CRTC1/MAML2 Fusion Transcript in Warthin’sTumor and Mucoepidermoid Carcinoma:Evidence for a Common Genetic Association

Diana Bell,1 Mario A. Luna,1 Randal S. Weber,2 Frederic J. Kaye,3 and Adel K. El-Naggar1,2*

1Departmentof Pathology,The Universityof Texas M.D.Anderson Cancer Center,Houston,TX2Departmentof Head and Neck Surgery,The Universityof Texas M.D.Anderson Cancer Center,Houston,TX3National Cancer Institute and Naval Hospital,Bethesda,MD

Translocations and gene fusions have an important early role in tumorigenesis. The t(11;19) translocation and its CRTC1/

MAML2 fusion transcript have been identified in several examples of both Warthin’s tumor and mucoepidermoid carcinoma

and are believed to be associated with the development of a subset of these tumors. To determine whether Warthin’s tumor

and mucoepidermoid carcinoma are genetically related, we used reverse transcriptase-polymerase chain reaction and DNA

sequencing to analyze microdissected components of three tumors consisting of Warthin’s tumor and mucoepidermoid carci-

noma. We also investigated a metastatic melanoma to Warthin’s tumor and a Warthin’s carcinoma of the parotid gland for

comparison. The fusion transcript was identified in both Warthin’s tumor and matching mucoepidermoid carcinoma compo-

nents of all three tumors, in the Warthin’s carcinoma, and in the Warthin’s tumor component but not in the metastatic mela-

noma. The results provide evidence for a link between the t(11;19) fusion gene and the development of a subset of Warthin’s

tumors with concurrent mucoepidermoid carcinoma and possible malignant transformation to Warthin’s carcinoma. This arti-

cle contains Supplementary Material available at http://www.interscience.wiley.com/jpages/1045-2257/suppmat.VVC 2008 Wiley-Liss, Inc.

INTRODUCTION

Warthin’s tumor is a benign tumor that repre-

sents 10% of salivary epithelial tumors and occurs

almost exclusively in the parotid gland and peripar-

otid lymph nodes (Aguirre et al., 1998). These

lesions are characteristically composed of epithelial

and lymphocytic elements, in which the epithelial

cells are oncocytic with papillary, glandular, cystic,

and solid morphologies (Eveson and Cawson, 1986;

Williamson et al., 2000; Maiorano et al., 2002). The

evolution and nature of Warthin’s lesions are con-

troversial and it is assumed that they represent a

pathogenetically heterogeneous entities (Chapnik,

1983; Aguirre et al., 1998; Stenman et al., 1998;

Sobrinho-Simoes et al., 2005; Teymoortash and

Werner, 2005; Sobrinho-Simoes and Maximo, 2006).

Two main hypotheses have been put forward for

the origin of Warthin’s lesions (Ruebner and Bram-

hall, 1960; Therkildsen et al., 1992; Teymoortash

et al., 2006). One proposes a nonneoplastic prolifer-

ation manifested as oncocytic cellular hyperplasia

and the other is based on a clonal derivation result-

ing in oncocytic neoplastic growth (Martins et al.,

1997; Aguirre et al., 1998). Multicentricity, lack of

recurrence and an absence of clonal genetic/molec-

ular alterations in some Warthin’s lesions support

the nonneoplastic proposition (Seifert, 1997; Take-

zawa et al., 1998; Honda et al., 2000; Maiorano et

al., 2002; Arida et al., 2005; Sobrinho-Simoes and

Maximo, 2006). Conversely, the pure epithelial

presentations of early lesions (Aguirre et al., 1998;

Sobrinho-Simoes and Maximo, 2006), transforma-

tion to carcinoma (Ruebner and Bramhall, 1960;

Therkildsen et al., 1992; Foschini et al., 2005) and

the clonal cytogenetic and molecular findings in

some Warthin’s tumors provide evidence for

the neoplastic theory (Bullerdiek et al., 1988; Mark

et al., 1989, 1990; Martins et al., 1997; Lewis et al.,

2000; El-Naggar, 2006; Tirado et al., 2007)

Based on these assumptions the hyperplastic

form of Warthin’s tumors may evolve as a result of

an age-related mitochondrial defect whereas the

*Correspondence to: Adel K. El-Naggar, MD, PhD, Professor ofPathology and Head and Neck Surgery, Unit 85, The University ofTexas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Hous-ton, TX 77030. E-mail: anaggar@mdanderson.org

This work was supported in part by the Kenneth D. Muller Pro-fessorship, National Cancer Institute Specialized Program ofResearch Excellence (SPORE) Grant in Head and Neck and theNational Cancer Institute Grant (CA-16672).

