,StE460materta/
72
I 0 a 0
800
600
4 00
200
0 .0 0 0 .5 1 .0 1 5 2.0 25 30
'CraCk propagation Aa in Rim!
3 5 4 .0
Fig.J5 Comparison ofj-Resistanrecuroesfm-differonlfracluro _bani" spedm<msfm-StE460matEria1
FigJ6ASketchoflhePipesped- with122"throughwaYd,cumferontlalen"" testedaIMPA, Sluttgorl
73
BARC NEWSLETIER Founder', Day Special/=e 200/
,..~ .
~..r~i '.G
""jcr autiBe. In".ol'eu'fac...--.
... '" ..w..IIIhk;~n_st'l mm
is
..""lor suriaoe """1' s"riao"&
." to.
1.u, t.
i,..00 ~ .s .. .. . ,.
wallIl>f<;kness!I nun
PIg./7Paliguccrackl'roftkof""'crackfron'uf""'I'pele,'eda'MPA, Sluttgarl
~
~>
ABVS02 '" = 60'
;jo
ABV302..- 3000
~,
""pc" ~~~h",,"
'p~",;",,'n he"d
lua" cell
olrcumfhmnt<", flaw
cy!;"der I> (pUS")
cy"nu.r 1 (pull)
..p"':'...,..n.h=""
74
Flg./BSketcb of I"" exfJerl-tai "Iul' used In "'" """fraclure 1e,1umkrromhl""d Inlernall'"",ureand """ding ","_,alMPA
IQw-"r c"""'head
l2)f::,~,Cl\:<if
i' '~'1it "-;f
'<~~~~V'
Fig19 Finite element """h of a ,tmight Pipe hmnng 122' throughwaU""oumf-UaJ"ack.
(aj
(oj
(b)
(d)
Fig. 20 Campa,.;,on of ,-"p.mmental vi, rompatad "",It, fw the Pipe with 122' tiffough-waU ",cumf_tid _k "'bpa;ted /Qinternalp""""and hendingmoment (MatariaIX6C,NiNbMPAABV302 Experiment)
a. Momentvl,r1ejkcUonatcen"', b. Momentvl'CMOD; c. CMODcl, "uckgrowth, d EndrotaUonvl",uckgrowth
75
Conclusions
In the present work, the importance of damagemechanics has been shown over the classical fracmre
mechanics in analysing cracked components. TheBARCin-honse finite element code MADAMhas been
used for this pnrpose. The code has the capability of
carrying out elastic, elastic-plastic and damagemechanics analysis of 2-D and 3-D components. The
Gurson constitutive model has been incorporated fordamage mechanics analysis. The code has been tested
and verified against number of case studIes and also by
participating in an international round robinbenchmark study conducted by GKSS (Germany). The
code has been also used at MPA,Stuttgartonsupercomputers for analysing number of straight pipeswith flaws tested at SERC and also at MPA. Such
exercise has been done as a part of an Indo-Germancollaborative program.
A number of grooved tenslle specimens have been
analysed to ascertain the Gurson material parameters
for the IndIan and German materials. These parameters
are then used to analyse number of fracture specimensto demonstrate the dependency ofJ-resistance curve on
the crack tip stress triaxiality condItion. The results of a
straight pipe with flaws under internal pressure and
bendIng moment are presented. A close agreement
between the computed and experimental data of
varions parameters shows the correctuess of Gurson
parameters and importance of damage mechanics in
analysing real life power plant components.
Refereuces
1. Brocks, W., Klingbell, D., Kunecke, G., and Sun,
D.Z., "Application of the gurson model to ductile
tearing resistance", Constraint effects in Fracture,
Theory and Applications: Second volume, (Eds. M.
Kirkand AdBakker),ASTMSTP1244, 1995,pp.232-252.
2. Berg. C.A.,Elastic behaviour of Solids (Eds. M.F.
Kanien etal), Me Graw Hill FubL, 1970, pp. 171-210.
3. Gurson, A.t. "Continuum theory of ductile rupture
by void nucleation and growth: Part I-Yield criteria
and flow rules for porous ductile medIa",! Engg.Mat. Technowgy, Trans. of MME, VoL9, 1977,
pp.2-15.
4. Tvergaard, V. and Needleman, A., "Analysis of the
cup-cone fracture in a round tensile bar", Acta
Metallurgica, Vol 32, 1984, pp. 157-169.5. Santa!, M.Il, Dutta, B.Il, Kushwaha, H.S., "Three
dImensional analysis of piping components using
BARC damage mechanics code MADAM",Communicated for publication as BARC report,
July 2001.
76
Pheromonesin the Management of MajorLepidopterous and Coleopterous Pests ofCotton
A.J. TamhankarNodm Ag,I,wmw ,nd Blmedmology OI,I,lonBb,bb, Awmk R"""b C,m"
R. T. Gahukar
Plm ,220. R"blmb'g, N'gpm
,lid
T.P. RajendranPI,", Pw""lnn DI,I,lon.COnn,II",I"", fo, Conon R"""h. Nogpo,
Abstract
Cottan is infested by over 30 pests bekmging to kpidoptera and cokoptera, Amongst these insects. variousbollworms and cotton boa weevil cause ecanomic damage everyyea', In [PM,pheromones a,e consiikred to bean essential component because they are usedfa' dotecting the economic threshold kve~ of pest populations and
for mating disrnption as a direct pest suppression measure Pberomones of major pests have beenfound to beeffective. economic and eco-friendly tn ogm-ecosystems in which cotton is cnurvoted
Introduction
II THE GROWfH STAGESOF THE COTTONsuffer from insect attack and details on the
L JIheconomic importance of these insects; their bio-
ecology, population dynamics and methods of thcircontrol, are well-documented (Frisbie, 1989; Gahukar,
1991; Matthews & Tunstall, 1994), Amongst the nearly
135 insect pes" that infest cotton, economic plant
damage is caused by lepidopterous and coleopterous
insects. The various non-pheromonal management
tactics that are employed to reduce the crop damage
caused hy these insects include mainly cultural and
mechanical practices, releases nf parasitoids and
predators, use of microhial, hotanlcal and chemical
pesticides, These practices provide varying levels of
efficiency of pest management in cotton and areavallahle across the board. Since cotton is a cash-
generating crop, cultivated over the last few decades,
indiscriminate use of insecticides has become
widespread, in both the developed and the developingcotton growing countries. This excessive use of
chemical insecticides has produced several
undesirable effec" including: development ofresistance to insecticides; toxic residues on lint and
seed; dangers to the environment, heneficial organisms
and man. As a result, the concept of Integrated PestManagement [IPM] is becoming popular
(Sundaramurthy &Gahukar. 1998) because it
encourages the use of several components in the pest
control system in a harmonious combination, which
has a minimal impact on the environment.
When pheromones are used as a tool to monitor pest
populations, it results in need-based use of pesticides
(or any other pest management practice). As cotton
cultivation is ridden with the large-scale use of
insecticides, any reduction in the pesticide reqnirement
77
BARC NEWSLETTER Founder's Day Special/ssw 200/
can make an economic impact in terms af a saving an
productian cost Besides, pheromanes can be used
directly in the cantrol af insects throngh mating
disruptian and can substitute for insecticide use for the
suppression of populations of certain cotton pests. In
cotton pest management, besides the sucking pests, the
majarity af insecticide =ge is directed against
Iepidopterous and coleopterous insects that daIrulgethe fruiting bodies. This review discusses the utilizatian
af pheromones in the management af the most
damaging pest species af cottou. Some insect species
occur sparadically an cattan crops and are of mioar
importance and utilizatian af their pheromones in IPM
s. -..pea;s
spodDptero UJura
is at a preliminary stage and therefare has beenexcluded from this review.
Pheromones, pheromone formnlationsand traps
Pheromanes af sever:d lepidopterous and coleopterous
cotton pests have been identified and syothesiled and
anly the primary references in this context are given in
Table \. Once identified, the pheromane componentscan be syothesized through varying alternate!
impraved/novel routes and this does not form thesubject matter of this review. Experiments on some
Table 1. Pheromanes af important insect pests af cottolL
".:Pt,I)Qs'7.cis.tl~';:;:"WnyI"';;;;'(l).. 2)Qs.7,-.1I.h_",ylacetale(t)~,,+AI. . 1 & 2 in li\<..o.:-" "}Jjjj#i.~Ph,l)c/s'9,ttiiM-1I"etrndi'i"ili,nylacetate(3j)2
2)cIs.9.tetrndecenylacetatl(46) ..!) trans. li-tetrndecenyl"""'" (9)4)cIs-1I-tettadec<oyI"""'" (7)
5)cls-9,c1s-11-teIrndecailieoy"""'" (4)6) cIs-9,trans.l2-teIrndecailieoy"""'" (t-) +AI,I
and 6 In 11"'),(-5 n1io
"Ph,I)cIs-9,trans-lI-teIrndecailieoy"""'" (5)
2)cIs-9, trans-12-IeIJ><Iecadi",yI"""'" (0.7) + AI,I and 2 In la, I ","0
"ph: 1) cIs-9-tetrudecenyiaretat< (47.9)2)cis-9.1i:trudecen-I.OI(4)
!) T""""'roy!ac'tat< (40.2)4) cIs-9, cIs-12.tell1lde<:eWenyi """'" (6.5)
5) cIs-lI.h<:xadecenyl"""'" (t.7)
+AI, 2.! and 5 lnaho¥en1io"Ph l)cIs-lI-h<:x»dee<:oW (43)
2) cIs-9-h<:x»dee<:oW(t-3)
3)h<:x»dee<:oW(1-21)4) cIs-lI-h<=lecenot (1-9)
5) h<=lecenol (!lace)+AI tand2mtOOHOrnOo
"ph, I)cIs.lI.II<:xadcc",al (81.4)
2)cIs'9.h<:xadccroal(1.0)!) cIs-7-h<:x»dee<:oW(t-3)4)~(9.5)
5) cIs-lI-h<=lecenol (3.2)
6)T<InI<Ieceoa1(t.6)7) C/s-9-(3. 2)
+AT,I,7,4,5in65,1'1.6'3'.6:0.7n1io
78
".
_dal.I979.198O+Kehaldal.l98O
DunkelbIum d aI. 1980
"K1uij"'al.1980 ."
.l!an1iswamyetal.J985RoeIoIsdal.l974Tumlinsoo dal 1975
K1ondal.l979Tea1da1. t986
BARC NEWSLETTER Foumkr's Day Special Issue 2001
Table 1. (conJ/nuetI)
L"',~geetal,19s8"lif!tltetal.19S1
'£ 'PhI2)'Jjh~(1)4) oc:tadi<mal (2)
5)';'-11_(4)6)/Jrms-10,"",,12-_0I(lO)
+A1-I,2andSinlo-.",....oph, 1)/npIs-9-1I- dodecadieo~"""'" (S.O)
Z),ds'9,1l-dod=d;enyl """'" (2.0)J)jfJii~9- <Iode<.n~ace~. (0.5)4)/rans-I-dcdeceoJ!"","" (2.5)S) Dod«eoyI"""'" (S.O)
+AI,l,2and4 in8.0, 2.0,2.S""gmndis 'Ph,Inmhedsexes
I) (R-<is)-1- meIhyI-2-cyclohu~«Ihanol(lJ)
2) (Z)-2-(3,3-dnnethylcycloh")'lideoe)e!heool(9)
J)' (ZHJ,J-dnne!hylcyclnh")'lidenenceillidehyde(9)
4) (E)-(J,J-dnneth~oh")'lideoe)~(l)
-ph, Inmaler.ec.Jmaner1,2,3and4 in 6,6,2,1-+AlI,2,Jand4_e!fedWeinrntiosof2,6,1,I;J,5,1,landS,6,J,J
10 mparopsis castmwa
II An/bmwmus
gmndis
'Neshitteta/.1975
+Mwks1976
_eta/. 1961
(I-cned>Jletheo~) - -lIOOineta/.1974+!Wdeeetnl.1974
Ridgway et a/. 1990
'ph = Pheromone componeo!'s Proportion; -Ph = pheromone componenG in mnIe; +At = Reid attrnction
insects show 1hat more than one blend of pheromone
components can be attr:u:1ive,as in tobacco budworm,
Heliotbis virescens (Fh.) (Vickrn & Baker, 1997;
Ramaswamy el aI., 1985; Shaver et aI., 1989;
Hendricks & Shaver, 1990). It is also possible Ihat any
insecl species may show geographical variation in this
regard as is Ihe case willi pink bollworm,
PecJ/nopbora gossypieIIa (Sanndrn) (Flint et aI.,1979). However, it should be remembered 1hatIhere is
always a precise ratio that elicits maximum attraction,
as in P. gossypiello (Tambankar et aI., 1993), and Ihatthis ratio should always be used to obtain Ihe bestresults.
Since pheromones are volatile in nature, slow release
formulations bave been developed so 1hat an effective
release rate is maintained over several days after
application. Such pheromone formulations arecommercially available for several insect pests of
cotton crop (Hall el al., 1980; 1992)- Generally, Ihe
formulations used for monitoring are in 1he form of
rubber septa, polyethjlenevi:lls or polyvinyl chloride
dispenser>, while !hose for mating disruption purposes
include plastic hollow fibres, plastic laminate IIakes,
polyethjlene tube dispenser>, bag dispensers etc. Someformulations are also available as emulsifiable
concentrate (Downham et aI., 1995) or as polymeric
aerosol (Kebat & Dunkelblum, 1993). The micro-
encapsulated formulation is used in aqueous
suspension and can be sprayed by conventiotud
applicators, hul !he fibre and flake formulations
require an adhesive !o ensure !hat !hey stick to foliage.
Polyelhylene tubes bave to be applied by handindividually. Sprayable formulations require less
chentical and are easy to adapt to conventiotud
practices, but !heir effect does not last long, whereas
polyetbjiene tubes which can be applied by band can
be effective for months. For a long dnration crop like
cotton, !hey are eminently suitable-
Three types of pheromone traps viz., sticky, liquid and
dry, are used in cotton pes! management. The most
widely used sticky trap in cotton is !he delta trap.
This trap, however, has limited trapping capaciIy, is not
79
adequatefor large insects like Helicaverpa spp. and
the scales of trapped insects and dust affect its trapping
efficacy. Liquid traps have the problem of falling liquid
levels due to evaporation and require careful handling.
Currentiy, dry tf'JpS are in vogue as they are easy to
handle, are rugged and have a large trapping capacity.
They include the funnel trap, sleeve trap, wire cone
trap, double cone trap (Texas model), automated trap
etc. These traps are suitable both for monitoring andmass trapping. The rule of thumb for trap height in
cotton is titat for small insects like pink boliworm,
traps should be 60 em above ground ievel in the earlyseason and 15 em above the crop canopy in the late
season. For large and strong flying insects like
American bollworm, Helicaverpa armigera (HUbner),
the parameters would be 1 m above ground level in the
early season and 1 m above crop canopy in the lateseason.
Pheromones in the management oflepidopterousandcoleopterouspests
Deleclion and monitoring
Several studIes have been conducted on cotton pests to
establish a quantitative relationship between the
pheromone trap catches of a particular pest and the
plant damage cansed by it. This relationship would be
used to define trap catch values titat could be used to
identify the economic threshold level of a pest at whichcontrol measures were necessary. For example, the
correlation between pheromone trap catches and the
levei of egg or larval infestation were found to be highiy
significant in most of the major pests of cotton, suchas, H. virescens and Helicaverpa lea. (Boddie) (Lopez
el ai., 1988, 1990; Leonard el aI., 1989; Frisbie el aI.,
1989), H. armigera (Srivastava el aI., 1992;
Devaprasad el al., 1993, Whitman & Rao, 1993),
Barias villeOa Fabricius (Qureshi & Ahmed, 1989,
Naikel al., 1997), B. insu!ana Boisduval (Campion el
aI., 1981; Qureshi & Ahmed, 1989; Makkar &
Kostandy, 1995); P. gossypieOa, (Page el al., 1984;
Dhawan & Sidhu, 1988, Moawad, 1993) and
Anlfunomus grandis grandis Boheman (Benedict elaI.,1985).
Commercial advances in pheromone related
monitoring and control technology have tremendouspoteotial (Kirsch & Lingren, 1993; Card. & Minks,
1997). However, utilizatiou of various types of traps
having varying efficacy, different dispensers and
quantities of pheromone in different agro-ecosystems
has resulted in variable predictive values of trap
catches for any particular insect. For example,
predictive values of the trap catches of pink bollwormmoths ranged from 4 males/night (Dhawan & Sidhu,
1988) to as high as 22 males/night (Page el aI., 1984).
Valuable information can be generated by conducting
experiments simultaneously, osing a standardised
trapping protocol, in cotton growing areas. Such an
effort would plug the major gaps in knowledge relatedto pheromone utilisation in cotton insect pest
management. The data obtained could be assembled
and processed together to include the local weather
variables and to determine whether nnllorm predictive
values of trap catches can be obtained for a pest, atieast for the initial infestation under specified weather
conditions, or there really exists a variation in this
regard. Such an experiment may also help in proper
evaluation of the doubts expressed about the utility oftrap catch as a predictive tool for pest infestation levels
(Campion, 1994). There is also evidence to prove that
exposure to sub-lethal ievels of insecticides alters male
sex pheromone response and female calling behaviour,
at least in the case of pink bollworm (Haynes et al.,
1986). This may result in a delay in mating and also
subsequent oviposition by females (Lingren el al.,
1980; Hutchison elal., 1988).1fthis is the case, there
is a need to evaluate plteromone trap catch values
relating to infestation levels following insecticide
application. Sequential sampling experiments may be
of great value in this context since trap catch threshold
levels may be exhibited after implementation of pestcontrol measures. Most probably, because of the
foregoing reasons, though pheromone traps have
become an important tool for monitoring pests, their
data are not easy to interpret and a lot still needs to be
done to establish this methodology as a routinemanagement practice
While the impact of weather on trap catches is
routinely studied (Beasley & Adams, 1994; Tadas et al.,
80
BARC NEWSLETTER Founder', DaySpeciaII,,~ 1001
1994; Korat & Lingappa, 1995; AIbms el aI., 1995),
not many stndies have been carried out on the impact
of other biotic or abiotic factors. For example, mixedcropping or mono-cropping patterns may influence
pberomone-related behaviour of oligophagous insects,
snch as, P.gOSSYPiella,Barias spp., and Heliolhis spp.There is evidence that host plants or plant-odourants
influence pheromone related behaviour of cotton
insects (Landolt & Phillips, 1997) such as
HeliroverpaIHeliolhis spp. (Raina el aI., 1972; light
el aI., 1993; Dickens el aI., 1990,1993), Earias spp.
(Tamhanltar, 1995), A. grandis grandis (Dickeus,
1986) and Tricboplusia ni HUbner (Landolt & Heath,
1990). it appears that pure (as in monocropping
systems) or altered (as in multi-cropping systems)
signals may influence the panem of !r:Ip catches. Innatura1 settings, these major insect pests release
pheromones in the presence of bioactive odourants.
Traps baited with artifici:d lures based solely on
pheromones and not properly Integrated with the hostecosystem by inciuding host odours, wherever
necessary, may at times give erroneous results. Athorough evaluation of these considerations is a real
need. Drapekelal(I997) found thatspatialpattems
of planting and wlud blocking features influencedpheromoue trap catches of H. zea and suggested the
use of this information to modify pheromnne trap-based predictions of H. zen damage. These studiesneed to be extended to other insects also.
Pheromone traps have been of immense value in
several other areas of cotton pest management. A
classic example is the tracking of cotton boll weevil,
A.grandis grandis, as it spread to the sonthern parts of
American continent (Whilcomb & Morengo, 1985).
Pheromone traps were also used to evaluate the
success of sterile backcross releases ou population
suppression of H.mrescens (Laster el al, 1996). Traps
were successfully employed for detecting the tolerance
levels to insecticides in surveys on H.zea doring 1986-1994, for monitoring insecticide resistance in
P.gossypiel/a (Haynes el ai, 1987) and H.annigera(Horowitz el ai, 1993), and also in an evaluation
experiment nf attracticide against cotton leafwono,
Spndoplera litloralis Boisduval. Nevertheless,
there are instances, as in southern Portugal, where
pheromone !r:Ipping <bta were affected by extraneous
inflnences, sneb as predation by nocturnal avian fauna
(particularly, owls) which were found feeding on the
H. awigera male moths near pheromone traps. On
the contrary, al. Meierrose el aI (1996) found light
trap data of these moths to be more efficient andreliable.
Mass lrapping/a/lractieide approach
The aim of mass !r:Ipping is to deploy pheromone trapsin sufficient numbers over an area for an insert species
to be controlled by capturing a significant proportion
of pest population. In the case of Lepidoptera, varyingdegrees of success have been reported; a siguilicant
reduction in egg laying in E. insu/ana (McVeighe/ ai,
1979) and S/ittora/is (@ 5 trapsIba), (Campion el
ai, 1980) promising control of the third generation in
the case of H. armigero and suppression of the
population below detectable levels of P. gossypie/lamoths (@ 20 traps/ha) (Mafra-Neto & Habib, 1996).
However, In all these cases doubts remain about the
area-wide and proiouged success, because (I) in
Lepidoptera, the female sex pheromone attracts onlymales and then not all of them, and (2) since the males
are polygamous even a small proportion of un!r:lppedmales can continue to fertilize a substantial number of
females which have high egg laying potential, thereby
ensuring the presence of the targeted species in that
area. In the case of the boll weevil, where an
aggregation pheromoue is involved, mass trapping, at
least at low population levels holds significant promise.
A definitive field experiment on boll weevil indicatedthat as many as 92% of the males emerging from a
population were captured with a !r:Ip density of 14traps/ha (Uoyd el ai, 1983). In reality, such a !r:Ip
density is not practical for high-density populations. On
the contrary, with low population levels, a density of
2.5 trap""a resulted in a high rate of elimination of
boll weevils (Legge, el al, 1988), and such trapdeusities h:>.vebeen used in the south-eastern boll
weevil eradication programme in the USA (Planer,
1988). it should, however, be remembered that
difficulties involved in extensive deployment of traps in
fields would always be a handicap in the mass trappingapproach.
8t
A novel pheromone nse is the attracticide approach.
Dean & [jngren (1982) nsed a series of false trails of
gossyplure to lead pink bollworm males to an
insecticide-laced area with resultant fatality to males.
This could reduce the insecticide reqnirement,
especially as the pheromone acted like a synergist for
the insecacide, becanse male moths became agitated
and thereby more susceptible to the lethal effecis of the
insecacide. In NicarAgua, grandlure was used in
conjunction with an early sown cotton trap cropsprayed with insecacides to control cotton boll weevil
(Sterllng el. aI., 1989). It has been a practice in some
parts of cotton growing countries to use pheromone
sources laced with insecticide in the mating disrupaonmethod so as to inllict lethalJsnblethai insecacide
doses on males as they come in contact with the
pheromone sources, the sublethal effect causingrednced pheromone response in survivors. Anotherinnovaaon is the Boll Weevil Attract and Control Tube
(BWACT)that utilizes a combination of grandlnre, afeeding stimulant, and an insecacide, and was fonnd to
be three times more effecave than traps alone in
removing boll weevils from a local populaaon
(Villawso el aI. 1998). Jansen (1994) reported an
IPMstrategyin whichuse of BWACTalong withearlydestrucaon of stalks resulted in about 40% reduction
in the use of insecticides aimed at boll weevil control.
Largescale use of BWACTin Colombia,BrJziJandParaguay for successive years with a primary aim of
prevenaon of establishment of boll weevil in Argenanaand Bolivia has shown not ouly high levels of boll
weevil control, but also delayed first applicaaon and
minimised inseeacide sprays, reduced crop damage,increased square retention and gave economic profits
by way of savings in the cost of insecacides and
increased fibre producaon. It is therefore, evident that
the 'mass trapping' or 'attracacide' approach cannot
be a singular method of control, but can defiultely be apart of !PM strategy in cotton fields.
Mating disruption
Insecacide-based reducaon of populaaons of variousbollworms and also of the boll weevil is difficult
becanse the larvae are inaccessible, being lodged
inside the host assue. In contrast, mating disrupaon is
aimedat theadultstage,whichis exposedthroughout
its life. In the mating disrupaon approach, pheromone
formulations are nsed to prevent maang of adults
throngh mechanisms discussed in detali by Card. &Minks (1995)
Amongst insects infesting cotton, the mating disruption
technique is practiced most widely against pinkbollworm. Hollow fibre formulaaon of pink bollworm
pheromone was the first disruptant formulaaon to get
Environment Protection Agency (EPA) registration in
1978 (Doane & Brooks, 1981). In 1981, over 40,000
hectares of cotton crop in California received hollow
fibre mating disruption treatment whereby reducingplant damage and giving enhanced yields compared to
conventional insecticide treatment. In 1985, twist.tiepolyethylene formulation became available and
thereafter these two formulations were employed
continuously. Their use in an area-wide approach inArizona dnring 1990-93, resulted in decreased boll
damage from a pre-programme level of 23.3% - 0.0%,
reqniring only an occasional post-programme use ofinsecticides (CarM & Minks, 1995). Further, in an IPM
approach, use of pheromones in early crop season andinsecticides in late crop season proved successful both
in Egypt (Critchley ef al., 1984; Campion & Murhs,1985; Moawad ef. aI., 1991) where the area treated
Increased to several thousand hectares (Russel &
Radwan, 1993; El-Deeb ef aI., 1993), and also in
Pakistan (Critchley ef d, 1991; Ahmed & Attique,1993; Chamberlain, 1994) with smaller losses in seed
cotton yield in pheromone treated areas compared to
conventional treatment. Becanse of these resonndingsuccesses, nse of pheromone against pink bollworm is
growing everyyear.
While it was thought in the earlier days that
pheromones have to be nsed singly as they were
species specific, their nse in cotton crop protection hasproved otherwise, effecting cost reductions. A hand
applied twist-tie polyethylene tube pheromone
formOOon containing a combination of pheromonesof P. gossyPiella, E. viffella and E. insnlana was used
in Pakistan during 1986-89 in plot sizes ranging from
2.8 to 6.0 ha. Seasonal control was achieved usingpheromone alone or together with one insecticidetreatment. The level of control as well as the estimated
yields achieved were comparable to five applications ofinsecticides (Chamherlainel. aI., 1992). This indicated
82
that combined pheromone treatment could be usedand that it also was effective in smaller areas.
Experimeut' of Tanthaukar and co-workers
(unpublished observations) also showed that matingdisruptiou can be achieved in plots of 100-250 sq.m., if
the crop is isolated by a non-host crop or fallow land
for about 100 m on all sides. Combined pheromone
formulations have also proved successful in Israel
(Kehat & Dunkelblum, 1993). A combined pheromone
fonuulation of H. armigera and P. gossypiella
suppressed mating of both the species for more than
three months (Kehat el aI., 1998). They furtherreduced the dose of pheromone as web as number of
dispenserslha to suppress mating of individual species.
Matiog/communication disruption has also been
suecessfuliy attempted using the primary/secondary
components or analogues in case of Diaparopsiscastanea Hmps. and S. littoralis (Beevor & Campion,
1979; Campion el aI., 1980; Ellis et aI. 1980) and S.
exigua HObner (Mitchell el aL 1997). Since area-wide
application is more effective in mating disruption thanby individual farmers, the treatment lends itseif most
suitably to be used by goveruments or large fanners'co-operative organisations. However, there arc
difficulties in exploiting mating disruption on large
scale. Casagrande & Jones (1997) enumerated these
problems as : unsuitable formulations, agrooomic
constraints, inadequate knowledge of pest hiology,particularly population density fluctuations, number of
generationslyear and socio-economie constrAints.There are also other constraints such as: interactions
between different populations of a pest species,
migrdtion of males into treated fields, males attractingfemales for mating, the calling strategy of nativefemales (Carde & Minks, 1995) which can make ormar the results.
Research and Development
Semiochemicals
Host plants eulumeelsynergise pheromone production
and the response to it in several pests of cotton such as
H. ZeD,H. virescens, H. armigera, A grandis grandis,
(Dickens,1986; 1989), E. vittella (Tanthaukar, 1995)and T. ni (Landolt et aI., 1994). Reliable methods
should be developed to utilise this s')'Ilergism in cotton
crop protection. Female H. armigera moths are
attracted by a steam distiliate from pigeon pea plants. A
mixture of six sesquiterpenes, mixed in the proportions
found in the steam distillate, elicits the same
behavioural responses. This is a highiy promising
development that needs to be exploited for use as an
oviposition stimulant (Hartlieb & Rembold, 19<)6).
Pheromones for monitoring purposes have been
explored/exploited in cotton IPM. Integration of mating
disruption along with other management components
has its own place in pink bollworm suppression.
Several attempts have been made as in Egypt (Moawad,1993) and in Pakistan (Chamberlainet. aI., 1992)
while integration with avoidance of insecticides needs
more exploitation (Regupathy & Mabadevan, 1993).
Livemale T. ni moths attracted eonspeemc males andfemales in cotton fields (Landolt, 1995). This
phenomenon should be investigated for other cotton
pests also. It should also be found out if anymodifications in methodology and further infonuation
on pheromone use in cotton !PM are reqnired forfurther improvement.
Pheromones in cotton pest management
At times, sudden dramatic inere-",es in pheromone trap
catches oceor for insects such as Helicoverpa spp. andHeliothis spp. for which local populations alnne
cannot account for the magnitude of these catches. A
method of discriminating between local and migratory
captures needs to be developed so as to forecast the
likely arrival of the migrants, which come in relatively
large numbers and can devastate the cotton crop, as
happens in India in the case ofH. armigera.
Auto-dissemination of entomopaihogens involves the
deliberate use of insects to spread entomopathogens in
the insect habitat (Ignoffo & Shapiro, 1978; Yn, 19<)6).In this method, adnlt insects can be attracted to a
contantinant station, where they pick np the pathogenand transfer it to the eggs, the females doing this
directly and the males transferring it to the female
ovipositor while mating. The neonate larvae eat the
eggshell and ingest the inoculum. This is a very
attractive proposition with the development of efficient
methods of dispensing and it could prove to bea good
53
practice in cotton !PM. The initial experiments on this
approach in case of non-conon infesting as well as
cotton infesting insects (Nordin ef aI., 1991; Jackson
ef aI., 1992; Yu, 1996) using Nuclear polyhedrosis
Virus iuoculum (Yu & Brown, 1997) have given
promising results. The use of pheromones in
conjunction with innndative releases of Tricbogramma
chilunis Ishii snppressed pink hollworm and spotted
bollworm infestation to sub-economic level (Ahmad et
al.,1996).
Pheromone appllcation with sterile-moth release
progcammes is also highly promising, as has been
observed in the San Joaquin ",illey by the CaliforniaDepartment of Food and Agriculture for the
management of pink bollworm (Baker ef at., 1990).
This methodology needs to be evaluated for otherius«tstoo.
It is indeed n«essary to carefully evaluate whether the
practice of adding insecticide to disruptant pheromone
formulation will create foci for development of
ins«ticide resistance in insects, particularly in pink
bollworm against which, it has been practised for a
fuirly long time. The methodology is almost akin to the
nne used in experimeuts aimed at developingresistance in laboratory populations.
Based on the observations of Flint ef aI. (1977), a
fundamentally different approach to mating disruptionwas pursued by Flint & Meride (1983, 1984) and Flint
ef aI. (198S) in which they evaluated the creation of
pheromone composition imbalance by releasing ouly
the Z, Z isomer of pink boliworm pheromone. The
pheromone synthesis is generally expensive; however,
current research in this area may help to bring downthe cost of pheromoue treatmeut
ExperImeuts to study whether there is poteutial for the
evolutiou of resistance to the pheromoue iu the pink
bollworm were geuerally uegative (Haynes ef aI.,
1984).As the use of pheromones in pest management
will undoubtedly increase, it would be prudent to
monitor whether ius«t pests of cotton are developing
resistance to pheromones. For example, genetic
variation exists for the production and/or detection of
pheromone compound blends in natural populations
of pink bollworm (Collins & Carde, 1985, 1990 a, b).
Under such circumstances, selection may operate to
produce a strain of moths immune to disruption of
communication cansed by the 1:1 mixture currentiy
used for pink bollworm. VarIability in pheromone
response is also possible, as described by Doane &
Brooks (1980). They found that male pink bollwurm
would preferentially orient towards traps emitting high
rates of gossyplure in llelds.. Thns, there is an nrgent
need for the development of sprayable formulation,
which may have season-long efficacy.
Shoreyef aI. (1996) and Shorey& Gerber(1996)evaluated 'puffers' for distributing large amounts of
pheromone. This technique is eminently snitable for
cotton bollworm pheromones with aldehydecomponents, as in this technique the pheromone
chemicals are protected from oxidative degradationuntil they are released into air.
A field-portable electro-anteunogram system used by
Farbert ef aI. (1997) indicated that dispeusersdeployed at the edge of the crop could provide effective
protection to the cotton crop from pink bollworm.
Althongh mating disruption has proved to be an
effective control strategy in cotton, improvements and
optimisation in the methodology stili depend largely on
empirical field tests, such as: the number of
pheromone releasers, the distance between them and
other nnknown factors including the actual aerialconcentration given by a formulation, the fine scale
distribution of pheromone in treated plots etc.
In the case of cotton pests, which have developed
resistance to insecticides on a world-wide basis, therewill be a demand for enormous utilization of bio-
reactors for culturing pheromoue gland cells. This is
certaiuly a necessity because only the pheromone
glands produce the full and proper blend. Minks &Card. (198S) indicated that such bleuds will achieve
total mating disruption with the minimum quantity of
pheromones. Abernathy ef at. (1996) reportedinduction of pheromoue production in female H.
virescens by topical appllcation nf a pseudo-peptide
mimic of a pheromonotropic neuro-peptide. It may be
possible to develop future pest suppression techniques
based on the use of amphiphilic pseudo-peptides
designed to bind strongly to receptors therebycontinuously stimulating pheromone production so as
to cause a depletion of the pool of pheromoneprecursors.
84
The discovery of Pheromone Biosynthesis ActivatingNenro-peptide (PBAN) (Raina ef at., 1987: Raina &
Menn, 1987; Ma et al. 1996), has the potential to lead
to no'el strategies of exploiting cotton plantsthentselves to interfere with the behaviour and
ultimately the reproduction of insects, utilizing genetic
engineering techniques (Keely & Hays, 1987: Menn ef
aI., 1989). It has been possible to induce pheromoneprodnction in H. zea females by feeding PBANor its
analogues as well as clone a synthetic PBAN genebehind polyhedron promoter of AcMNPVand a cell line
infected with a recombinant baculovirus yieldedpheromonotropk activity (Raina ef aI., 1994; Vakharia
ef aI., 1995). Then a major constraint would he the
delivery of the peptide to the target organism.
In a decade that end< up with increased difficulties to
suppress cotton pests with the present !PM tools
further work on narrowing of gaps in the present
techniqnes of utiliring pheromones for both cotton pest
monitoring as well as mass-trapping, is warranted.
Acknowledgements
A.j. Tamhankar is grateful to Dr. Ii. Raghu, former
H...!d, Nuclear Agriculture Divisiou and Dr.P.C.
