Clin Exp Immunol 1994; 97:87-93

Active hepatitis C virus infection in bone marrow and peripheral bloodmononuclear cells from patients with mixed cryoglobulinaemia

A. GABRIELLI, A. MANZIN*, M. CANDELA, M. L. CANIGLIA, S. PAOLUCCI*, M. G. DANIELI &M. CLEMENTI* Istituto di Clinica Medica and *Istituto di Microbiologia, Universitd di Ancona, Ancona, Italy

(Acceptedfor publication 17 March 1994)

SUMMARY

The presence of hepatitis C virus (HCV) genomic sequences was checked in plasma, liver,peripheral blood mononuclear cells (PBMC) and bone marrow cells from 11 patients withmixed cryoglobulinaemia positive for anti-HCV antibodies, and from 11 patients with chronicHCV hepatitis without serological evidence of cryoglobulinaemia. HCV RNA sequences weredemonstrated by reverse transcription polymerase chain reaction in seven plasma samples, in sixPBMC samples, and in seven bone marrow cell samples from the 11 cryoglobulinaemic subjects;otherwise, viral specific nucleic acids were detected in 10 plasma samples, in one PBMC sample,and in two bone marrow cell samples from the 11 patients with chronic hepatitis. The HCVreplicative intermediate was evidenced in four of the six PBMC and in five of the seven bonemarrow aspirate HCV RNA-positive samples. Analysis of subpopulations isolated from bonemarrow and peripheral blood samples showed HCV RNA sequences in mononuclear cellsbelonging either to the CD2 + subset or to the CDl9 + subpopulation or to the adherent cells.Finally, we compared the nucleotide sequences of a large portion (-270 to -59) of the HCV5'-untranslated region from five patients with mixed cryoglobulinaemia and from seven patientswith chronic hepatitis without cryoglobulinaemia; the degree of heterogeneity, compared with theprototype HCV sequence, was similar in both groups. These findings from two groups of HCV-infected patients indicate that transient or permanent active HCV infection of bone marrow andPBMC is frequent in anti-HCV-positive patients with mixed cryoglobulinaemia, and suggest thatextra-hepatic infection may play a major role in influencing the pathophysiology of this infectionas well as the viral persistence.

Keywords hepatitis C virus cryoglobulinaemia polymerase chain reaction

INTRODUCTION

Mixed cryoglobulinaemia (MC) is a clinical disorder character-ized by purpura, weakness, arthralgia, and the presence ofserum cryoglobulins with rheumatoid factor activity [1,2]. Atpresent, MC is considered an immune complex-mediateddisease, as documented by complement activation [3], presenceof immunoglobulins and/or complement in vasculitic lesions[4,5], and morphologic identity of circulating cryoglobulinswith tissue deposits [6,7].

Current knowledge regards cryoglobulins as antigen-anti-body complexes formed by the interaction of IgG with therheumatoid factor immunoglobulin. Although clinical andserological studies have emphasized a possible role of differentviral infection in MC [8,9], not only is the specificity of primaryIgG (if any) still unclear, but also the understanding of the earlypathogenic steps is currently incomplete.

Correspondence: Armando Gabrielli MD, Istituto di ClinicaMedica, Ospedale di Torrette, 1-60020 Ancona, Italy.

87

Hepatitis C virus (HCV) is distantly related to flavi- andpestivirus [10]. At present, it is considered the causativeagent of a wide spectrum of liver diseases, including post-transfusion non-A non-B acute hepatitis [11], chronic hepati-tis and cirrhosis [12], a subset of autoimmune forms ofchronic hepatitis [13] and primary hepatocellular carcinoma[14]. Recently, it has been observed that circulating anti-bodies to HCV [15-20] or the presence of HCV RNAsequences in serum samples [21,22] are detectable in the vastmajority of patients with MC. The cell-free virus and specificanti-HCV antibodies have been found in the cryoprecipitatefrom these patients [23]. These data suggest that HCV mayplay a major role in the onset and/or development of MC. Infact, clinical signs of chronic liver disease are common inMC [24,25], and there is increasing evidence that HCV iscapable of infecting other cells besides hepatocytes [26,27],e.g. peripheral blood lymphocytes.