Received 17 August 2007; Accepted 22 November 2007

DOI 10.1002/gcc.20534

Published online 7 January 2008 inWiley InterScience (www.interscience.wiley.com).

VVC 2008 Wiley-Liss, Inc.

GENES, CHROMOSOMES & CANCER 47:309–314 (2008)

neoplastic form originates from clonal mitochon-

drial and/or genomic DNA alterations of ductal

cells (Lewis et al., 2000; Sobrinho-Simoes and

Maximo, 2006). Mitochondrial clonal alterations in

Warthin’s tumor and oncocytic thyroid lesions have

been identified and lend credence to the potential

involvement of these abnormalities in the

development of some of these tumors (Lewis et al.,

2000; Sobrinho-Simoes et al., 2005; Sobrinho-

Simoes and Maximo, 2006). Although, the exact

mechanism by which mitochondrial DNA

(mtDNA) alterations play in the development of

Warthin’s tumor remains unknown, it has recently

been shown that mtDNA alteration may lead to

defective apoptosis of oncocytic cells and an over

production of reactive oxygen species (Zhou et al.,

2007). These events may contribute to tumorigen-

esis through the induction of signal transduction

pathways and tumor related genes (Stenman et al.,

1998; Zhou et al., 2007).

Although multiple cytogenetic and molecular

alterations have been reported in Warthin’s tumors,

(Gadient and Kalfayan, 1975; Berger et al., 1985;

Bullerdiek et al., 1988; Honda et al., 2000; Lewis

et al., 2000; Arida et al., 2005) the t(11;19) is the

most frequent and distinctive cytogenetic abnor-

mality identified (Mark et al., 1989, 1990; Martins

et al., 1997). Interestingly, the same translocation

has also been reported in mucoepidermoid carcino-

mas (Dahlenfors et al., 1995; El-Naggar et al.,

1996) and in some instances, as the sole chromo-

somal alteration in both tumors (Bullerdiek et al.,

1988; Dahlenfors et al., 1994, 1995; El-Naggar,

2006; El-Naggar et al., 1996). Moreover, the

CRTC1/MAML2 fusion gene transcript resulting

from the t(11;19) alteration has also been detected

in Warthin’s tumors and mucoepidermoid carcino-

mas by multiple independent groups (Berger et al.,

1985; Seifert et al., 1986; Nordkvist et al., 1994;

Stenman, 2005; Stenman et al., 1998; Conkright

et al., 2003; Tonon et al., 2003; Martins et al., 2004;

Wu et al., 2005; Okabe et al., 2006; Winnes et al.,

2006; Mitelman et al., 2007 Tirado et al., 2007).

In a recent study of both tumors (Tirado et al.,

2007), we proposed that the CRTC1/MAML2 fusion

transcript may constitute a common underlying

event associated with the development of a subset

of Warthin’s tumor and mucoepidermoid carcinoma

(Anderson et al., 2006). Central to this proposition

is whether the acquisition of this genetic alteration

predisposes a subset of Warthin’s tumor to malig-

nant progression. The simultaneous occurrence of

Warthin’s tumor and mucoepidermoid carcinoma

and the development of oncocytic carcinoma in

some of these lesions lend circumstantial support

for this probability (Ruebner and Bramhall, 1960;

Gadient and Kalfayan, 1975; Onder et al., 1990;

Seifert, 1997; Nagao et al., 1998; Williamson et al.,

2000; Foschini et al., 2005). However, direct evi-

dence for a histogenetic or molecular genetic link

between Warthin’s tumor and the malignant trans-

formation to mucoepidermoid and oncocytic carci-

nomas has yet to be established (Gadient and Kal-

fayan, 1975; Bullerdiek et al., 1988; Mark et al.,

1989, 1990; Dahlenfors et al., 1994, 1995; Hryn-

chak et al., 1994; Johansson et al., 1995; El-Naggar

et al., 1996; Nagao et al., 1998; Williamson et al.,

2000).