Kesavan,former Director, Biosciences Group, BARC.,
Mumbai, for useful discussions and for grantingperotission to publish this review.
References
1. ABERNATHY,R L., TEAL,P E. A., MEREDITH,}.A. and NACHMAN,R }. (1996) Induction of
pheromone production in a moth by topical
application of a pseudepeptide mhnic of a
pheromonotropic neuropeptide. Proceedings of
National Academyof Sciences, USA93,12621-25.
ADAMS,C.j., BEASLEY, C.A. AND HENNEBERRY,
T.J. (1995). Effectsof temperatureand wiudspeed on piuk bollworm (Lepidoptera:Gelechiidae) moth captures during springemergence. Jourual of Economic Entomology 88,
1263-70.AHMAD, N., ASHAF, M., HASSAIN, T., FATIMA,
B. AND NASRULLAH, A. (1996). Significance
of pheromones and parasites for the control of
2.
3.
cotton bollwornts in Paldstan. Pakistan Jourual of
Zoology 28,355-57.
4. AHMAD,Z. ANDATTIQUE,M.R (1993). Control
of pink bollworm with gossyplnre in Punjab,Paldstan. Interuational Organization for
Biological Control, West Palearctic RegionalSection Bulletin 16, 141-48.
5. BAKER,T.C., STATEN, RT. AND FUNT, H.M.
(1990). Use of pink bollworm pheromone in theSouthwestern United States.. In Behaviour
Modifying Chemicals for Insect Management:Application of Pheromones and Other Attractant<
(cd. by P.L. Ridgway, RM. Sllverstein and M.N.
Inscoe). pp. 417-36. Marcel Decker, New York,USA.
6. BEASLEY, C.A. AND ADAMS, C.j. (1994).
Relationships between environmental factors and
capture time of male pink bollworm
(Lepidoptera:Gelechiidae) moths in traps baited
with sex pheromone. Jonrnal of Economic
Entomology 87, 986-92.7. BEEVOR,P.S. AND CAMPION,D.G. (1979). The
field use of 'Inhibitory' components of
lepidopterous sex pheromone and pheromonemimics. In Chemical Ecology: Odour
Commnnication in Animals. (ed. by RF.Ritter).pp. 313-25. Elsevier/North Holland,
Antsterdam,Holland.
8. BENEDICT,J.H., URBAN,T.C., GEORGE,D.M.,
SEGRES, J.C., ANDERSON,D.}., McWHORTER,
G.M.ANDZUMMO,G.R (1985). Pheromone trapthresholds for management of overwintered boll
weevlls (Coleoptera: Curculionidae). Jonrnal ofEconomic Entomology 78,169-71.
9. BIERL,BA,BEROZA, M., STATFN,RT., SONNET,P.E. ANDALDER,V.E. (1974). The Pink bollworm
sex attractant. Journal of Economic Entomology67,211-16.
10. CAMPION, D.G. (1994). Pheromones for the
control of cotton pests. In. Insect Pests of Cotton
(ed. by G.A. Matthews and }.P. Tunstall). pp.505-34. CABInternational, Oxon, U.Ii.
II. CAMPION,D.G., BETlANG,B.W., NESBITT,B.F.,
BEEVOR, P.S" LESTFR, R AND POPPI, RG.(1974). Field studies of the female sex
pheromone of the cotton Ieafworm, Spodopteralittoralis (Boisd.) in Cyprus. Bnlletin of
Entomological Research 64, 89-95.
85
12. CAMPION, D.G. AND MURUS, ). (1985).Sex
pheromones for the cootrol of iosect pests in
developing coootries. Mededlingen van de
Faculteit von Landbouwwetenschappen van deRijiksuulversiteit Gent 50, 203-09.
13. CAMFION,D.G., McVEIGH,LJ. AND HUNTER-
JONES,P. (1981). The nse of sex pheromones forthe control of spiny bollworm Earlas insulana and
the American bollworm Heliothis armigera in
cotton growing areas of Syria. Food and
Agriculture Organisation, Unpublished Report, 10
pp.14. CAMPION,D.G., HUNTER-JONES,P., MCVEIGH,
L.j., HALL,D.R, LESTER,R ANDNESBIIT, B.F.(1980). Modificatiou of the attractiveoess of the
Egyptian cotton leafworm, Spodoptera littoratls
(Boisduvul) (Lepidoptera: Nocmidae) by
secondary pheromone components and related
cbemicals. Bulletin of Entomological Researcb70,417-34.
15. CARVE,RT. ANDMINKS,A.K. (1995). Control of
moth pests by mating disruption: Successes and
contralnts. Anoual Reviewof Entomology 40, 559-85.
16. CARVE,RT. ANDMINKS,A.K.(1997).InsectFberomone Research: New Directions. Chapman
& Hall, London, UK. 712 pp.
17. CASAGRANDE,E. AND JONES, O.T. (1997).
Commercial exploitation of mating disruption
technology: Difficulties encountered and keys to
success. International Orgaulsation for Biological
Control, West Palearctic Regional Station Bulletin.20,11-17.
18. CHAMBERLAIN,D.). (1994). Fheromonesin theIPM of cotton in Fakistan. Paper presented at the
Cotton Connection, Pesticide Actions Network,Hamburg, Germany. November, 25-26.
19. CHAMBERLAIN, DJ.,CRITCHLEY, B.R,CAMPION,D.G.,ATI1QUE,M.R, RAFlQUE,M. andARIF,M.L
(1992). Use of multicomponent pheromoneformulation for control of cotton bollworms
(Lepidoptera:Gelechiidaeand Nocmidae)inPakistan.Bulletinof EntomologicalResearch82,449-58.
20. COLLINS, RD. AND CARVE, RT. (1985).
Variation in heritability of aspects of pheromoneproduction in the pink bollworm moth
Pectinophora gossypiella (Lepidoptera:Gelechiidae). Annals of Entomological Society ofAmerica 78,2229-34.
21. COLLINS, RD. AND CARVE, RT. (1990.).
Selection for increased pheromone response In
the pink bollworm Pectinophora gossypiella(Lepidoptera: Gelechiidae). Behavior Genetics20,325-331.
22. COLLINS, RD. AND CARVE, RT. (1990b)Selection for increased pheromone titre in the
pink bollworm Pectinophora gossypiella
(Lepidoptera: Gelechiidae). FhysiologicalEntomology 15,141-47.
23. COPPEDGE,).R, BULL, D.L., HOUSE, V.S.RIOGWAY, RL., BOTRElL, D.G., CORK,A.,CHAMBERlAIN,DJ., BEEVOR,P.S.,HALL,D.R,NESBIIT. B.F., CAMPION,D.G. AND AITIQUE,M.R. 1988. Components of female sexpheromone of spotted hollworm, Earlas vittella f.
(Lepidoptera:Noctuidae) :Identification and field
application in Pakistan. ).Chem. Eco!. 14, 929-945.
24. CRITCHLEY,B.R, CAMPION, D.G., MCVEIGH,E.M.,MCVEIGH,L.j., JI.STUM,AR, GORDON,RF., MARKS, GJ., NASR EL-SAYED,A AND
HOSNY, M.M. (1984). Microencapsulated
pheromones in cotton pest management. In.Proceedings of British Crop Protection
Conference: Pests and Diseases. pp. 241-45.
British Crop Protection Council, Croydon, Surrey,UK
25. CRITCHLEY, B.R, CHAMBERlAIN,D.j., CAMPION,D.G., AITIQUE, M.R, All, M. AND GAFFAR.A
(1991). Integrated use of pink bollwormpheromone formulations and selectedconventional insecticides for the control of the
cotton pest complex iu Paltistan. Bulletiu of
Eutomological Research 81, 371-78.26. DEAN, D.A. AND LINGREN, P.D. (1982).
Confusiug and killing cotton pests. Agricultural
Research (Washingtou D.C.) 31,4-5.27. DEVAPRASAD,V., RAMBABU,L. ANDREDDY,
G.P.V. (1993). An action threshold of
Helicoverpa armigera Hb. based on pheromonetrap catches in cotton. Indian Joumal of Plant
Protection21,17-18.
28. DHAWAN, A.K. AND SIDHU, A.S. (1988).
Correlation between the moth catch gossyplure
86
BARC NEWSLETTER Founder's Day Special Issue 2001
baited traps and pink bollworm incidence in F-
414 llirsutum collOo. Indian Journal of
Eotomology 50, 55-60.
29. DICKENS,J.C.(l986).Orieotation of boll weevil,
Anthomonas grandis Boh. (Coleoptera:
Cnrcnllonidae) to pheromone and volatile host
compounds in lIIe laboratory. journal of
Economic Fntomology 12, 91-98.30. DICKENS, J,c, (1989). Green leaf volatiles
eohance aggregation pheromone f boll weevil,
Anthonomus grandis. Fntomologia Experimeotilis
etAppllcata 52,191-203.31. DICKENS,J,C., JANG, E.B., liGHT, D.M AND
ALFORD,A.R. (1m). Enhancement of insect
pheromone responses by green volatiles eohancesex attrWant pheromooe of lIIe IObaccobudworm, Hellothis Yiresceos (Lep., Noctuidae).
Naturwissenscb3f 77,29-31.
32. DICKENS,J,C., SMITH, J,W. AND UGIIT, D.M.
(1993). Greeo leaf volatiles enhance sex
attractant pheromone of lIIe tobacco budworm,Hellothis virescens (Lep., Noctuidae).
Chemoecology.4,175-177.33. DOANE, U., AND BROOKS, D.W. (1980).
Research and developmeot of pheromone for
insect control willI emphasis on pink bollworm
Pectinophora gossypiella. In. Proceedings of
Colloquium on Managemeot of Insect Pests.Gainseville,Florida. USA.March, 1980.
34. DOANE,U.ANDBROOKS,D.W. (1981). Research
and development of pheromone for insect control
willI emphasis on the pink bollworm. In.Managemeot of Insect Pests with Semiocheoticals(ed. by E.R Mitchell). pp. 285-303. Pleoum
Press, New York, USA.
35. DOWNHAM, M.CA, McVEIGH, L.J. AND
MOAWAD,G.M. (1995). Field investigation of an
attractiveness control technique using lIIe sex
pheromone of the Egyptian cotton leafworm,Spodoptera llllOralls (Lepidoptera: Noctnidae).
Bulletin of FnIOmological Research 85, 463-472-
36. DRAPE!(, R.J" CROFT, BA AND FISHER, G.
(1977). An examination of spatial input
paramete" in order to improve com earworm(Lepidoptera: Noctuidae) damage predictions for
a pheromone trap catch regression model. Pan-
Pacific Entomologist 73,9-15.
37. DUNKELBWM,E., GOTIllLF, S. AND IEHAT, M.
(1980). lderttification of the sex pheromone of
lIIe collOn bollworm, Hellothis armigera, in
Israel. Phytoparasltica 8, 209-11.38. DUNKELBLUM,E., IEHAT, M., GOTHlLF, S.,
GREENBERG,S. ANDSKLARASZ,B. (1982).
Optimiscd mixture of sex pheromoruU
componeots for trapping of male Spodoptera
tillOralls, in Israel. Phytoparasitica 10, 21-26.39. EWS, P.E., BRIMACOMBE,1.C., McVEIGH,l.J.
AND DIGNAN,A (1980). Laboratory experiments
ou lIIe disruption of the mating in the Egyptian
cotton leafworm, Spodoptera llttoralls
(Boisduval) (Lepidoptera: Noctnidae) by excess
of ferru1lepheromone. Bulletin of EolOmologicaiResearch 69, 673-84.
40. El-DEEB,YA, EL-HAMAKY,MA ANDMOAWAD,
G.M. (1993). large scale use of pink bollwormsex pheromone formulatious integrated willIconventioruU insecticides for the control of collOn
pests in Egypt. InternatioruU Organisation forBiological Control, West Palearctic RegioruU
Section. Bulletin. 16,213-319.
41. FARBERT,P.,KOCH,U.T.,FARBERT, A.,SfATEN,R.T. ANDCARDt,R.T. (1997). Pheromooecoocentration measured willI electroantenoogram
in collOn fields treated willI mating disruption of
Pectinophora gossypiella (Lepidoptera:Gelechiidae). Enviroomental Eotomology 26,1105-16.
42. FUNT,H.M. AND MERKLE,J,R. (1983). Pinkbollworm (Lepidoptera: Gelechiidae):
Communication disruption by pheromone
composition imbal2nce. Journal of Economic
Eotomology 76, 46-46.43. PUNT,H.M. ANDMERKLE,J,R.(1984). Thepink
bollworm (Lepidoptera: Gelechiidae): Alteration
of male response to gossyplnre by release of itscomponent Z, Z-isomer. Journal of Economic
Eotomology 77,1099-1104.44. PUNT, H.M., aJRTICE, N.T.ANDYAMAMOTO,A.
(1988). Pink bollworm (Lepidoptera:Gelechiidae): Further test willI (z, Z)-isomer of
gossyplure. Journal of Economic EolOmology 81,
679-83.
45. PUNT, H.M., SMITH, R.I.., FOKEY,D.E. ANDHORN,B.R.(1977).Pinkbollworm:Responseof
87
BARC NEWSLETTER Found,,', Day Special l"ue 2001
males to (z),)- and (l,E) isomers of gossyplure.
Eovironmental Entomology 6, 274-75.46. FLINT,H.M.,BAlASUBRAMANIAN, M., CAMPERO,
J., STRICKLAND,G.R, AHMAD, Z., BARRAL,J.,BARBOSA,S. AND KllAUL, A.F. (1979). pink
bollworm response of oative males to ratios of
(z),) and (l,E)- isomers of gossyplure in several
cotton growing areas of the world. Journal of
Economic Entomology 72, 758-62.
47. FRISBIE, RE. (1989) Lntegrated PestManag:unent Systems and Cotton Production.
John Wiley& Sons. London, D.1l
48. FRISBIE,RE., EL-ZIK,IlM. AND WILSON,LT.
(Eds.) (1989). Lntegrated Pest Management
Systems and Cotton Production. Wiley
Lnterscience,John Wiley& Sons, New York, USA..49. GAIIIJKAR,RT. (1991). Control of cotton insect
and mite pests in sub-tropical Africa : CUrrentstIlUS and future needs. Insect Science and its
Application. 12, 313-38.50. l\ALL, D.R, BEEVOR, P.S., LESTER,R. AND
NESBITT, B.F. (1980). ( E-E ) -10,12-
hexadecadienal: A component of the fentale sex
pheromone of the spiny bollworm, EariJosinsuIana (Buisd.) (Lepidoptera: Nocmidae).
Experientia 36,152-53.51. HALL, D.R, BEEVOR,P.8., CAMPION,D.G.,
C11AMBERLIIN,D.J., CORK, A., WIllTE, RD.,ALMESTAR,A. AND HENNERERRY,T.J. (1992).Nitrate esters: Novel sex pheromone componentsof the cotton leaf perforaror, Bacculatrix
thurberiella Busck. (Lepidoptera: Lyonetiidae).
Tetrahedron Letters 33, 4811-14.
52. HARDEE,D.D., McKIBBEN,G.H., RUMMEL,D.R,HUDDLESON,P.M. ANDCOPPEDGE,J.R(1974).
Response of boUweevils to component ratios and
doses of the pheromone, Grandlure.Environmental Entomology 3,135-138.
53. HARTLIEB,E. AND REMBOIl>,H. (1996).Behavioral response of female Helicoveepa(Hellothis) armigera Hb. (Lepidoptera:Nocmidae) moths to synthetic pigeon pea(Cajanus cajan L.) kairomone. journal ofChentical Ecology 22, 821-37.
54. HAYNES,IlF., IJ, W.G.ANDBAKER,T.C. (1986).
Control of pink bollworm moth (Lepidoptera:
Gelechildse) with insecticides and pberomones
(Attracticides): Letltal and sublethal effects.
JoncnalofEconomicEntomology79,1466-71.55. HAYNES,IlF., GASTON,LIl, POPE,M.M. AND
BAKER,T.C. (1984). Potential for evolution of
resistance to pheromone: Inter-individual and
inter-populational variation in chemical
communication systems of pink bollworm moth.
Journal ofChentical Ecology 10, 1551-65.
56. HAYNES,IlF., MILLER, T.A., SATETN,RT., IJ,
W.G.AND BAKER,T.C. (1987). Pberomone trap
for monitoring insecticide resistance in pinkbollworm moth (Lepidoptera: Gelechlidse): A
new tool for resistance management.
Environmental Entomology 10, 84-89.57. HEDIN,P.A.,HARDEE,D.D., THOMSON,A.C.AND
GUE1DNER,RC. 1974. An assessment of the life
time biosynthesix potential of the male boll
weevil. Joucnal of Insect Phl'iology. 20, 1707-1712.
58. HENDRICKS,D.E.ANDSHAVER,T.N.(1990).Persistence and performance of pheromoneformulated with or without Z-II-Hexadecen-I-OC
in pre-hait for trapping tobacco budworm moths.
Southwestern Entomologist 15, 245-51.59. HOROWITZ,A.R ., SEIJGMEN,I. M ., FORER,G.,
BAR, D AND ISHAAYA,1 .(1993). Preventive
insecticidal resistance strategy in Hellcoverpa (
Hellothis) armigera (Lepidoptera: Nocmidse) in
lsraeili cotton. Journai of Economic Entomology86,205-12.
60. HUMMEL, H.E., GASTON,LIl, SHOREY,H.H.,KAAE, RS., BYRNE, 1lJ. AND SILVERSTEIN,RM.(l973). Cbrification of the chemical stIlUS
of the pink bollworm sex pheromone. Science181,873-75.
61. IIUTCII1SON, W.D., BEASLEY,C.A. ANDHENNEBERRY,T.J. (1988). Efficacy of selected
insecticides on pink bollworm ovipositioo in
cotton. pp.309-311. In Proceedings of Beltwide
Cotton Production Research Conference, (ed. ByT.C Nelson),January,3-8, 1988. New Orleans,National Cotton Council, Memphis, Tennessee,USA.
62. IGNOFFO, C.M. AND SHAPIRO, M. (1978).
Characteristics of baculoviros preparations
processed from living and dead larvae. Journal of
Ecooomic Entomology 71,186-88.
88
63. JACKSON,D.M., BROWN,G.C.,NORDIN,G.1.ANDJOHNSON,D.W(1992) Auto-disseminationof abaculovirus for management of tobacco
budworms (Lepidoptera:Noctuidae) on tobacco.
JournalofEconomicEntomology.88, 710-719.
64. JANSEN, H.G. (1994). Integrated cotton
production in Nicaragua. Paper presented at the
Cotton Connection, Pesticide Actions Network,
Hamburg, Germany, November 25-26, 1994.65. KEELEY, 1.1. AND HAYES, T.K.(1987).
Speculations fur biotechnology applications forinsect neuroendocrine research. Insect
Biotechnology. 17,639-51.
66. KEllAT, M. AND DUNKELBLUM,E. (1993). Sex
pheromones: Achievements in mnnitoring andmating disruption of cotton pests in IsraeL
Archives of Insect Biochemistry and Physiology
22,425-31.67. KEllAT, M., ANSHELEVICH,1., GORDON,D.,
BAREL, M. AND DUNKELBLUM,E. (1998).
Evaluation of Shin-Etsu twist-tie rope dispensers
by the mating table technique for disrupting
mating of the cuttun budworm, Helicoverpa
armigera (Lepidoptera:Noctuidae) and the pink
bollworm, Pectinophopra gossypielia
(Lepidoptera: Gelechiidae). Bulletin of
Entomological Research 88,141-48.68. KEHAT,M. GOTHILP,S., DUNKELBLUM,M. AND
GREENBERG,G. (1981). Captures of Earlas
insulana males in water traps and dry funnel traps
baited with synthetic pheromone and virgin
females. Phytoparasitica 9,149-151.69. KEHAT,M., GOTHILP,S., DUNKELBLUM,E. AND
GREENBERG,S.(1980). Field valnation nf female
sex pheromone components of the cottonbollworm, Heliothis armigera. Entomologia
Experimentalis etApplicata 27,188-93.70. KIRSCH, P. AND LINGREN, B. (1993).
Commercial advancement of pheromone related
monitoring and control technology. International
Organisation for Biological Control, WestPalearctic Regional Station Bulleen. 16, 121-27
71. KLUN,JA., PUMMER,JB., BIERL-LEONHERDT,B.A., SPARKS,A.N.,AND CHAPMAN,0.1.(1979).Trace chemicals: The essence of sexual
communication system in Heliothis species.
Science204, 1328.
72. KLUN,JA., PUMMER,JB., BIERL-LEONHERDT,B.A., SPARKS,AN., PRIMIAN!, M., CHAPMAN,O.L., LEE, JK. AND LEPONE,G. (1980). Sex
pheromone chemistry of female corn earwormmoth, Heliothis lea. Journal of Chemical Ecology
6, 165-75.73. KORAT, D.M. AND LINGAPPA, S. (1995).
IulIuence of weather factors on the pheromone
trap catches of cotton bollworm moths. Indian
Journal of Plant Protection 23, 188-90.74. LANDOLT,P.J.ANDHEATH,B.B. (1990).Sexual
role reversal in maie-finding strategies of the
cabbage looper moth. Science 249, 1026-28.
75. LANDOLT,P.J.ANDPHlUJPS,T.W. (1997). Host
plant tuiIuences on sex pheromone behaviour of
phytophagons insects. Annual Review ofEntomology 42 ,371-391.
76. LANDOLT, P.J, HEATH, B.B., MILLER, JG.,DAVIS-HERNANDEZ,K.M., DUEBEN,B.D. ANDWARD,K.E. (1994). Effects of host plant,Go";ypium hirsutum L., on sexuai attraction of
cabbage looper moth, Trichoplusia ni (Hubner)(Lepidoptera: Noctuidae). Journal of Chemical
Ecology 20, 2959-74. LASTER,M.1., HARDEE,D.
D. AND SCHNEIDER,JC. (1996). Heliothis
virescens (Lepidoptera: Noctuidae): lulluence of
sterile backcross releases on suppression.Southwestern Entomologist 21, 433-44.
77. LEGGET,J.E., DICKERSON,W.A.ANDLLOYD,E.P.(1988). Suppressing low level boll weevil
populations with traps: lulluence of trap
placement, grandlure concentration and
population levels. Southwestern Entomologist 13,
205-16.
78. LEONARD, B.B., GRAVES,JB., BURRIS,E.,PAVLOFF,A.H. ANDCHURCH,J.(1989). Heliothis
spp. (Lepidoptera: Noctuidae) captures in
pheromone traps: Species composition and
response to oviposition in cotton. Journal of
Economic Entomology 82, 574-79.79. UGHT, D.M., FLATH, B.A., BUTIERY, B.G.,
ZALOM,F.G.,AND RICE, B.E. 1993. Host plant
green-leaf volatiles synergize the synthetic sex
pheromones of the corn earworm and codliog
moth (Lepidoptera). Chemoecology4, 145-52.80. LINGREN,P.D., BURTON,J, SHELTON,W. AND
RAULSTON,JB.(1980). Nightvision goggles: For
89
NEWSLETTER Found,," Day Speciall"u, 2001
design, evaluation and comparative efficiency
determination of a pheromone trap for capturing
live adnlt male pink bollworm. Journal ofEconomic Entomology 73,622-30.
81. LLOYD, E.P., McKIBBEN, G.H., LEGGIIT, J.E. AND
HARTSTACK, A.W. (1983). Pheromone for survey,
detection and control. In Cotton Insect
Management with Special Reference to Boll
Weevil. (ed. by IU. Ridgway,E.P. Lloydand W.H.Cross). pp. 179-205. Agriculture Handbook No.
589. United States Department of Agriculture,
Agricultural Research Service, Washington, USA.82. LOPEZ, J.D. Jr., GOODENOUGH, J.L. AND
HENORiCliS, D.E. (1988). Evaluation of two
pheromone dispensers in combination with
phlstic and wire cone traps for tobacco budworm(Lepidoptera:Nocmidae). Journal of Economic
Entomology 81,1750-53.83. LOPEZ, J.D. Jr., SHAVER, T.N. AND
GOODENOUGH, J.L. (1990). Multispeciestrapping of Helicoverpa (Heliothis),ea,
Spodoptera frugiperda, Psuedaletia unipuncta
and Agrotis ipsilon (Lepidoptera: Noctuidae).
Journal of Cbemical Ecology 16, 3479-89.
84. MA.P.W.K.,ROLOELOFS,W.L.ANDJURENKA,RA.(1996). Characterisation of PBAN and PBAN-
encoding neuropeptides in the central nervous
system of the com earworm, Helicoverpa 'ea.Jnnrnal of Insect Physiology42, 257-66.
85. MAFRA-NlITOAND HABIB, M. (1996). Evidence
that mass trapping suppresses pink bollworm
populations in cotton fields. Entomnlogia
Experimentalis et Applicata 81, 315-23.86. MAKKAR,A.W. AND KOSTANDY,S.N. (1995).
Relationship between spiny bollworm males
attracted to pheromone traps and larval
infestation in cotton bolls. Annals of AgriculturalScience, MoshtohorB 33, NMI529-38.
87. MARKS.(1976). Field studies with the synthetic
sex pheromone and inhibition of the red
bollworm, Diparopsis castanea Hmps.(Lepidoptera:Noctuidae) in Malawi. Bulletin of
Entomological Research. 66, 279-300.
88. MATTBEWS,C.A. AND TUNSTALL,J.P. (1994).
Insect Pests of Cotton. CABInternational, London,
U.K.593pp.
89. McWElGH, LJ., PATON, E.M. AND HALL,D.R
(1979). Factors alIecting the performance of
pheromone traps for male Spodnptera littoralis.In. Proceedings of British Crop Protection
Conference: Pests and Diseases, pp. 409.19.
British Pest Control, Croydon, Surrey, U.K.90. ME1ERROSE,C., MELISSE, M., NESKAKIS,A.,
WAGNER,L.ANDWIEDIGER,J. (1996).Theuseof photovoltaic insect traps for the establishment
of a forecast system against noctuid pests in south
Portugal. Mededlingen Faculteit
Landbouwkundige en Toegepaste BiologischeWetenschappen Universiteit Gent 61 (3A), 773-76.
91. MENN, J.j., KLNG, E.G. AND COLEMAN,RJ.
(1989) Future control strategies for Heliothis in
cotton. 10. Pest Management in cotton (ed. by
M.B.Green and DJ.de Lyon). pp. 101-121. EllisHarwood Ltd., Chichester, U.K.
92. MINKS,A.K.ANDCARD!!,RT. (1988). Dismption
of pheromone communication in moths: 15 the
natural blend really most efficacious?
Entomologia Experimentalls & Applicata 49, 25.
36.93. MITCHELL,E.R, KEHAT,M., TINGLE,F.C. AND
Mc LAUGHLIN,R (1997). Suppression of matingby beet armyworm (Noctnidae:Lepidoptera) in
cottnn with pheromone. Journal of Agricultural
Eotomology 14,17-28.
94. MOAWAD,G.M. (1993). Commericial use of pinkbollworm (Pectinophora gossypiella) pheromoue
in Egypt. luternational Organisation for BiologicalControl, West P:1learctic Regional Section
Bulletin. 16, 175.
95. MOAWAD, G.M., KHIDR, A.A., ZAKl, M.,
CRITCHLEY,B.R, MCVEIGH,J. AND CAMPION,
D.G. (1991). Large scale use of hollow fibre andmicro-encapsulated pink bollworm pheromone
formulation integrated with conventional
insecticides for the control of cotton pest
complex in Egypt. Tropical Pest Management 37,
10-16.96. NAlK,M.1., LINGAPPA,S., HlREMATH,I.G. AND
SHIVANNA,B.K. (1997). Pheromone trap to
monitor adult spotted bollworm, Earlas vittella
(F.) on cotton. Mysore Journal of AgriculturalScieuces 31, 33-35.
90
NEWSLETTER Founders Day Special b,ue 2001
97. NFSBITf,B.F.,BEEVOR,P.S.,COLE,R.A.,LESTER,R. AND POPPI,R.G. (1975) The isolation and
identification of the female sex pheromone of thered bollworm moth, Diparopsis castMea. Journal
oflnsectPhysiology21,1091-98.98. NFSBITT,B.F., BEEVOR,P.S.,HALL, D.R. AND
LESTER,R. (1979). Female sex pheromonecomponents of the cotton bollworm, Heliothis
armigera. Journal of Insect Physiology 25, 535-41.
99. NFSBITT,B.F., BEEVOR,P.S., HALL, D.R. AND
LESTER,R. (1980). (Z)-9-hexade<:enal : A minor
component of the female sex pheromone of
Heliothis armigera (Hubner).
(Lepidoptera:Noctuida£). EntomologiaExperimentalis et Appllcata 27, 306-311.
100. NORDIN,G.L, BROWN,G.C. ANDJACKSON,D.M.(1991) Trans-ovumtransmissionof twonuclear
polyhedrosis viruses (Baculovirida£) by adulttobacco budworm and viral persistence on
tobacco budworm and viral persistence on
tobacco foliage. Transactions of KentuckyAcademyof Sciences. 52, 33-39.
101. PAGE,F.D. MODNlI, M.P. AND STONE,M.E.
(1984). Use of pheromone trap catches to
predict damage by pink bollworm larvae in
cotton. In. Proceedings of Fourth Australian
Applied Entomological Research Conference,Adelaide, Pest Control: Recent Advancements and
Future Prospects. pp.6B-73. South Australian
Government Printers, Adelaide, Australia.
102. PLANER,F.R. (1988). Sootheastboll weevileradication programme. In. Proceedings of the1988 Beltwide Cotton Production Researcb
Conference,pp. 239-40. NewOrleans,January3-8, 1988. Cotton Council of America, Memphis,USA.
103.POPE,M.M.,GASTON,LK AND BAKER,T.C.(1984). Composition, quantification andperiodicity of sex pheromone volatiles from
individmd Heliothis lea females. Journal of Insect
Physiology30, 943-45.
104.QURFSHI,ZA ANDAHMED,N. (1989). Efficacyof sex pheromones for the control of three
bollworms of cotton. Jonroal of Applied
Entomology 10, 386-89.
105. RAINA,A.K AND MENN,J.J. (1987). Endocrine
regulations of pheromone production inLepidoptera. In. Pheromone Biochemixtry (ed. by
G.D. Brestwich and G.J.Blomqnisto). pp. 159-74.
Academic Press, Orlando, florida, USA.
106.RAINA,A.K.,KINGAN,T.G.ANDMATTOO,A.K.(1972). Chemicalsignalsfrom host plantsandsexualbehaviourin a moth.Science255, 592-594.
107.RAINA,A.K., RAFAElJ,A. ANDKINGAN,.T.G.(1994). heromonotropicactivityof orallyadministered PBAN analognes in Helicovecpa lea.
Journal ofInsect Physiology. 40, 393-397.108.RAINA,A.K.,JAFFES,H., KLUN,JA., RIDGWAY,
R.L.,ANDHAYFS,D.K. (1987).Characteristicsofa neurohormone that control sex pheromoneproduction in Heliothis rea. Journal of Insect
Physiology33,809-14.109. RAMASWAMY,S.B.,RANDLE,DA ANDMA, W.K.
(1985). Fieldevaluationof the sex pheromonecomponents of Heliothis virescens (Lepidoptera:Noctuidae) in -<:one traps. Environmental
Entomology 14,293-96.llO. REGUPATHY,A. ANDMAHADEVAN,N.R. (1993).
Management of pink bollworm of cotton through
gossypiure and insecticides. Indian Journal ofPlant Protection 21, 230-33.
lll. RIDGWAY,R.L., INSCOE,M.N. AND DICKERSON,WA (1990). Rollof boll weevilpheromoneinpest management In Behaviour Modifying
Chemicals for Insect Manngement (ed. by R.L.
Ridgeway, R.M. Silverstein and M.N. Inscoe). pp.437-71. Marcel Decker, New York, USA.
ll2. ROELOFS,W.L, 1IlLL,A.S.,CARD~,R.T.ANDBAKER,T.C.(1974).Sexpheromonecomponentsof the tobacco budworm moth, Heliothisvirescens. We Sciences 14, 1555-62.
113. RUSSELL,RA AND RADWAN, S.M. (1993).
Modelling pink bollworm mating disruption in
Egyptian cotton. International Organization for
Biological Control, West Palearctic RegiomdSection Bulletin 16, 268-75.
ll4. SHAVER,T.N.,HENDRICKS,D.E.ANDLOPEZ,J.D.Jr. (1989). Influence of ZII-hexadecen-I-Ol on
field performance of Heliothis virescens
pheromone in PVC dispenser as evidenced by trap
91
capture. Journal of Chemical Ecology 15, 1637-45.
115.SHOREY,H.H. ANDGERBER,RG. (1996).Disruption of pheromone commnnication
throngh the use of puffers for control of beet
armyworm (Lepidoptera: Noctuidae) intomatoes. Enviromnental Entomology 25, 1401-
05.
116. SHOREY,H.H., SISK, C.B. AND GERBER,RG.
(1996). Widely separated pheromone releasesites for disruption of sex pberomone
communication in five species of lepidoptera.
Enviromnental Entomology 25, 446-51.117. SHOREY, H.H., SUMMERS,C.G., SISK,C.B. AND
GERBER,RG. (1994).Disruptionof pheromonecommunication in Spodoptera exigua(Lepidoptera: Nocmidae) in tomatoes, aIfulfa and
cotton. Environmental Entomology 23, 1529-33.118. SRIVASTAVA,C.P., PIMBERT,M.P. ANDREED,W.
(1992). Monitoring of Helicoverpa (Heliothis)
armigera (Hubner) moths with light and ils
pheromone trap in India. insect Science and i~
Application 13, 205-10.119. STERlING,W.C., WIlSON, LT., GUITIERREZ,A.P.,
RUMMEl, D.R, PH1illPS JR, STONE,N.D. AND
BENEDICT,JH. (1989). Strategies and tactics for
managing insec~ and mites. In International Pest
Manngement Systems and Cotton Production. pp.
267-325. john Wiley& Sons Inc. New York, USA.120. SUNDARAMURTHY,V.T. AND GAHUKAR,RT.
(1998). Integrated management of cotton insect
pests in India. Outlook on Agriculture 27,247-55.121. TADAS,P.L, SARNA1K,D.N., KliNE, H.K. AND
SATPUTE, U.S. (1994). Effect of weather
parameters on monitoring of cotton bollworms
with pheromone traps. PKV Research journal18(1),87-90.
122. TAMHANKAR,A.J. (1995). Sex pheromone gland
and calling behaviour of female spiny bollwormEarlas insulana (Boisduval). Entomon 20, 1-4.
123. TAMHANKAR, A.J, RAJENDRAN, T.P.,BHAMBU11KAR,M.W. AND HARWA1KAR,M.R
(1993). Optimum pheromone blend for pinkbollworm males: Evaluation with two
experimental designs. International Journal of
PestManagement39,111-12.
124. TAMAKI, Y. AND YUSH1MA,T. (1974). Sex
pheromone of the cotton leafworm, Spodoptera
littoralis. journal of Insect Physiology 20, 1005-14.
125. TAMAKI, Y., NOGUCHI, H. AND YUSHIMA, T.
(1973). Sex pheromone of Spodoptera litura (P.)