In this context, the precise understanding of the role ofpersistent HCV infection in the progressive immunologic

A. Gabrielli et al.

damage caused by MC is essential for a more correct clinicalmanagement of these patients.

To gain more insight into both HCV pathophysiology andevents related to MC pathogenesis, we planned a molecularanalysis ofHCV infection in two groups of patients: (i) patientswith chronic HCV hepatitis without serological and clinicalevidence of cryoglobulinaemia (CH), and (ii) HCV-infectedpatients with MC. In these subjects, several molecular featuresof HCV infection were studied comparatively, including tissuetropism and sequence heterogeneity of the HCV 5' untranslatedregion (5'-UTR).

PATIENTS AND METHODS

PatientsEleven consecutive patients with MC (two males and ninefemales; age 57-72 years, mean 64 6 years), were studiedaccording to a protocol approved by the appropriate institu-tional review board, and each patient gave informed consent.Diagnosis was established on the basis of a clinical history ofpurpura, weakness, and arthralgia associated with detectableserum cryoglobulinaemia in the documented absence of co-

existing connective tissue diseases, lymphoproliferative disor-ders, and infectious processes. Liver involvement, when pre-

sent, was always detected after a long history of purpura andarthralgia. Ten patients had MC with a monoclonal component(type II); one had MC in which both constituents were

polyclonal (type III).Eleven CH patients (four females and seven males, aged 22-

65 years; mean 49-2 years) underwent the same study protocol:none of these hepatitis patients had positive rheumatoid factor,complement consumption and/or serological evidence of cryo-

globulinaemia.Infection with hepatitis A virus, hepatitis B virus,

Epstein-Barr virus (EBV), and with cytomegalovirus (CMV)were ruled out in both groups with appropriate serologicaltests; moreover, there was no evidence of alcohol abuse or

drug addiction. None of the patients had a history of bloodtransfusions.

All patients underwent a complete clinical assessment,including a liver and a bone marrow biopsy. In the MCgroup, six patients had been treated with interferon-alpha(IFN-a) (3 x 10-6 U three times a week) for at least 6 monthsbefore enrolment into the study, two patients with low dosagedeflazacort (12mg daily), and three patients with antinflam-matory drugs. In the CH group only three patients were undertherapy with IFN-a at the time of the study.

Serologic methodsCryoglobulins were isolated from venous blood samples which,collected into pre-warmed tubes after an overnight fast, hadbeen allowed to clot at 37°C and, after centrifugation, had beenincubated at 4°C for 7 days. Cryoglobulins were characterizedby immunoelectrophoretic assays and by immunofixation usingmonospecific antisera to -y, a, k, K, and A chains.

Antibodies against HCV virus were detected using two

different second-generation enzyme immunoassays (ELISA 2,United Biomedical, Inc., Hauppage, NY, and Sorin BiomedicaSpA., Saluggia, Italy) and confirmed by second-generationimmunoblotting assay (Chiron RIBA 2, Ortho DiagnosticSystems, Raritan, NJ). Hepatitis B virus markers were assayed

using commercial kits from Murex (Dartford, UK) and SorinBiomedica.

Cell separationPeripheral blood mononuclear cells (PBMC) from 10 ml ofheparinized blood were isolated by Ficoll-Hypaque (Sigma, StLouis, MO) density gradient centrifugation, resuspended in 10ml of RPMI 1640 (Whittaker M.A., Walkersville, MD) andwashed twice in cold PBS. Bone marrow cells were collected byaspiration from the posterior iliac crest and the cells (BMC)were isolated as for PBMC.