To test whether the CRTC1/MAML2 transcript

represents a common molecular event in the devel-

opment of these lesions we have analyzed matched

microdissected Warthin’s tumor and mucoepider-

moid carcinoma components of three cases for the

presence of this fusion transcript. We also analyzed

a Warthin’s tumor that occurred with metastatic

melanoma and a primary oncocytic (Warthin’s) car-

cinoma for the presence of the t(11;19) fusion tran-

script.

MATERIALS ANDMETHODS

A search of the database of the department of

Pathology at M.D. Anderson Cancer Center from

1970 to 2007 for the diagnosis of Warthin’s tumor

with mucoepidermoid carcinoma yielded six

tumors; one in-house and five received from con-

sultations. Of these six tumors, three had paraffin-

tissue blocks available and formed the major mate-

rials of our study. We also included a primary ma-

lignant Warthin’s tumor and metastatic melanoma

coincident with Warthin’s tumor.

Microdissection

In all cases, except for the Warthin’s carcinoma,

Warthin’s tumor and corresponding malignant com-

ponents were present in the selected tissue blocks.

For microdissection, 10 unstained 7-lm thick sec-

tions were prepared on plain glass slides and were

briefly (2 min) stained with H&E and were left

uncovered. Slides were examined with xylene for

better visualization using converted phase contrast

microscope. Five separate slides were used for

the dissection of each component of each case.

The microdissection was performed within the de-

lineated areas with a safety margin to avoid con-

tamination and inclusion of cells from the other

component. Slides of each microdissected compo-

nents were mounted, covered and reevaluated for

the efficiency of microdissection.

Genes, Chromosomes & Cancer DOI 10.1002/gcc

310 BELL ET AL.

RNA Extraction

RNA was extracted from formalin-fixed paraffin-

embedded tissue (10-lm paraffin sections) using a

Recover All Nucleic Acid Isolation Kit (Ambion

Diagnostics, Austin, Texas) per the manufacturer’s

instructions. We quantitated the absorbance of the

extracted RNA with a DU 60 spectrophotometer

(Beckman Coulter, Fullerton, CA). For positive

controls, we used RNA from two t(11;19)-positive

cell lines (NCI-H292 and H3113) and one mucoe-

pidermoid carcinoma that had previously been

identified as having the transcript (Tirado et al.,

2007). Cell blocks were prepared from the cell

lines. For the negative control, we used RNA from

a mucoepidermoid carcinoma that had previously

been shown lacking the transcript (Tirado et al.,

2007). For the negative control, we also included

archived normal parotid gland and SCC of larynx

tissues. Additional controls of all reagents minus

the cDNA template were used.

Reverse Transcriptase-Polymerase Chain Reaction

Assay for the CRTC1/MAML2 Transcript

One-tube reverse transcriptase-polymerase chain

reaction (RT-PCR) (Promega, Madison, Wisconsin)

was performed using 0.5 lg of extracted RNA in a

final mixture of 50 ll consisting of nuclease-free

water, 2 ll of 25 mM MgSO4, 1 ll avian myeloblas-

tosis viral RT (5 U/ll), 10 ll avian myeloblastosis

virus/Tfl 53 reaction buffer, 1 ll 10 mM deoxyri-

bonucleotide triphosphate mix, 1 ll Tfl DNA poly-

merase (5 U/ll), and 50 pmol of both primers. Ini-

tial primers used for the one-tube RT-PCR were

CRTC1 50-AAGATCGCGCTG CACAATCA-30 andMAML2 50-GGTCGCTTGC TGTTGGCAGG-30.The RT-PCR cycling consisted of 458C for 45 min,

948C for 2 min, followed by 40 cycles of 948C for

30 sec, 608C for 45 sec, 688C for 60 sec, and one

final cycle of 688C for 7 min.

All samples were subjected to nested PCR using

0.2 lg of amplified DNA from the initial RT-PCR

product, using TaqGOLD DNA polymerase and

1.5 mmol/l MgCl2. The amplification conditions

consisted of 948C for 10 min followed by 35 cycles

at 958C for 30 sec, 558C for 30 sec, 728C for 30 sec,

and one final cycle of 728C for 5 min. The primers

used for the nested PCR for CRTC1/MAML2 were

CRTC1 50-GGAGGAGACGGCG GCCTTCG-30 andMAML2 50-TTGCTGTTGGCAGG AGATAG-30.The final PCR product was 117 bp, which was

detected by gel electrophoresis 2% agarose; (FMC

Bioproducts, Rockland, Maine) and visualized with

ethidium bromide staining under UV light (Fig. 1).