(Lepidoptera: Nocmidae): isolation, identification
and synthesis. Applied Entomology and Zooiogy 8,200-203.
126. TAMAKI, Y., OSHAWA,T., YUSHlMA,T. AND
NOGUCHI, H. (1976). Sexpheromone and
related components secreted by virgin females of
Spodopteralitura (P.) japanese journal ofApplied Entomology and Zoology 20, 81-RS.
127.TEAL,P.EA,TUMUUNSON,JH. AND HEATH,R
(1986). Chemical and behavioural analysis of
volatile sex pheromone componen~ released by
calling Heliotrus virescens (P.) females
(Lepidoptera: Noctuidae). journal of Chemcial
Ecology 12, 107-26.128.TEAL,P.E.A.,TUMUUNSON,JH., MclAUGHliN,
j.R, HEATH,R ANDRUSH,RA. (1984). (Z)l1-bexadecen-I-ol: a behaviour modifying chemical
present in the pheromone ghmd of femaleHeliothis lea (Lepidoptera: Noctuidae). Canadian
Entomologist 116, 777-79.129. TUMliNSON, j.H., HARDEE,D.D., GUELDNER,
RC., THOMPSON, A.C., HEDIN, P.A. AND
MINYARD, j.P. (1961). Sex pheromones
produced by male boli produced by male bollweevil: Isolation, identification and synthesis.
Science 166, 1010-12.
130. TUMliNSON,j.H., MITCHELL,E.R ANDYU, H.S.
(1990). Analysis and field evaluation of volatile
blend emitted by calling virgin females of beet
armyworm moth Spodoptera erigoa (HUbner).journal of Chemical Ecology16, 3411-23.
131. TUMUNSON,j.H., HENDRICKS,D.E., MITCHELL,E.R, DOOUTTLE, RE. AND BRENNAH,M.M.
(1975). Isoiation, identification and synthesis of
the sex pheromone of the tobacco budworm.
Journal of Chemical Ecology I, 203-14.132. VAKHAR1A,V.N.,RAINA,A.K.,KINGAN,T.G.,1995.
Synthetic pheromone biosynthesis activating
neuropeptide gene expressed in a baculovirns
expression system. Insect Biochemistry andMolecular Biology 25,583-89.
92
133.VEITER,RS AND BAKER,T.C. 0984).Behavioural responses of male Heliothis lea
moths in sustained flight tunnels to comhinationof four compounds identified from female sex
pheromone gland. Journal of Chemical Ecology10, 193-202.
134. VICKERS, N.]. ANDBAKER,T.C. 0997). Chemicalcommunication in Heliothine moths. VII.
Correlation between diminished responses to
point-source plumes and single filaments
similarly tainted with a behavioural antagonist.
Journal of Comparative Physiology A. Sensory
Neural and Behavioural Physiology 18O,523-36.
135. VILIAVASO,E.]., McGOVERN,M.L.ANDWAGNER,
T.1. 0998). Efficacy of bait sticks versus
pheromone traps for removing boll weevils
(Coleoptera: Curculionidae) from released
populations. Journal of Economic Entomology 91,637-40.
136. WHITMAN, J.A. AND RAO, G.V.K. 0993).
Pheromone trapping in south Asia: Review and
requirements. Bulletin OlLBISROP16,149-56.
137. WHITCOMB,W.H. ANDMORENGO, RM. 0985).
Use of pheromones in the boll weevil detection
and control programme in Paraguay. Florida
Entomologist 69, 153-56.
138.YlI, Z. 0996). Auto-disseminationof abaculovirusfor suppressionof beet armyworm,Spodoptera exigua HUbner (Lepidoptera:Nocmidae). M.S. thesis, University of Kentucky,
Lexington, USA.
139. YlI, Z AND BROWN, G.C.0997). Auto-
dissemination of a beet armyworm
(Lepidoptera:Noctuidae) baculovirus under
laboratory conditions. Journal of Economic
Entomolgy. 90, 1187-94.14O.YlISHIMA,T., TAMAKI,Y., KAMANO,S. AND
OYAMA,M.0974). Fieldevaluationofa syntheticsexpheromone,litiur,as an attractantformalesof Spodoptera litura (F.) (Lepidoptera:Noctuidae). Applied Entomology and Zoology 9,
147-52.
Aboot the author ....
Dr AJ. Tambankar did his MSc. (Agriculture) from Nagpur University and Ph.D. fromMPKV:
He Is currently heading the Pheromone and SIT group of Nuclear Agriculture and
Biotechnology Division, BARC. He has published several papers in national and international
journals on the subject of insect sex phermomoues and sterile insect technique.
93
BARe NEWSLETTER Found", DoySpecial/ssue20fJ/
Emission from Charge Transfer State ofDye-Sensitized TiOz Nanoparticles: A NewApproach to Determine the Back ElectronTransfer Rate and Verification of Marcus
Inverted Regime
Hirendn Nam Ghod.
Had;"ion Cherni",y & Chernk.! Oyn,rni" O;vi,ionBh,bha A<ornkRe,,",ch Cen'"
Introduction
ELECTRON TRANSFER (ET) BETWEENmolecular adsorbates and semiconductor
nanoparticles bas been a subject of intense
researcb interests for many years. The undersl2nding
of this fundamentalprocess is essential for theapplication of semiconductor nanoparticle materials in
photogcapby, solar energy conversion, W3Ste
degrndation, and nano-sale devices. For example,
photoelectrochemical solar cells based on dye.
sensitized nanocrystalline TiO, thin films bave receivedmuch attention in recent years because of their
potential applications as a cost effective alterrultive to
silicon based cells. Gratzel's group reported that solar
cells based on Ru(dchpy),(NCS), [dchpy=(4,4'-
Dicarboxy-2,2'-Bipyridine)] (or Ru N3) sensitized
nanocrystalline TiO, thin films could achieve a solar toelectric power conversion efficiency of about 10%. The
high conversion efficiency can be attributed to high
solar energy harvesting by the sensitizer and high
photon to current conversion efficiency. A high photon
to current conversion efficiency requires a fast electron
injection rate from the sensitizer to the senticonductorand a much slower back electron transfer rate to the
sensitizer.
It is very impo_t to underst2nd the forward and
backward electron transfer processes, especially their
dynamics in semiconductor nanoparticles and suitableadsorbates. So far most of the electron transfer
dynamics have involved dye molecules as the
adsorbates. In many of these stodies the dye molecules
are excited nsing suitable wavelength of light and
dynamics nf electron transfer is measured by theirtransient absorption or Dnorescence decay and
conseqnendy electron transfer rate CODSt2nrshave been
measured from these analyses. Back electron transfer
rates have been also measured by monitoring the
bleach recovery of the ground state absorption of the
dyes. Recently, femtosecond mid-IR spectroscopy has
been nsed to study the interfacial ET processes by
direcdy monitoring the injected electrons in the
semicouductor nanoparticles and also by observing the
vibrational spectral changes of the adsorbates. IR
stodies mostiy eliminate the spectral overlap problems
that hinder the estimation of ETdynamics in the visible
region. This approach is favored for SJrudladsorbates
such as SCN" and Fe(C//)o' which have been nsed tostudy the back electron transfer dynamics.
In the present article it is discussed that in the case of
coumarin-343 and xanthene dyes (Fluorescein (FL),
Di-bromo Flnorescein (DBF), Fluorescein
Isothiocyanate (FITC), 5(6) Carboxy Fluorescein(5,6 CF) and Eosin Yellowish (ET)) (Scheme I) when
94
~I o% LoH
OOH ~I
HO ""- 0
Coomari0343 Flo""".,;o
l:"cX " "" 'D I v! N.O vl..oHO / 0 ::,...;lo H 0
1100"",10 lwthloqaoote
S,hem,l
ad<orbed on the TiO, nanoparticle surface, a good
portion of the molecules form charge transfer
complex. On excitation of the above systems two
processes take place simultaneously. First adsorbed
dye molecules go to the excited state and then ioject
electron into the cooduction hand of the nanoparticle.
Second, when the photons excite the charge transfer
complex, electroo injection takes place directiy to the
conduction band of the nanoparticle rather than via the
excited state of the dye molecules. Back electron
transfer dynamics have been measured by monitoring
the blcarh recovery dynantics using time-resolved
picosecond spectroscopy. When the electron comes
back in the case of charge-separated species of CT
complex from the nanoparticle to the dye molecule, a
low quantum yield CT emission has been observed in
the dye-nanoparticle systems. Measnring the decay
of the CT emission by picosecond time-resolved
5(6)Co,6"'ylI00""'lo
~tOH
,. '"
HOJ 0 0
Di.b","", Fluo"""io
Emio y,limPlsh
fluorescence spectroscopy we get the dynamics of back
electron transfer reaction from nannparticle to the dye
molecule.
Experimental
Time-resolved absorption and emission measurements
were carried out using a picosecond laser pump-probe
spectrometer and a time-resolved fluurescence
spectrometer. Nanometer-size TiO, was prepared by
controlled hydrolysis of titaninm (IV) tetraisopropoxide
inwater.
Results & Discussion
a) Assignment of charge transfer absorption and
emission spectra:
To study the dye sensitized electron transfer reaction in
the excited state, it is very important 10 know the type
95
of interaction of the dye molecules when they adsorb
on the nanoparticle surface. Shown in Fig.I, the steady-state optical ahsorption spectra of fluorescein in water
and iu no, colloidal solotion. On additiou of no,
nanoparticle, the optical density of the dye increases
dramatically and goes broad and red shifted. Fig. la,
Fig. Ib and Fig Ie show the optical absorption spectra
of the dye in water, in ZrO, colloid and no, colloid.
"..,lSOti-!0"~
.. .35.
Fig. 1 NormaJ;z,d (A) Optical absmpUon sp"im of flM""""
dye (a) In ua"", (b) in zrO, eo/k)l~ and (c) in TiO, eollnid;and (B) Emission speclra of fluorescein dye (d) in water, (,)
InZrO,co/k)l~ and If) In TiO,eollnid.
It is seen from Figure I that the optical absorption of
the dye goes little red shifted as it is adsorbed on ZrO,surface. Here we have chosen zrO, nanoparticles
because it is non-injecting surface (E, = 5.2 eV) forthese dyes and can see the optical behavior of the dyesin the nanoparticle surface. The above results indicate
that on adsorption of the dye molecule on no,nanoparticle surface, a new ligand to metal chargetransfer (CT) band is formed.
no, + Dye---> [TiO,6 Dye"t.",
The experimental observation can be explained in the
following manner. When the dye molecules get
adsorbed on the surface, a fraction of the dyemoiecuies get just adsorbed on the surface of the
nanoparticle and the rest goes for charge transfer
interaction and gives a charge transfer (CT) complex.
Formation of charge transfer complex has been
observed in all the dye molecules studied when they get
adsorbed on no, nanoparticle snrface. Fig. Id, shows
the emission spectra of fluorescein dye in water at pH
2.8 peaking at 515 nm (~= 0.072). Fig. Ie shows the
emission spectra of fluorescein dye in ZrO, colloid at
pH 2.8 peaking at 518 om (~= 0.068). To see the
effect of the emission spectra of the dye, non-injecting
ZrO, surface was chosen. The shift in emission spectracan be attributed to the electronic effect of the
nanoparticle surface. But, when the dye is adsorbed on
no, surface, it gives a lower quantum yield red-shifted
broader emission spectra (Fig.1D (~= 0.048) peakingat 530 nm with a broad shoulder at 545 nm. This
emission is attributed to the combination of dye
emission, which does not inject electron in the no,nanoparticle and the charge transfer (CT) emission.Similar type of lower quantum yield with broad and
red-shilted emission spectra has been observed for
coumarin 343 and in other xanthene dyes. On
excitation, the photon excites the free dye molecule
adsorbed on the surface and also the CT complex of
the dye-TrO, nanoparticle. Some of he adsorbed dye
molecules, which get excited, inject electrons into the
conduction band of the nanoparticle while some does
uot inject. The dyes, which do not inject, give emission.
On the other hand, excitation of the charge transfer
complex goes for charge separation, which leads todirect injection to the conduction band of the
nanoparticle instead of via excited state of the dye. On
recombination of the charge separated CT complex, the
electron comes back to the parent cation. k; a result, it
96
giveschargetransfer emission.A schematicdiagmm is
givenin SchemeII to show the excitation, injection,back electrontransfer, chargetransfer emissionof theabovedye-nanoparticlesystems.
b) Assignment of transient absorption spectra:
Transient absorptioo spectra in the pico-secood time
domaio in the visihle region (500-900 om) have beeo
carried out for all the dye-sensitized no, nanoparticlesusing 532 mn picosecond laser pulses. Figure 2 shows
the transient absorption spectra of C-343 sensitized
TiO, nanoparticle. In this experiment a transient peak
at 635 nm with a shoulder at 580 mn is assigned to the
cation rJdical of C-343 and a broad positive feature in
the spectral region 700-900 nm is observed which isattributed to the conduction band electrons in the
nanoparticles. The band at 635 nm shows decay (Fig. 2
inset) and is due to the back reaction involving
recapture of the conduction band electrons hy the C-
343cationrJdicais.Thedecayof the observedsignalcan be fittedbya multiexponentialfunctionwith timeconstants of 190 ps and >5 ns.
~ ~2'"e~J:
~ OJifI!e~i!Ql! QO"
roo 700 000W..elmgth (nm)
000
Fig 2 Transient absorption spectra of coonwrin .343
sensitiZEd TiO, coilnid in water at (a) 35 ps. (b) 130 ps, (c)660 ps. (d) 1.98 m. and (e) 3.4 m aft" 532 om excitotion.{tmet: KiURtic,"=y trace ofC-343 cotion radiealat 630 nml
Wehavealso carried out transientabsorption studies
for all the xanthenedyessensitizedTiO, nanoparticles.Fig. 3 showsthe transientabsorption spectraof 5(6)Carboxy Fluorescein (56 CF) sensitized no, inthe spectral region 500-550mn peaking at 520nm
n__.-
0.1
Fig3 Transient absorption spectra of 5(6)-carboxy fIuv",,"o
sens/ti"d TiO, nanopartick in water at (a) 0, (b) 33. (c) 66,
(d) 330ps (e) 1.98 and (D 3.2 nsaft" excitotionat532nm
{lmet: Kinetic trace of the bkacb rn:ooeryat520 nmI
nanoparticleinwater.In thisexperimentableachpeak
and a broad positivefeaturein the spectralregion550-800 mn are observed.The bleachpeakappearsdueto
disappearanceof the ground state of the dye-nO,complex, on excitation hy the laser pulse.The hroadspectral absorption in the 550-800 mn region isattributed to the conduction hand electrons in the
nanoparticle. The reactions can be depicted in thefollowing scheme.
TiO,+ Dye"" [TiO,-Dyel- ~ ,.(TiO,) +Dy,Electron injection
where, Dye is the cation mdical of thedyeande. isthe conduction band electron in TiO, nanoparticle.However,the bleachat 520nm recovers(Fig3 Inset)
and is due to the back reaction involvingrecaptureofthe conduction band electronsby56CFcation mdical.The recomhination reaction was found to be
multiexponentialprocesswithtimeconstantsof 122psand> 5 ns.
Recombination
,.('fiO,) + Oy'- 3> [TiO,-DyeJ-
c) Time-resolvedfluorescence measurements:
In the present report we are goingto demoostratethat dynarulcsof back electron tranalerreactionfor
97
coumarin 343 and xanthene dyes sensitised TiO,nanoparticle can also be investigated by monitoring thered shifted emission band. The red shifted emission
band has been characterized as charge transfer (CT)
emission band as described earlier. Lifetimeanalysis of
the CT emission gives the exact rate of back eiectrontransfer reaction. The back eiectron transfer rate is
also cross-checked by a complimentary techniquenameiy picosecond transient absorption studies. Data
from both the techniques matched very weli.
After eiectrun injection, recombination reaction takes
piace for the charge separated CT compiex. When the
recombination takes place a charge transfer emissionis observed.
Recombination
le.(TiO) + Dye'l _ITiO,-Dyci_+hvo<emissiooJ
:;-.!!.Z-'0;c:C>
E
10' ~
~.,~'- .
, ~'-'-10'j"-, .~-"""--'.,.,.,
"', """"
10'j c'"' I
10' j-"1~\~10'
0 5 10 15Time (ns)
20
Fig 4 Single photon counting ,tudi" of (a) 5(6)-ca,boxyJluo"""n in waM, (b) 5(6) ca,boxy-Jlno"""n ,ensltizcd
Z"" colloid in watC>', and (c) 5(6)-carboxy Jluo""cin"""It/zed TiO, colloid in watC>' emi"ion ajlC>' 445 nmexcitation.
Shown in Figure 4 are the typical emission decay traces
for 56 CF in water, 56 CFsensitized ZrO, nanoparticle
and 56 CFsensitized TiO, nanoparticle in water. 56 CFin water gives singie exponential decay with lifetime of
2.6 as. To compare the excited state lifetime of 56 CF
dye on nanoparticle snrface, ZrO, was chosen because
the chemical nature of Zro, surface is very similar to
that of TiO, nanoparticle and the condnction band is
very higb in energy (E, = 5.2 eV). Thns, eiectroninjection is not possibie althongh the dye is adsorbed
on the surface, The ilnorescence lifetime of 56 CFon
ZrO, snrface is found to be 2.8 ns. On the other hand,
56 CF sensitized TiO, nanoparticle gives low quantumyield emission band. Tbe emission decay of the band at
550 urn was fitted by a multi-exponential function with
lifetimes of 129 ps(77.5%), 573 ps (14.4%) and 2.35
ns (8.1%). The first two decay components areattributed to the back electron transfer rate constants
and the iong component is assigned to the radiative life
time of 56 CF adsorbed on TiO, surface, which doesnot inject electron in the conduction band. It is to be
noted that the faster component of back electron
transfer reaction measured by picosecondspectroscopy is found to be very close to the values
measured by picosecond time-resolved fluorescence
measurements. The most important point is that time-resolved fluorescence measurement' can also be nsed
to study the back electron dynamics of dye-sensitized
TiO, nanoparticle systems.
d) Ba<k ewctron transfer reaction and marcusinverted regime:
Both classical and quantum mechanical theories of
electrontransfer (ET) predictsthat ETrates sbouldultimately decrease with increasing thermodynamic
driving force (.l,G'). Tbe back electron transfer rate
(k,o) can be given as
(211:
J[]2 I J (!'lJJ+A)2
}kBET= h HAB J4m\kTexl-~
where A is the total reorganization energy, H~ is the
coupling element, "'Go is the overill free energy of
reaction = (Ee- E~+), E, is the potential of electronsin the conduction band of the semiconductor (-O.52V),
E~+ is the redox potential of the adsorbed dye(Scbeme II). The prediction of "inverted" rate
behavior has convincingly demonstrated in many
organic, inorganic/organometallic and biological redox
processes in both liquid and frozen bomogeneous
solution but not many reports are available for
nanoparticle surface. In the present observation wehave demonstrated the inverted behavior for the back
electron transfer reaction of xanthene dye sensitized
TiO, nanoparticle system. Tbe free-energy (-"'G') has
98
been calculated from Eooof the charge-transfer (er)complex on the nanoparticle surface. In the present
investigation Eoo is being calculated from the crossing
point of cbarge-transfer excitation and emission
spectra and is sbown. Figure 5 is the plot of back
electron transfer rate (k,.,) vs Eoo' It has been observed
that with increasing Eoo, rate of back electron transfer
(k,") decreases.
troy DBF23
~.>::s22
FITC
t. FLU.56 CF
212.3 2.4 2.5
Eo., (eV)
Fig.5 Plot of lnlk.,) ""'US the drimngfo", IE,,)f"' ba<k,ketron t,anif" to the caUonrodicaJof the dy", E. i, thefjn€a'JuncUonof-JG.
Tbe observed trend of decreasing back electron
transfer rate (k",) with increasing driving force would
be consistent with Marcus inverted region behaviur if
the eiectronic coupling does not vary considerably inthese different xanthene dyes. Since ali these xantbene
dyes bave same anchoring gronp to no, and similar 1t'eiectron donating orbital, we think that the substitution
to the benzene ring shonid not cbange the electroncoupling much. We have attributed the observed trend
totheMarcosinvertedregionkineticbebavior.A more
detaiied analysis in the future would qnantify the
variation of the coupling strength in these different
'xanthene dye sensitized no, er complexes. Our
ongoing experimen~ are carried out to find out the
back electron transfer dynamics of charge transfer
complex In different solvent, changing their polarity
and temperature. These measuremen~ will help us todetermine many electron transfer parameters for the
heterogeneous electron transfer reaction, which havenot been determined so far.
Conclusions
Pico-second transient absorption and time-resolved
emission spectroscopy have been used to study
photoinduced electron transfer dynamics in coumarin
and xanthene dye sensitized no, nanoparticles inaqueous solntion. On excitation with laser pulse a bleach
has been observed for xanthenelfiO, systems and cation
peak for C-343IfiO, and a broad electron absorption
(550-800 run) in the nanoparticle have been found for
ali the dye sensitized no, nanoparticle systems. Thedynamics of the injected electrons have been measured
by monitoring the bleach recovery rate at the bleach peakand also monitoring the cation peak in the transient
absorption spectra. The electron injection times are
found to be pulse limited but the subsequent back lIT is
found to be a multi-exponential process.
On excitatioo of the xanthene dye seositized no,
nanoparticle systems, electron injection takes place intwo differeot ways. Electron injection to the cooduction
band of no, nanoparticle can take place through theexcited state of the dye. The other mechanism is
through direct injection to the conduction band on
excitation of the charge transfer complex. When the
recombination reaction takes place, charge transfer
(er) emission has been observed for ali the dye
"nsitized nanoparticle systems. Monitoring the eremission, the back lIT rate has been determined. We
have also found that back lIT rate for the xanthene dye
sensitized no, er complex decreases as the relative
driving force increases. Assuming a negligible change
in the electronic coupling, our resul~ provide the
evidence for the Marcus inverted region kinetics
behavior for an interfacial lIT process. Our ongoing
experiments are carried out in different dye-
nanoparticle er complexex to find out the back ET
dynamics on heterogeneous surface by changing thepolarity and temperature of the media. These
measurements will help ns to determine many electron
transfer parameters for the heterogeneons electron
transfer reactions and also lead to new insights of theMarcus inverted region interfacial lITkinetics.
99
References Acknowledgements
1 would like to thank Mr. G. Ramakrishna for pursue
many experiments and fruilful snggestions and Dr. A.V.
Sapre, Dr. T. Mukhetjee and Dr. J.P. Minal for theireonstant encuuragements
1. Ghosh, R.N.]. Phys. Chern. B 1999, 103,10382.
2. Ramakrishna, G.; Ghosh, R.N.]. Phys. Chern. B.
2001,105, 7000.
4fter obtaining his M.Sc. in Chemistry fmm II~ Kharagpur, in 1989, Dr. Gbosb joined Chemistry
Division, lIARC, in 1990, through lIARC Training School Course (33" batch). He obtained bis Ph.D.
degree in 1996 from Bombay University for his work on fast photo physical and photochemical
pmcesses in liquid and microhelerogeneous media. He did his post-doctoral studies,for tbe period of
1997-98, with Prof Tim Lion at the Chemistry Department of Emory University, Atlnnta, US>!, on
femtosecond interfacial electron transfer dynamics, using Infrared spectroscoPic detection. Dr. Ghosb
was awarded the "INS>! Young Scientist Medal" in 1998 for bis ouistanding Ph. D. work. He has also
received the prestigious "Anil Kumar Bose Memorial Award" in 2000 for the best output during the year after the INS>!
Young Scientist Award by the Indian Notional Sclenee Academy, New Delhi. Recently, he is involved in developing
Femtosecond laser spectrometer detecting in hotb visihle and infrared region. His current researcb interests include
ultrafast interfacial electron transfer and electron solvolion dynamics in microheterogeneous media.
100
BARC NEWSLETTER Founder', Day SpecioJ [".e 2001
Automation and Control: Technology
Spin-OffsY,S,MayyaConuo!l"""""en,,,.on DimionBhabhaAwnUcR=uch Cenue
Introduction
THIS ARfICLE REVIEWS SOME OF THE
significant spin-<>II technologies developed orbeing developed by BAReduring the last decade
in the area of automation & control. These projects
represent consolidatiou and extension of the
pioneering developments carried-ont by BARCover the
previous few decades. The article covers developmentof control >')'Stemsfor the Giant Metre-wave Radio
Telescopes (GMRT), vehicle mounted trackers,
airborne tracking & stabilisation systems, traction
control systems, real-time networks and land
navigation systems. The applications span a wide areaand include scientific research, indnstry, delence and
transportation sectors. The underlying technology ofcomputer hardware and software, used to realise these
>~stems is changing rapidly requiring constant re-
skilling. This has also increased user expectations in
tenDS of performance, miniaturisation, autonomy,maintainability and relial>ility- Purpose-bWlt
microcontrollers and DSPs make it possible now to
realise hard-real time applications nsing computers-
which-until now were monopoUsed by hardware
intensive solutions. Motor controllers, inverter and
converter control applications fall in this category.
In the following paragraphs, we look at the abovc
developments from the perspective of technologicalchallenges they pose and the opportunities they olIer.
Servo control systems for Giant Metre-waveRadioTelescopes (GMIIT)
Giant Metre-wave Radlo Telescope, near Pune,
is a front line research facility for astronomy and
GMRTr_""",
m,;_.~~.,;t._i~' ~ ....
/;'iII 1\.
EWctronicCiN:Uit cards u..d in GMRTServo
astrophysics aimed at studying phenomena, such as,
sun, stellar Bares, puJsars, quasars, radio galaxies andoriginand evolutionof the universe.GMRTconsistsof30 fully steerable, 45 m. diameter parabolic dishes
arranged at the centre and 3 arms of a Y shaped array.Tweh:e telescopes are located within the 1 km X 1 km
array centre and six each along the three arms of a 'Y'
shaped coufiguration extending to about 14 km from
JOJ
NEWSLETTER
the array centre. The dish is mounted on a Elevationover Azimuth mount.
The challenges iu the design and development of servo
control system for such a large telescope array were
manifold. The telescopes are operated remotely and
largely unmanned. Hence safety of the structure under
gusty winds is a primary concern and must he ensured
by the system autonomously. In addition to meeting the
servo performance specifications, the design
accommodates maintainability using remote
diagnostics, fail-safe operation without degrading
availability and high degree of configurabiliy. Cost was
of overriding concern. Realising these objectives,computer based station servo computers along with
thyristor drive amplifiers were developed indigenousiy
and progressively commissioned during 90's.
GMRT Control ",b;net
GMRTMoto,drivecoblnets
An 8086 uP based Servo Controi Computer iocated at
the base of each teiescope facilitates co-ordinated
program tracking of stars by all the telescopes in thearray as per the target trajectory information
periodically sent by a central computer. Each axis is
driven by two uumbers of 6 HP DC servo motors in
counter-torque arrangement and are powered by OCR
power amplifiers. The control topology adheres to the
classical three loop cascade: the outer position loop,
followed by speed loop and current ioops. The servo
system guarantees pointing and tracking accuracy of ImRad. The control system implements operational!
safety interlocks, type II Type IT position loop servo,antenna angle and status displays, manual positioning
& slew modes of operation and two-way
communication with central computer. The servo
performance specilicatious are, tracking error of I arc
minute @ 40 kmph wind, angle display resolution of
10", slew rates of 30'/ min and precision trackingrates of l50'/min for Az.
Antenna Control Systems for
FALCONand PTAprojects of DRDO
The FALCONand !'fA programsof DRDOprovidedchallengiugtechnologydevelopmentopportunitiesinthe area of real-timeembeddedcontrol systems.Aspart of this program, a farnilyof vehiclemonntedantenna control systemswere developedduringthe90's, applyiugmodern techniques and tools fordynantic modelliug and simulation, softwareengineeriug and modelling etc. The systemsevolved progressively, incorporating changes and new
the
102
BARC NEWSLETTER Foun<kr~ DoySpeciol Inue 2001
requirements in successi>e models as the result of
experience gained duriog BighltriaJs.
These vehicle mounled antenna control systems are
designedto track the airbornevehiclesNISHANTandLAKHSYA.The technology is indigeuously designed
and developed and has beeu successfully demonstrated
during various BighltriaJs.
The NISHANT Remotely Piloted Vehicle (RPV) is used
for battlefield reconnaissance and is required 10 be
tracked from launch 10 recovery from a ground based
antenna vehicle. The anleuna is a vehicle mounted, 6'
dia, continuously stcerable Az-ouly mount, fan beam
ante- with tracking speeds of 200/sec, tracking
acceleration of 200/sec' and tracking accuracy of
0.1°. The computer based Antenna Control system
incorporates anti back-lash drives, PWM amplifiers,
cascade coutrolloops with IOrque, speed and position
controi. Control system is interfaced to tbe ranging
system and performs range dependent seclOr scamting
if target is losl while tracking. The target is tracked
from a Grouod control system (GCS)vehicle through aRemole Antenna Control Unil (RACU)which is linked
10the base unit through optical fibre links.
PTAis used for traiuJug ship or land based missile or
guu crew iu weapou engagement. PTAis 10be tracked
by vehicle or ship mounted, coutinuuusly steerable Az
ouly mouol antennas, with speed of 3O0/sec and
tracking acceleratiou of 200/sec' and tracking
accuracy of 05°. The system incorporates auto-track,scan, manual positiouJug and slew modes of operatiou
iu LOCAL and REMOTEcootrol regimes.
The systems are based ou 80286 processor, and are
designed for }SS 55555 quali6catiou. The software was
developed as per ESA software engineeriog standards.
Software aualysis and design was carried-out using
Object Modelling Technique (OMT) methudology. This
provided deeper insights in 10 the art of applying 00
methods 10 real-thoe applications. The systematic
approach 10 software development and documentatiou
yielded rich dividends during the subse<Juent upgrades
10 the software.
Real-time Networks
Real-time networks form the back-bone of any
distributed coutrol system. High throughpul,
deterministic response-thoes even uoder varying load
couditions, robust protocols and media level
reduudaucy are the de6u1ug chacacteristics of these
networks. In order 10 support the integratiou of
distributed control systems in nuclear power plants,
ddevelopmenl of real-time Local Area Networks basedon IEEE 802.4 Token Bus Media Access ProlOcol was
uodertaken during the early 90's. As part of this
development 80186 based network coutroller cardsfor
103
-fd!:Q
~~~
~
'"u0
r---""--------
[JII1II111111
'"~~j
~~
E]
n:U&
.,0
--
~]~
/
::;;
h
VME,ISA bus systems amoug others, dual reduudautcarrier-baud modem cards, 802.2 LLC software,
uetwork drivers aud APls for pSOS, DOS aud WINDOWs
euviromueuts were developed aud deployed.
Tbis technology was trausferred to ECILHyderabad,aud tbis forms the back-boDe of the distributed
Programmable Logic Coutrollers supplied by them for
use iu Ka.iga aud Rajastau atomic power statious.
Reartor regulatiug System aud Boiler pressure & level
cDutrol systems iu these reactors also employ thistechuology.
MIL-STD-1553B Data Bus
Tbis aviouics staudard iutegratioo oetwork forms the
back-boDe of mauy of the ougoiug projects for defeuce
applications. A Dew deveiopmeut iuitiative was
lauuched with au aim to master all aspects of this
technology. Dcvelopmeot aud testiug facilities werecreated aud a variety of luterlace cards aud software
compoueots were reallsed as part of this activity.
Microprocessor-based Traction Control
System for Tbyristorised ACLocomotives
A collaborative technology dcvelopmeut /demoustratiou mitiative of DOE, RDSO aud BARC,this
effort was targeted to retrofit the large Dumber of tap-
chauger AC locomotives of Iudiau Railways by thyristor
based power couverters aud micro~rocessor based
coutrols. The loco is propelled by six umubers of
- 700 HP, separately excited DC motors, each of whicb
is powered by a thyristor couverter which is made-up
of two half bridges couuected iu sequeuce, The field
wiudiugs of three motors of ODe group are couuected
iu series aud is powered by a separate couverter.
The challeuges of dcvelopiug the complex, state-of-the-
art tractiou coutrol system lay iu mauy fronts- the
hard-real-time coustraiuts imposed by thyristor firiug
puixe coutrol, the EMI euviromueut of high current,
high voltage switchiug devices, the uuforgiviug hot aud
dusty euviromueut of a locomotive.
The system has a distrihuted architecture with multiplemicro computers (80286 hased supervisory coutroller,dual8OCI96KChasedmotorcoutrolleraud8044RUPI
based commuuicatiou coutrollers) iutegrated arouud
CARNETuetworkaud features dual redundaucy.Theloco is coutrolled by two Tractiou Coutrol Computers
configured iu Master /Slave lashiou. The control
s)'Stem iutegrates loop aud logic coutrol with fault
loggiug aud status mouitoriug. It iucorporates
computer triggered phase augle coutrol of the
armature aud field converters, anuature aud field
curreut coutrol iu three reglmes (coustaut torque,coustaut power, coustaut 1aJIf), dynamic brake
coutrol, two step "'queuce coutrol, slip/slide detectiou
aud coutrol, software based loco iuterlocks aud
exteusive fault loggiug aud auuuuciatiou capability.
Specially desigued hardware accommodates the harsheuviromueut of au Electric locomotive.
The coutrol loops aud loco logic are programmed
usiug a purpose-built fuuctiou block programmiug
lauguage called Block Coutrol Lauguage. BCL was a
siguillcaut spin-off technology iu it-seU, impactiug
developmeut of software for reliable coutrol
applicatious.
t05
BARC NEWSLETTER
'0<,""" ,..", ,""..,.(,
Founder's Day Special Issue 2001
"," .,""".
... ... .... ......===
<:9fRONT CAB
,""""""""11"
Stabilisation & Tracking Antenna Control
Systems for Air-bome Applications
The ongoingdevelopmentof airborne trackingandstabilisatioosystemsrepresentan importantextensionof our activities.In theseapplications,whiletrackingatarget, the control systemmust also slahilise theantenna in space against vehicle's rotationalclisturhances in pitch, roll and yaw. The servo system
must reject disturhances induced hy vehicle vihrations
and linear accelerations. The l:uge linear accelerations
in all directions make demands 00 DJ:ISShalanclng and
motor torque. The complexity is compounded hy the
constraints of space, weigh~ power dissipation, heating
and serviclng constraints.
I I
===
""..,d ....,u"","" <:9
REAR CAB
Inertial sensors such as rate gyros and !MUsare usedto stabilise the antenna using either feedhack or feed.
forward compensation schemes. The antenna ismounted 00 two degrees-of.freedom gimhal
mechanism and target tracking is achieved hy steeringthe antenna so as to minimise monopulse tracking
errors. The tracker provides real.time updates on
measured target positions and rates which are then
used in the vehicle guidance loops.
The demanding real.time computations require a high
performance control engine. This providedopportunitiesto employfloatingpointSHAReDSPforthe control task The evolution of control strategy and
prediction of performance is aided by modelling andsimulation studies.
tO6
DSP b""d mn'",1lw and '1""" biDCkdlali'am
Antenna Platfonn Unit for Air-borneMulti-mode Radar
Efforts are underway for indigenous developmentahigh perfonnance Antenna Plarlorm Unit for anairborne multi-mode Radar. This is a highly multi-
disciplinary venture requiring expertise in the area ofcontrol systems, inertial systems, modelling &simulation, motor drives, Mil-1553, real-timeembedded system hardware & software and
mechanical design.