Cell subset separationHeparinized venous blood samples were loaded over Mono-Poly Resolving Medium (Flow Labs, Milan, Italy) and centri-fuged at 300 g for 30 min at room temperature, resulting in theformation of two cell bands. The first band, located at theplasma-resolving medium interface, contained mononuclearcells which were 95-98% viable; the second band located10mm below the first one consisted of 99% of pure polymor-phonuclear leucocytes which were 98% viable. In both bandsviability was assessed by trypan blue exclusion. The cells of thefirst fraction were recovered, washed twice with RPMI 1640with 10% fetal calf serum (FCS) and divided into two aliquots.The first aliquot was incubated for 30 min at 370C in 5% CO2 ina plastic Petri dish; non-adherent cells were dislodged withseveral washings of cold PBS, and adherent cells, whichcontained more than 95% of non-specific esterase-positivecells, were employed for the molecular studies.

The second aliquot was employed for positive selection ofCD2+ and CD19+ cells using Dynabeads (Dynal International,Oslo, Norway) according to the manufacturer's instructions.

Bone marrow aspirates, anti-coagulated with heparin, were

obtained from the posterior iliac crest and processed as

described for the peripheral blood samples.

HCV RNA assays

Total RNA was extracted from BMC, PBMC, liver biopsy, andfrom 100 pl of plasma samples using the guanidine thiocyanatemethod [28].

For HCV RNA detection, an aliquot (10 ptl) of purifiedRNA was reverse transcribed and amplified using specificprimers for the 5'-non-coding region of HCV genome: HCV-01 ( 5'-ACC ATA GAT CAC TCC CCT GTG AGG AACTA, recognizing a specific HCV sequence at position -313 to

-285) and HCV-02 (5'-CAC TCG CAA GCA CCC TATCAG GCA GTA CCA, recognizing a specific HCVsequence at position -29 to -58) encompassing a 285 bpsequence (-313 to -29) [29] (Fig. 1). Reverse transcriptionwas carried out at 420C for 30 min in a mixture (finalvolume 20 IAL) containing 10 pl RNA sample, 1 x PCRbuffer (50 mm NaCl, 10 mm Tris HCl pH 8-3, 1.5 mM

MgCl2, 0 01% gelatin), 0-2 mm of each dNTP, 10 pmol of

antisense primer HCV-02, 20 U RNasin, and 100 U

MoMuLV reverse transcriptase (BRL, Bethesda, MD).After a denaturation step at 94°C for 5 min, the amplifica-tion reaction (50 cycles) was performed in a mixture (finalvolume 100 gl) containing x PCR buffer, 2 5 U Taq DNApolymerase and primers HCV-01 and HCV-02 (final concen-

tration 50 pmol each) using an automated thermal cycler(Pelkin Elmer Cetus, Norwalk, CT) and the following ampli-

88

Hepatitis C virus and cryoglobulinaemia

4 5 6

bp

285

Fig. 1. Reverse transcription-polymerase chain reaction (RT-PCR)products of hepatitis C virus (HCV)-RNA isolated from plasmasamples of two HCV-infected patients with mixed cryoglobulinaemia(MC) (lanes 1 and 2) and two chronic hepatitis without cryoglobuli-naemia (CH) patients (lanes 3 and 4). Lane 5, negative control from a

healthy, HCV-negative subject; lane 6, positive control with HCV-RNA extracted from a pool ofplasma of HCV-positive patients; lane 7,molecular weight markers (ox 174 DNA digested with HaeIII).Aliquots (10p1) were loaded on 10% polyacrylamide gel and run at180 V for 40 min. After ethidium bromide staining, the specific productswere visualized on UV screen.

fication profile: denaturation at 94°C for 60 s, annealing at55°C for 45 s, extension at 72°C for 60 s.

The presence of the HCV replicative intermediate (minusstranded viral RNA) in BMC and PBMC was documentedby reverse transcribing RNA samples using the consensus

primer HCV-01 in independent RT assays. Double extrac-tion and amplification assays were independently performedfor each sample, as well as multiple negative and positivecontrols, included to assure the specificity and sensitivity ofthe tests.