Mismatched primer sets were used under the same

condition to determine specificity. As a control for

amplification efficiency and RNA quality, beta

actin mRNA 190-bp fragment was the housekeep-

ing marker (Mark et al., 1989).

Sequencing

Nucleotide sequencing was performed on all

nested CRTC1/MAML2 PCR amplification prod-

ucts of the nine specimens (GenBank AY040324).

Sequence alignment of the sense and antisense

DNA strands was performed using the clustlW at

http://www.ebi.ac.uk/emboss/align/program. A highly

efficient alignment was achieved in all transcript

positive and negative samples. (For complete se-

quence view attached files).

RESULTS

Histopathologic Features

All three Warthin’s tumors with mucoepider-

moid carcinoma contained discernable areas of

Warthin’s tumor and low- to intermediate-grade

mucoepidermoid carcinoma components (Fig. 2A,

Cases 1 and 2). In all three, metaplastic squamoid

changes of the oncocytic epithelium were noted in

juxtaposed areas. In the metastatic melanoma to

the parotid, the Warthin’s tumor was an incidental

finding (Fig. 2B, Case no.4). The malignant War-

thin’s tumor consisted entirely of oncocytic tubules

and ductal structures invading the surrounding soft

tissues (Fig. 2B, Case no. 5).

Molecular Analysis

Table 1 presents the results of the fusion tran-

script analysis in paired Warthin’s tumor and the

malignant component of the three tumors. The

117-bp fusion transcript comprising exon-1 of

the CRTC1 and exons 2–5 of the MAML2 gene was

Figure 1. Nested RT-PCR amplification product of the CRTC1/MAML2 fusion transcript (117 bp) in mucoepidermoid carcinomas(MEC), malignant Warthin’s tumor (MWT) and Warthin’s tumor (WT).The fusion transcript is noted in both components of concurrent MEC/WTs, in only the Warthin’s tumor associated with metastatic melanomaand in a Warthin’s carcinoma. Beta-actin was used as control for themRNA amplification quality. (M, molecular weight marker; SCC, squa-mous cell carcinoma; NP, normal parotid; MEC(2ve), previouslysequenced MEC lacking the transcript; H292, cell line positive fort(11;19) transcript).

Genes, Chromosomes & Cancer DOI 10.1002/gcc

311CRTC1/MAML2 FUSION TRANSCRIPT

detected in both the Warthin’s tumor and the

mucoepidermoid carcinoma components in all

three concurrent tumors (Figs. 1 and 2A), in the

Warthin’s tumor but not in the metastatic mela-

noma (Figs. 1 and 2B, Case no. 4) and in the War-

thin’s carcinoma (Figs. 1 and 2B, Case no. 5). A

mismatched sequence of primers for the same

fusion gene showed no evidence of amplification

product. The integrity and quality of the mRNA

extracted from all samples was confirmed by con-

current amplification of beta actin as a housekeep-

ing gene control.

DNA nucleotide sequencing of the amplification

product confirmed the presence of the t(11;19)

fusion gene in both the Warthin’s tumor and the

matching mucoepidermoid carcinoma components

(Fig. 2Ac, Cases 1 and 2), in the Warthin’s tumor

that occurred with metastatic melanoma (Fig. 2Bc,

Case no. 4) and the malignant Warthin’s tumor

(Fig. 2Bc, Case no. 5). The melanoma, normal pa-

rotid and squamous carcinoma lacked the t(11;19)

fusion transcript (Fig. 2Bc, Case 4 MM). (See

attached files for full sequence analysis).

DISCUSSION

Our findings show that Warthin’s tumor and syn-

chronous mucoepidermoid carcinoma share the

same t(11;19) fusion gene and that this may consti-

tute an early or initiating event in the clonal devel-

opment of a subset of Warthin’s tumors. In addition

to confirming the presence of the CRTC1/MAML2fusion gene in benign Warthin’s tumors, the data

also suggest that some of these lesions may be

prone to malignant transformation. Together, these

findings along with the simultaneous occurrence of

both tumors and the sharing of identical cytoge-

netic (Gadient and Kalfayan, 1975; Seifert et al.,

1986; Williamson et al., 2000) and molecular find-

ings, (Mark et al., 1989; Dahlenfors et al., 1994,

1995; Nordkvist et al., 1994; Johansson et al., 1995;

El-Naggar et al., 1996; Stenman et al., 1998;

Enlund et al., 2004; Martins et al., 2004; Okabe

et al., 2006; Winnes et al., 2006; Tirado et al., 2007)

support a histogenetic link between certain War-

thin’s tumors and the development of mucoepider-

moid carcinoma. Moreover, the detection of the

fusion transcript in the Warthin’s carcinoma

extends the role of this genetic event to the direct

malignant transformation of oncocytic epithelium

(Nordkvist et al., 1994; Gallo, 1995).