The 650 mm dia. flat plate antenna is scanned by the
APL in Azimuth and Elevation planes as per the scan
pattern commanded hy the external Data processor.
The cnmmand angles are updated hy the Data
processor at 200 Hz rate via. 15538 data bus. The
measured antenna angles and errors are to be reported
back to DAP at 200 Hz rate. The antenna should be
stabilised in space air-craft body anitudes & rates (rofl,
pitch & yaw rates). The commanded angles are in the
North-East-Down (NED) frame- these have to be
converted by APL to the scanner frame and then used
for positioning the antenna. For this purpose, the
instantaneous aircraft body attitudes (roll, pitch and
yaw angles) are used. Additionally, the APL is designed
to frmction within specifications nnder increased load
caused by aircraft accelerations. It should also reject
linear acceleration body disturbances.
The APL consists of two axis glmbal driven by brush-
less AC servo motors and gear redncers. Each axis is
driven by two motors arranged in counter torque mode
which eliminates the effect of gear back-lash. Each of
107
Found", Day Sp,dal ]"u, 2001
IIIL!J~
~..
~
'h_'~i'J~
.
rn~~ .
~. ~
.SY UHV REGULATED DCPOWER FDRCOHTROCCER "-RCTRornes
noVUHREOULATrn DCPOWERFDRPWM""""""'"
APl wntrollm hwck dlagrom
1'J!2~0~~A
FcomELR"oIver
cd' .!'>1' MeasucedAZ. EL angles ,n NED fcam,a".i3" Commanded AZ.EL angles in NED fcamecf.1? Commanded AZ,EL angles in body fcame.al',!,>I': MeasucedAZ, EL angles m bodyfcame'!I,e,<%>:Yaw, pitch coli angles of aicecaft001 60 Off,.t fcom <cann", f..m. to hom fc~.
~~
II2
~
<;Ii
~
APl control wops
108
BARe NEWSLEITER Fowuk,'s Day Special Issue 2(J()/
""""""">'&p"-""',._,.._,,
Nav/gaJkm.frame_isalio.
RS23'C
_.............._--
IMU, INERtIAL Y!ASUOEJmIrtlNITnru,lNERtlALNAVIGAtIONtlNITam CONDWL D'!KAY UNitDDU, DRIVER" DISI>LAYtINIrDro, DISTANCE 1RANSIIltmOUNlt
ALNS baniware bIod diagram
109
P"'"irt,
"""<of""">'&p,"'m
DDU
the fourmotorsis drivenby a four qnadrant poweramplifier. Quick deceleration of the load is made
possibie due to the regenerative braking snpported by
the four quadrantoperation.Regenerativebrakingisalso brongbt in to play under powered off conditions,
to arrest the antenna from guiuing higb accelerations.
The command input to the power amplifiers is
generated by the APL controller which is a SHARC DSP
based system with hosts the control software. The
motor power amplifier is being developed nsingmodern motor control DSPs for 3 phase IGBTbridgecontrol. Motor mounted resolvers are used as rotor
position sensors for realising sinusoidal commutationof the brnsh less AC motor. The position of the
anteuna is measured along AZ and EL planes by a pair
of higb precision resolvers coupled to the respectiveload axes. The APL controller receives commands
from and sends responses to the DAPvia the MIL.STD.1553B data bus.
Fibre-optic Gyro based Land Navigation
System (GLNS)for Battle-tanks
This development is targeted to meet defence needs for
advanced fund navigation systems for use in battle
tanks. The system is reqnired to provide a positionaccuracyof 1% of distancetravelledand headingaccuracyof I'. ThedesignoftheALNSis basedaroundan InertialMeasurementUnit (IMU)consistingof a
triadof 0.\'/ hour fibreopticgyros (FOG)and 500
J.lg accelerometers. A SHARC.21060 DSP based
navigation computer performs in real.time, attitude
computation, specific resolution and navigatiou
computations.
While inertial navigation provides good short term
accuracy and is antonomous, the errors io the long
term grow unbounded when sensor and alignmenterrors are considered.For this pnrpose, the ALNS
integrates a distance transmitting unit (DTU) and GPS
receiver for improviug the long. term navigation
accuracy.
The navigation computer provides an estimate of the
vehicle position in LAT,LONG,Heigbt co.ordinates of
the reference ellipsoid. These are in turn converted intoUTMand MGRSco.ordinatesand presentedtotheuser.
The user interacts with the ALNS from aDDU
(Driver's Display Unit) and CDU (Control DisplayUuit). The DDU facilitates viewing of the vehicle
heading, bearing to destination and the vehicle
position. The CDU provides an interface to the
commanderfor perforntingvarionsfunctionssuchasself and destination navigation, way.point and ronte
planning, gyro compassing, calibration and testing.
Conclusion
The various project activities outlined above have also
resuited in the creation and consolidation of expertisein varions areas such as digital! analog hardware
design, DSP, motor controllers, computer networks,real.time software modelling & design using object
modelling techniques, establishment of software
engineering practices with documentation,
development of real.time kernels, modelling &
simuiation of dynamic systems, antenna and motion
control systems and inertial navigation.
110
About the author...
Mr YSMU}'Va gradUdted in Ekctronics and Communication Engineering from Kflmntaka Regional
Eng. CoUege in 1979. He joined Reactor Control Division, lWIC in 1980 through the 25" batch of
lWIC Training School in Ekctronics discipline. He is currently heading the Distributed Automationaad Control Section of Controllnstrumcutation Division.
His main interests include real-time embedded systeJUS, computer networks and dynamic
morknlng and simulation of control systeJUS. He has contributed to the develcpmcut of step-track
systeJUS for INTElSAT Earth stations, antenna control systeJUS for Master Control Facility at Hassan,I Giant Metre-wave Radio Tekscopes at Pune and tracking systeJUS for FALCON and PTA programs of
DRDO. His '!!forts In the rkvelcpmcut of Token bus networks, MIL-STD-1553data hus and distributed systeJUShaveresulted in the realisation and deplcymcut of many distributed dala acquisition and control systeJUS in nuckiar power
plants and other facilities of the department He is currently involved in develcpmcut of two types of airborne tracking and
stahillsation systeJUS,advanced load navigation system and servo control systemfor MACE tekscopes.
III
Determination OeHe / 4He Ratio UsingDouble Focusing Mass Spectrometer
K.A.Jadhav, N.Padma, K.K.B.Nair and V.V.K.Rama RaoTtdmkal Ph"b ,nd p'O<°'YJ" Enginwing Oi,i,ionBru.bh,Awmi, "',,~oh etnt"
Introduction
DETERMINATION OF ABUNDANCEOF
in Natural gas samples has been of great
in the geological applications. A few
Natural gas samples, from ONGCISRBCIChennai have
been analysed for their total helium content using an
indigenously designed and built Double Focusing Mass
Spectrometer (DFMS)"', which is capable of a
resolving power upto 6000. However, the geologists
and the geophysicists are also interested in 'He / 'He
ratio in these samples, in order to identify the source of
Helium gas collected along with the Natural Gas from
the fields. In this context, an experiment was
conducted to determine the percentage of 'He inNaturalHelium (which is about 0.00013%or 1.3ppm) commercially available in pressurised cylinders.
The details of the experiment are presented in this
paper.
Detennination of 'He I'H Ratio
A single focusing mass spectrometer can be used to
determine the ratio of 'He / 'He in atmosphere.
Though the small peak of 3 a.m.u. can he measured
using these instruments, the main problem will be due
to the isoharic interference of 'He by residual HD and
H, molecules in gas source mass spectrometers. Amass resolution of ahout 800 is required to resolve
these peaks. Hence this work was carried on using the
DFMS,indigenously developed in TP&PED,BABC.
Procedure of Analysis
The resolutionof the instrumentwasadjustedto therequiredvalue,byopeningthe adjustablesourceslit.
This also increased the sensitivity thus helping in tbe
detection of the small peak of 'He. A Natural He
sample, taken from the commercial He cylinder of
99.9% purity, was fed into the mass spectrometer and
tuned for 'He peak. The intensity of the peak was
measured on a Cary vibrating reed electrometer
amplifier, which can be operated at three resistance
values - 10'0, IOtO and 10110 i.e., at three different
conversion gains of 10' 0 ,wolt, 10' ,wolt and 10"
,wolt. The signal strength of 'He was raised to the
maximum, to about 16Y at 10'0, hy increasing thesource pressure under reduced pumping speed
condition to about 6x10' torr, and operating the
multiplier at a gain of 10" at a suitable voltage. Underthe same operating conditions, the mass spectrometer
was tuned for 'He and the signal detected was about 20
mY when the Cary was operated at 10"0 range. Tberatio of the intensity of the two peaks was found to beabout 1.3 x 10' which is the true ratio. Since the
sample was of high purity, presence of H, wasnegligible and the peaks corresponding to those of
Hydrogen ( namely HD and H,), due to tbe residualgas in the source, were not detected and there was nointerference from these.
Problems Faced
While tinting the mass spectrometer near about 3
a.m.u., two pe-aks were detected, one was around
mass number 3 and the other, which was a broad peak
of much lower intensity, located near about 3.3 a.m.u.Since there is no mass indication av.tilable in our
DFMS,the mass numbers could only be inferred from
the measured values of the magnetic field and the
112
mlius uf curvature. To ideutifywhicb of thesetwo arereally due to 'He aud also the maguetic field for
'Hepeakexactiy,a sampleof pure 'He was introducedaud the field value at which the peak due to the 'Hesample occurs, was uoted. With the Natural Hesample, one of the two peaks around 3 a.m.u., wasfound to be at the samefield valnewhfie the otherwas
at a higher value, whosemassnumber was calculatedfrom the field data to be around 3.3 a.m.u..Also tbis
peak was found to be mucb broader than tbe otherpeaks. It was suspectedthat whfie tuIling for massnumber 3, the highiy inteusepeak of 'He must havebeeustriking thewafisof the cbamberaud apart of thescatteredbeam must be giving rise to the spuriouspeak at 3.3 a.m.u. To confino this, differeut gassampleslike N, aud Ar were introduced into tbe massspectrometer raising the main peaks at 28 aud 40respectivelyto very higb intensity, in the same mauner
as said earlier. Spurious peaks, which were verybroad, at unexpectedmass numbers around 24 aud
33.68for N, audAr (I.e. for the major peaksat28 aud40) respectivelywere found to occur aud the ratio ofthe massnumbers of the spurious peak to the majorpeak was found to be the same in eacli case, thussupporting the view point tbnt it could be due to thescatteredious.
Determination of He Concentration
A few samples of Natural Gas,from ONGC,wereaualysed,to determinetbe concentrationof He presentin the sample. For these measurements,initially astandard He sample of known concentration wasprepared by injecting the known quautity of Heliumtakentbroughgastightsyringes,into a glass bottle of
known volume. The He standard sample wasintroduced into the massspectrometerby opeIling thevariable leak valve to a snitable level, aud the peakbeight of 'He was noted. The Natural Gas sample,collected from the petroleum wells, over water in abottle, was trausferredto auother glassbottle, snitableto be introduced into the mass spectrometer. The
beigbt of'Hepeak rising due to the presenceofHeliumin the sample,for the sameposition of the leak valveopeIling was noted aud compared to that obtaioedwitb the standard sample aud the unknownconcentrationwasdetermined.
Conclusions
The ratio of 'He / 'He (1.3 ppm) in NaturalHeliumsample, could be measuredusing the double focusingmass spectrometer. Analysis of a few Natural Gassamples,from ONGC,was carried out to determinethe
percentage of Helium present in these samples.Tomeasure the 'He / 'He ratio in these samples,it isnecessaryto introduce the samplesin the fono ofpurehelium ioto tbe massspectrometerso that a detectableion current of 'He could beobtained.
Acknowledgement
The authors wish to thauk Dr.V.C.Sm, Head,
TP&PED, for his keen interest aud encouragementshownin this work.
Reference
I. B.S.PrahalladaRao et al., Proceedingsof 5'NationalSymposiumon MassSpectrometry,1991,1-14.
113
ijARC
!'About the a"thors ...
Mr KA,Jadhavgraduated in Physicsfrom Pune University, He joined Mass Spectrometry Section, BARC in
the year 1978, He hav made remarkable contributions to the development of electron impact and themud
ionisation source for high mass isotope ratio mass spectrometry, Currently, he is working on double
focussing mass spectrometer aad octo pole experimental set up for Rand D,
Ms. N Padma did her MSc, (Physics) from University of Madras and joined the 32" batch of BARCTraining School in 19ii'l She has been working on the development of dvuble focussing massspectrometers, different types of ion sources and ion oPticsfor 1CPMSand TIMS.She has initiatedcomputer simulotion techniques for stndy of ion optical designs and utilized it for design optimisation,She is currently working on evaluation and optimisation of isotoPic ratio mass spectrometers.
Mr KKH Nairjoined BARCin 1965 and was working in TPPED, BARC. until his superannuation in 1998, He has heen
instrumental in the development of DFMS and the related sample intraduction systems and has taken active pari in the
development of different types of mass spectrometers, viz, helium leak detectors and TIMS,
Mr ~~K RamaRao heads the Mass Spectrometry Section in TPPED. BARC, since 1992. He did hisM, Se.
(Tech) in Applied Physics with instrumentation as the special subject from Andhra University in 1963
and M Tech (Elect, Engg) from lIT, &mbay in 1965 He joined TPPED. BARC, in 1965 and has
contributed to the design and development of aU mass spectrometers indigenoU$1y built in the Division,
viz., low mass range generat purpose mass spectrometers for gas analysis, helium leak detectors, isotope
ratio mass spectrometers for Li and N, QM4s, large muliicoliector mass spectrometers for nuclear
materials (both solid and gas samples) and the /CP-MS, He has about 50 publications to his credit, He is a foundermember of several professional societies.
114
ICP-MS- Improvements in DetectionLimitsV.Nataraju, D.Ramanathan, V.c.Sahni, V.V.KRamaRao, P.Raju and S.R.HalbeT"hnid Phy,i" &Pww'YPe Enginwing Diyi,ionBh,bh, Momie R~",oh Cenne
Introduction
s REPORTEDEARLIER [1,2], TP&PED,BARChad developed a protolype Inductively Coupled
Plasma Mass Spectrometer as a Department of
Science and Technology sponsored project. Here we
report on some of the developments directed to
improve the performance 01 our instrument to reachdetection limits at ppb ievels.
Instrumentation
The basic mounting design 01 the instrument remains
uncbanged ie., a three stage system with the plasma-
sampler/skilmner interface region as first stage, the ionoptics located in the second stage and the qundropole-
detector in the tlUrd stage. Fig. 1 gives a schematic and
Fig. 2 gives a photograph of the system. The lofiowing
design changes/improvements have been incorporated.
VaCUUM Sysi;eM, Pr,Go5
Figl Schematicofthesy"em
115
Found"" Day Special hm 200 J
Fig 2 PootagmPhofthesy,tcm
i) First Interf""e region: The first stage interface
flange has been modified by enlarging the pnmpingchannel dimensions and also hnving two additional
pnmping channels (instead of one before). The higherconductance resnlting from this modification, enables
ions to reach the second stage iu larger uumbers. The
present dimensions of each channel are I6mm X 8mm.
This new interface regiou is being pumped by two 300Vrnin rotary pumps in parallel, to provide a speed of60OVrnin. Care has been taken to ensure good surface
finish to the sampler cone to minimise the peripheral
le-qe. The previonsly used sampler with 0.7 mm
diameter aperture, IOmm length was replaced by onewith 0.8 mm aperture diameter and l1mm length
while skimmer cone of 0.7 mm aperture diameter isstill in use.
ll) The diameter of difierential pumping aperture
(OPA), betweeu second and third stages has been
iucreased from 2mm to 4 mm. Thongh this increases
the gas load in the third stage, the pressure (5xlO"
Torr) is still adequate for the safe operation of the
Quadrupole Mass Analyser (QMA) and the Channel
Electron Mnltiplier (CEM).
ill) A uew deflector / Faraday cup (FC) subsystem, has
beeu iucorporated in place of the existing deflector
assembly in the collector region. The CEM is mounted
at 90" to the axis of the system, as shown in Fig. 3. In
the deflector mode, the FC is disconnected from the ion
current amplifier and a suitable voltage is applied to it
for deflecting the ion beam from quadrupole towards
the CEM. Alteruately the FC enables the monitoring of
the ion beam exiting from the QMA. This arrangement
helps in determining the Gain-Voltage characteristics of
116
the CEM. Fig. 3 also shows the trajectories traced by
the SlMlON3D version 6.0
iv) A peristaltic pump (Mlclins, India) has been
introduced in the sample introduction system to
provide a uni/onn feed rate of sample solution to the
nebuliser and hence the pbsma.
v) The overall aligmnent of the system from the pbsma
torch to the collector assembly has been improved by
checking it with a fine laser pointer.
Performance
The improved interface Dange has brought down the I"
stage pressure. This pressure drop necessitated the
increase in sampler length from 10mm to lImm to
provide an optimum skimming distance. The enlarged
DPA has belped in increasing the intensity of the ion
beam entering the QMA. These changes along with the
dr""- J,ft, / J..- ~," ~.
PigAn. Cs 1 ppb
6" ?8 .-.
introduction of the peristaltic pump, have progressively
enabled us to bring down the detection limits for
Cesium and Silver solution samples to about -Ippb
level in the mtalog mode of operation (figs. 4a & 4b).The detection capability of the instrument for other
samples viz., Arsenic, yttrium, Silver and Indium has
been found to be in 1-10 ppb range. The working of
Utis equipment has been established at utis level of
perfonnance abd has been checked by routinely
operating with standard solutions. It is now being
readied for analytical applicatious with the help of
outside users. Figure 5 shows a spectrum of the
mixtureof elementsin 25ppb concentrationrange.Other laboratory made standards in mass range of 60-
160 amu are being analysed to check instrument
repeatability, regnlarly.
~,A...
Fig. 4b Aglppb
Fig. 5 MixturoofAs, ~Ag,ln&Cs
117
The gain of the CEM (KBL20RS) at -2100V, estimated
using the new deflector / Faraday cup, is 5x10'. These
measuremeots were dooe by oebulisiog Csl solution
and measuring the resulting curreot recorded on the
faraday cup. Presently, efforts are on to switch over to
the pulse counting operation.
Conclusions
The detection capabilities of our instrument bave been
considerably improved after iocorporating the
modifications in the desigo nf snme of the subsystems.
Detection limits at ppb level for different elements have
beeo achieved, in the anaIog mode of operation of the
multiplier. These are expected to improve further in
the pulse counting mode of operation of the multiplier.
Acknowledgements
The authors wish to thank the staii of MSSand MFAS
for providingall the help in carrying out the
modifications, Ms. Madbumita Goswaoti for her heip in
preparing the laboratory standards and Mr. Amit
Bhutaoi, a trainee student from lIT, Mumbai for
simulating the ion trajectories nsing SIM10N.
References
1. V.Nataraju et aI., proceediogs of 7"' NSMS 1996, p.
527
2. A.N.Garud et aI., S' ISMASWorkshop on Mass
Spectrometry, 1997, p.5S
Addendum. Since Otis paper was preseoted inDecember 1999, some probiems encountered by way
of high RF. pickup at the collector have been reducedeffectively and the pulse counting mode of operation
has been made operationaI.
118
BARe NEWSLETTER Founder's DoySpecioJ Issue 2001
About tlte autltors,..
Mr. f Nataraju did his MSc (Physics)from Andhra University andjoined the 31' haich of/WIC TrainingSchool in 1987. He bes been working in theMassSpectrometry~tion ofTPPEDsiuce 1988and bes beenassociaJed with the Development Project of ICP-MSsiuce its inception. He bes worked on computersimulation studies of ion oplks of Massspectrometers. and used it for design optimisaJion in the ICP-MS.CurrenJly, he is also working on the indigenous development of quadropok MassFilters.
Dr. Devaki Romanotbon did her B.Sc. (Physics) from Mndras University and joined the sixth batch of/WIC Training School in 1962. Shejoined TPPEDin 1963and worked on UfJraHigh Vacuum techniquesand instrumenlation. She obtained her M.Sc. in 1973 from Bombay University on Field EmissionMicroscopy and obtained herPh.D.from Pune University in 1983 on FieldIon Microscopy. Currently,sheis working in the mass spectrometry section on the indigenous ikvelopment of ICP-MS. She bes co-nutbored a number ofpapers in nationoJ and inlernationoJjournals, including apaper in theprestigious
journoJ 'Nature'.
Dr. fC. Saboi is currently the Directm, PbysU:s Group, /WICO AJWr his B.S<. (Hons.) (Physics) from JJe/bi University, he
joined the If batch of /WIC Training School He stood first in his halch. His first R & D work was in Condensed Maiter
Physics. He did hisM.Sc. (AppltedMaibematics) in 1968 and Ph.D. (Physics) in 1973 - hothfromBombay University. His
acndemic distinctions inclUlkd the coveted INSA Young Scientist's medo! in 1974, Visiting fellowship at Centre for
CbemicoJ Physics, Ontario, Canada (1981-82), INSA-USSJI Academy Exchange fellowship (1987) and INSA-Royal Society
(UK) Exchange Fellowship (/993). Dr. Sabni bes published over 250 sclenllflc papers, co-authored the hook 'Dynamics of
PerfecICrystals' andco-edited a hook 'Developments in TbeorelicoJPhysics'. He was Head, TPPED, /WIC, from 1996 IoAug.
2QOI and bas been intimately associaJed with the indigenous ikvelopments of UHV-besed surfare instrumentation, muss
spectrometers and other anaIyticoJ instruments.
Mr fY.KRamaRaobeods the Mass Spectrometry Sedion in TPPED, /WIC siuce 1992. He did hisM. Sc.
(Tech.) in Applied Physics with instrumenJa/ion as the special sufdect from Andbra University in 1963
and M. Teeh (Elect. Engg.) from ll~ Bombay in 1965. He joined TPPED, /WIC in 1965 and bas
contribnted to the tksign and ikvelopment of all mass spectrometers ikveloped in the Division, viz. Low
mass range general purpose mass spectrometers for gas anoJysis, He leak tktectors, isotope ratio mass
spectrometers for L, and N, ~, large multicolkctor mass spectrometers for nocker materials (both
SQ/id and gas samples) and the ICP-MS. He bes about 50 publica/ions 10 his credit He is a fonUlkr member of several
professWnoi soc/et/$s.
Mr. P. Raju did his B.E. (Meeb.) from Osmania llniversiJy and joined Mass spectrometry ~tlon, TPPED, /WIG in 1991. He
bas been intimately associated with the design, fohricaJion and assembly of all the mass spectrometers tkveIoped in theDivision.
eY" .
Mr S.R. Halbe is in charge oftheMeehanicoJFabrica/ion & Assembly SectionaIActivity in TPPED, /WIC.
His group is primarily resPOnsible for the tksign, ikvelopment and prototype manufacture of a number of
inrwvaJifJe components and devices required for ufJra high - based anaIyticoJ instruments - a
major programme of the Di9vision. TecbnoJcgies of two components ikvefoped hy him were /ranferred 10
industry for commerciaIisaJion.
119
BARC Found,,', Day Special!"u, 200!
Fabrication of High Density Th02, Th02-V02 and Th02 - Pu02Fuel Pellets for Heavy Water Reactors
U. Basak, M.R Nair, R. Ramachandran and S. MajumdarR..d;omemllmgyDly;,;ooBh,bh, Awm;, R"""h Ceoue
Introduction
THO, - PuO,<:<;4%)AND ThO, - U"'O,(:<;4%)arebeingconsideredas fuels for the proposedadvanced heavy water reactor(AHWR). ThO"UO, and PuO, are iso.structorai (FCC,00, type),
mntoally solid solubie and have similar physical andthermodynamic properties. Fabrication procedures ofthoria and thoria based fuels are also similar to that of
UO, and (U,Pu)O, fuels. However, ThO, is a perfecdystoichiometric compound with very high meiting pointand hence it is difficult to sinter to high density
(~5%ID) even at reasonably high
temperatore(:<;1973 K) without any sintering aids.
MgO, GaO, Nb,o, etc. act as effective sintering aids forobtaining high density pellets at relativeiy lowersintering temperatore"". Even among the additives,
Nb,O, is found to be the most effective for high
densification «:95%ID) at sintering temperatore:<;1773K in reducing atmosphere.
A modified flow sheet developed for the fabrication ofThO, pellets starting with thorium oxide powdercontaiuing high sulphur content is also discussed in thepaper.
Fabrication of High Density Pellets
lligh density ThO" ThO, - UO, and ThO, - PuO, pelletsare fabricated by powder metallurgical route consistingof milling of MgO(-500 ppm) doped ThO, powder,pre-compaction & granulation followed by high
temperatore (:<;1973 K) sintering in reducingatmosphere. The conventional process flow sheet for
the fabrication of high density ThO" ThO, - UO,and ThO, - PuO, fuci pellets isshown in Figure 1.
1-105MP,H-J50 MVa
300 M Pa
Fig. 1 Conwn#onaljlow,heetfo, thefabrication of ThO"
lb,U)O, and (rh,Pu)O, pelkt,.
J20
I87JKB
["",ily;~96%U)C"I"",;Brown
S"lphuc;5.50PPI11
-vi"",1
-111"'(>"'.""""
-"hel11ical
1523K.,he>
8hs
G"y8"lph"o;."50ppm
FIg. 2 Mod!fiedp",tion of the processJWwsheetf",high density pelktfahricationfrom ThO,powdm-containing high sulphur
A fewlots of MgOdopedThO,powder(Qty: 2.5 t)
supplied by MIs. Indian Rare Earths I.td. contained very
high sulphur impurities (8011-1200 ppm). Though
high sulphur impurity in ThO, powder did not affect
either the powder sinterability or pellet fabricabilitybut considerable amount of sulphur (400 - 700 ppm)
remained in the sintered ThO, pellets as Th-D-S
compound even after high temperature sintering under
N,8%II, atmosphere"'. This caused shattering of
sintered and centrele" ground pellets during air
drying process at 473-523 K before encapsulation.
Hence experimental studies were nndertaken in order
to fabricate high density ThO, pellets of acceptable
sulphur impurity starting with powder containing high
sulphur. These included (a) re-calcination of
as received ThO, powders before further processing,
121
BARC NEWSLETTER Founda', Day Spedol I"ue 2001
Fig.3a TbO,peikls with ingh mlphu, ,hottemJ during dry;ng
Fig.3h Acap/{yjThO,pelklsfnhrlca/{yjhymndtfiedfahrtcationrouw
122
Found,,', Day Speciol/"u, 200/
(b) high temperature (;'1873 K) sintering of pellets in
air, (c) low temperature (51523 K) treatment of
pellets in air followed by high temperature (;'1923 K)
sintering in N, - 8%H, atmospbere, (d) low
temperature (51573 K) oxidative sintering nsing Nb,o;dopant. Based on these investigations and keeping in
view of easy adaptation of the modified process in the
conventional process flow sheet for the fabrication of
high density pellets, two alternative processes viz. (1)
high temperature sintering in air and (2) low
temperature treatment in air followed by hightemperature sintering in reducing atmosphere were
finaIlzed for the fabrication of high density ThO, pellets
with acceptablesulphur content (-50 ppm). Theprocess modification incorporated in the
conventional flow sheet is shown in Figure 2.
Air pre-sintering of green ThO, pellets at 1523 K
brought down the sulphur content within acceptable
limit. However high density (;'95%TD) was achieved
ouly after the sintering of these pellets either in N,-
8%H, atmosphere at ;'1923 K or in air at ;'1873 K.Figure 3a shows the typical photograph of the high
sulphur containing pellets which shattered during
drying process before encapsulation and Figme 3b
shows photograph of good pellets obtained after
incorporating the modifications in the process flowsheet.
Conclusion
A modified flow sheet for fabrication of high densityThO, pellets for PHWR, starting with thorium oxidepowder containing high sulpbnr impurity bas beendeveloped. Abeady 2.5 tons of high density ThO, pelletsfabricated by this modified process have been suppliedto Nuclear Fuel Complex, Hyderabad for use in fivenewPHWRs.
References
1. U. Basak, M.Sc(Tecb) Thesis, UniversityofBombay, 1988
2. P. Ba1akrisbua et ai, fl. Nuclear Materials160(1988) 88-94
3. Shigeru Yamagishi and yoshihisa Takabasi, fl.
Nuclear Science & Technology, 26(10), Oct. 1989pp 939 - 947.
About tbeautlHws ....'
,
'
,,
'
,
'." Mr U &=kjoined the 2/" bateEofBAllC TralnlngS<;boolin 1977 aftergraduoling In Metdlu,!!Ica1Eng/neeringfrom
"', jadaepur Unl"",lIy, Cakutia. He obialned M.Sc(Tech)from Unl""'ily nf Mumbal In 1988, 1n Radlometdlu'1iYr' Divi<lon, he bas 23 year< of work .xperience In the fabricalion and cbarocterluilian of Uranium, plutooium and
, . Tbarlum ,,",cd ",amlc nudear jUE~,
~~+
Mr S, Majumdar, Head, Radiometdlu'1iY Diel,'an, BAlIC, I< a Metdlu,!!lca1 Eng/- from the Unl"",lIy of
Cakutto(1967) and joined BAlIC through lhe 11' batch of Training s<;boo1 He I, wo"dng In the Radiametdlu'1iY
Divi<loo ,Inee 1968. HI<rerearch In/ere,t inclwk decewpuwnt,fabricatlon, cbarocterluilian and property ecoluolian°fPlulonlum, Tbarlum and rI" basedf""~ both for thennalandfmtreactor,.
811
Mr R. Ramacbandran " a Metdlu"glca1 Engl- from liT Chennal, and joined Radlonwtdlury Divi<lon through Jii' hatch ofBAllC
TralnlngS<;bool In 1967. HI<fwVl of,pecialimlioo Indwk, decewpuwnt andfah"Cdlion of oxide nuekar f""".
MrM.R, NalrjolnedRadlometoUu'1iYDivi<loo, BAlIC, In /973aftergraduolionfrom Unlv""'yofK"aW. HecompktedAMIE In Metdlu,!!Ica1Eng/neering In 1978 and got ekctedmMemher af1,.,tllulioo ofEng/_'(MIE) In /990. Hebas
got28year<ofexperience In lhedeceWpmentandfabriCdlian °fUO, PuD,and ThO, ,,",cd nuc/earcemmicf""",
123
TRISUL- The Computational Tool forStrategic Planning of Thorium Fuel Cycles
V. Jagannothan, R. P. Jain and R. KarthikeyanTheo,",i,," PhY'i~ DivisionBh,bh, Awmi, Re..~"h Ce"",
Abstract
A computer cOik calkd TRISULJor Thorium Reoctor Investigations with Segregated Uranium Loading has been
devewped. TRISUL cOik is a hexagonal finite difference Jew group diffusion theory cOik. It has a bulY-in
thernud hydraulics maduw to cakulate eonlanl void Jormation awng the Juel channel height. TRISUL cOik caters
to the design and analysis oj a mm reoctor concept calkd, ~ Thorium Breeder Rea<:tor' (ATBR). In this reactor
coneept, tbeseedzonecan he enriched uranium, orfuturisticaRy, It can beplulonium or '"Useed in thorium or
in depwted uranium. Tbe uniqueJeatureoJATBR coneept is that the equilibrium core considers Wading oJ50 to
60% natural TbO,fuel hy weight, with no seed material in them. The thoria rods, after irrndiation Jor one fuel
eyew, are integrated with seed fuel rods. In situ produetion oJmU is a<kquate to attain a discharge burnup
comparabw to or eren mare than that oj the seed fuel.
For the tbariafuel clusters, cross sections are prescribed as oJ unction oJneutronfiuenee as weD as the absolute
flax history pertaining to a given k>cation. The cross sections Jor the integrated fuel cluster, deponds on the
occumulated mU in thoria rods during its first fuel eyew irrndiation. Thus the starting irrndiation history oj
tharia rods is carriedJorward, as the integratedJuel cluster is shuffkdfrom one k>cation to another in veery
Juel eyew. TRISUL code ineorporates a semi-automatic refueling scheme to Jacilltate optimization stndies Jar
designing the reJuellng pattern Jor a gieen seed fuel type, reWad batch size and the corresponding eycw kngth.
For the (ypes aJseed and hatch size considered, It is seen that the eycw kngtb variesJrom 10 to as wng as 22
months. The k>ngereycw kngtb is particuk>rly useful in a cwsedJuel eycw option which would need a sizeabw
time Jor out oj piw Juel handling, i.e., reprocessing, prior cooling time and refabrication. AUhough the ATBR is
a coneeptnal rea<:tor, the physics analysis oj such a reoctor coneept is helpful to identify a reolistic and
oPllmum option to he Jollowed Jar an effective use oj thorium. The resuYs oj the TRISUL analyses can serve as
the hasis Jar k>ug term pianning oj fuel eyew strategies to maximize the fission nuewar pouer from the natural
resources oj uranium and thorium.
Introduction
NEWREACTORCONCEl'fCALLED'A THORIUM
Breeder Reactor' (ATBR) has heen evolved
L .'i.based on certain physics design principles [1-
6]. Thedesignparametersof the ATBRcore are
given in the references 1-6. Some salientcharacteristics are given here for ready reference.Tohle-Ia descrihes the core design parameters.The
unique feature of ATBRdesignis the possihility to ioadnatural thorimu, SOto 60% hyweight,with no externalfeedenrichment.Aiongwith everynewhatch of seededfnei one hatch of seedlessthoria rod clustersare also
loaded. In situ production of "'u in one fuel cycle is
adequatefor thesethoria rods to hecomelike reguhufnei rods. Theseclustersafter one cycle irradiation are
iotegrated with the seed fuel rod clusters in thesuhsequentfuel cycle.Thus the ATBRcore consistsoftwo types of fuei clusters viz., natural thoria cluster(Fig.1) and the two ring clustersof freshseedfuel rodswhich are integrated with the one-cycle-hrradiatedthoria cluster (Fig.2). Theseedfuel canhe of different
types. The details of seed fuel design with seedmaterials enriched UO, (eUO,),PuO,in ThO"and"'uO, in ThO,are descrihedin TahIe-lb.A typicaloptimized refueiing pattern for a \-hatch core with 72
124
BARC NEWSLETTER Founder's DaySpecia/lssue 2(J()/
assemblies per batch is sbown in Fig.3. The study of the
ATBR concept required the development of a special
calcwation tool called 'TRfSUL' whose acronym is
derived from Thorium Reactor Investigations with
Segregated Uranium Loading. We will describe in this
paper the potential of TRfSUL code as a tonl for
strategic planning of thorium fuel cycles.
Toble-I.: AT1fRcore design parameters
Toble-Ib: Descripllon of seed I1IfIIerlals
Note: 30 irradiated ThO, rods of !D/OD 12.6114 mm is considered in the outermost ring surrounding the see
zone for all fuel types.