For sequencing of a portion of the HCV 5'-UTR, amplifiedDNA products were deproteinized and purified with phenol/chloroform extraction and centrifugation with Centricon 100filters (Amicon Division, Beverly, MA). Double-strandedpurified material was sequenced by the T7 DNA polymerasechain termination method and 35SdATP using a commercialkit from Pharmacia (Uppsala, Sweden) as described previously[30]. Amplified samples were bidirectionally sequenced usingboth primers HCV-01 (consensus primer) and HCV-02 (anti-sense primer).

RESULTS

Mixed cryoglobulinaemiaLiver biopsies from MC patients showed histologic featurescompatible with chronic persistent hepatitis in seven patients,chronic active hepatitis in two patients, and cirrhosis in one

patient. Only one MC patient (no. MC07, Table 1) had no

evidence of liver disease, and since aminotransferase levels werewithin the normal range at the time of the investigation, liverbiopsy was not performed.

All patients were found to be positive for anti-HCVantibodies when tested by enzyme immunoassay and RIBA 2(Table 1), whereas HCV genomic sequences were detected inliver samples available from MC patients (10/10) (thus con-

firming the specificity of the serologic data) and in the plasma of7 of 11 patients (63-6%).

When PBMC and BMC from these patients were assayed forthe presence of specific HCV-RNA sequences, six (54 5%) andseven (63-6%) of 11 patients were positive, respectively (Table 1).

Only one patient (no. MC09, Table 1) had no evidence ofHCV-RNA in both PBMC and BMC. Interestingly, four patientsexhibited the presence of HCV-RNA sequences in BMC (no.MC06 and MC07) or in PBMC (no. MC10 and MCI 1),although RT-PCR testing for viral sequences in serum gavenegative results. Overall, 10 of 11 MC patients (91%) showedmolecular signs of extra-hepatic HCV infection.

Reverse transcription of the RNA extracted from the cellsamples was carried out using the upstream primer; under theseconditions, the replicative form of the HCV genome (the minusstrand) was detected in four of six PBMC and in five of sevenBMC (Table 1). On the whole, seven (63 6%) of 11 patients hadmolecular evidence of active extrahepatic viral infection.

All plasma samples tested negative for the presence ofHCVminus-strand RNA.

Ten patients underwent a bone marrow biopsy at theposterior iliac crest. Variable degrees of lymphoid hyperpla-sia, sometimes occurring as small lymphoid aggregates, couldbe detected in nine patients, six of whom showed detectableHCV-RNA sequences in mononuclear cells isolated from theseaspirates.

The molecular analysis of enriched cell populations is shownin Table 2. The presence ofHCV-RNA was documented only inmononuclear cells (the CD2+ enriched fraction, the CD19+,subset) and in the adherent cells.

Table 1. Detection of hepatitis C virus (HCV) RNA sequences in clinicalsamples from anti-HCV-positive patients with mixed cryoglobulinaemia

(MC) and chronic hepatitis (CH) without cryoglobulinaemia

HCV RNAPatient Therapy/no. Plasma Liver PBMC BMC months

MCOl + + +* + * "IFN-a/1IMC02 + + +* + * IFN-a/15MC03 + + + + * IFN-a/20MC04 + + - + * IFN-a/10MC05 + + - + * NoneMC06 + - + "Steroids/3MC07 - ND - + Steroids/3MC08 + + + - IFN-a/7MC09 + + - IFN-ca/14MC1O + * - IFN-a/15MC11 - + + - IFN-a/7

CHO + + - + NoneCH02 + + - + IFN-a/12CH03 + + +* - NoneCH04 + + - - NoneCH05 + + - - NoneCH06 + + - - NoneCH07 + + - - NoneCH08 + + - - NoneCH09 + + - - IFN-a/3CH1O + + - - NoneCHIl - + - - IFN-a/12

* Detection of negative stranded HCV RNA.PBMC, Peripheral blood mononuclear cells; BMC, bone marrow

cells; "IFN-a, human recombinant IFN-a (3 MU intramuscularly 3times a week); steroids, deflazacort (12 mg per day); ND, not done.