The study results and those of previous cytoge-

netic and molecular analyses of this entity are in

fact not mutually incompatible with the hypotheti-

cal evolution of two biologically and pathogeneti-

cally distinct groups of Warthin’s lesions from a

heterotopic oncocytic salivary ductal cell (Chapnik,

1983; Sobrinho-Simoes and Maximo, 2006). In that

context, we propose a stochastic model (Fig. 3) for

the classification of Warthin’s lesions where a non-

clonal cellular modification gives rise to benign or

reactive process, while clonal genetic alteration

(e.g., CTRC1/MAML2 fusion gene) induce a malig-

nancy susceptible tumor (Lewis et al., 2000;

Sobrinho-Simoes et al., 2005; Tirado et al., 2007).

In the latter category, the malignancy phenotype

may largely be dependent upon the metaplastic

Figure 2. (A) Composite illustrations of the phenotypic, transcriptand sequence analysis of two concurrent Warthin’s tumor and mucoepi-dermoid carcinoma cases (Cases 1 and 2); (B) metastatic melanoma toWarthin’s tumor (Case no. 4) and Warthin’s carcinoma (Case no. 5). (a)H&E stained sections, (b) CRTC1/MAML2 fusion transcript and beta-actinas control by gel electrophoresis, and (c) nucleotide of the fusion tran-script; g, breakpoint. The full amplified gene sequence of CRTC1/MAML2with nested probes is ggaggagacggcggccttcgaggaggtcatgaaggacctgagcctgacgcgggccgcgcggctccagggttccttgaaaagaaaacaggtagttaacctatct cctgccaacag-caa (probes bolded; g, breakpoint). [Color figure can be viewed in theonline issue, which is available at www.interscience.wiley.com.]

Genes, Chromosomes & Cancer DOI 10.1002/gcc

312 BELL ET AL.

state of the oncocytic epithelium. Accordingly,

mucoepidermoid carcinoma development is pre-

ceded by metaplasia and in its absence and most

likely with additional molecular alteration(s) War-

thin’s carcinoma evolves (Fig. 3) (Williamson et al.,

2000; Enlund et al., 2004; Martins et al., 2004;

Tirado et al., 2007). The findings of squamoid and/

or mucinous features in all Warthin’s tumors with

mucoepidermoid carcinoma component in our

cases and also in the previously reported coin-

cident examples of these entities lend further

credence to the first proposition (Ruebner and

Bramhall, 1960; Therkildsen et al., 1992; William-

son et al., 2000). Further analysis of Warthin’s carci-

nomas is needed to validate this notion.

Interestingly, in the case of metastatic melanoma

we identified the fusion transcript in only the War-

thin’s tumor component. This incidental finding

lend further support to the restricted involvement

of the t(11;19) fusion gene to a set of morphologi-

cally and histogenetically related tumors (Martins

et al., 2004; Okabe et al., 2006; Winnes et al.,

2006). We, and others, have recently reported the

presence of the fusion transcript in a restricted

group of tumors, including mucoepidermoid carci-

nomas at different sites, some Warthin’s tumors

and clear cell hidradenoma of skin but not in other

types of malignancies (Enlund et al., 2004; Winnes

et al., 2006; Tirado et al., 2007). The aggregate

data, therefore, indicate a role for the fusion gene

as an early or etiologic event in the development

and/or malignant transformation of a limited num-

ber of interrelated benign and malignant epithelial

neoplasms (Enlund et al., 2004; Martins et al.,

2004; Tirado et al., 2007).

In summary, we have identified, for the first

time, the t(11;19) fusion gene transcripts in both

Warthin’s tumor and coincident mucoepidermoid

carcinoma and in a malignant Warthin’s tumor.