1;g.1 ATBR'30natu,a/TbO,rodsfw"cIusW Fig2 ATBR- (54sood+30/n-adiatedTbOJfue/cIusw
125
Reactor Power 600 Mwel 1875 MWth
No. of batches 31 41 5
No. of fuel assemblies ner batch 72/ 90/120No. of Seedless Thoria Rods 9111091145No. of Seed + Irradiated fuel Assemblies 360/360 /360
Par:uneter Seed Fuel Tvne
eoo, PuO in ThO "'u0 inThOSeed EnrichedU Reprocessed Pu RC!rocessed U
Inner Outer Inner Outer Inner OuterFuelClad!DIOD(mm) 10/11.4 10/11.4 10/11.4 9/10.4 10111.4 10111.4No.ofFuel Rods 24 30 24 30 24 30Seed Content (Wt %) 6% 5% 20% 14% 6% 5%
'"u '"uPuO, PuO, 00, 00,
inThO inThO inThO inThOFissiIefraction 1.0 0.745 0.941Hex..onaI Pitcb (em) 30.5 30 29.5CvclelenRth EFPD) 330/390/510 390/480/660 330/390/510
NEWSLETTER
. MoveabieThO2 -19
-72 0 IV Cycle
0 V Cycle(Last)-72
@ Fixed ThO2
e I Cycle (Fresh) -72
-72 @ II Cycle
0 III Cycle -72
-72
Salient Featnres of TRISUL Code
Fig.] ATBReqoillbrlom"", Typlcalcoroioadlngpallern360 I",d + '"adlaledThO) c/o,i", +911'hO,jMlc/usl""
Neutronics and thermal hydraulics model
The neutronics model of TRiSULcode is soiotion of few
groop diffusioo theery equations in hexagonal geometry.The method of center-mesh finite dilIereoce with
hexagonal or triangniar right prismatic meshes is used.
Presently TRISULconsiders a single hexagonal mesh per
fuei assembiy radially. Since DP is considered asmoderator and reflector, finite difference method of
solution with a hexagomtl mesh size of 30 em is found to
be sufficiently accnrate. A thermal hydranlics modelsimflarto thatof TarapnrBWRsimulatorcodeCOMETG[7J is used to calcnIate coolant axial void distribution in
each fuel channel. The phenomenon of snb-cooled
bofling is calcnIated by Levy's model [8], flow quality
which is different from heat eqnliibrium quallty is
calculated by Zuber-Findlay model [9], and the void-
quality correlation is as per Ref. 10. Detailed pressure
drop calcnIatioos are not dooe. A tentative flow-powercorrelation is used.
TRISUL uses a two group lattice parameter basegeneratedby CLUB[11] modnIe of PBANTOMcode
system [12], Cross sections for thoria clnsters depend on
effective one gronp absolnte flos level in fuel, trradiation
time in days,coolantvoid and temperaturestate. For(seed + irradiated thoria rods) clnster, cross sectionsdepend on thoria rod flos history or accumnlated fluence
126
in thoria rods during their first fuel cycle, cluster bumup
in MWDIf, coolant void, and other temperature states.
The absolute fiux level is not known a priori. They are
therefore iteratively updated starting with some guess
value. Saturated xenon and Doppler feedback efiects are
cousidered in every spatial mesh.
Additional capabilities ofTRlSUL code
TRISULcode models the equilibrium core following a
batch mode of refueling. Normally one-sixth core is
simulated with rotational symmetry. Identical number of
fuel assemblies is present corresponding to every fuel
cycle batch. Locations of natural thoria clusters are fixed.A semi-automatic refueling scheme is used. In this
scheme, the bumnps are arranged in ascending order
and the fuel assembly movement from cycle to cycle
follow this order number. The fuei cycle follow-up must
be repeated a few times to converged bumup and power
promes.
Output from TRlSULanalysis
The TRlSULoutput consists of k", three ilimenslona!flux, power, bumup and void distributions as a
function of cycle bumup. Fig.4 gives the typical k<ffvariation during a fuel cycle as computed for the threetypes of seeds described in Table-lb. Fig.5a and 5bgive the radial plot of typical epithermal and thermalflux promes in axial plane 15 at the beginning of a fuel
102
","....
cycle. Figs. 6a and 6b give the same at the end of cycle.
There are regular dips seen in the epithemed fluxdistribution at the locations of thoria clnsters. Thermal
flux peaks at these locations. It is interesting to observe
that the flux and hence the power distributions are
intrinsically maintained flat by optimum refueling
pattern. The k<ffaIso remains close to unity and flat for
a cycle dnration of as long as 660 days. These features
are typical of ATBR design concept. Heavy metal
composition in each fuel batch, seed inventory in fresh
charge and seed output in discharged fuel arecompnted by TRlSUL.Fig.7 gives these results for thethree types of seed materials with 120. assemblies perbatch. Dillerent fuel management strategies can beinter-compared by comparing the discharge bumups
and the net seed ontpnt to inpnt ratios.
Other types ofTRISUL simulations
TRlSULcodecan evaluatethe worthof moveablethoriaclusters and the worth of reactivity devices located at theinter-channel space in D,Q oderator [see theaccompanying paper presented at this conference, Ref.[131. Reactivity loads due to fuel, moderator and coolanttemperatures, coolant void, saturated xenon and reactivityefiect due to full conversion of "'pa to "'U can all be
estimated using the appropriate database generated byPHANTOM.More details of TRISULcode is being broughtout in a BARCreport.
~'"5
~~
lot
100
0.99
8
D~1'--"'-",iii""'"
-.
12 16 20
COR Average Bwnup (GWdIT)
200\
Fig.4 ComJ>ari'<m ofR-eJJ""Y'ie burnupf", throe batrbjUetiug
127
BARe NEWSLETIER Founder's Day Special/ssu. 201//
:;.~~.'~>:,:'k':~m~h.-,~~,~~i>~'fJ.'i;::::" ,A','::~o~o"d~"~
> . ""'"" .,'" "'" help'" PLOT..00,,"' ~::::1.. '
~ :::, I;;: "M
.""\"
"\,\"a
\.,.'" ';\;~
2.6
2IU
.' "0'
""-,..,, ","'
Fig.50 RadI4lep;I-"jluxd~lrihuJi""aIbeginojogof<yde(lypjcal)
AT~~.C~~,:'k'~~"-'~~~'m~o~z>~'fJ.P~:" 3A'~:;"\f""d~'~..,. ""'"" .,'" "'" '",p '" PL"'" <0,,"'> .' ,,"'"
I~, "on."::' ""
.!:""" I~p "'"
."
"\".
~206
\.. '"210. t-""'" ,oO)
Fig5b Radiall-"jluxdis/rlbutlooolbegloologof<yde (lyplcal)
128
~:~c~~'~':-<~2;;'~i~'~;:~I;*dy,t~~1~7:n .:' ~~",' d'~~~ u'""
1.
.:j!""'":;, 'Met."""
e"'~
"\~'~
.~
6C"
:J.~'C:"'~':~~<i~;;;~'~rtt:r~E~;;~!~::p:n ,\"~~o>'d_'~
, 1
.
~1.
.""""~"w,
710,.Cd-""" ,~,
Fig."" Rad/al,pitlxmnaljluxdi,'ribuiton01ond ofcyck (Iypi"")
...
"'6'"~
Fig.6bRadialtlxmnaljluxdistribuitonal ond ofcyck (lyPicaQ
129
"-No. ""-" ""'.. Av~...l)f,.-- L""",,-(GWD!1) (""PD,) (%)
.UOl ".m '" 5,w
""'" """. '" ".,"mum",.. '" 5.,w
879.2
879.2
1774.6
2""'3
r--",<M>ut..r..,utRan.(%)'" F-. o,..,.HnOuJput(j.,)
" Sood <M>'" (10,)
"F-. o, tinl"",,(j.,)"Soodr,.,-ry(j.,)
Hg.7 ATER - Comparl<on ofwedinput/outputfo,"ario", type,offU81 (120FMbat,h)
Conclusions
TRISULcode is specially developed for the ATBR (A
Thorium Breeder Reactor) core aualysis. Though the
smilie, pertaiu to a conceptual reactor, the aualyses
are useful in evolving opthnum fuel mauagement
strategies for Th-U-Pu fuel cycles in future thermalpower reactor design.
Refereuces
L V. Jagaunathau, R P. Jain, P. D. Krishnaui, G.Ushadevi aud R Karthikeyau, ;In Optimal U-ThMix Retl(;tor to Mnaimize Fission Nuckar
Power', p. 323 Proc. of The InternationalConference on The Physics of Nuckar Science
and Technology, Oct 5-B, 199B, The Radisson
Hotel, Islaudia, Long lslaud, New York2. V. Jagaunathau aud S. V. Lawaude, ;I Thorium
Breeder Concept for Optimal Energy Extractionfrom Uranium and Thorium', paper presented atlAEATCMon 'Fuel CycleOptionsin LWRs&HWRs', at Victoria, Cauada, p.231, lAEA-TECDOC-1122, April, 2B-MayI, 199B.
3. V. Jagaunathan, Usha Pal, R Karthikeran, S.Gauesau, R P. Jaln, aud S, U, Ramat, ;lTBR - A
Thorium Breeder Reactor ConcePI for An EarlyInduction of Thorium in An Enriched UraniumReactor', original accepted aud revised papercommnnicated to the Jonrnal of NnclearTechnology, 2(){)Q.
4. V. Jagaunathau, Usha Pal, R Karthikeyau, S.Gauesau, R P. Jaln aud S. U, Ramat, 'ATBR - AThorium Breeder Retl(;tor Concept for An Early
130
BARC NEWSLETTER Founder's Day Speciat Issue 2001
Induction of Thorium', Report BARCJ1999/F1017,1999.
5. V. Jagannathan, 'ATBR - A Thorium Breeder
Reaclor Concept for Early Induetion a/Thoriumwith no Feed Enrichment', published as a featurearticle in BARC. Newsletter 187, August 1999.
6. V. Jagannathan, Usha l':I1 and R Karthikeyan, "A
Searcb in/a the optimal U-Pu-Tb Fuel CycleOptions for the Next Millennium,. paperpresented at PIIYSOR'2000 lot Conference - .INSIoteruatiorud Topical Meeting ou "Advances inReactor Physics and Mathematics and Computationinto the Next Milleonium", May 7-11, 2000,Pittsburgh, Pennsylvania, U.S.A.
7. S. R Dwivedi, V.Jagannathan, P. Mohaoakrishoan,K.R Srinivasan Aod B. P. Rastogi, "Core Fol/owup
SIutHes of The Tarapur Reactors With The ThreeDimensUma/ BWR Simulator COMETG,"BARe.-864, (1976).
8. S. Le>y, GEAP-5157, Geoer2l Electric Cnmpany(1966).
9. N. Zuber Aod J. A. Fmdlay, GEAP-457Z,Geoer2lElectric Cnmpany (1964).
10. N. Zuber et aL, GEAP-45I7 Gener2l ElectricCnmpany (1967).
11. P. D. Krishoani, Ann. Nuel. Energy, 9, 255(1982).
12. V. Jagannathan, R P. Jain, Vinod Kumar, H. C.
Gupta Aod P. D. Krishoani, "A DiifUsion 1-Model for Simulation of Reactivity Devices inFressurized Heavy Water Reactors," NucL Sci.andEng., 1M, 222 (1990).
13. V. Jagannathan, R P. Jain and R Karthikeyan,'Physics Design of Cnntrol and InstrumentationSystem for ATBR- A Thorium Breeder Reactor;paper presented to this Cnnference INSAC'2000,Jnne, 2000.
14. V. Jag:umathan, ;TRISUL - A Code For ThoriumReactor Investigations with Segregated UraruumLoading', BARe. Exterrud report nnder
preparation, 2000.
Abouttbe autbors...
Dr ~jagannatban, BSc, Physics, Madras University, 1971; PhD,Mathematics, &Jmbay University, 1988.
He is currently Head of Llgbt Water Reactors Physics Section in Theoretical Physks Division, //ARc. He
was tkputed /0 lto1y as IAEAfe/low from May 1977 /0 Oct. 1978. /Ie is responsi!J/efor qualification of
multigroup nuclear dota IIbrarWs, development of physics and tberrnaI-bydrau/k design codes for
boiIingwa/erreactors (BWRs),pressurized water reactors (PWRs), IWlIs, andpressurizedbeovy water
reactors (PHWRs) and study of oPtimal urantum-thorium fuel cycles. He bad porIidpakd tn the lniernatIonaI AtomIc
Energy Agency (IAEA) Co-ardinaled Researr:b Program (CRP) on incore fuel numngemenJ code pacIfnge wIidation for each
of the aforementioned types of tberrnaI power reactors between 1988 and 1994. The evolution of a new reactor coru;ept
calkd 'A Thorium Brmkr Reactor' is an ou/come of the experience gained from the ajOremenlioned studies.
Mr R. P. jain, MSc, Mathematics, Agra University, 1968, is working in Reactor Design Section in Theoretical
Physics Division He bas devekJped and calidated computer codas for fuet management of BWRs, PHWRs,
PWRs, and VlWs and bas been using them for derign and analysis of tbennal reactors.
Mr R. KartbiIoJyan, BSc, Physics, Madras University, 1992; MSc Physics, Hytlarabad CenIrrJI UniversltJ,
1995, is working In L/gbI Water ReacIms Physics Section in Theoretical Physics DivisIon His background
Includes analysis of tberrnaI reactor bencbmorks using multigroup nuclear dota cross-_ion sets aad
design evoIuations for uranium-thorium based reactors.
131
Effect of Diluent on the Transport ofAm(III) from Nitric Acid Medium Across ASupported Liquid Membrane (SLM) UsingDimethyl Dibutyl TetradecylMalonamide(DMDBTDMA) as the Carrier
S.Sriram and V.K.Manchanda
Radioohemi,try DivisionBhabha Atomic Re""oh Con'"~
Abstract
Tbe effect of di/uents like n-dodeeane, n-bexane, c-hexane, to/new, 1,2 dich/Noethane, dietbylhenzene,
deoalin and nitrobenzene on tbe extraction of Am(I/I) and it.s transport from nitric acid medium across a
supported liquid rnenWrane (11M) using DMDBTDMA as the extractant/carrier bas been investigated The
distribution ratio of Am(I/I) displayed a good empirical corre"'tion with som" of the parameters based on the
pbysico-cbemicalproperiies oftbe di/uents. Tbe experimental datafor Am(ll!) transport were quantitatively
described by rate /ranspart equations.
Introduction
ONGLIVEDALPHAEMITfINGRADIONUQlDES
present in aqueous raffinate waste streams.generated after Pu recovery operation in the
PUREXprocess have been of great environmentalconcern. Partitioning of actinides from such acidic
waste solutions using solvent extmction and extraction
chromatogmphy has been studied extensively over the
past two decades [1-4]. Facilitated transport of metalionsthrougha supportedliquidmemhrane(51M) has
great potentialfor the separation of radionuclidesespecially from waste solutions with a low metalcontent [5]. 10 liquid membmne hased separation
techrtique, the extraction, stripping and regeneration
operations could be combined in a single stage.
Additional advantages of this techuique are low cost,
low energy coosumption and miuimum solventinventory. Flat sheet S1M seems to represent a
convenient means for the systematic study of the effect
of varioos parameters on flux and cation selectivity in
liquid membranes. Studies on flat sheet S1M also
enables one to predict whether the hollo\\iibre ,')'Stem
can be used to carry out similar separationsincontinuousflowopemtions[6].
Among the various reagents nsed in solvent extraction
(SE) and extraction chromatography (EC), CMPO
{octyl(phenyl)-N,N-diisobutyl carbamoyl methyl
phosphine oxide} and Dimethyldibutyltetradecyi-I,3-malonamide (DMDBTDMA) have been preferred for
actinide partitiouing because of their ability toefficientiyextracttri, tetra, and hexa yalentactinideions from acidic waste solutions [1,7]. The mainadvantages of DMDBTDMA over theorganophosphorous bifunctional extraclants like CMPO
arc: a) ease of >')'IIthesis b) complete incinerability and
c) innocuous md1olytic and chemical degradation
prodocts (namely carboxyhc acids and aliphatic
amines) [7].
132
Focus of the present studies is to evaluate the effect of
diluent on the extraction and transport of Am(III)
nsing DMDBTDMAas the extractant. An anempt hasbeen made to empirically correlate the distribution
ratio of Am with various physico-chemical properties ofthe diluents. Thus for the first time, a model for the
distribution mtio of Am(]]]) employing a diamide inseveral diluents bas been established. The results
obtainedin the SLMexperimentsbavebeenused to
verify a physico-chemical model proposed previously
by our group [8].
Experimental
DMDBTDMAwas synthesised and purified in our
labor.ltory by a previously reported procedure [7].
Commercially available hydrophobic polypropylene
(PP) membrane of pore size: 0.57 /-Lm,porosity :
84%,and thickness: 112 /-Lmwere used in all theexperiments. Effectivemembrane area (computed from
the geometrical area and membr.rne porosity) wasfound to be 4.12 em'.
The supported liquid membrane studies were carried
out by using a pyrex glass cell consisting of two
compartments viz. the feed side of 25 mL separ"ted by
a strip side of 10 mL. The feed and strip solutionswere mechanically stirred at -700 r.p.m using a
magnetic stirrer at ambient temperature (24:t I'C) tosuppress concentration polarisation conditions at themembr.rne interfaces and in the bulk of the solutions.
Membmne permeabilities were determined by assaying
the samples from both the feed as weli as the strip side
mdiometricallyat a regular interval.
In case of liquid liquid extroction experiments, equal
volumes of "'Am tmcer in aqueous phase of desired
composition and pre-equilibmted 0.6 M DMDBTDMAdissolved in a diluent were agitated in a 15 mL glass
stoppered tube for an hour at 25 :t 0.1 "C.After
ceotrifugation, aliquots from both the phases were
withdrawn for mdioassay. The distribution r"tio (K,),defiued as the mtio of Am cnncentration in organic
phase to that in the aqueous phase was determiued.
Transport Equation
A model describing the transport mechanism which
consists of a diffusion process through a feed aqueons
diffusion film, fast reaction kinetics at feed-membmne
and membrane-strip interfaces, and rate detennining
diffusion through the membrane itsell was derived
previonsly for Am(llI) transport from a feed solution of
3.0 M HNO, across a SLM containing DMDBTDMA in n-
dodecane as carrier and nsing O.OIM HNO, as the
strippant [8J. The equation nsed for the determination
of permeability coefficient is :
p~ !L-
[Kd (da) + (dOT)](Da) (Do)
(I)
where P is the permeability coefficient, K, is ilie
distribution ratio, D, is the aqneons diffusion
coefficieot of Am(NO,)" D, is the membrane diffusion
coefficient of Am(NO,),A, complex, d, is the thickness
of aqueous staguant film, d, is the membrane thickness
and T is the tortuosity factor which is required to
couvert membr.rne thickness to effective diffusion path
length in the membmne phase. Substituting R, and "as the aqueous and membmne iliffusion resistance
parameters in equatiou (I).
P~ K,[K,R,+RJ
(2)
When transport is controlled by membmnediffusionresistanceterm i.e
[do dOT
]
.Kd-«- , theoequation(I) reducesto
Do Do
KdDoP~-
doT(3)
In ilie present work an anempt was made to obtain D,
using Wilke - Chang, Scheibel and Ratcliff equationswhich are based on hydrodynamic I alisolute mte
theory and Stokes-Einstein and Eyring's equations [9].
The permeability coefficient can be obtainedexperirnentaliy by usiug foliowing equation [5]:
In([MV[M],)~-(Q/V)Pxt (4)
where 1M], and 1M], are the concentration of themetal ion (M) in aqueous feed at time t and initial
metal ion concentration (at t~ 0) respectively. Q ~ A x
8 where A is the geometrical area and 8 is the porosity,
IJJ
V is the aqueous feed volume (lu mL). The above
equation was only applicable when carrier was notsaturated and flux was linearly decreaslug with time
snggesting its validity lu experiments where metal ion
tracers are nsed. An excellent agreement was observed
lu our earlier work on P values of Am"-3M HNO, I0.6M DMDBTDMA- n-dodecane IO.OIMHNO,systemobtained experimentally using eqnation (4) and those
computeduslugequation (3) [8].
Results And Discussiou
Effect ofdiltwnt on theextr(l(;tion ofAm(/II)
The membrane carrier (extractant) and solvent
(diluent) may influence the trausport of metal ion
through SLMlu many diDerent ways. As per equation 3,
the distribution ratio (1\) and the membrane diffusion
coefficient (D) are the two major carrier and solventdependent factors aflecting the transpori rate of metaliou.
To understand the effect of diluent on extraction of
Am(Ill) from 3.0 M HNO, medium, it's distribution
ratio (1\) was deterntined using varying extractantconcentrations (O.1M - 1M DMDBTDMA)in several
diluents. The 1\ (Am) for various diluents varied in theorder nitrobenzene> n-dodecane > n-hexane > 1,2dicholorethane (DeE) > decalin > c-hexane >
diethylbenzene (DEB) > toluene. The plot of log 1\versus [DMDBTDMA]resnlted in slope values in the
range 3tO.3 thereby ludicating the following extractioneqnilibria for Am extraction:
Am"r.v+3NO;(.,,+3A(o'~ Am(NO,),.3A,o) (5)
(where Ais DMDBTDMA)
Novel emPirical correlations between K, and diluentproperties
Linear Solvation Energy Relationship (LSER) has been
proposed for the correlation of physico-chentical
properties of dilnents with solution processes like
solubility, distribution of a solute between two
immiscible liqnids, free energy and enthalpy ofeqnilibria, etc. Selected properties of the diluents
utilised lu the present work are obtained from
literature [10,11].
A multiparameter approach of the general form
A=a+bB+cC+dD+. (6)
where a, b, c, d are solvent-Independent but process
dependent coefficients. Latter three of these being the
indicators of the sensitivity of the solvent parameters B,CandD[12].
In the present paper, an attempt bas been made to
correlate the experimentally observed 1\ with varioussolvent parameters based on linear solvation energy
relationship models proposed by Schntidt, Swalu,
Koppel-Palm as well as by uslug combluations of
various other diluent parameters, uslug a Fortran
program for multi-dimensional linear fit [10-12J. The
computation luvolved the Stepwise Multiple Linear
Regression (SMLR), to meet desired statistical criteria
with respect to correlation coefficient (rO) and
standard deviation (cr) [13]. Neither of the three
models (mentioned above) conld be successfnfly
employed for correlating 1\ (Am) with the solventparameters.
Further correlations were attempted uslug the two,
three and four parameter approaches with various
diluent properties given lu the literature [1O,I1J. The
best correlations lu each of these approaches alongwith correlation coefficient (r') and standard deviation
(S.D) have been summarlsed in Table1. Thebestcorrelation of r'=0.9327 in case of the two parameter
approach was obtained nsing parameter Y defined as
[Y= (E - 1) / (E +2)], where E is the dielectric
constant) and DP (Schntidt diluent parameter). In
case of the three parameter approach, the best
correlation of r'= 0.9466 was obtained using the
functions Y, DP and viscosity (~). r'value of 0.9869and SDof 0.0067 was obtainedlu case of the four
parameter approach utilislug the diluent properties Y,
DP, ~ and E: (the normalised Dinuoth andReichardt's polarity Judex).
An attempt was also made to utilise equation (i) of the
4 parameter approach (see Table 1) to predict the 1\values lu case of some other diluents not lucluded for
calculating a, b, c and d values. The results given luTable 2 show excellent correlation between the
predicted and the experimentally observed 1\ values for
]34
Table 1: Correlation with statistical validity obtained using various approaches
(a) 2 parameter approach
Standard deviation
0.11230.2120
Correlation
(j)logK,= 4.41Y-0.29DP-0.15~-3.34E,'-0.667
Standard deviation
0.0067
Table 2: Comparison of K, values obtained experimentally and from equation (i) of the fourparameter approach (Table 3)
Table 3: Comparision ofP ~ (In emlsee) obtained experimentally and computed using D. valuesobtained from Wilke Chang, Scheibel and Ratcliff equatious in eqn. (3)
Foed, "'Am in3.0 M HNO,; Ca"i", 0.6M DMDBTDMA ""d Steip' 1M Oxalic acid
135
Correlation r' Standard deviation
(j) logK, =2.65Y-0.30DP-1.54P--!J.145 0.9361 0.1264
(ij) logK, =3.17Y-0.28DP-1.30E," -0.56 0.9419 0.1205
(ill) logK, =2.88Y-0.33DP-0.07 -0.45 0.9466 0.1125
Diluent ExoectcdK Exoerlmental Kn-decane 3.89 3.45
xylene 0.60 0.58benzene 0.33 0.38
chloroform 0.35 0.31dlehloromethane 1.72 1.53
Diluent PW;",ChOO, PSGh"'" PRatel" PEx",'me,.,'"-dod"",,, 1.80xlO 1.87xlO 1.75xlO 1.80xl0
toluene 0.73x1O4 0.78x1O4 0.84x1O4 0.9Ox1O4
"-hex"", 1.80xlO4 2.12x1O4 2.20x1O4 1.63xl04c-hex"", 0.54x104 0.62x1O4 0.66x1O4 0.76x104
DCE 1.99x104 1.93xlO4 2. 14xlO4 1.80xl04"i"ob,"",", 2.60x1O4 2.48x104 2.62x1O4 2.4lx104
d"ali, 0.50xlO-' 0.50xI0. 0.50x1O4 0.62x104DEB 0.65x104 0.66x104 0.66x1O4 0.71x104
n-decane, xylene,dichloromethane.
chloroform and basis of hlgher snrface tension of nitrobenzene (46.34dynes/em) as compared to that of the critical surface
tension ofPp (-35 dynes/em) [8J.
benzene,
Effict ofdi/uent on Am(lll) transport
The membrane diffusion coefficients (D) for all thedilnents used in the present work were calculated
using the Wilke-Chang, Schiebel and Ratclilf eqnations
reported in literature [9J. The Dovalues obtained io allthe tbree cases for each dilnent were in reasonable
agreement thereby snggesting litde difference in thevarious models.
To deterntine the tortuosity of the membrane being
used, permeabilities were measured throughmembrane laminates (prepared by laminating a
number of membranes) of pore size 0.57 11m. This
was done by immersing each membrane separately into
tbe carrier soludon and then pressing them together.
The figure nf americium permeability vs. reciprocal
membrane thickness gives a linear plot, thus indicating
that under the present conditious, the metal inn
transport Is membrane diffusion limited. The slope of
the straight line nbtained is given as K.D,I' (eqn. 3).
The tortuosity value of 2.4 obtained using
experimentally observed K. (4.46 at 0.6 M
DMDBTDMA) and computed Do (average of tbreedifferent models mentioned abnve) was used tn
calculate the P~ values.
P~ was also determined experimentally using a feed
solutinn nf "'Am in 3.0 M HNO" strip of 1.0 M oxalic
acid and 0.6 M DMDBTDMA as extractant in various
diluents as the carrier. P~ varied as nitrnbenzene > n-dndecane - DCE > n-hexane > toluene> c-hexane >
DEB > decalin (Table 3). An excellent agreement
nbserved between the experimental and cnmputed P~
values has been reported previously by our group for
Am transport across an SLM using 0.6M DMDBTDMAin n-dodecane as carrier [8]. Table 3 gives acomparison between experimentally obtained P value
using (0.6M DMDBTDMA in various diluents as
carrier) and those obtained frnm equation 3. A
reasonable agreement in P~ was observed in all cases
suggesting the validity of the derived physico-chemical
mndel equation. In case of nitrobenzene, the P~
decreased to more than balf of its Initial value in about
6 hours time. This instability could be explained nn the
Conclusions
Extraction of Am(III) by DMDBTDMA in various
diluents, from 3.0 M HNO, varied in the ordernitrobenzene> n-dodecane > n-hexane > DCE >
deealin > c-hexane > DEB> toluene. The best
empirical correlation fnr variatinn in distribution ofAm(III) with diluents was nbserved with the four
parameter approach involving diluent properties like
Schmidt's diluent parameter, dielectric constant,
viscosity and the normalised Dimroth and Reicbardt's
polarity index. It was possible to accurately predict theK, (Am) for various other diluents by using this
approach. The results of the permeation experiments
through the SLMconfirmed the validity of the physico-chemical model derived previously employing factors
like distribution coelficient, diffusion coefficient as well
as thickness of diffusion layer in both aqueous and
membrane phase along with tortuosity.
References
1. W.W.Schulz and E.P.Horvvitz; Scpo Sci. andTechno/., 1988,23(12&13),1191-1210.
2. C.Musikas; Scpo ScL Techno!., Sep. Sci. andTechno!., 1988,23(12&13),1211-1226.
3. J.N.Mathur, M.S.Mumli, RH.lyer, A.Ramanujam,
P.S.Dhami, V.Gopalkrishnan, loP.Badheka and
A.Banetji;NuclearTechnology,1995,109,216-225.
4. PKMohapatra, S.Sriram, V.KManchanda and
L.P.Badekha; Scp. Sci. Technol, 2000, 35(1),39-55.
5. P.RDanesi; Scp. Sci. Techno/., 1984-85, 19,857-894.
6. RM.lzzat, ].D.Lamb and R.loBruening; Sep. Sci.
Technol, 1988,23,1645-1658.
7. C.Madic and M.J.Hudson; Repnrt No. EUR 18038
EN;European Commission 00 Nuclear Science andTechnology, Luxembourg, 1998.
8. S.Sriram, P.KMohapatra, A.KPandey,
V.KManehanda and loP.Badhek,,; J .Memb. Sri.,
2000, 177, 163-175.
136
9. j.C.Charpentier, (T.B.Drew, G.RCokelet,j.W.Hoopesjr., and T.VermeuljI),Eds.); Academic
press: London Volume -11, Clffpter-I, 1981.10. Y.Marcus; Chern. Soc. Rev., 1993,409-416.
II. D.RLide; Ed.; CRCpress: Boca Raton, LO, 1999-2000.
12. RABartsch, EJeon, W.Walkowiak andW.Apostoluk;JMemb.Sci. 1999,159, 123-131.
13. C.Danieland F.S.Wood;John Wiley& Sons:NewYork,1980.
About the authors ...
After obtaining his MSc. (AtUIlytical Chemlslry) from Mumbal University, Mr S. Sriram jvilUJd
Radlochemislry Division, BARC, in 1996 asJunlor Research Peb under the BA.R.C. - Mumbal University
Collahoration Scherr", for Ph.D (Chemistry). His main area of research includes the stadies on liquid -
liquid extraction, synthesis and characterisation of solid actinlM compkxes, extraction chromatography
and liquid memhralUJ based separation of actiniMs and ftsslon praducls using novel extractants like
N,N'dlaikyi amiMs and substituted malonamlMs relevant from the nuckar fuel reprocessing and waste
management point of view. Mr S. Sriram has to his credit over 27 publicatiom In kading natiotUll /
InternatiotUlljourna/.5 and conferences! symposia.
i
Dr VK Maru;handa jollUJd the Radiochemistry Division, BA.R.C. in 1969 after graduatingfrom Deihl
Unlversityandfrom 11' batcb of Training Schoo, BARC. He was awarMdPh.D. hy &Jmbay University
In 1975 and he carried out Post-Doctral work at UTEP, Texas, USA. as Fulhright Scholar (1985-87). He
was recogalsed as Pb.D GuiM in Chemistry hy &Jmbay University in 1993. He is at present Head,
ActinlM Chemistry Section, Radiochemistry Division, BARC. Dr Maru;hanikJ has mo<k original
contributiom In the following areas: I) Thermodynamics and kllUJtics of compkxes of mocrocyclic
ligands witb IantbunlMS and actinlMs, Ii) Physico-chemical studies on actinlM compkxes, iiI) Novel
extradants of actinides and Iv) Chemical Quality Control of Po hased fuels. He has over 300 publications In various
InternatiotUlljourna/.5 and (NationaV1nternational) conferences.
137
Positron Annihilation Studies on Radiation
Crosslinked Poly(N -isopropylacrylamide)Hydrogels
S. Sabharwal
Anjali Panda, R N. Am"')'a, A. Goswarni and S. B. ManoharIUd;od"m;my o;,;,;onBh,bh, Amm;, R"""h Coo",
IUd"';on Technology Omlopm,m SwionBh,bh, Ammi, R"""h C,o'"
and
H.S. SodaroO'p""n,m of Ch,micli Engin""ngIndi,n In"',",, ofTechoology. Pow"
Abstract
The microstructure of temperature sensitive poly(N-isopropylacylamifk) (PNIPAAm) bydrogels prepored by
gamma-irradiation bas been studied using Positron Annibilation Spectroscopy. Tbe effect of water content
of bydrogels on tbe lifetime and intensity of Oops in PNIPMm was investigated. An attempt bas been mafk to
correlate tbe observed positron lifetime witb tbe microstructure cbanges taking place in tbe polymer during
sweOing.
Introduction
OLY(N-ISOPROPYIACRYLAMIDE)(PNIPMM)ISthermally reversihlehydrogel that exhibits a
Cower critical soCution temperature (tQ,T)
arouod 34"C in aqueous solutions and may find
applications in areas such as controlled drng delivery
devices, recydable absorbents and as actuators II].
Radiation crosslinked hydrogels have been reported to
swell!deswell at much Caster rate compared to
conventionally produced gels probably due to different
microstructure of these gels. Therefore, a study of their
microstructure is of importance to equilibrium
dynamic swelling behaviour. Positron annihilation
spectroscopy (PAS) has emerged as a powerful
technique to explore microscopic structure of polymers
due its selectivity to probe the free-volume in the
polymer. The probing entity ortho-positronium (o-Ps),
which is a bound state of electron and positron having
their ""ins paralic, L<stabilised in the free-vollllTIe, and
its life-thoe (',) has been Cound to be proportional to
the free-volume hole size [2]. While the oops lifethoe
can give indormation about the free-volume hole size,
its intensity (I,) may yield information about free-
volume concentration. In the present work PNlPAAm
hydrogel synthesized by y-irradiation have been studied
using PAS to characterise its microstructure.
Experimental
PNIPAAmgels were prepared from 20 wI. % NlPAAm
monomer solution by y-irradiation, using a 'Co
138
radiation source having a dose rate of 1.3 kGy.hr'. The
samples ohtained were cut into thin circular disks arId
purified hy repeated swelliuw'deswelling cycles. The gel
pieces were swollen in water to reach equilibrium arId
subsequeutly deswelled at a higher temperature (>
LCST) resulting iu gel with different water content. The
positron source "Nael deposited on 0.3 mil aluminium
foil was saudwiched between the two pieces of gels arId
the whole of this assembly was wrapped in parafilm to
avoid auy water loss doring the measurement. lifetime
measurements were carried out using a lifetime
spectrnmeter that had a resolution of 285 ps. The data
were aualysed using PATFIT code for evaluating the 0-
Ps lifetime values.
Results and Discussion
TheOopslifetime(',) arId intensity0,) are plottedagalnst the polymer weight content iu Fig.!.Representationerror on " arIdI, are shownin onepointarIdthelinesareeyegnidesonly iu the figure.
'.