89

A. Gabrielli et al.

Table 2. Hepatitis C virus (HCV)-RNA in cell subpopulations* isolatedfrom peripheral blood (PB) and bone marrow (BM) aspirates of

patients with mixed cryoglobulinaemia

HCV-RNA

CD2+ CD19+ AC PMNPatientno. PB BM PB BM PB BM PB BM

MC03 + - - - + + - NDMC04 - + - - - - NDMCO5 - - - + - - ND NDMC08 + - - - - NDMCll - - + - - - - -

* AC, Adherent cell; PMN, polymorphonuclear leucocytes; ND, notdetermined.

The absence ofHCV RNA sequences in the last cell wash ofall the experiments and the presence of the minus strand ofHCV RNA (the replicative intermediate) in most of the cellsamples from our patients excluded a possible plasma contam-ination.

Chronic hepatitis groupAll patients were selected for the presence of histologicalevidence of chronic liver disease and serum antibodies toHCV. HCV-RNA sequences were found in plasma samplesfrom 10 of the 11 subjects and in all liver biopsies (Table 1).Interestingly, viral HCV-RNA was found to be present in thePBMC from one case (9%) and in the BMC from 2/11 patients(18%). The presence of the HCV replicative intermediate wasdemonstrated using the upstream primer for reverse transcrip-tion in PBMC from one subject.

Bone marrow biopsy did not reveal any abnormality in thepatients with CH.

HCV 5'-UTR sequenceTo perform a comparative analysis of the viral genotypes amongthe patients studied, a portion of the HCV genome (-270 to -59sequence from the 5'-UTR) was sequenced directly using cDNAamplified from plasma samples from five of the seven viraemicpatients with MC and seven of the 10 viraemic patients withoutMC. The sequencing data are shown in Table 3, and reveal thepresence of highly conserved domains interspersed with clusteredvariable domains in viral isolates from both groups. The degreeof heterogeneity compared with the prototype HCV sequence[30] averaged 2 73% (0-94-5-66%) among MC patients, and2-62% (0-5-18%) among CH patients without MC. Nucleotidevariations were primarily located in three major domains (-239to -228; -151 to -139; -128 to -119); in contrast, in mostisolates, domains invariably conserved were located betweennucleotides -270 to -238, -188 to -78, and -76 to -29.

DISCUSSION

In this study we performed a comparative molecular investiga-tion of two groups of HCV-infected patients with differingmanifestations and documented (i) that a high proportion of

MC patients harbours specific HCV-RNA sequences in PBMCand/or BMC, and (ii) that molecular evidence of active viralinfection (i.e. presence of the negative stranded viral RNA, thereplicative intermediate of HCV replication) is detectable inBMC and PBMC from the vast majority of these cases. Incontrast, we could document active HCV replication in PBMCfrom only one patient with chronic hepatitis without cryoglo-bulinaemia. The contrast between our data and those of others[26,27], who found HCV-RNA sequences in a significantproportion of PBMC samples from patients with CH, is onlyapparent, since in those studies no information on signs or

symptoms of cryoglobulinaemia was given.In the last few years, comparative sequence analysis of the

complete HCV genome or partial sequencing of HCV isolateshave indicated the existence of distinct viral types [31]. Sig-nificant genetic heterogeneity has not only been reportedamong HCV isolates from different geographic areas [32], butalso within isolates from a single individual [33], thus indicatingthat this virus is particularly prone to genetic variation.Although our data cannot exclude that differences in otherviral regions may exist, we did not observe any differentialfeature in sequences of the 5'-UTR portion of viral isolatesfrom the two groups, thus ruling out the possibility that geneticvariability of this region may be at the basis of the differentialmolecular aspects of the infection observed in these two groups

of HCV-infected patients.Following the suggestion of a potential role of HCV in

chronic autoimmune hepatitis [34], HCV infection has more

recently been associated with cryoglobulinaemic nephritis [35],and a direct or indirect involvement ofHCV infection has beenproposed in this study. In this context, evidence of differentialbiological features ofHCV infection (such as differential tissuetropism) in different clinical manifestations may have impor-tant diagnostic and pathogenic consequences. However, thebiological and pathogenic significance of the presence of HCVsequences in BMC remains to be established.

In fact, data presented here may suggest that (i) BMC andPBMC may be the reservoirs from where the virus (hidden fromneutralizing or cytotoxic T lymphocytes) triggers a chronic,albeit defective, immune stimulation leading to the serologicalfeatures of cryoglobulinaemia; (ii) alternatively, although theremay be no direct and causal relationship between the twoevents (HCV infection of BMC, and onset of cryoglobulinae-mia), it can be speculated that the appearance of a new HCVvariant may be responsible for either the infection of BMC or

the appearance of novel antigenic characteristics able to elicitrheumatoid factor and immune complex generation. After all,our comparative sequence data cannot exclude differences inviral regions other than the HCV 5'-UTR; (iii) finally, sinceinfected BMC and PBMC cells do not appear to store the viruspassively, but rather seem to be a site of active viral replication,persistent HCV infection may profoundly affect the biology ofthese cells, thus leading to MC.

The development of in vitro model systems for propagatingHCV in lymphoid cells is thus crucial for understanding theprecise role of this virus in mixed cryoglobulinaemia.

From a clinical standpoint our findings may have severalimplications. First, in the 6 months preceding the investigation,seven MC patients had been treated with IFN-a, but despiteevidence of clinical improvement, HCV-RNA was still presentin the cells of six of these subjects, two of whom were plasma

90

Hepatitis C virus and cryoglobulinaemia

Table 3. Sequence analysis of the hepatitis C virus (HCV) 5'-untranslated region (5'-UTR) amplified from plasma samples of anti-HCV-positivepatients with (MC) or without (CH) essential mixed cryoglobulinaemia

HCVOI 5'-ACCATGAATCACTCCCCTGTGAGGAACTA (-313-285)

-3191 ~~~~~~5UTR

HCV02 5'-CACTCGCAAGCACCCTATCAGGCAGTACCA (-29-58)HCVV:-270 AAAGCGTCTAGCCATGGCG1TAGTATGAGTGTCGTGCAGCCCCAGGACCCCCCCTCCCGGGAGAGCCATA-199 GTGGTCrGCGGAACCGOTGAGTACACCGGAA¶[TGCCAGGACGACCGGGTCCTIT'TGGATCAACCCGCTC-128 AATGCCTnGGAGATITGGGCGTGCCCCCGCAAGACTGCTAGcCGAGTAGTG1TIGGGTCGCGAAAGGCC'1TGMCO1:-270

-1991A-A-128MCO2:-270-199 A-128MC03:-270-199-128MC04:-270 TAG*A-119 AA-128T-C-CCMC05:-270 A T-199 G- A-128 T-C---CCCiol:

-270-199 C-G-128CH02:-270-199-128CH03:-270 AC-199 AT A A-128T

CH04:-270 A C-199 A -T A A-128CR05:

-270 A---199 ----~ A TA A A-128 TT

CH06:-270-199 A-AAA-128CH07:-270-199-128

91

92 A. Gabrielli et al.

negative. This suggests either that the dosage of IFN-a weadministered was unable to induce virus clearance and thatmost of the clinical improvement may be ascribed to the anti-inflammatory effects of the compound, or that IFN-a is unableto block virus replication. In any case, it will be important toverify whether, in accordance with the report of Gil andcolleagues [36], persistence of HCV-RNA in extrahepatic sitesis associated with a higher post-therapy relapse rate. Second,the evaluation of the response to any treatment employed inMC patients should consider not only the presence of HCV-RNA in plasma, but also viral infection in PBMC and BMC.Third, the high incidence of bone marrow lymphoid hyperpla-sia in patients with HCV-RNA in BMC warrants furtherstudies to ascertain whether they have a higher risk of devel-oping lymphoproliferative disorders, and whether they requirelong-term clinical follow up. In this respect, the infection ofcells of lymphoid but not of myeloid lineage may havepathogenic relevance.