2"f\(\~ I
""Ily
"~,
;eeo,""""""","'"
FlgJ Variatianof;andJ,osafunctionofwot"C<mWntof
NJPAAm bydffllJ't
It is evident from the graph that as the water content of
the polymer increases, the Oopslife time (') Increasesfrom 1.89 ns to - 2.1 ns at - 94 wI. % water indicatingau increase iu the free volume hole size due to
incorporation of water. On the other haud, the oops
intensity 0,) decreases linearly with water content from24% before reaching a constant value of about 19% at
94-wt.% of water. The proportional increase iu" withwater content up to <94% water indicates a destruction
of hydrogen bonds between PNlPAAmchains, arId the
polar water molecules probably exist as a plasticizerbelow 94-wt. % water. This increases the mobility of the
polymer chains increasing the free-volume hole size.Further increase in the water content leads to decre-JSe
in the '" that approaches the lifetime observed iu thepure water (1.9ns).
Acknowledgements
Dr. Anjal! pauda, Research Associate, is grateful to
CSIR,New Dellti, for providing finaucial assistance forthiswork.
References
1. Gehrke S. H. in, "Advances In polynwr Science",
Dusek K. (Ed.), Springer Verlag, Berlln, 1993, p.
83.
2. Schrader D. M. arId Jeau Y. C. (ed.) , "Positron
and Positronium Chemistry", Elsevier,
Amsterdam,1988.
139
About the authors",
Dr. Anjali Panda (now known as Dr. Anjali Acharya) obtained her Master's and Ph. D. degrees inChemistry from Utka!University,Bhubaneswar. Shejoined as a ResearchAssociate in RadiochemistryDivision, R4IIc, under CSIR scheme. Now she is working as a KS. Krishnan Research Associate inRadiation Technowgy Devewpment Section (RTDS), R4IIC. Her research interest is "synthesis,
characterization and applications of stimuli sensitive hydrogels".Other areas of interest are studies onpositron annihiiation spectroscopy and pulse radiolysis technique. She has about 20 publications to
her credit.
Dr. R.N Acharya obtained M.Sc. in Chemistry from Utka! University, Bhubaneswar. After graduatingfrom
31" hatch of R4IIC Training Schaa( he joined Radiochemistry Division, R4IIC, in 1994. Since then, he is
engaged in research and devewpment work on comwntiona1, k" and prompt gamma-ray neutron
activation analysis. The other areas of interest are trace ekrnent speciation, nuckar reactions and
positron annihiiation studies. He ohtained his Ph.D. degree in science from University of Mumbai in
2000. Cu"ently he is pursuing his postdoctoral studies at Dalhousie University, Halifax, Cannda. He has
about 50 publications to his credit.
Dr. A. Goswami obtainedMSc. in Inorganic Chemistry in 1978 from Burdwan University, Burdwan. After
graduatingfrom R4IIC Training School in 1979, he joined Radiochemistry Division, R4IIC. Since then he
has been working in the field of nuckar chemistry. His areas of researcb include studies on nuckar
reactions, positron annihilation studies, and prompt gamma-ray neutron activation analysis. He has
many publications to his credit.
Dr. S.B. Manohar obtained his Master's degree in Chemistry from the University of Pane in 1965. He
joined Radiochemistry Division, R4IIC, through the R4IIC Training School and is at present Head,
Radiochemistry Division. His areas of research are nuckar fISsion, nuckar reaction, nucwar
spectroscopy, radiochemical separations, neutron activation analysis, nuckar prohes, radioactivity In
the environment, and devewpment of non-destructive assay (NDA) techniques. He has 70 papers in
international journals and more than 100 papers in symposia to his credit He has authored a book
"Experiments in Radiochemistry" and bas edited the symposium proceedings NUGAR 95 and NUGAR 99. Dr. Manohar was
involved in an MEA intercomporison measurements of radionuclides in grass sampks collected after Chernohyl accident.
In this connection, heattendad the MEA consultants meeting at Cndarach, France, during 15-17;uly, 1987. Dr. Manoharis
a Ph.D. Guide for Mumbai University. He is a member of many scientific associations and President (ekct) of Indian
Association ofNuckar Chemists andAUied Scientist (MNCAS).
Dr. S. SabharuJal after graduating from 21" halch of R4IIC Training Schaal joined R4IIC in 1979. Presently, he is Head
Radiation Technowgy Devewpment Section (RTDS), Isotope Group. His research inlerests are industrial radiation
processing, radiation effects on polymeric materials, synthesis, characterization and applications of stimuli sensitive
hydrogels and radiation processing of natural polymer. He has more than 75 publications to his credit.
Dr. H.S. Sodaye obtained his Master's In Chemistry from University ofMumbal. Then he worked as a DAB research fellow in
Radiochemistry Division, R4IIC, and obtained his Ph.D. degree from University of Mumbai in 1998. After working as a
research scholar in 11~ MumboiJar a periad of one year, he joined R4IIC as a KS. Krishnan Research Assaciate. Now, he is
working in Desalination Division (DD), R4IIC. His research Interesis are positron annihilation studies and studies onmembranes.
140
B.,ae """iJ. T,; Found",', Day Special I"ue lOOI---
Studies on Voltammetric Determination of
Gallium in Dilute Hydrochloric Acid atGlassy Carbon Electrode
Ja)"hree Kama" N. Gopinath, H.S. Sharma and S. K. Agga>waIF"d Chernimy Di,i,ooBh,bh, AwmioR"""h CO"'"
,.,..,.. ETERMINATIONOF GA1llUM BY ANODICt ,Stripping Volt:nnmetty (ASV) II] and
J Adsorptive Volt:nnmetty at mercury electrode
12- 4] have been carried out in Ibe past at trace andsob-trace concentrations.
It is known that alkali metals form complex salt of the
form Ga,[Fe(CN),J, wilb ferrocyanide ions inhydrochloric acid solution of pH 2 to 3. It was Ibougbt
Ibat detennination of excess K,IFe(CN).] bymltammetry can serve as an indirect melbod for Ibe
determination of gallium 151. Wilb Ibis objective,
Unear Scan Voltammograms (LSV) of potassium
ferrocyanide were studied employing Glassy Carbon(GC) disc (2mm dia) electrode. Tbe electrode was
scanned in the positive direction from -200 to 800 mVvs Saturated Calomel Electrode (SCE) at a scan rate of
50 mV/s and 10 mV/s in StationaryElectrodeVoltammetric (SEV) and Rotating Di>c Volt:nnmetric
(ROV) (1600 rpm) modes, respectively. To get
reproducible results, Ibe electrode was initially
polisbed metallograpbicaIly wilb 0.05 f1m alumina
slurry and resurfaced after e-arb experimeut.
The anodic peak curren~ (Ip) were observed to
increase linearly wilb concentrations of K.lFe(CN)J .Also, in ROV Ip was found to be five times of Ibe
corresponding SEV ( Fig.I). Based on Ibese
observations, experiments wilb gallium were carried
out in ROV mode. In Ibese experiments, Ibe
concentration of K,[Fe(CN).] (O.lmM) and Ibe cellvnlume (50 mL of 0.005M HCI) was maintained
constant and Ibe amount of gallium was varied. A plot
of decrease in ~of K,IFe(CN).] due to complexation bygallium VS Ibe amount of gallium was found to givea
straight line wilb a good correlation coeIIicient
(Fig.2).
!"
, ,~ (F«'~J""lm'f.
Fig.IJ'kJ/of[Fe(ll)IYslpinSEYaudRDY
~~/;
,,/
,y/J:, , .....-...............Qa(,.g) .
Fig 1 EffeclolqaUium anI, olg,IFeCN)J
t41
Founda', Day Special h,ue 2001
5002Il3
2000 37.57 33673\>0 5.58 449500 8.70 703750 15.36 11891000 18.83 1456300 5.7 446400 7.9 618500 9.5 744
MeanConc.1.52I 0.09 (rsd: 6%)Expected Ga conc.: 1.57 mglg
results obtained from four different sets of experiment'
carried out on different days. As can be seen, the values
were found to be within tbe experimental limits oferror.
Acknowledgment
Tbe authors wisb to thank Dr.V.Venugopai , Head, Fuel
Chemistry Division and Shri. D.S.C. Purushotham,Director, Nuclear Fuels Group for their interest andeocouragement in this work.
References
1. ].Wang, Stripping Analysis. rinciples,Iostrumentation and Applications, VCRPublishers,Deerfield Beach, FL, 1985.
2. ].Wang, Am. Lab., 17(5) (1985) 41.
3. Pablo Cofre and Karin Brink, Talanta 39 (2)(1992) 137.
4. Gaston East and Pablo Cofre, Talanta 40 (8)(1993) 1273.
5. 1. M. Kolthof Etal, Treatise On Anal. CbemistryPart II, Vol. II, Page 37, Inter Science, New York(1962)
For the determination of gallium, similar experiments
were carried out with known and unknown sample
solutions and the corresponding I, of K.[Fe(CN),]
were measured. From the decrease in I, of K,[Fe(CN),]in presence of known and unknown gallium samples,
the amount of gallium in the unknown sample solution
was calculated by ratio method. Table -I presents the
'won the Best fh.ai Presentation award tn th~ Workshop-cum-s;ininar on
alyllcul Chemistry and Allted Topics,EIAC2000' held at BARCfrom November 27J~,ber1, 2000
About the authors. . .
Msj.~ Karmlthas been working in tbefield of quality control of nuclear fuelsfor tbe last twenty years. Shehas heen actively invotved in developing various semilive eiectroanalytical techniques for differentapplications In the nuclearfuel cycle.
~9
Mr N. Goplnath has been working In thefield of quality control of nuclear fuelsfor the last 24 years. He hasbven actively Invo!oed in developing and employing various electroaualytical techniques for differentapplications In the nuclear fuel cycle.
Dr B.S. Sba- obtained his Ph.D. from University of Aiklbabad in 1976 and joined 1WIC In 1977. He Is
currently Invo!oed in the development of voUamawtric awtbadology for trace elemental aualyses In varioustypes of nuclear fuel rmlterials.
i*
Dr S.K Aggarwal Is the Head of the Mass Spectmawtry Section, Fuel Chemistry Division, 1WIc. He has been
working In the area of atomic mass spectroawtry since 1973. &sldes, he has bven Involved In
electroanalytical chemistry since 1994. He is the recipient ofseveraiMedeis of Honour. He bas visited mony
countries in connection witb scientific activities / awetings.
142
DARC NEWSLETTER Founder', Day Special I"ue 2001
Determination of Uranium and Plutoniumin Nuclear Fuel Materials
by Electroanalytical MethodsN. Gopinath, ].Y. Kama" N. B. Khedckar, K.Y. Lohithakshan, P. D. Mithapata, P.R. Nair,B.N. Patil, M. Renuka, KeshavChander. H.S. Sharma, M. Xavier and S.K. AggrwalFud Chern""" Div~ionBhabhaAtomic R=«h Centre
ELECfROANALYTICALMETHODS, POTENTIO-
meary, Biamperomeary aod Coulomeary are
. normallyemployedfor the determinationof Uand Po in various nuclear fuel materials surh as DO"~
PoO" (U,Po)O" (U,Po)C, (UO,+PoO,+C), UC, PoC
etc.. Results of high accuracy and precision are
required for the purpose of Chemical Quality
Assurance of fuels, because an accorate knowledge of
6ssile content is an importuJt and stringentrequirement in the nuclear fuel. The eIec1roanalyticalmethods have been adopted due to the fact that
actinides ions, especialiy, U and Po exist in multipleoxidation states in solution and are interconvertible.
Elec1roanalytical methods are simple in operation,
compatible for automation in a radioactive laboratory
and can provide reqnisite level of accuracy andprecision at milligr.un levels. Besides, instrumentation
involved in potentiometry and biamperomeary isinexpensive and indigenous.
Several redox methods have been developed and
modified in onr laboratory in the past for thedetermination of U and Po in nuclear fuels. Uranium
determination in uranium bearing fuels is carried Oul
by well known modified Davies and Gray [I,2J
method, wltirh involves redoction of U (VI) to U(IV) by
Fe (II) in >10 M phosphoricacidmedium.ExcessofFe(Il) ls selectively oxidised and U(IV) ls titrated with
standard potassium dichromate, after dilution with
dilule sulphuric acid. Potentiometric method ls
employed for detecting the end-point of the titration.This method is versatile in the sense that plutonimn, if
presen~ along with uranium, does not interfere.
However, because of the difficulty of plutonium
recovery from analytical waste in phosphate medium,
its application is preferred for uranium determination
in uranium based fuel materials. An alternate method,
developed in our laboratory 13] for uranium
determination in plntonium hearing fuel materials is
based on the reduction of U(Vl) to U(IV) byTiC!,in 6-7 M 8,SO" excess Ti(III) is destroyed by HNO, andU(IV) is titrated with standard K,Cr,o, using lerric ion
as intenuediate. The end-point is detected usingBiamperomeary.
Modified Drummond and Grant method [4J is
routinely employed for the determination of Po in
diverse matrices of fuel samples. The method involves
oxidatiouof Po to Po(Vl)withargenticoxidein 1 MH,SO,. The excess of argentic oxide is selectivelyreduced with sulphamic acid. In the next step, Po(Vl)
is reduced to Po(IV)/Po(III) by adding a knownamount of standardised Fe(II). The excess of Fe(II) is
titrated with dirhromate to a poteutiometric orbiamperometric end point
In potentiometry, Saturated Calomel Electrode (SCE) is
used as a reference electrode and a platinum wire as
an indicator electrode for sensing the potential of the
redox couples undergoing redox rhange. A digital
Poteutiometer directly monitors the poteutial of theredox couple. In biamperometric method, two
identical platinum wire, embedded in a glass tube,
sense the electrolysis current in the cell.
Amperometer, having facilities for applying a anitable
poteutial across the two platinum electrodes anddifferent Corrent ranges, is employed for monitoring
the eIectro~is current In order to achieve higher
143
Found,,'., Day Spedol/"u, 2001
accuracy and predsion, addition of \he reagents is
done on weight basis.
Quantitative dissolution of the sample is an essential
requirement for accurate determination. In actual
practice, a weight solid ( 200-500 mg ) sample is
dissolved in a suitable dissolvent medium. DO, samples
are dissolved in nitric acid and PuO, in conc. HNO,cont:Uning 0.05 M HF. Mixed carbide fuel samples
are dissolved in conc. HNO, + conc. H,SO, mixture(1:1), by direct dissolution procedure [5]. Dissolution
of Pu bearing fuel samples is carried ont in GloveBoxes. After \he dissolution, \he solution is
quantitatively transferred to preweighed volumetric
4 7
ftasks and is taken to another glove box for aliquoting.
Quantity of U and Pu is norm2lly in \he 3-5 mg r.mge
in each aliquot. Analysis of \hese aliquots for Pu or Uare carried ont in afumehood by the above mentionedmethods.
During the fahrication of FBTR fuel, a large numher of
samples of the finished prnduct sintered (IJ,Pu)C, as
well as starting material, VO" PuO" (V,Pu)O"
(UO,+PuO,+C), VC and PuC etc. have been analyzed
for Pu and U. Typical V and Pu results ohtained in a
series of thirty FBTR Foel samples are shown in figs. 1
and 2 respectively.
10 22 2513 16 19 28
Sample No.
Hgi
Hg.2
Distribution oJU & Pu in Sinlmd (U,Pu)C "'mp[e,oJFB1W1""
144
BARe NEWSLETTER Founder', Day Speciall"ue 2001
Redoxchemistry inroMd in these methods is not only
1iIrerestingbot 2isu exdtiog. All tJrese ifS(I«/S tfflb an
ernphasis on the interference of the impurities presentin the dissolved solution, reliability of the methods for
routine U,Pu detennination, sbali be discussed.
Acknowledgements
Authol1lthank Dr. V. Veungopal, Head Fuel ChemistryDMsion and Sbri D.S.C. Purusbotbam, Director,
Nuclear Fuels Group, BARe, for their keen interest intbiswork.
References
1. W.DaviesandW.Gray,Talantall,1203(19(i4)
2. M.,Jobn, S.Vaidyanathan, P.Venkataraman and P.R.
Natarajan, convention of chemists, Bangalore
0976) and lJAlIt: l/epOlV 1-634 (1 JlfJJ)
3. P.R. Nair, !lV. Lohithaksban, M. Xavier, S.G.
Maralbe, and H.C. Jain , , Determination of
Uranium and Plutonium in Plutonium Based Fuels
by SequentialAmperomelricTitration" J.R:ldinanal. Nucl. Chern. Articles, 122,19 (1988)
4. C.LBan, G.M.Nair, N.P. Singh, M.V.Ran1aniah and
N.srinivasan, Anal. Chern. 234,126(1971)
5. Keshav Cbander, B. N. PatiI, J.V. Itamat, N.B.
Khedekar, R.B.Manolkar, and S.G.Mar2the, Direct
Dissolution of Nuclear Materials for Chemical
Quality Control, Nucl,Tecbnol, 78, 69 (1987)
mp;.per .ron11Hi_, po;;;;;l'resetIiIiiiOnawardliithe lI'arliii1HJp'c"m...semllUlr on .""
'Eleclr<)tIIUIlylkalChemistry and Allied Topks, £MC ZOOO'held al BAlICfrom NtnJemberZ7 10/]eEetnlJe,rA!looo
About the autbors...
III/c.;!'
II~
Mr N. Gopinatb bas been worIl/ng In thefrefd of quality control of nudem fte/s for the last Z4yetm. Hebas been actively involved In tievekJpingand emp/oyiug vorl"", eiedroanalytlcal te<bniquesfor differentappllcatio", in the nudear fuel eyck.
MsJ.~ Kamal bas been working In /befield of quality control of nuclearfte/s for /be lost twenJyyear< Shebas been «tI..., involved in developing - """mve eIedroanaIytlcal te<bnlquesfor different
appIicatiom in /be nudem jiIel cycle. ,
Mr N.D. kbedekar joined BARC In 1980. Since tbnn, he bas been working in the field of chemical quality
control of vorl"", kinds of nuckar fuel malerial,
Dr K ~ Lobitlx1/uban joined BARC in 1981. He obtained MSc. and Ph.D. tkgrr!es from MuntbaI llnitJet>ity
in /be yetm 1990 and;J{)(J(),.,pecIiveIy in /be field of solvent extractWn 'tudles of IlCtini<ks. Pr=ntly, he
is involved in the cbemlcaJ quality control of nuclear fte/s.
145
Mr P.D.Mithapara has befm working in the field of solvent extraction studies of actinides since 1970.Presentryhe is involved in the quality control of nnekar fuelmiltenals.
MrP.R.NairjoinedBARCin 1976. Since then, he has been activery invoked in theareaofchemicaJquality
controlofnnekarfuels.
Mr B.N. Patil joined the BARC in 1971. Since then, be has befm activery involved in the area of chemica!
quaiitycontrolofnuckarflUJlmiltenais.
A MsM. RenukajoinedBARCin 1994. she is involved in thefieldofquality eontrolofnuckar flUJls.
Dr Keshav Chander joined BARC in 1967. since then, he has heen activery involved in the quality control of
nnekar fuels. He has devewped and standardized milny simpk eketroaualytical methods for the
determination of Pu, U and Th in a variety of sampks. He obtained his Ph.D. degree from Bombay
University in 1992.
I"Dr HS. Sharma ohtained his Ph.D. from University of Allahabad in 1976 andjoined BARC in 1977. He is
cumntry involved in the devewpment of vohammetric methadowgy for trace ekmenhd analyses in
varioM types of nuckar flUJlmiltenals.
Ms Mary Xavier is a graduate from 15' batch of BARC Training Schavl. She is responsibk for introducing
the simpk biamperometric methodowgy for determination of uranium and plutonium in nnekar fuel
sampks. Presentry, sbe is /(Joking afier the work perlaining to the quality control of nnekar flUJls.
Dr S.K. Aggarwal is the Head oftheMass Spectrometry Section, FlUJl Chemistry Division, BARC. He has heen
working in the area of alomie mass spectromelry siace 1973. hesides, he has befm involved in
ekctroaualytiea! chemistry since 1994. He is the recipient of several Medals of Honoar. He has visited
milny coantries in conmwtion with scientific activities / meetings.
146
Thermal Ionisation Mass SpectrometricAnalysis of Neodymium pre-separatedbyHigh Performance Liquid Chromatography
N. M. Raut, P. G. Jaison and S. K. AggatwalFud Ch,rnimy DivisionBh,bha Amrnk R"",ch C,n'"
ISOTOPICCOMPOSmONANDCONCENTRATIONOF
Nd are important for the detennination of burn-upof nuclear fuel and also for geochrouological
studies using Sm-Nd couple. It involves three steps; (i)
separation of lanthanides from the major matrix, (li)
purIfication of Nd from other lanthanides and (ill)
mass spectrometric analysis of purIfied fraction.Several methods e.g. solvent extraction,
chromatogmphlc separation on anion and cation
exchanger resin etc. are available for matrix
separation. But separation of Nd from otherlanthanIdes is a difficult task due to their similar
chemical behaviour. Isobaric overlaps like Sm-I44,Sm-I48, Sm-150 and Ce-142 hamper the accurate
detennioation of isotopic composition Nd by Thermal
lonisation Mass Spectrometry (TIMS) and therefore, an
extensive chemical separation is required. High
Performance Liqnid Chromatography (HPLC), a
promising separation method, offers the potential toresolve all the lanthanIdes in a short time- Keeping
above aims in mind, a fast and efficient method fur
separation of different lanthanIdes using HPLC was
investigated. Reverse phase dyruunicaliy modified ion
exchange chromatogmphy was selected for carryingout the studies because of its ability to alter the ion-
exchange capacity and selectivity rapidly. Hydrophobicanion like camphor sulphonate was tested as a
modifier for C-18 reversed phase colwnn and «-
hydroxy isobutyric acid «(-HIBA) was used as elnent.
Arsenazo (III), a specific complexing agent for
lanthanIdes, was used as the post-column derivatising
agent during development of separation method. A
diode array detector was employed for monitoring the
eluted lanthanides at a waveleugth of 615 mu. Under
the chromatographic conditions, the retention times of
separated lanthanides were recorded and used for
progmmuting in the fraction collector. The nse ofarsenazo(lll) was ellminated while collecting the
fractions for mass spectrometric analysis. A synthetic
mixture of Ce, Nd and Sm in 1:1:1 proportion (by
weight) was prepared and separated by HPLC.The Ndfraction collected contained the organic components i.
e. the eluent and the modifier used in c1uomatogmphlc
separatiou. The application of this Nd fractiou along
with the organic part on 6lament used in the ion
source of TIMSsuppresses the yield of Nd' ions. Hencethe collected fractiou was pre-treated with
concentrated UNO, and 8,0, and evaporated to
dryness. This was repeated 4 to 5 times to destroy the
organic part. The fraction free from organic truiIterwas
concentrated and analysed hy TIMS using a double6lament assembly. The isotope ratio measurements
were done at temperatures corresponding to 4.5A and
2.5A for ionisation and vaporisation 6Iameots,
respectively. No isobaric interferences were present at142 (Ce), 144 (8m), 148 (Sm) and 150 (8m) as was
evident from the absence of peaks at mil 140 (Ce')
and at mil 147, 152 (Sm'). Resubs of isotopic
composition of separated Nd fraction were comparedwith those of natural Nd and were in good agreement.
Thos it is possible to detennine the accnrate isotopiccomposition of Nd from a mixture of lanthanIdes hy
TIMS and the developed HPLC procedure for
separation.
147
Found,,', Day Sp,dol hm 2001
About tbeautbars ...
..
I
Mr N. M. Raut comPktedM Sc. in Analytical Chemistry from Mumbai Univer,ity in 1998. HejoinedBARC
injanuary 1999 as ajunior Research Feik>w under theMumhai Univer#ty -DAE co/k>horative programme.
Presently, he is working in theMas, Spectrometry Section ofFueiChemi,tryDivisionfarhi,Ph.D. withDr.
S. K Aggarwal. Hi, research field iocimk, the phy,ico-chemical sludies far "'termination of trace
ekmenls using HPLC andMass Spectrometry.
Mr P.G.jaison bas obtained MSc. in Chemistryfrom Cachin Universiiyof Science andTechnologyin 1997. Hejoined FuetChemistryDivision,BAlle,througbibe41"baicba/TrainingSchoolin 1998.Presently,he is workingonHPLCand inorganicmassspectrometry.
Dr S.K Aggarwal is the Head of the Mass Spectrometry Section, Fuet Chemistry Division, BARC. He has been
working in the area of atomic mass spectrometry since 1973. Be#des, he has heen inoolved in
ekctroanalytical chemistry sioce 1994. He is the recipient of several Medals of Honour. He bas visited
many countries in connection with scientific activities / meetings.
148
A Simple and Rapid Molecular Method forDistinguishing between Races of Fusariumoxysporum f.sp. Ciceris from India
A. Chaluabarti, P.K. Mukhe'jee, P. Sh«khane and N.H.K. MurthyNode" Ag,iwho" ,nd Bio",hnolngy Di,i.ionBh,bh, Awmi, Re,,"ch Cenae
Abstract
A simPk, mPid and reliabk method for studying the variability and itkotification of races of the chickpea wiltpathogen F,,",arium oxysparum fsp. ciceris (FOC) is described here. The method involves sekctiveamplification of the intergenic spacer (IGS) region of the nuckar ribosomal DNA,and restriction digestionwitb a set of emrymes. RFLP anarysis of the amplified IGSregion offour isofates o/FOCiepresentingfour racesfrom India (RaceI-Patancheru; Race2 - Kanpur; Race3 - Gurdaspur; Race 4- jabatpur.) was carried-out witb
varia,,", restriction emryme.5. All the enzymes gave simifar restriction pattern for race I and race 4; which was
distinctry different from race 2 or race 3. The present finding indicates that race 1 and race 4 are either the
same or very ckJsery refated to each other. It is suggested tbat amplification of the IGS region and digestion
with restriction emrymes could he Used to study polJlmorphism in FOG, and to itkotif; the races existing in
India.
Introduction
FUSARIUM OXYSPORUMSCHL.:FR.F.SP.CICBRIS(Padwick) Mauto & Sato, which incites wilt, is
one of the major pathogens of chickpea (Cicer
arktlnum L.) worldwide, especially in the Jodiansubcootinent and the Mediterranian basin [ 1,2]. The
best available method for control of fusarium wilt is the
cultivation of resistant chickpea varieties [3]. However,
the existence of severul physiological races of the
pathogen makes it complicated to contain thes disease
through resistance hreeding. Seven races of thes
pathogen have so far been reported. Races 1-4 fromIndia; 0,1, 5, 6 from Califomiaand Spain; 1 and 6 fromMorocco and 0 from Tunisia [4,5,6]. Race I has
further been subdivided into three sub-groups viz. IA,
IB and IC [6]. Of these races, race IA, 2 through 6
cause typical fusarial wilt and necrosis, whereas, races
0,18 and IC induce yellowing syndrome in absence of
wilting [6]. The races arc conventionally identified by
inoculation of a set of 10 differential varieties [3]. This
method of rAce identification is expensive, time
consuming (at least 40 days) and may be inflnenced by
variability inherent in the experimental system [7,8,9].
In thes regard, a rapid molecular method, therefore,
would be advantageous over conventional techniques
of race identification.
UsingRAPD/AFLPanalysis,Kelleyel aI. [1O,l1Jcoulddifferentiate between the two groupstpathotypes
indncing either wilt or yellowing symptoms. No
polymorphism in the mitochondrial DNAwas detectedamong the seven races studied by Perez-ArIes el al.
[12]. To our knowledge, there is no molecularmethod avallable that could distingrtish between the
wilt-indncing races of thes pathogen. RFL.Panalysis ofthe nuclear ribosotual DNA (rDNA) was nseful in
demonstrating species-specific differences in to xin-
149
NEWSLETTER Found,,', DaySp,,;a! bm 200!
producing Fusarium spp, [131, The present paper
reports on the genetic variability within wilt-causing
pathotype of [( oxysporum f.sp. deBris usingmolecular methods based on the varinbility in the rDNA
region. The nsefulness of tlUs method in studying the
polymorphism in the wilt-indting isolates of FOC and
the rapid race identification has been discussed.
Materials and Methods
Fungal Isolates
Four isolates of [( oxysporum f.sp. cieerls,representing four races from India were collected from
the International Crops Research Institute for the Serm-
Arid Tropics, Patancheru. Race I was originallyisolated from Hyderabad, 2 from Kanpur, 3 fromGurdaspur and 4 from ]abalpnr. The cultures were
multiplied and maIntained on potato dextrose medium.
Isolation of genomic DNA
High molecular weight genormc DNA from Fusorium
mycelium grown in potato dextrose broth for 3 days,
were isolated using a method described by Kim et al
[14]. Briefly, the mycelium was harvested on
Whatman no. I filter papers, washed thorougWy and
ground in liquid nitrogen. Five ml of extraction buller
(100 mM NaC!, 10 mM Tris, I mM Na,EDTA,pH 8)
containing 1.0 % SDS and 05% p-mercaptoethanol
was added to 2 g of ground mycelimn taken in 50 mf.
Sorvall centrifuge tubes and nUxed thorougWy. The
mixture was incubated at room temperature for 30
minutes and extracted twice with equal volume ofphenoV chlorofonnl isoamyl alcohol (25:24:1) and
twice with chloroform! isoamyl alcohoL DNA was
predpitated with two volnme of ice-cold ethanol,
spooled, washed with 70% ethanol and dissolved in TE
buller (10 mMTris, I mM Na,EDTA,pH 8).
PCR.amplijkation and restriction analysis
Amplification of the IGS region was performed using
the primer p;rlr CLN 12(CTGAACGCCTCTAAGTCAG) and
CNSl(GAGACAAGCATATGACTACTG) designed by Apple
and Gordon [15] for Fusarium oxysporum with
priming sites at the 3' end of the 2SS gene and 5'
end of the ISSgene reapectively. The amplification nUx
contained 05~M primer, lOng DNA,O.lmM of each of
the dNTPs in IX reaction buller containing 1.5 mM
MgCl, (supplied by manufacturer). After initial melting
at 95"C for 5min, temperature was held at 68"C and IUof Taq polymerase (Bangalore Genei, India) was added
per 25~1 final volume of reaction nUx. This WJS
foliowed by 30 cycles of amplification with the
foliowing parameters: annealing at 55"C for ltain,
extension at n"c for 2min, melting at 94"C and a finalextension of 10 min at n"c. The amplified products
were extracted twice with chlorofonnlisoamylalcohol
(24:1), ethanol precipitated, washed with 70% ethanol
and dissolved in TE. The products thus purified were
digested completely with Eeo RI, Bam 1lI, Hind Ill, Fst
I, Sac I (New Englaod Biolabs) , Taq I (Boehrioger
maunheim), Alu I and Sau 3A I (Bangalore Geoei,
India) as per manufacturers' instructioos and size
separnted on 1.5% agarose gels in IXTBE buller.
Results and Discussion
Our earlier experiments on RFLP analysis using
Neurospora crassa rDNA as probe indicated the
presence of a variable EcoRi site. Amplification of the
ITS region foliowed by EeoRi digestion did not prodnce
any variability and combining these two we could
locate the varinble Eoo RI site on the IGSregion.
Using the primer pili CLN 12 and CNS I, we could
amplify the IGS region from all the 4 races, the
approximate size being 2.6kb (2.4 for Race 2)
(Fig. I). Digestion of the amplified IGSregion withEooRI prnduced simllar bands for both Race I and Race 4(one 1.9 and another 0.7kb). But individual and
distinctive banding pattern were observed for bothRace 2 (1.9 and 05 kb) and Race 3 (2.2 and 0.4 kb)
(Fig. 1). This conclusively proved that the varinbility in
the restriction patterns observed in Southernhybridization with rDNArepeat unit from Nocrasso was
indeed due to varinbility of the Eco RI site within the
IGS region. When variability within the IGSregion wasfurther studied using Hind Ill, Bam HI and Sac I,
none of them did restrict the amplified fragmentindicating absence of these sites within IGSregion in all
the four races. However, Pst I was found to have one
site only in case of Race 3 ( 2.0 and 0.6 kb fragment)
(Pig. 1). When tetrabase cutters (Alu I, Taq I and Sau
ISO
Found,,', Day Spedol!"ue 200!
~""""':;;~"'<')"':;;~"""'"~~ ~~~~~ ~~~~1!~~&.&. &.&.~&.&. &.&.~&.&.&.&.
Kb Kb
5.0
4.03.0
2.0
1.5
1.0
5.04.03.0
2.0
1.5
1.0
.75
.50
.75
.50
' v 'UNCUT
' v 'EcoRI
Fig.! PCB omplljkd IG8"'8'°n ood It, EooRl uod P"I ""triclton pa/Wrm oJfou",""" oJFOC
Kb
:;;~ "'<') '" :;; ~'" '" '"
~~1!n~~1!~~::;;&.&.&.&.::;;&.&.&.&.
5.04.03.0
2.0
1.5
1.0
.75
.50
.25
Toq I Sou 3AI
Fig2 R"tricltonpattern oJthePCB omplljkd!GSrog/on oJfoun'OC"oJFOCw//bTaij/, AluIoodSau,W
151
3A I) were used number of restriction fragments were
produced. But in each case Race I and 4 had similar
prome where as that for Race 2 and 3 were always
different from each other and rest all (Fig. 2).
~ oxysporum f.sp. dceris races were originallyclassified based on wilt reaction on 10 differential lines
[4J. The disease reactinn was scored based on percent
wilting (resistant 0-20%, moderately susceptible 21-
50%, and susceptible >51% wilt). While Races I, 2
and 3 could be cleariy identified based on distinctreactions (either resistant or susceptibie) on two
differential lines, race 4 was designated based on
reaction on ouly one differential line Le., CPS-l, and
the reaction was "moderately susceptible" as comparedto "resistant" for race I. This observation is indicative
of relatedness of race I to race 4. The data obtained in
the present experiment also indicate that races I and 4
are identical with respect to restriction pattern of the
IGSregion of the rDNA However, race 1/4 is distinctlydifferent from race 2 and race 3, which are different
from each other. The present investigation indicates
that the wilt-causing races of ~ oxysporum f.sp.
dceris are genetically distinct, and polymorphism can
be studied in the wilt causing pathotype using the
variability in the IGS region. We also suggest that after
further verification with more representative isolates, it
could be possible to develop a simple, rapid and
reliabie method of race identification in FOC by
amplifying the IGS region and restriction digestion of
the same with appropriate restriction enzyme(s).
Acknowledgement
The anthors thank Dr. M.P. Haware, ICRISATAsia
Center, Patanchern, for the Fusarium oxysporum f.sp.dceris isolates.
References
I. Haware M.P. Fusarium wilt and other important
diseases of chickpea in the mediterranean area.
OptMediterrSem 1990; 9: 61-64
2. Nene Y.L. and Reddy M.V., in The chickpea (eds
Saxena M.C. and Singh KB.), Oxon: CAB
InternationuJ, 1987, pp. 233-70.
3. Haware, M.P., Nene, Y.L, Pundlr, RP.S. and
Narayana Rao J., Field Crops Res., 1992, 30, 147-
154.4. Haware,M.P.andNene,Y.L,PlantDis.,1982,66,
809-810.5. Jimenez-Dlas, RM., Trapero-Casas, A.and Cabrera
de la Colina]., in Vascular wilt diseases of plants
(eds Tjamos E.C. and Beckman C.), Springer-
Verlag, Berlin, 1989, 828, pp. 515-520.
6. Jimenez-Djjjz, RM., Alcala-Jimenez, A, Hervas, A.
and Traperocasas J.L, Hod. Rosi. Aklim. Nasn.
(Special Edition), 1993,37,87-94.
7. leala-Jimenez, A.R, Trapero-Casas, ].L and
Jimenez-Diaz,RM.,in Resumenes, VI Congreso
£atino-Americano de Fitopatologia,
Torremolinos, Spain, 1992, pp. 39.8. Bhatti, M.A.and Kraft, J.M., Plant Dis., 1992, 76,
50-54.
9. Bhatti, M.A.and Kraft, J.M., Plant Dis.,1992, 76,1259-62.
10. Kelly., A, Alcala-Jimenez, A.R and Bainbridge,
B.W., in Modern assays for plant pathogenic
fungi- Identification, detection and
quantification (eds Schots, A., Dewey, F.M. and
Oliver, Rp.), Oxon: CABInternational, 1994, pp.75-82.
II. Kelly, A., Alcala-Jimenez, AR, Bainbridge, B.W.,Heale, ].B., Perez-ArIes, E. andJimenez-Diaz, RM.,
Pbytopath., 1994,84,1294-1298.
12. Per-ArIes, E., Roncero, M.I.G. and Jimenez-Diaz,
RM.,j. Pbytopath.,1995, 143, 105-109.
13. Lodolo, E.]., Van Zyl, W.H. and Rabie, CJ., Myco!.
Res., 1992, 97, 345-46.
14. Kim, D.H., Martyn, RD. and Magill, C.W.,
Pbytoparasitica, 1991, 19, 211-213.
15. Appel, DJ and Gordon, T.R, Mol. Plant-Microbe
Interactious, 1996, 9,125-138.
152
About the authors...
M' Apratim Chakmba,ti, M.Sc., isfrom 41" batch of BARC T,aining Schoo!. He won the Homi Bhabha awa,d
fo, Biowgy.Radiobiowgy discipline in his batch, and is wo,king in the Plant Cell Culturn Techiwwgy
Sectian ofNuclea, Agricultu,e and Biotecbnowgy Division (NABTD).
Dr P.K Mukhmjee,M.Sc., completed his Ph.D. as aD' KS KrishnanDAR ,esea"hfe!.kJw. He is wo,king in
the Plant Pathowgy and Pesticide Residues Section of NABTD, on the biocont'o!. mechanisms of plant
diseases. He was awa,ded the 'Pran Vohm Awa,d' fo, agricultural sciences 1998.99 by the !.ndian
Sciences Congress Association.
, Mr P.D. Sbe,hkane, B.Sc. (Micrabiowgy), joined BARC in !.997. He is working in the Piant Patbowgy and
Pesticide Residues Sectian of NABTD.
Dr NB.K Murtby, MSc., Ph.D., is the Head ofPiant pathowgy and Pesticide Residues Sectian, NABTD.His
special.tzation is in the fiel.d of pesticide residues. He has several publ.tcations in nati<mal aadinternatiomd journa~ to his credit
Dr Aj Tamhankar did his MSc. (Agriculture) from Nagpur University and Ph.D.from MPKV.
He is currently heading the Pheromone and SITgroup of Nuckar Agriculture and Biotechnology
Division, BARC. He has puhlished several papers in national and International journ~ on the
subject of insect sex phemwmones and sterik insect technique.
i53
A Methodology for the Estimation ofMercury, Boron, Samarium and Cadmiumby Prompt Gamma RayActivation Analysis
Yogesh Scindia, A.V.R. Reddy, A.G.c. Nai" A. Goswami, R.N. Acharya,KSnwshan and S.H. Manoh.,Radioch,mimy DivisionBhabh, Awmic R"""h C,rn"
Abstract
Prompt Gamma ray Neutron Activation Analysis (PGNAA) ts an effective analysis techniql#J especiaOy for
lighter elements like boron, hydrogen, nitrogen and sorrw rare earth elements. A PGNAA system was set up
making use of the guifkd neutron beam facility at the Dhruva Reactor for tbe first time in BARC. A metbod ta
estimate high neutron absorbing elements like Hg, B, Sm and Cd which eliminates tbe variations in neutron
flu;x and georrwtric efficiency is discussed.
Introduction
PGNAA TECHNIQUE IS BASED ON THE RADIATIVE
.. captu,e of neutwn by the nucleus. It is a nniqne
non-destructive techniqne complementary to the
conventional Neutwn Activation Analysis. It is widelyused fm many elements, which ...e nmmally not
aI'llenable to NAA[I]. Its seusitivities fa, elements like
B, Hg, Sm, Cd and Gd...e supedo, dne to thei, highe,
neutton absol']Jtion cwss section. Routine assay of
these elements is c..-ded ant by standal'd compalison
techniqne. This calls fa, dnnble hradiation and
thmfme ,eqni,es COITections fm the iITCpmducible
paJ'affiete" like neutton flux and detection elliciency
maInly due to the valiation in the sal'llplegeometry, se~
attenuation of the neutton flux. In the p,esent
appwach, the sal'llple containing elements of intmst is
intimately mised with known aI'llount of standal'd
(ammonium chlodde) and inadiated. This obviates the
need fa, sep te ir,adiation of the standal'd. In the
p,esent wad, a methodology based on calibmtion
curve of the element of inte,est, comcted by the count
mte of \;] as standal'd is ,epnrted.
Experimental
The the,mal guided bCaJ'llfacility in 100 MW Dh,"".
,cactm, BARC,Twmbaywasusedfa, the PGNAAwmk.The neutwn beal'll is t,ansported thwugiI the guided
beal'll tube to about 30 mete" away ITom the ,eacto,
co,e. An expedmenta! set up has been ananged fm
PGNAAusing tins guided beal'll. The dimensions of thebeal'll ...e 2.5 cm x 10 em. The detecto, was
su,,"unded by 30 cm tinck lcad bdcks as shielding
mate,ial fa, ,educing the gal'llma my baclwound. The
y-my detectm was located at about 40 cm distance
ITom the sal'llple and was at 90" with ,espect to thebeal'll dimtion. A lead collimatm 01 3 cm dia and 30
cm length was used in ITontof the detecto, to collimate
the gamma mys coming Iwm the sal'llple.
Elements in the;' appwpdate chemical lo,m (whe,eve,
possible the chlo,ide salt) weighing in the ,ange of
100-500 mg we,e mised thowughIywith knownaI'llount 01 NH,Cl and wmpped in a dtin Teflon tape.They we,e exposed to the neutwn bCaJ'llfa, snlflciently
longtime.A 22% HPGedetecto, counectedto a PC
154
based8k MCAwasused for assayof prompt gamma
rays.Theresolutionofthedetectoris 2.4keYat 1332keY.The MCAhas beeo calibrated in the eoergy region
of 0.1 to 8.5MeYusingthe delayedgammaraysfrom"'En and .Co, and prompt gamma rays from "CI. A
second order polynomial was used for the energy
calibration. Photo peak areas under the corresponding
gamma lines of "CI (1951 keY), boron (478 keY),
mercury (368 keY), samarium (333 keY) andcadmium (558 keY) were detenuined by analysing the
gamma ray spectra using the software developed inElectronics Division, Bhabha Atontic Research Centre.
Thecountrateper log of 1951keYgamma rayfrom"CI in a sample was taken as standard and count
rate/log of "CI for other samples were normalised tothis value. The same norrnalisation factors were
applied to the count rate per log of the element ofinterest.
,,' '> >,,! ",. ,.~"""","~"""""'"" """""
."'0.."""""
,,'
~ ,,'
'"'
'"'"'" '"'" 00'" '"'" 00'"00'" ,0"0'"'"
Fig1 AtyPlcalpromptgam"""ay'f>ec/romofNH,Gf
Results and Discussions
Fig.! shows a typical gamma-rayspectrum of NH,CIwith the background. The delayed gamma-raysfrom
"'Eu and the prompt gamma-raysfrom "CI and "riwere used for efficiency calibraticn. The absoluteefficiencies were deterntined for low energy region
(i.e.. upto 1500keY)using"'Eusource.Therelative'efficiency plot from 500 to 9000 KeYobtained fromthe prompt gamma-rays of "CI and "Ti wereoormalizedwith absolutevaluesfrom "'Eu. Thedetails
of efficieocy fitting are given elsewhere [2]. Theabsolnteefficiencyplot is shownin Fig.2.
10"
~u.'0"'w00"u.i'i,0'.~::i'
10'3 4 5
Energy (keV)
Fig. 2.Absoloteefficiencyco", of thePGNAA system
/ ]/ .
° " 'w ,. ~ "","0000
"O,~"'"" "'""'"
Fig. 3 SensitivitypkJt ofB, c~ ligand Sm
155
Fig. 3 shows the plot of the normalised count rate
plotted as a function of the elemental weight for the
above mentioned elements. Good linearity between thenormalised count rate versns weight of the element is
observed with correlation coefficient valnes rangingfrom 0.999 - 0.99 for the entire weight range studied.
The linearity of the CPS Vs weight over the wide rangeshows the feasibility of this method for determining
concentrations in nnknown samples over this widerange.
References
1. G. L. Molnar, Zs. Revay,R L. Paul, R M.Understram,J Radioanal Nucl Chem.234, 21(1998).
2. K. Sudarshan,A.G.C.Nalr, RN. Acbarya,Y.M.Scindia, A.V.R Reddy, S.B. Manohar and A.Goswami,Nucl Insir. and Meth.A 457 (2001)180.
156
SF6 Gas Handling System for FOTIA atBARC
S.K.Gupta, RY. Patkar, P. Singh, E. Shallom, A. Agarwal, S. Santta, Rajesh Kumar,S.P. Sarode, P.J. Raut and B.K. JainNod", Phy,i~ Diyi,iooBh,bh, Awmi, R~""h Cwo,
and
S.Y. Gogate, RR Patankar, M.G. Andhansare, A.c. Tikku and M.G. Khadilkar",",w, Smi~, ,ad M,im'o'o~ Diyi,iooBh,bh.. Awmi, R~""h Coon'
Introduction
N INDIGENOUSLYBUILTFOTIAFACIUTYHASrecently been commissioned at BARC. It involved
designing, procurement, fabrication, testing,
installation and commissioning of a 6 MV ]'Qlded
TandemIonAcceleralor(FOTlA) (Fig.l), byutilizingalarge part of the existing eqnipment such as thepressure tank, the storage tank, the equipotential rings,
the high voltage dome and the accelerator room of theold 5.5 MY Van-de-Graaff accelerator at the Nuclear
PhysicsDivision, BARC.
Theconstructionof theFOTlAinvolveddevelopmentofstate-of-the-art technologies for several important
components like dipole magnets, high voltage
generator, SF, gas handling system, vacnum systems,magnetic and electrostatic lenses, computer control
system, etc [IJ. A new accelerator facility of tltis type
would have costed around 18 crore rupees to the
department. However, due to availability of the
expertise at BARCand utilization of infrastructure from
the earlier Van-de-Graaff accelerator, it was possible to
set up the facility in a cost effective way al about 3-4
crore rupees.The FOTlA has capabilityof deliveringaccelerated light and heavy ion beams up to A~40 and
beam energy up to 66 MeV. These accelerated beamswill be used both for research in basic and applied
science in the fields of nuclear physics, astrophysics,
material science, accelerator mass spectrometry,
atontic spectroscopy, etc.
The high voltage column section of the FOTIA was
tested and a voltage of 3.4 MYwas achieved on the
terminal with N,+CO, gas ntixture filled in theaccelerator tank at a pressure of 98 psig [2J. The
terminal voltage would exceed 6 MY with SF, gas, as its
dielectric breakdown strength is more than 2 times that
of the N,+CO, ntixlure at this pressure. A SF, gashandling s')'Stem was designed, fabricated, installed [3]
for FOTlA and has been used extensIvely for high
voltage operation. In tltis paper, some of the salient
features of the gas handling system arc discnssed.
Objective of Using SF, Gas in FOTIA
Tbe FOTlA is an electrostaticacceleratorin which
terminal is raised to a maximnm voltage of 6 MVwbereas the accelerator tank is at ground potential.
While the lower portion of the terntinal has coaxial
cylindrical geometry, the upper portion has spherical
geometry. The coaxial cylindrical geometry is formed
between cylindrical surfaces of the high voltage dome
and the accelerator tank. Similarly coaxial spherical
geometry is formed between spherical top end of the
high voltage terntinal and the accelerator tank The
typical voltage gradients between dome and the
accelerating tank at the terntinal voltage of 6 MY,for
cylindrical and spherical geometries, are 134 kV/cm
and 205 kV/cm respectively. These voltage gratlients
could be withstood by using N,+CO, gas mixture asinsulating medium ouly if accelerator tank pressure is
t57
r-:LDED
I TANDEM
I
ION
ACCELERATOR.,
BAR.C.
Fig! Ferspectlve_ofFoJdedTomkm lonAcvelerotw (FOTlA)
158
maintainedat about 240 psig. Iu FOrIA, since
compressed geometry acceleratiog tubes are usedwhich bavea safemaximum operatinggaspressureof
120 psig, achieving6 MY at the terminal with N,+CO,mlainre would oot be possible. Hence, an insulating
medium of higher dielectric strengthwas mandatory.Design calculations indicated that SF, is the suitableinsulatinggasmediumfor this requirement.In additionto i~ excellent dielectric properties, SF, bas goodchenticalstability, thermalpropertiesand is nontoxic.
Properties of the SF, gas
Chemical and electrkal properties
Under oormal conditions SF, gas is cbemically inert,
stable and least reactive. It can be beated op to a
temperature of 500"Cin quartz containers without anydecomposition. The electrical discbarges, bowever, can
cause decomposition of SF, gas. Under the influence of
an electric arc a portion of the SF, gas L<dissociatedinto i~ atontic constituent<.
SF, S + 6F"'"
Tbls reaction is reversible. After the discbarge, the
dissociation produc~ may recombine to form the
original molecule. Both solid and gaseous produc~
sucb as SOF" SOl" SOF" SF, can result from these
secondary reactions. These produc~ are uot barntiul iu
the absence of moisture. However, they hydrolyze in
the presence of moisture and form higidy corrosiveacids like HF.
Up to I50"C, materials such as metals, cerantics, glass,
rubber and cast resins, normally used in the
accelerator systems, are stable in SF, environment.
Pure SF, is chentically inert and does not cause
corrosion.However,in the presenceof moisture,theprimary and secondary decomposition produc~ of SF,form corrosive electrolytes which may attack and cause
damage resulting in operational failure of various
devices. As it is practically impossible to avoid
formation of SF,decompositionproduc~corrosionofdevices can be largely eliminated by the carefulexclusion of. moisture and selection of suitablematerials.
The excellent electrical insulating properties of SF,are attributabletoi~ strong electronaffinity(electro
negativity). SF, bus a dielectric coustant of 1.002 at20"C.
Physlcat and thermal properties of SF,
The SF, is a colorless, odonrless non-toxic and non-
inflammable gas with a molecular weight of 146.05 and
is about 5 times heavier than ail. Some of i~ physical
properties, used in the system design, are as follows:
Cas density (20"C)
Thermal Conductivity
Heat transfer coefficient (J
bar,2m/secflowrate)
Specific Heat (25" C)
: 6.07 gmJ1itre
: 1.3 x 10' W/cm k
: 30W/m'k
: 97.26J/molk
Details of the SF, Gas Handling System
In view of the abovementionedelectrical propertiesitwas decided to use SF, gas as the insulating mediumand a SF.gas handlingsystem [3] was designed,fabricated, installedand comntissionedat FOTIA.Itcousis~ of an oil free compressor,a centrifugalblower, a heat exchanger,dust fllters,dryersand avacuum pump etc. The schematic diagram of the SF,gashandling system is showu iu Fig.2.
It bas been designed to achieve the followiugobjectives:
I. Trausfer of SF, gas from cylinders to the storagetank.
2. Transfer of SF, gas from the storage tank to theaccelerator tank before starting the accelerator.
3. Transfer of SF,gas from the accelerator tank to thestorage tank for repair/Illilintenance work.
4. Recirculation of SF, gas during the acceleratoroperationfor removalof moisture, decompositionproduc~ and cooling of varlons devicesin highvoltage terminal and accelerator tank area.
Detalled heat transfer calculations were done to arrive
at the recirculatioo flow in order to remove the total
heat load of about 20 kW from the systemand toeosure thai high voltage terminal, which is having amaximum heat load of about 5 kW, is maiotained
within the permissible temperature Untit of 50"C
159
~.=~-- -- --
<">- _V'C~-- .~ v~.V1- ~~, v~~-- "=~ v~~Iii _no<A ~~.~~
@J0
~. _.~. ~.".p~u ~...
'-'3-0 ~~ ~=
-,.-. .m.~ -=0
fiJI_2SdHmmIi,j/om,bw/oJ."~"a.,baadli"g'J"'em
Magnet Cooing,J:~';:";';,T~~._.
T_"".~-""'.7"(.'
~w"",._~,~w;" ,;.,
Fig.3 Var/alio" of/empem/","of'be 18ftfo/di"g mago,' ",i" ood it, ,0""0,,di"8 arm milb oodmitbo"'jo,,ed
cooli"3-
160
(Fig 3). It W1ISestimated that a total flow rate of 5000
Ipm, at an operating pressure of 6.3 kWcm' of SF" is
required to remove the above beat load. A blower with
suitable capacity (7000 Ipm) was designed, fabricated
and installed in the system. Out of the total flow of
7000 [pm passing through the cbilled water beat
excbanger, 5000 Ipm goes into the accelerator tank
and 2000 Ipm is used to cool the motor of the blower.
It was also estimated that a total bead of 5538 mm of
water column, for SF, gas at pressure of 6.3 kWcm', is
required to maintain the above mentioned flnw rate in
the main circuit.
Hg.4 IB1f-joldlngm«gn<JUnsidet'" hlghoottage_'nnl
From the main recircuJation circuit 1000 Ipm of gas isdiverted to the terminai section inside the accelerator
tank for adequate cooling of the components [4] like
180'-folding magnet, 100 amp power supply,controflers for strippers, Faraday cup and ion pump
etc. installed inside the dome (Fig. 4) and 4000 Ipm is
directly blown on to the high voltage column section
for the removal of break down products produced due
to high voltage corona discharges. A globe valve is
provided in the gas line to reguJate and control the gasflow into the terminal. The system bas been tested with
N, + CO, gas mixture as insuJating gas at 100 psig for
terminal voltages of up to 3.4 MV and found
satisfactory.
An air compressor baving capacity of 110 CFM, rated
for a maximum discbarge pressure of 125 psig and a
suction pressure of I atm, is used. It is a non
lubricating type, vertical double acting, single stagecompressor (de-rated for SF, application). The
compressor is used for transferring the gas from
cylinders to the storage tank and also from the stofagetank to the accelerator tank and vice versa.
The recirculating blower is a centrifugal blower
designed for a flow rate of 7000 Ipm at 6.3 kWcm' withan equivalent discharge bead of 130 mm water column
at a pressure of I atm of air.
Heat exchanger is a shell & tube type with single pass
on shell side and ten passes on tube side. It has gas onshell side and cbilled water on the tube side. The heat
exchanger is designed to remove a heat load of 20 kWand has a transfer area of 13.4 m'. The gas (at 31'C)
when passed through the heat exchanger gets cooled to25'C.
A vertical vessel twin column activated alumina filled
dryer is used for removing the moisture and
breakdown products. Activation of alumina balls is
done by passing pre-heated air at 150"C tluough thealumina bed.
Coarse and flue fiters are provided to make sure that
dust free SF,gas is circuJated tluough the accelerator
column. Coarse fiters are pleated bag type suitable forfitering dust particles of sizes above 1.0 micron. A flue
fiter assembly has been incorporated in the gas line at
the entry of the accelerator tank Fine fiter is a
cartridge type and bas four borosilicate glass fibercartridges mounted inside a SS housing and is suItable
for fitering dust particles of size above 0.1 micron.
Safety Features of the SF, Gas HandlingSystem
The gas storage and accelerator tanks of the old 5.5MVVan-de-Graafl accelerator are used in the Fom
The operating pressure in the Van-de-Graafl
accelerator was 225 psig. In FOTIA,SF, gas operatingpressure will be 80 psig. The ultrasouic and "Iu-situ"
101
metallographic examinations carried out by the NDT &
QutaIltyEvaluation Sectiou nf the Atomic Fuels Divisinn,BARCto mnnitorthe conditionof the tanksfor their
continued nse showed that it is safe to use the existingtanks in the new system [5J. Siuce the main health
hazard from SF, gas is that of a simple asphyxiant,
oxygen defidency monitors have been provided at
several strategic points in the building. If the oxygencontent falls below the safe limit of 16.5% level, a loud
wailing inside the high voltage tenninal siren will
be sounded in the building indicating that building
should be evacuated immediately. SF, is a very
expensive gas and is not readily available. Being a
simple asphyxiant small leaks of SF, which are notlikely to cause substantial oxygen defidency and hence
<.,m=""'A~'
are not generally considered hazardous. However, the
safe limit for SF,.concentration is given as 1000 ppm(TLV) which is about 100 times lower than thesuffocation level. Thus, from both economic as well as
safety considerations loss of SF, should be minimized.For this reason, the storage and accelerator tanks and
pipe lines were thoroughly leak tested. SF, monitors
are installed at the various strategic locations in theaccelerator room, beam hall, control room, gas-
handiing room etc. In order to take care of any
catastrophic leaksge, forced ventilation system is
provided to bring down the concentration of SF,within
safe limit. A typical safety logic, as shown in Fig. 5, is
followed for safe handling of SF,gas.
-~
Fig. 5 Safety Wgi< jWw sheet Jo, SF, gas handling in FlJTJA
162
Discussion
The gas handling system of FOTIAis in continuous use
and its performance is satisfactory. Duriug the beam
trials it was found necessary to introduce an additional
IDter at the entrance of the accelerator tank, which
assured a dust free recirculation of the gas through
high voltage column section therehy reducing the
number of sparks substantially. However,
incorporation of the additional filter has resulted in
reduction of fe-circulating flow.
The FOTIAhas now been commissioned byaccelerating beams of "c up to terminal voltages of 3.2
MV.In a typical experiment beams were characterized
by measuring the Rutherford Back Scattering from
several targets and the energies were found to be in
agreement with the terminal voltages and field values in
the analyzing magnet
References
I. P. Singh, IndianJ. Pure & AppL Phys. 35, 172
(1997).2. P. Singh et al, Proc. DAESymp. on Nuel. Phys.
842,366 (1999).
3. S.K.Gupta et al., Proc. 4' National Symp. on Phys.and Tech. Part. Ace. &their Applications (PATPAA-
96),1996, Calcutta.
4. V.Bhasin, Illl Vale, H.S. Kushwaha &Anil
Kakodkar-private communication.5. B.Il Shah et al., AFD/Report No. 25 (1997).
Mr S.K Gupta, B.E (Ekctrieat Engg.) from 28' batch of BARC Training SchOOL is an accekrator
teclmolcgist. He has been working in the 14 UD BARC-TIFR PeDetron Accekrator and has expertise in SF,
gas handling and uUra high vacuum systems. He has been workingfor FOTIA Project since its inception. He
has rkveloped many heam line components used for an accekrator. He has been working as Operation-in-
charge, PeDetronAccekrator Facility, TIFR, and presentry, he is Officer-in-charge of the FOTIAfacility at the
Nuckar Physics Division, BARC.
Dr. Pitamher Singh joined the Nuckar Physics Division, BARC,in 1976 after grnduatingfrom 11' batch ofthe BARCTraining &:hool He received his Ph.D in physicsfromMumbai University in 1983. Dr Singh spentone year at the Max-Planck Institute fuer K£mphysik, Heitk1iJerg,Germany, and has visited severalEuropenn accekrator labs. In nddition to huilding a 2 MY Tantkm Accekrator at BARe, he has matk an
.'.:>"! outstanding contrihution in setting up the 6 MY Fokkd Tantkm Ion accekrator (FOTIA) facility at BARC.
Recentry, he has beensekcted asa memherofthe "National Academy of Sciences, India"forhis outstanding contrihutions
toward<indigenous rkvelopment of the .~cekrator technology in the country and nuclmr reaction studies using heacy ion
heams from partiek aceekrators. He has per/icpated in an experiment at LNL, Lngnaro, Italy, performed to study the rowofftssion dynamics information of Super Heary Ekrnents (SHE). He is co-author ofmure than 160 scientific publications.Presentry, he is Head of FOTIASection of the NuelmrPhysics Division.
163
BARC NEWSLETTER Found.,', Day Special I"ue 2001
Mr Amn.4garwol joined lbe Nuclear Physics DivisWn in 1994 '!fter gradUllJingftom 31' baJcb of /be BARe
Tl'aining SChool He bas been working for. FOTIA Proje<t ,;noe ils inceplion. He bas mmk oulslimdlng
conlrlbu/ions towards de,;gn of g'" handling 'Y'- and ,truetural design and analysis of bigb voIIage
column opOTIA.
Mr S. Santra joined lbe Nuclear Physics DivisWn in 1994 '!fter gradUllJing ftom 31' baJcb of lbe /WIC
Training SChool He bas been working jOr FOTIA Proje<t ,;noe ils inception. He bas mmk ou/slimding
con1rlbutions - Beam optics aIkulations, Design of severaleIedrostaIic and magne/i(: dipole and
quadrupok mngnels for. FOTIA. He bas also been involved in Nuclear Physics experimenls .,;ng PelletranAccekraJor.
Mr RajesbKumar, B.Tecb. (Ek<tricaiEngg.}ftom3Ef' batcb of/WIC TrainingScbaol bas been =oclatedwitbFOTIA slnoejoining /WIC. Be bas heen worklngfor.de,;gn ofbigb voltage column and blgb ooUagecbarglng System ofFOTIAProject.
Mr S.P. Sarodsjolned FOTIAproject in April 1994 after p..slng Dipwma in ElectricaiEngineeringftom Gavt. Polytecbalc,
jaIgaon. In 1992.. Mr PJ Raul joined TPPEDfor.Mngne/o-llydro-Dynam/c (M1ID)generator projecJ In October 198UfterCO1U/Jk1//onof Ibis project be was transferred /0 (;IT, Iadore,jOr S//SIINDUS-IprojecJ and then /ater on, he
joined FOTIAprojecJ at NPD.He u working for. g'" handling system and uUro higb vacuum system ofFOTIA.
Mr s.~ Gogatejoined Reactor Group in /WIC in February 1967. He was responsiblefor tbefabricatlonand installation of piping for _t of the systems of Dbruva """,,/or Presently, he u responsiblefor.fabrication and ins1allation of - componenls for. Critical Pacilily jOr AHWR " 500 Mlfe PllWR- and madifted ApsaraReactor. He bas coordinoW for. execution of FOTIAgns handling system.
Mr R.R. Patunbar joined Reactor. Group in lillIC in May 1976. He was responsible for. the fabrication aad
=embly of gnlde tubes " Installation, commu,;ontng of overhead crane, " compressor for. Dbruva
Reactor. He bas performed aU quality related tests for FOTIA g'" bernYlng System. Presently, be u
1n-cberge of Quality Assuram:e Sectionfor Dbruva Group.
~Mr Mohan G. Aadbansor.e, RE. (Mecbaniad) joined jiIe/ handling group of Dbruva reactor aftergradua/ion ftom 16" baJcb of lillIC TraIning SChool He bas ae,;gned and erecW sbie/dingjlask orOn
Power" fte11ing machine and /ater erecW and commissioned on power JUe11ing machine. He bas
de,;gned and fabricaied a buggy for. handling of uotopes ftom "On Power" tray rod and other irrodlaW
sampics and a pool site InspeclionfaciIity for. inspection ofirradtatedftel =emblles ofDhmva. He bas
designed and erecW SF6 g'" barnYing 'Ystem of FOTIA Project. Sinoe 1997, be u working wltb Reactor.
Engineering Divulon on design of componenu and review of ae,;gn related aclivltles of Advanced Heavy Reactor.
".j
Mr Ac. TikIm, RE (E- Engg), joined Reactor operattans Group, lillIc, In August 1968 '!ftergraduating ftom 11' baJcb of /be Training School. He was responsible for. ae,;gn, ins1allation andcornmissIaning of.fresb and irradiakd jiIe/ storagejOr Dbruva reactor. In 1990, be lead a team wblcbSll(X$$SjUIlyae,;gned, developed and commissioned "On-Power operation of Dbruva tray-rods" for.produc1ion of rmUoootopes. Sinoe 1999, be u bolding the charge of Head, Researr:l!Reactor -Division (RllSD),lillIc.
164
Influence of N eutronic Parameterson the
Stability of the Advanced Heavy WaterReactor
AK. Nayak, P.K. Vijayan and D. SabaReacM Engin",ing Diyi,innBh,bha AtomicR",acch Conn,
Abstract
The infltle1UJeof nentronic parartUiterson the stability hehaviour of theAdvanced Henry WaterReactor hasbeen incestigated ana/yticany. The ana/yticnl nwdel considers bonwgerwous two-phase flow, a pointltinetics nwdelfor the nentron dynamics and a lumped heat transfernwdelfor thefnel dynamics. Further,to study the out-of-phase instability in the boiling channels of the reactor, a couPled multi point kineticsnwdel was also applied The resufts indicate that both Type I and Type II density-wave instabilities canoccur in the reactor In hath in-phase and out-ofphase nwde of ascinations in the boiling channels of thereactor. The stability of the reactor isfound to increase with increase in negative void reactivity coefficientorde<:reaseinfuel tirtUiconstant unlike that ohservedprevious/y in vessel type BWNs.Decay ratio map waspredicted considerIng the effects of channel power, channel inlet suhcooling, feed water temperature nedchannelexitqna/lty, which are usejUlfortheliesign of the reactor.
Introduction
STUDYFOCUSESONTHE STABIUTYBEHAVIOUROF THEADVANCEDHEAVYWATERREACTOR(AHWR)
IN India. This is a 750 MWthpressure tube type beary water moderated and light water cooled
eactor. The reactor Is designed for natural circulation core cooling during start-up, power raising,
normal operating condition and accidental conditions. This necessiates large tall risers (or ondet feeders) to achieve
required natural circulation flow rate, which in turn, may canse larger two-phase pressnre drop in the riser portions
than in the single-phase portion of the reactor coolant system composed of the downcomers, header, inlet feeders, and
the single-phase portion of the core. Dontinance of two-phase pressnre drop may induce thermohydranlic instahilities
in the reactor as observed in our previons studies (Nayak et.al., 1998). Snch thermohydraulic oscillations may indnce
reactivity oscillations through the void-reactivityconpling. A recent review by March-Lenba and Rey (1993) snggests that
there are severalincidentsof snch conpledneutronic-thremobydraulicinstabilitiesin operatingBWRsin the past.Specialattentionhasbeendrawnto thistopicafteroscillationswereobservedin the LaSalle2 (USNRC,1988)andCoarso plants (Gialdi et. al., 1985). Since then many investigators have attempted to model and understand the
instabilities in the above reactors by both time domain (Takigawa, et. al., 1987, Muto, et. al., 1990, Araya, et. al., 1991)
and frequency domain analysis codes (March-Leuba, 1990, Rao et. al., 1995). March-Leuba and Blakeman (1991)
were the flrst to show that the dontinance of in-phase or out-of-phase oscillations in a BWR depends on whether
the gain of the neutronic feedback or the iulet flowfeedback is more predontinant. Hashimoto (1993) showed that the
165
occurrenceof out-of-phase mode oscillationsin a BWRdependson the snbcriticalityand void reactivityfeedback.Uehiro el. aI. (1996) sbowedthat the interactionsamongtbe channelsdne to nentron diffusion inflnence the out-of-pbaseuscillations.
Theabovestndiesclarified thatthe BWRinstabilityis a complexphenumenonwhicb dependson the stateof the thermalbydranlicbebavionrof the system,neutronic feedback effectsdue to the void, fuel temperatnreand fuel time constanl.Lookingat the geometryof the AHWR(Fig. 1), it canbeseenthat the reactor containsmanyparallel cbannelswhichareconnectedbetweenthe steamdrum and the headerwith eqnal nnmber of outlet feedersand inlet feedersrespectively.With suchlong feederpipes, the period of density-waveoscillation is expectedto be verymuch longer than that of aconventionalvesseltype BWR It is of interest to investigatethe effectsof nentron and fuel dynanticson such lowfreqnencythermohydranlicoscillations occurring in the parallel channelsof the AHWR.Further to tltis, the effect ofdelayedneutronson the coupled nentronic-thermohydranlicinstabilitiesof such a reactor will be investigatedhere. Inaddition, the decayratio mapsfor the reactorwill be predictedconsideringvarionsoperating conditions,which will beusefuliu thereactor design.
For tltispurpose,the theoreticalmodel developedpreviously(Nayak,el. aI. 2000) was nsed.This solvesthe linearised
conservatiouequationsof mass,momentnmand energyand the eqnationof statefor the flnid, assuminghomogeneoustwo-phaseflow alongwithapoint kineticsmodelfor theneutron dynamicsand alumped heattransfer modelfor thefuel
thermaldynantics.In addition, the model considersthe thermohydranlicinteractionsof parallel multiple channelswith
the inlet and outlet feederstogetherwith the extemalloop (i.e. downcoemers).The characteristicequationhasheeuderivedand the stabilityhehaviour for in-phaseand om-of-phasemode of oscillationswere investigatedfrom the rootsof the characteristicequation.
Primary Heat Transport (PHT) System of the AHWR
Theschematicof the PHTSystemof the AHWRis shownin Fig. I. k; shownin the flgure, the PHTsystemcontainsmany
parallel channels(408numbers)which are connectedbetweenthe headerand the steamdrums (four numbers) by an
eqnalnumberof inlet and outlet feedersrespectively.Eachsteamdrmu is connectedto the headerbyfour downcomers.
The channelshaveinside diameter of 120 mm and contain fuel hundles consistingof 52 numher of fuel rods and 8nnmber of water rods. The outer diameter of fuel rod is 11.2 mm and that of the water rod is 6 tntn. There are six
spacerslocatedin the fuel bnndlesand theyare separatedhyequal distancesalong the length of fuel. The activefuellength is about35 m and the height of the loop ahovethe core is ahuut 30 m. The inside diameter of inlet feedersLs
ahout 97 tntn and that of the outlet feedersis ahout 122 mm. The steam drums havea length of 10 m and inside
diameterof 3 m and are kepthorizontal. Dnring normal operatingcondition the steamdrum pressureis maintainedat
70 bar. This is a typical designconflgnrationof the AHWRconsideredin the presentanalysis.Bniling takesplacein the
core and the two-phasemixture leavingthe core is separatedinto steamand water iu the steamdrum. Theseparated
steamflows into the tnrhine and anequal massrate of feedwater entersthe steamdrum. Thecoolant circulation in the
PHTsystemtakesplacebynaturalcirculation.