ACKNOWLEDGMENTS

This work was supported by Grants MPI 40% and 60% 1991 and 1992;by grants from the Italian National Research Council (C.N.R.), targetproject 'Biotechnology and Bioinstrumentation' (BTBS), and from theMinistero della Saniti (6th AIDS Project). We are indebted to DrRenato Galeazzi, Divisione di Gastroenterologia, Ospedale Umberto10, Ancona, for allowing us to study some of the patients with chronichepatitis, and to Mrs Gabriella Riganelli for assistance in the prepara-tion of the manuscript.

REFERENCES

I Lo Spalluto J, Dorward B, Miller W Jr et al. Cryoglobulinemiabased on interaction between a gamma macroglobulin and 7Sgamma globulin. Am J Med 1962; 32:142-7.

2 Meltzer M, Franklin EC, Elias K et al. Cryoglobulinemia-aclinical and laboratory study. II Cryoglobulins with rheumatoidfactor activity. Am J Med 1966; 40:837-56.

3 Riethmuller G, Meltzer M, Franklin EC et al. Serum complementlevels in patients with mixed (IgM-IgG) cryoglobulinemia. Clin ExpImmunol 1966; 1:337-9.

4 Gorevic PD, Kassab HJ, Levo Y et al. Mixed cryoglobulinemia:clinical aspects and long term follow up of 40 patients. Am J Med1980; 69:287-308.

5 Miescher PA, Paronetto F, Koffier D. Immunofluorescent studies ofhuman vasculitis. In: Grabar P. Miescher PA, eds, Fourth Interna-tional Symposium on Immunopathology. New York: Grune &Stratton, 1975: 30-7.

6 Farivar M, Wands JR, Benson GD et al. Cryoprotein complexesand peripheral neuropathy in a patient with chronic active hepatitis.Gastroenterology 1976; 71:490-3.

7 Gabrielli A, Sbarbati A, Marchegiani G et al. Evidence of immunedeposits and of basement membrane alterations in dermal vessels ofnormal skin of patients with essential mixed cryoglobulinemia.Arthritis Rheum 1987; 30:884-93.

8 Levo Y, Gorevic PD, Kassab HJ et al. Association betweenhepatitis B virus and essential mixed cryoglobulinemia. N Engl JMed 1977; 296:1501-4.

9 Fiorini G, Bernasconi P. Sinico RA et al. Increased frequency ofantibodies to ubiquitous viruses in essential mixed cryoglobulin-emia. Clin Exp Immunol 1986; 64:65-70.

10 Miller R, Purcell RH. Hepatitis C virus shares amino acidsequence similarity with pestivirus and flavivirus as well as

members of two plant virus subgroups. Proc Natl Acad SciUSA 1990; 87:2059-61.

11 Alter HJ, Purcell RH, Shih JW et al. Detection of antibody tohepatitis C virus in prospectively followed transfusion recipientswith acute and chronic non-A non-B hepatitis. N Engl J Med 1989;321:1494-1500.

12 Katkov WN, Dienstag HC, Cody H et al. Role of hepatitis C virusin non-B chronic liver disease. Arch Intern Med 1991;151:1548-52.

13 Michel G, Ritter A, Gerker G et al. Anti-Gor and hepatitis Cautoimmune liver diseases. Lancet 1992; 339:267-9.

14 Saito I, Miyamura T, Ohbayashi A et al. Hepatitis C virus infectionis associated with the development of hepatocellular carcinoma.Proc Natl Acad Sci USA 1990; 87:2059-61.

15 Pascual M, Perrin L, Giostra E et al. HCV in patients withcryoglobulinemia type II (letter). J Infect Dis 1990;162:569-70.

16 Casato M, Taliani G, Pucillo LP, et al. Cryoglobulinemia andhepatitis C virus. Lancet 1991; 337:1047-8.

17 Ferri C, Greco F, Longobardo G et al. Antibodies to hepatitis Cvirus in patients with mixed cryoglobulinemia. Arthritis Rheum1991; 34:1606-10.

18 Dammacco, F, Sansonno D. Antibodies to hepatitis C virus inessential mixed cryoglobulinemia. Clin Exp Immunol 1992; 87:352-6.

19 Misiani R, Bellavita P. Fenili D et al. Hepatitis C virus infection inpatients with essential mixed cryoglobulinemia. Ann Intern Med1992; 117:573-7.

20 Pechere-Bertschi A, Perrin L, De Saussure P et al. Hepatitis C: apossible etiology for cryoglobulinemia type II. Clin Exp Immunol1992; 89:419-22.

21 Ferri C, Greco F, Longobardo G et al. Association betweenhepatitis C virus and mixed cryoglobulinemia. Clin Exp Rheuma-tol 1991; 9:621-4.

22 Marcellin P. Descamps V, Martinot-Peignoux M et al. Cryoglobu-linemia with vasculitis associated with hepatitis C virus infection.Gastroenterology 1993; 104:272-7.

23 Agnello V, Chung RT, Kaplan LM. A role for hepatitis C virusinfection in type II cryoglobulinemia. N Engl J Med 1992;327: 1490-5.

24 Levo Y, Gorevic PD, Kassab HJ, et al. Liver involvement in thesyndrome ofmixed cryoglobulinemia. Ann Int Med 1977; 87:287-92.

25 Bombardieri S, Ferri C, Di Munno 0 et al. Liver involvement inessential mixed cryoglobulinemia. La Ricerca Clin. Lab. 1979;9:361-8.

26 Zignego AL, Macchia D, Monti M et al. Infection of peripheralmononuclear blood cells by hepatitis C virus. J Hepatol 1992;15:382-6.

27 Bouffard P, Hayashi PH, Acevedo R et al. Hepatitis C virus isdetected in a monocyte/macrophage subpopulation of peripheralblood mononuclear cells of infected patients. J Infect Dis 1992;166:1276-80.

28 Chomczynski P. Sacchi N. Single-step method of RNA isolation byacid guanidinium thiocyanate-phenol-chloroform extraction. AnalBiochem 1987; 16:156-9.

29 Petrelli E, Manzin A, Paolucci S et al. Chronic liver disease andactive hepatitis C virus infection in patients with antibodies to thisvirus. J Clin Pathol 1994; 47:148-51.

30 Manzin A, Menzo S, Bagnarelli P et al. Sequence analysis of thehepatitis B virus pre-C region in hepatocellular carcinoma (HCC)and non tumoral liver tissues from HCC patients. Virology 1992;188:890-5.

31 Choo QL, Richman KH, Han JH et al. Genetic organization anddiversity of the hepatitis C virus. Proc Natl Acad Sci USA 1991;88:2451-5.

32 Chen PJ, Lin MH, Tu SJ et al. Isolation of complementary DNAfragments of hepatitis C virus in Taiwan revealed significantsequence variations compared to other isolates. Hepatology 1991;14:73-8.

Hepatitis C virus and cryoglobulinaemia 93

33 Houghton M, Weiner AJ, Han JH et al. Molecular biology of thehepatitis C virus: implications for diagnosis development andcontrol of viral disease. Hepatology 1991; 14:381-8.

34 Lenzi M, Johnson PJ, McFarlane IG et al. Antibodies to hepatitis Cvirus in autoimmune liver disease: evidence for geographicalheterogeneity. Lancet 1991; 338:277-80.

35 Johnson RJ, Gretch DR, Yamabe H et al. Membranoproliferativeglomerulonephritis associated with hepatitis C virus infection. NEngl J Med 1993; 328:465-470.

36 Gil B, Qian C, Riezu-Boj JI et al. Hepatic and extrahepatic HCV-RNA strands in chronic hepatitis C: different patterns of responseto interferon treatment. Hepatology 1993; 18:1050-4.