Analytical Model
The analytical model consistsof (i) a thermohydranlicstability model, (ll) a point kinetics or a coupled multipointkineticsmodel and (ill) a lumpedfuel heattransfermodel. Thethermohydranlicstabilitymodel assumesthe flowto be
incompressibleand Boussinesqapproximationto he valid for variation of densitywith temperatnrein the single-phase
region of the loop. Also it assumesthat in the two-phase region the flow is homogeneous, 8p I at in energy
conservationequationis neglected,two-phasesare in thermo-dynamic equilihrium, axial uniformheat fluxproflIe
166
BARC NEWSLETTER Found,,', DoySpeciaJ l..ue2001
(Nayak et, ai" 1998), heat 1O5SCSin the loop pipings are neglected, carry-over and carry-under in the steam drum are
neglected and mixing of feed water in the steam drum is complete (i,e, no thermal stratification),
With these assumptions the conservation equations of mass, momentum and energy for one-dimensional two-phase flow
are given by
A~!'+~=Oat az '
L~+2-~(w'v)+£+--L(w'v)+!!r.=oA i!t A' az v 2DA' az'ah ah
{qhA heated region,pA-+w-=
at az 0 unhealed region,
(1)
(2)
(3)
The equation of state in the two-phase regioo is given by
p=f(p,h), (4)
The frictional pressure drop in the two-phase regiou was estimated using the Baroczy (1966) correlation, The local
pressure drop due to bends, restrictions and spacers was estimated as
1>p.=Kw'/2pA', (5)
The governing equations are linearised by superimposing small perturbations of w', h', p', v' and q; over steady
state values where
w' = ';'(z)ce"; h' = h(z)ce"; p' = p(z)ce" ; v' = ~(z)ce"; q;=qh ce" . (6)
In Eq. (6) c is a small quautity and ,;" h, p, ~ and q, are the averages of perturbed Bow rate, enthalpy, pressure,
specific volume and heat addedIunit volume to the coohnt rcspedive1y and s is the stability par:uneter, Substituting them
in the conservation equations, the solntion of the perturbed equations for various segmenls of the loop can be obtained
by integration as follows,
In the single-phase heated region,
w' = w~ =constan~ (7)
(8), 1 [q,~w .
J-""
1h =- ---;;;;;-+q, 1-e ,p=~s
-t1p;, =[2:.+~
]W'L,p- g"
[-qh.,,W' +q;
][L,p +~(e-'" -1) .]
,A p"p,DA Crs w" p".~As
where'", = (p"~AL,,, / w,,),
(9)
(10)
In the adiabatic single-phase region, the perturbed equations for Bow rate, enthalpy and pressure drop can be obtained
fromEqs, (7) to (9) rcspedive1ybysubstituting q,~ and q; 10 be zero,
In the two-phase heated region,
w' =w;p +-#- v18 [!.(e'" -e,,2. )+i?(e'" -e,2. )],v,,~ hlg " r,
h'=[Pe'" + Qe"'] ,
(11)
(12)
167
A"'_ [S fW"v"",;;
]-~ - -+- x
ADA'
[W;,L" + :SVfg
{
!.-{~(e"" -e"'. )-e"" L,,}+{.f£{~(e"" -e"f")-e"" L,,}}}]+
v"",hje y, y, r, r,
(v&I h&)[
fW;', --!-+ 2w"s][
!.-(e"" -e"'")+.f£(e,,f, -e"f',)]
+ W~Vjg x2DA v"W Av",," r, r, A hje
[P(e"" -e"'. )+Q(e"f, -e"f,,)].
whereP= [-h;,(r, + AsPj I w")-q",,Aw;, I w;, +q;A I w,,] I (r, -r,)e"'" ,
(13)
(14)
Q=(h:,_pe',f")Ie""',
r", =[-C, I (C,' -4C,jO']/2,
C, = As I v"""w,,,
(15)
(16)
(17)
(18)C,=(q""lv;","XA'slw;,)(Vklhi<)'
and h;, is the perturbed enthalpy at the inlet 01 boiling region 01 the channel which can be estimated from Eq, (8),
In the adiabatic two-phase region
w'=w;,+(w"lv,,)(Vfplhfe)h;,[I-e-"'],
h' =h>-"',
(19)
(20)
-f¥J =[!.+ fW"~"][
W;,L + w"vfp h;,{L+ w"v,' (e-'" - I)}]
-~A DA v"hje As hi<
[fW;, _JL+2W"S][
Je-"'-I)h' w"v,, ]+w;,Vjg(e""-I)h',2DA' v;, Av" \ m As A' hip m
where" =(p"ALlw,,),
(21)
(22)
Similarly, the perturbed pressure drop due to bends, orifices, spacers and other restrictions in ".trious regions are given
by,
inthesingie-phaseregion,/o,p;"p=(K"/pA'jw"w;", (23)
inthetwo-phaseregion,f¥J;",=(K"/2A')rw;,h;,(v"lh,,)+2w,,v"w;,], (24)
The perturbed heat added/unit volume 01 coolant (q;) that appears in the above calculation depends on the neutron
and fuel dynamics which are esthnated as discussed below,
Neutron klnetla
Thepointkineticsapproximationis adoptedfortheneutronfielddynanticsas givenby
dn(t) k(t)(1-{J)-ln(t)+:tA",Cm(t),dt I m.r
(25)
dC;?) = k(t)~mn(t) - A",Cm(t), (26)
Eqs, (25) and (26) are linearised by perturbing over the steady state as discussed in section 3 and the perturbed
equations can be easily solved after elindnating the steady slate conditions to obtain
n k'
;;:= ~ sp ,Is + L., "-
m.r s+ Am
(27)
wbere n is the perturbed neutron density and k' is the perturbed reactivity whicb is related to the void reactivity
coefficient and Doppler coefficient as
f=Car~,+CDT;"" (28)
In Eq, (28) r~, and Tr,", are the perturbed void fraction and fuel temper.ture respectively averaged over the heated
charmellength, They can be estimated from the coolant density and the fuel heat transfer equations as discussed below,
Fuel heat trausfer model
Assuming only radial beat transfer, the fuel beat transfer equation can be written as
dTrp,
mfCr ;jf=Q(t)-Hfaf(Tr.o,(t)-T,m), (29)
where mr is the mass of fuel rods; Cf is the specific heat capacity of fuel; Hfis an effective heat transfer coefficient;
Q(t) is the heat generation rate in the fuel rods; Tr", (t) is the length average fuel temperature; of is the heat transfer
area of fuel rods and T,"r is the coohmt saturation temperature,
Perturbing Eq, (29) over the steady state for Tr," (t) and Q(t) and canceling the steady state terms, we get
r;,~(mrCrs+Hfof)=Q', (30)
where Q' is the perturbed heat generation rate in the fuel rod,
Applying the heat balance equation for the heat transfer from fuel to coohmt
HfOr(Tf",-T,m)=QhA,L" (31)
Perturbing Eq, (31) over the steady state and canceling the steady state terms we get
T;p,=q;AJ,IHrof' (32)
Substituling Eq, (32) into Eq, (30) and rearranging we get
169
, Q' [ 1 ],
q,=q""Q" l+mfCrs/HfGf(33)
Since the heat generation rate in fuel is proportional to the neutrnn density, Eqs, (27) and (28) can be substituted into
Eq, (33) to yield
q; = Gfr~", (34)
Ca /(1 + Tfs)(lH i: sPm )whereGj~ m~,s+"m1 CDA,L,
q"" - HjGj(l + T,S)(lS+ i: sPm )m~'H "m
and Tf ~ mjCf is the Inel titue constantHjGj
(35)
The density nl two-phase mixture is given by
P= rp, +(l-r)Pr' (36)
Perturbing Eq, (36) over the steady state and canceling lor steady state condition, we get
r'~-p'/Pf,~(P;,/Pf,)v"h',hi,
The channel average perturbed void fraction can be obtained by integration as
(37)
, -J.. 'JP;,vk h'dz,r" - L, ,~L"Pkhf'
(38)
which can be approxituated after sotue algebraic situplification as
, , ,r"~IfF,wf,+IfF,q,,
I vh 1 i
[
Xwhere Ij/, ~_2-,-
.- -l(e"L,
L, hk v""' hi' " "
1 v, I 1
[
Yo Yo
( )]Ij/, ~-~,-- -'-(e"r" -e',r'm)+-'- e"'" -e"Lm ,L, hf' v",",hk " "
X," -q,~,A[I+[(e-""-l)/P"SI(W"IA)(,,+ASPf") ] /[(',-")e',r,,,],w" w"
x,"[{(q""lw,,)(e-""-I)/Pms}-x,e',L"]le""",
[(
e-""-I
)(ASP,,
)A
]/() ',,'
Y,~ - ',+-+- ',-',e ",p"s w" w"
-e"rm)].
(39)
(40)
(41)
(42)
(43)
(44)
170
BARC NEWSLETTER Founder's Doy Spec'ol lnue 200/
v_ {e-"'-lv'L']/
""',- -+"e e.P,.s (45)
Substituting Eq. (39) into Eq. (34) an expressioo for the perturbed heat added per unit volume of coolant (q; ) to any
channel, for a perturbation of inlet flow rate (w~) in the i" channelean be easily obtained as given by
. Gr'll, .(q')'=(I-Gr'll,J,(w.),.
(46)
CoupledmullijHJhltlri..etks mode/
During an out-of-phase instability, neutron diffusion from channel to channel may be an important factor due to change
in void fraction among the channels which the point kinetics model does not take into account. This may result in a
different q, for any channel than that calculated using Eq. (46). For this purpose, a conpled multipoint kinetics model
was applied in place of simple point kinetics model for the neutron Idoetics. The model considers the reactor to contain
'N' no. of suboores which are subcritical, Isolated by reflectors and influenced each other onJy through leakage
Ineutrons number of which is proportional to the average neutron flux over each subeore. Each subeore may contain
one channel or group of channels having Ibe same power and resistances.
Taking Ibe model as 'N' bare homogeneons reactors, the coupled multipoint kinetics equation for the I" snbcore is
givenby6 N
dn,(t)_k,(tXI-P,)-I" "nj(t)dJ ~ /. ni(t)+L..,A",JCmJ(r)+L..,aij /. '
, m=t j=I'j.i
where aij is the coupling coefficient that determines the reactivity contributed by the interaction of j" subcore with
the i" subcore. In the analysis, a, is assumed to be constant which can be estimated from the steady state condition of
Eq.(47)as
(47)
N
k,u=k -l=-"'anj~,~ -f', 9 n,~ .
J~
(48)
For small excess reactivityN
P,.,=k",-I=-Laij nj.".,. ;;;. n,.,.,
(49)
Perturbing Eqs. (47) and (26) for Ibe '", subeore and solving Ibem togelber as before for Ibe point kinetics equation,
Ibe perturbed neutron density in Ibe '", suboore ean be obtained as
.!i..=
lk'~+ ta."L
}
/0n,." ' . 1 9 n,... "
!:,
(50)
171
~ sPmiwhere~=l-L..,~'
m=IS+Am,i
N njS$ 6 sPm; N njS$
6>;= l;s+(l- Laij-;;:'-) L s+" . + Laij-;;:'-'j=l ',ss mol "m,' j=l ',ssj*; J*;
Similar expressions can be derived to obtain the perturbed neutron density in other subcores which can be snbstituted
into Eq. (50) and simplified to obtain the perturbed heat generation rate in the ;" subcore as
(51)
(52)
[Q) ~ . n,."- =~L..XUkj-;;-'Q", ,=1 '."
(53)
where[Xu]N,N=[TUC,N' (54)
{
6>;Jor i=/andT;j= -aijJor i"/'
(55)
The perturbed heat added per unit volume of coolant for any subcore can be obtained by substituting Eq. (53 into Eq.(33).
Characteristic Equation
For constant Inlet subcooling, the equations for perturbed flow rate, enthalpy and pressure drop for single-phase and
two-phaseregionsof theAHWRloopcan beexpressedas functionsofperturbedflowrate in the steamdrum (W;D)
alone. Since ali paraliel paths are connected between the header and the steam drum so
(w;"J= t,(W;,J,.(56)
Also, the perturbed pressure drop for ali parallel paths between the header and the steam drum is the same, ie.
p~ - P;D=/',pH-.,"=G,(w;,), =G,(w;,), =.. ..=G,(w;,), =.. ..=G,(w;,)" (57)
where G( w;,), is the sum of the perturbed pressure drop components in the single-phase and two-phase region of the
channel; associated with its inlet and outlet feeders.
Similarly, the perturbed pressure drop between the steam drum and header can be expressed as
P.;D-P~=/',pW-H=Gr(W;D)' (58)
For the characteristic equation the condition is thst the perturbed pressnre drop around the closed loop is zero, which
canbeobtainedbyaddingEqs.(57) and(58) andrearrangingas givenby
172
Found,,', Day Spedal I"ue 2001
IF,I= [l" ~+ ~ [l" ~=O.G, L.,. G,
'~I '~I J"
(59)
The stability of the system is investigated from the roots of the characteristic equation. H any of the roots is having a
positive real part, the system is considered nnstahle and for zero real part the system is considered to be neutrnlly
stable. The system is considered stable if all the roots have negative real part.
In the AHWR as shown in Fig. I, both in-phase and out-of-phase oscillitions may occnr. The out-of-phase mode
oscillation has characteristics similar to parallel channel thenuohydranlic oscillations with coupled spatial neutron
dynamics. But during an in-phase mode of DScillition, oscillitious occur in the boiling channels and in the downcomers
without any phase dillerence between them.
From Eq. (57) we can express the ratio of permrbed flow rate oscillation between channeis i and j as
(w;"), few;")} =(G} fG,)=Re'"60)
where R is the ratio of amplitude and 8 is the phase dillereuce. The uature of oscillation, i.e. in-phase or out-of-pbase
can be detennined by snbstituting the roots of the chardCteristic Eq. (59) into Eq. (60).
Results and Discussion
Pure Ihert1Whydraulk luslahtlity
Before studying the characteristics of nuclear-coupled thenuohydranlic oscillitions, it is reqnired to study the pure
thenuohydranlic oscillations of both the in-phase and out-of-phase modes in the AHWR. This investigation will suggest
the uatore of dependency of the neutronics on the thenual hydranlic behavionr of the system. For this purpose, the
ahove analytical model without neutronic conpting (i.e. q; = 0) was applied. Figure 2 shows a typical flow stability map
considering the hottest channels of the AllWR. The analysis considers two parallel boiling channeis alongwith the
associated inlet and ondct feeders of the reactor. The stahility boundary has heen plotted as in the reference (Nayak et.
al., 1998) on N" vs. N.. plane. The results indicate that the ont-of-phase thenuohydranlic oscillations is more likely to
occur among the boiling channeis than the oscillations of the in-phase mode beeaDSe of the dampening cOect of the
extra single-phase friction in the downcomer which stabilises the in-phase mode oscillation. Ai,o it can be observed that
the dillerence in Type-II instability boundary between two modes of oscillation is much larger than that for Type-!
instahility boundary which is in agreement with the results of Van Bragt and Van det Hagen (1998). However, the
dillerence in the Type-I instability boundary between two modes of oscillition is also significant unlike that observed in
the Dodewaard BWR The frequency of oscillition has been calculated at the threshold point from the imaginary part of
the root of the characteristic equation and .iso shown for both modes of oscillation in the same figure. The frequency of
oscillation for Type-II instability is huger compared to that for Type-I instability. This is beeaDSe the Type-! instability
occurs at low power when the fiow velocity is smaller under natural circulation conditions than that for the Type-II
instability which occurs at much higher power. Hence, the flnid takes longer time to pass through the two-phase region
compared to the Type-II oscillation case. In geneml, it is also found that the frequeocy of oscillation i, very much less
for the AHWR channeis compared to that predicted for the Dodewaard natural circulation BWR (Van Bragt and Van der
Hagen, 1998). This is becaDSe the period of oscillation in the AHWRchanneis is very huge due to huge two-phase
region of the oudet feeder pipes whose length may be several times of the chimney height of the Dodewaard BWR.
t73
F auoda', Day Speciall"ue 2001
Coupled neutronk tbermobydraulk tnstabllity
Influenceof voidree«:tivitycoefficienton the stability:Figure3 showsthe effect of Co on the thresholdof stability
for the in-phasemode of oscillationsbetweentwo snhcoresof the reactor considering the point kineticsmodel for the
neutron dynamics.The resultsindicatethat with an increasein negativeCo the threshold power increasesfor Type-IT
instahilitiesand decreasesthat for Type-I instabilities.The stabilityof the reactor is found to increasewith increasein
negativeC.. Resultsfrom previons investigationsfor vessellype BWRshnveshown that the stahility of the reactor
decreaseswith increasein negativeCo dne to the increasein gain of the void reactivityfeed back loop (Uehiro,et. aI.
(1996), VanBragtand Vander Hagen(1998)). However,the thermohydraulicoscillation frequencyfor the Type-!and
Type--ITinstabilitiesin thosereactorsare much larger than the presentsystem.Addition of neutronic feed back atsnch
low frequencyof thermohydcanlicoscillations «0.07 Hz) asobservedin the AIIWR,stabilisesthe reactor due to less
phaselagbetweenthefuel heatgenerationrateand channelthermohydcanlicoscillations.
lrifluence of fuel time constant: The effect of fuel time constant on the stability of in-phase mode oscillation for the
above case is shown in Fig. 4. The fuel time constant wiB vary depending on the fuel properties, operational conditions
and fuel bnrn-up. Van der Hagen (1988) has shown that with the nse of lumped parameter model it could be as low as
2 s. The fuel time constant in the present analysis has been varied over a wide range from its normal operating value to
study its influence on the stability. It can be observed from the above figure that with increase in 'f the threshold
power for Type-IT instability decreases and that for Type I instability increases. Thestability of the reactor decreases with
increase in fuel time constant. Previous studies by March-Leuba and Rey (1993) have shown that chnnges in fuel time
constant have both stabilising and destabilising effects. They found out that the stabilisiug effect is due to the inherent
filtering of the oscillations hnvingfrequency greater than 0.1 Hz and the destabilising effect is due to the phnse delay to
the feed back. For the low frequency thermohydcanlic oscillations observed in the AIIWR, the phase delay is more
significant to destabilise the reactor lor an increase in fuel time constant than the filtering effect as observed in the
present case.
Effect of radial Power distribution aad inlet orlficing on the out-of-pbnse instability: Figure 5 showsthe effect of
interaction between two subeores hnving different RPF and trdet orifice pressure loss coefficients on tlie threshold of
out-of-phase mode oscillation. 10 the analysis, one of the subcores is always considered common and it contains
chnnnels of channel Type-3 (i.e. RPF = I.231 and K,,=O.O) and the other subeore is considered to be varied with same
number of channels haviug different RPF and trdet orificing coeIIicient in such a way that its outlet quality almost
remains the same as that for the companion subeore. It can be observed that by reducing the RPF and increasing the
trdet orifice coefficient in one subcore greatly stabilises the out-of-phase mode of oscillation occurring in the other
subcore having channels with higher RPF thereby enhancing the stability of the s')'Stem.
Study oj out-oj-phase osctllatwns nsing the coupled multipoint kinetics model
As mentiooed before, during an out-of-phnse mode oscillation neutron diffusion frnm channel to chnnnel due to
variation of void may affect the stability. This effect has been predicted by the conpled multipoint kinetics model. The
coupling coefficient which determines the degree 01 coupling between snbcore to subcore because 01 nentron diffusioo
was determined and lonod to be about 3.5 mk considering the reactor core to be divided in to two equal subcores.
Comparison of stability maps hetween the coupled multipoint kinetics model and modal point kinetics model :
In the recent past, the out-of-phase instability is exphtined as a phenomenon in which the neutron higher modes are
excited by the thermal hydcanlic leed back effects. The higher modes are all subcriticaI, which could result I n out-of-
174
BARC NEWSLETTER Found.,', DaySpecioll"ue 201)[
phoseosciIhtions depending on dIe subcriticality of the harmonic mode and dIe wid reoctMly feed back. A deriwJion
of dIe modal point kinetics model gn=ning the higher harmonic modes of osciIhtions are gi>en in reference
(Hashimoto, 1997).1t is of interest to compare dIe stabilily maps between dIe coupled multipoint kinetics model aud
the modal point kinetics model for the out-of-phase oscillations for the AIIWR.For this purpose, the suboriticality (Le.
the eigenvalue separatinn between the fundamental aud first harmnnic mode) was considered to be twice the coupling
coefficient OOsedon the theory ofNishina aud Tokashiki 0996). The results are shown in Fig. 6 aud it is seen that both
the models gi.. pr:lClically the same threshold power for stabilily for the alio.. condition. In fact, the coopling
coefficient is au indication of the degree of suboriticality doring au oot-of-phose instabilily. The coopled multipoint
kinetics model has bener advantage over the modal point kinetics model in ~ the out-of-phose instability.
Becanse, when ~ the stabilily beha>iour of a reactor willI multiple chauoels or subcores with different
nux distributions, the coupled multipoint kinetics model can haudle the problem by considering snitable coupling
coefficients. On the otherhaud, the modal point kinetics model assign a single value of subcriticality to all the snbcores
irrespective of their nux distributions.
DeuIy rtIIW fIUIPSfor ~ AHWR
The contour lines of constant decay ratin for in-phose mode of osciIhtion at different Iberrnal powers aud inlet
suboooling are shown in Fig. 7. Also, dIe constant feed w:der temperature lines alongwilb dIe constant channel exit
qualily lines are shown in the same fignres. From Ibese maps it is clear !bat the reactor can !we sufficient stabilily
margin with DR less thau 0.4 with core inlet subcooling of less Ihau 10 Kfor operating power of 750 MWth.Also, it is
observed that the Type [ instabilily occurs in the reactor at chaunel exit qualily of less thau 10 %. With increase in
chaune! exit qoality at a particular subcooling, the DR increases. Increase of chaunel inlet subcooling at a particular
power also increases the DR. Similar beha>iour is also observed for a decrease of feed water lemperature at a constant
power. WillI increase in feed w:der temperature, the suboooling increases, which has destabilising elfect since the DRincreases.
Conclusions
Analysis was carried out to study the nuclear-coupled density-wave instability beha>iour of the AIIWR. The following
insights are obt2ined from this study.
(I) Both in-phase and out-of-phase thermohydrau1ic instability may occur in the AIIWR channels at 7 MPa operating
pressure depending on the channel power and core inlet suboooling. The frequency of osciIhtion of Type-D
thermohydraulic instabilily is brger Ihau !bat for Type-I instabilily. The difference of threshold power between in-phase
and out-of-phase oscillations for Type-D thermohydraulic instabilily is larger Ihau !bat for Type-I instabilily.
(2) With increase in oegativewid reacti>ily coefficient (C.), the threshold power for stabililyincreases for Type-D and
decreases for Type-I instabilities. The stabilily of the reactor increases with an increase in negative C. .
(3) With increase in fuel time constant( 'f) the threshold power for stabilily is reduced for Type-D aud increases for
Type-I instabilities. The stability of the reactor is reduced with increase in fuel time constant
(5)The stabilily of the reactor increases by reducing the RFF and increasing the inlet orifice loss coefficient of the
companion subcore when two subcores interact with each other.
(6) The coupled multipoint kinetics model predicts the same threshold power for stabilily as !bat of a modal point
kinetics model if the coupling coefficient is half the eigen value separation between the fundamental aud fust harmonic
mode.
175
Found", Day Spedolj"ue 2001
Nomeoclature
(7) The DR increases with increase in channel exit quality, inlet subcooling aDd decrease in feed water temperature at a
constant power. The reactor cao have better stability IJIJItgin fnr subconling nHess thao 10 K.
Greek Symbols
a, beat transfer area (m')
A cross sectional area (m')
Co void reactivity coefficient (8k1kf8y)
C, Doppler coefficient (8klkf8T)
C.(I) deinyed nentron precursor
concentratiou of group m
C, specific beat (Jikg-K)
D bydraolic diameter (m)
f Darcy friction factor
g acceleration due to gravity (mI")
b enthalpy (Jikg)
b" latent beat ofvapourisation (Jikg)
H, beat transfer coefficient (W/m'K)
k(I) effective multiplication factor
K loss coefficient
I prompt nentron life time (,)
L length of section (m)
Ill, mass of fuel rods (kg)
n(I) neutron density
N.. (1jI1wb,,) I
N", (&".Ib,,)
P pressnre (N/m')
q. beat applied/mtit volume of
cnoinn! (W/m')
s stability parameter
t timers)T tempemtore (K)
v specific volume (m'lkg)
v, v,-v, (m'lkg)
w massflowmte(kW')
z axial distance (m)
IX coupling coefficient
p delayed neutron fraction
cr volumetric thermal
expansion coefficient (Ie')
)" decay constant of deinyed
neutron of gronp m
'" power (W)
T fluid residence time (s)
T, fuel time constant (s)
8 diDerence
p density (kg/m')
y void fraction
Snbscripts
av avemgec core
cb cbannel
d downcomer
f liquid
g vapourH header
in inlet of section
k loss due to restriction
sat saotration
SD steam drum
sp single phase
ss steady state
ss,av average steady state
snb subconlingt total
tp two-phase
176
References
1. Araya, F., Yoshida, Il, Hirano, M., Yabushita, Y., 1991. Analysis of oeutron flux oscillation event at LaSalle 2. Nucl.
Technol. 93, 82-90.
2. Baroczy, C.J., 1966. A systematic correlation for two-phase pressure drop. Chern. Eng. Prog. 62, 232-249.
3. Gialdi, E., Grifoni, S., parmeggiani, C., Tricoli, C., 1985. Core stability in operating BWR : operational experiences.
Prog. Nuel. Energy. 15,447-459.
4. Hashimoto, Il, 1993. Linear modal analysis of out-of-phase instability in Boiling Water Reactor cores. Ann. Nucl.
Energy. 20, 789-797.
5. Hashimoto, Il, Hotta, A., Takeda, T.,1997. Nentronic model fur modal multichannel analysis of out-of-phase
instability in BWRcores", Ann. Nucl. Energy, vol. 24, 99-111.
6. March-Lenba, J., 1990. LAPUR benchmark against in-pbase and out-of-phase stability tests. NLREG/CR-5605,
ORNIlfM-1I621.
7. March-Leuba, J., Blakeman, E.D., 1991. A mecbanism for out-of-pbase instabilities in Boiliog Water Reactors,
Nucl. Sci. Eng. 107,173-179.
8. March-Lenba, J., Rey, J.M., 1993. Coupled thermohydraulic-neutronic instabilities in boiling water reactors: a
review of the state-of-the-art, Nucl. Eng. Des., vol. 145,97-111.
9. Muto, S., Yokomizo, Y., Fukabori, T., Ebata, S., 1990. Space dependent analysis of BWR core nuclear thermal
hydraulic instability and thermal margin. Nucl. Eng. Des. 120, 227-239.
10. Nayak, A.K., Viiaran, P.Il, Saba, D., Venkat Raj, V., Aritomi, M., 1998. Linear analysis uf thermohydraulic
instabilities of tbe Advanced Heavy Water Reactor (AHWR).J. Nucl. Sci. Techool. 35, 768-778.
11. Nayak, P.1l Viiayan, D. Saba, V. Veokai Rai and M. Aritomi, 2000. Analytical Study of Nuclear-coupled Density-wave
instability in a Natural Circulation Pressure Tube Type Boiling Water Reactor, Nucl. Eng. Des., Vol. 195,27-44.
12. Nisbina, Il, Tokashiki, M., 1996. Verification of more general correspondence between the eigenvalne separation
and coupling coefficient. Prog. Nucl. Energy, 30, 277-286.
13. Rao, Y.F., Fukuda, Il, Kaneshima, R, 1995. Analytical study of coupled neutroulc and thermohydraulic instabilities
in a boiling channel. Nucl. Eng. Des. 154, 133-144.
14. Taltigawa, Y., Takeuchi, Y., Tsunoyama, S., Ebata, S., Chan, IlC., Tricoli, C.,1987. Coarso limit cycle analysis with
three-dimensional transient code TOSDYN-2. Nucl. Teclinol. 79, 210-218.
15. Takeuchi, Y., Taltigawa, Y., Uemalsu, H., Ebata, S., Shaung, j.C., Shiralkar, B.S., 1994. TRACG transient analysis
code - three-dimensiooal kinetics model implementation and application for space dependent analysis. Nucl.
Teclinol. 105, 162-183.
16. Uehiro, M., Ran, Y.F., Fukuda, Il, 1996. Linear stability analysis on instabilities of in-phase and out-of-phase
modes in Boiliog Water Reactors. j. Nucl. &i. Teclinol. 33, 628-635.
17. US NRC: Augmented Inspection Team (AiT) report, Report no. 50-373/88008, 1988.
18. Van Brag!, D.D.B., Van der Hagen, T.H.J.J., 1998. Stability of natural circulation Boiling Water Reactors: part II -
parametric study of coupled nentronic-thermohydraulic stability. Nucl. Teclinol. 121, 52-62.
19. Van der Hagen, T.H.J.J., 1988. Experimental and theoretical evidence for a short effective fuel time constant in a
Boiling Water Reactor. Nucl. Teclinol. 83, 171-181.
177
Steam steam
OutletFeederS
/ Steam drums
InletFeeder
Calandria
Fig. 1 Schema of AHWR PHT System
0.7
P :=7 MPa in-phase0.07337 --out-at-phase
0.6 f- ."'---'"0-,°.066,\\\""\\
~0.056\\\ 0.0501~\ii\
\ Unstableiiii\;. 0.0332
I;
/
...~0.02469
0.0168 J ~..Af' T I.
CIIII " 0 0173 ype region0.0155 .
0.5
0.4
.;;:(.)Q.
z 0.3
0.2
0.1
0.00.00
Type II region0.0736
Stable
0.04 0.08 0.12Nsub
Fig. 2 In-phase and out-at-phase thermohydraulicstability boundary in boiling channels at the AHWR
179
..r:::.ua.
Z 0.3
0.7
0.6
Pressure ::.:7 MPa
't ::.:8 sf
0.5
'... ,-. ...~" ~
"'. "\ ~
\. \~\ \" \.'. \\ \\ \ ''. \.. \\ \'. \.. \\ \'. \.. \\ \'. \
- C ::.:- 0.02 \ \a \ \
_uu c ::.:- 0.005 \ \a '. \
-'--'- C ::.: 0.0 \"a , \
\ ,,, I
I I.' ,,. .I'.' .I'.'.1'./,..'-~.." Unstable
Unstable
0.4Stable
0.2
0.1
0.00.00 0.03 0.06 0.09
Nsub
0.12
Fig. 3 Effect of void reactivitycoefficienton stability180
0.7
0.6
0.5
0.4
{i0.z 0.3
0.2
0.1
0.0
Pressure = 7 MPa
C = - 0.005a
"'......
......
...
"',.."'. ,..
'.. ,..", '"" ,'. ,
". "" ,'. ,'. ,"' ,
\. ".. ,'. ,'. ,.. ,'. ,\ ,.. ,'. ,'. ,. ,'. ..., ,.. ..'. .... ..I ..i ..
ii
il'
l,,-
;.:
Unstable
Stable
" = 2sf" = 8 sf" = 16 sf ,,'"
.-,,".-"
,,:;,.,'
Unstable
0.02 0.08 0.100.04 0.06N
sub
Fig. 4 Effect of fuel time constant on the stability
ISI
.c0
zc. 0.6
1.2 Pressure =7 MPa,C ex= -0.005, Tf =8s
- RPF =1.231 ; RPF = 0.9091 2
K = 0.0; K = 130.0In1 in2
RPF = 1.231; RPF = 1.1031 2K = 0 O' K = 80 0in1 ., in2 .RPF = 1 231 . RPF = 1 1241 . , 2 .
K = 0.0; K = 30.0m1 In2
0.9
0.3
".., , , , , ,~'. ,
""'" "". "". ,'. ," ,'. ,". ,'. ," ,'. ,'. ," ," ,~."-;'~',
~..,., . Unstable
Unstable
Stable
0.00.00 0.04 0.08 0.12
Nsub
Fig. 5 Effect of radial power factor on stability ofout-at-phase mode of oscillation
0.16 0.20
182
BARC NEWSLETTER Founder', Day Special /"ue 2(J(J/
0.7
0.6
- subcriticality=0,007subcriticality = 0.014
-II- a = 0.003512
-0- a = 0.007120.5
0.3
0.4.1:;()a.
Z
0.2
0.1
0.02 0.04N
sub
0.06 0.08
Fig. 6 Comparison of stability maps between coupled
multipoint kinetics model and modal point
kinetics model for out-of-phase mode of oscillation183
2000 266.7Pressure = 7 MPa
1750 ~. I
C = - 0.005 r---a "
1500 ~tf = 8 s
~_.. 233.3
---.c~ 1250:2.......Q; 1000~0. 750~
Lx = 15%
8 500-- X = 10%,.-
~
.~ I 200.0Tf d 160°- .
T:~-; 140og 166.7 !133.3a.
'"0Q)
100.0 ~
250
DR = 0.4 'eftDR = 0,6166.7DR = 0.8
- DR = 1,O~33.3
a I , I , I , I ' I , I , I , I , 10.0-5 0 5 1a 15 20 25 30 35
Subcooling (K)Fig. 7 Decay ratio map of AHWR for in-phase mode of oscillation
About tbe "utbors ...
Dr.A.KNayakjoinedthe35' batchof BARCTraining School after graduating in Mechanical Engineering
from Regionn! Engineering Colkge, Rourkela. He obtained his M. Techfrom Regionnl Engineering Colkge,
Warangal. Subsequently, he also obtained his /)(x;torate in Nnewar Engineering from Tokyo Institute of
Technology, Tokyo. His current field of interests are singw-phase and two-phase natural circulation,thermohydraulic and coupwd neutronic-thermohydraulic stability of natural circulation BWRs, spray
condensation, gravity separation of steam and water in natural circulation steam drums, scaling of natural circulation
systems, etc.
Dr. P.K Vijayan joined the 2(/' hatch of BARC Training School after graduating in Chemical Engineeringfrom
the University of Calicut. He obtained his Ph.D. from I.I. T Mumhai for his work on natural circulation in a
figure-of-eight loop relevant to PHWRs. He has worked in GRS, Munich,for a year on the simulation of natural
~ circulation systems. He has established himself an expert in the area of nuchasr reactor theruwdhydraulics. Dr.
Vijayan's work on singw-phase natural circulation loops is frequently cited hy researchers as a significant
contribution. His current research interests include stability of two-phase natural circulation, scaling of nucwar reactor
systems and setting up thermal hydraulic facilities related to AHWRand PHWRs.
Mr D. Saha joined the 15' batch of BARC Training School after graduating in Mechanical Engineeringfrom
the University of Calcutta. Subsequently, he ohtained his Master's degree in Mechanical Engineeringfrom the
sonw university. Over the period, he has established himself as an expart in the area of theruwdhydraulics
which plays a k", row in the design as wen as safe and efficient oparation of nnewar power plants. Right
from its inception, Mr Saha is deeply involved in the desigu and development of the Advanced He"", Water
Reactor. He has made exemplary contribution towards a nutaber of internationn! programmes. Recently, he wd an
internationn! group on pressure drop relationships constituted hy IAEA. He worked in Kernforschungszentrum, Karlsruhe
(KjK) on reactor safety. At present, he is desiguatnd as Head, Thernud Hydraulics Section, RED.
185