These establish a common clonal association of

some of these tumors and support a role for the

fusion transcript in the development of Warthin’s

tumor with a propensity for malignant transforma-

tion. Future molecular screening along with analy-

ses of the t(11;19) fusion gene in Warthin’s tumors

may permit subclassification of Warthin’s lesions

for prognostication and management.

ACKNOWLEDGMENTS

We thank Dr. John G. Batsakis for his construc-

tive suggestions and advice.

REFERENCES

Aguirre JM, Echebarria MA, Martinez-Conde R, Rodriguez C, Bur-gos JJ, Rivera JM. 1998. Warthin tumor. A new hypothesis con-cerning its development. Oral Surg Oral Med Oral Pathol OralRadiol Endod 85:60–63.

Anderson AR, Weaver AM, Cummings PT, Quaranta V. 2006. Tumormorphology and phenotypic evolution driven by selective pres-sure from the microenvironment. Cell 127:905–915.

Arida M, Barnes EL, Hunt JL. 2005. Molecular assessment of allelicloss in Warthin tumors. Mod Pathol 18:964–968.

Berger R, Bloomfield CD, Sutherland GR. 1985. Report of the com-mittee on chromosome rearrangements in neoplasia and on fragilesites. Cytogenet Cell Genet 40:490–535.

Bullerdiek J, Haubrich J, Meyer K, Bartnitzke S. 1988. Transloca-tion t(11;19)(q21;p13.1) as the sole chromosome abnormality in acystadenolymphoma (Warthin’s tumor) of the parotid gland. Can-cer Genet Cytogenet 35:129–132.

Chapnik JS. 1983. The controversy of Warthin’s tumor. Laryngo-scope 93:695–716.

Conkright MD, Canettieri G, Screaton R, Guzman E, Miraglia L,Hogenesch JB, Montminy M. 2003. TORCs: Transducers of regu-lated CREB activity. Mol Cell 12:413–423.

Figure 3. A schematic outline of a hypothetical evolution of War-thin’s tumor and related carcinomas based on the molecular findings ofthe t(11;19) fusion gene transcript. Step 1, mitochondrial alteration ofsalivary duct cells lead oncocytic ductal features. Step 2 is stochasticwhere nonclonal oncocytic cellular proliferation leads to nodular hyper-plasia, (2A) while clonal oncocytic growth induced by CTRCT1/MAML2give rise to Warthin’s tumors prone to malignancy (2B). In step 3, thepresence of metaplasia is a prerequisite for MEC development (3A),while the acquisition of additional hitherto unknown alterations in theWarthin’s epithelium leads to oncocytic carcinoma (3B). [Color figurecan be viewed in the online issue, which is available at www.interscience.wiley.com.]

TABLE 1. Demographic, Pathologic, and Molecular Analysis of Concurrent Warthin’s Tumors and MucoepidermoidCarcinoma and Metastatic Melanoma to Warthin’s Tumors

Case no. Age (years) Gender Site Grade

CRTC1/MAML2 Fusion

WT MEC Metastasis WC

1 54 M Parotid I Positive Positive O O2 46 F Parotid II Positive Positive O O3 74 F Parotid I Positive Positive O O4 79 F Parotid I Positive N/A Negative O5 44 F Parotid III O O O Positive

F, female; M, male; MEC, mucoepidermoid; O, not detected; WT, Warthin’s tumor; WC, Warthin’s carcinoma.

Genes, Chromosomes & Cancer DOI 10.1002/gcc

313CRTC1/MAML2 FUSION TRANSCRIPT

Dahlenfors R, Lindahl L, Mark J. 1994. A fourth minor salivarygland mucoepidermoid carcinoma with 11q14-21 and 19p12 rear-rangements. Hereditas 120:287–288.

Dahlenfors R, Wedell B, Rundrantz H, Mark J. 1995. Transloca-tion(11;19)(q14-21;p12) in a parotid mucoepidermoid carcinomaof a child. Cancer Genet Cytogenet 79:188.

El-Naggar AK. 2006. Clear cell hidradenoma of the skin—a third tu-mor type with a t(11;19)-associated TORC1-MAML2 genefusion: Genes Chromosomes Cancer. 2005;43:202–205. Adv AnatPathol 13:80–82.

El-Naggar AK, Lovell M, Killary AM, Clayman GL, Batsakis JG.1996. A mucoepidermoid carcinoma of minor salivary gland witht(11;19)(q21;p13.1) as the only karyotypic abnormality. CancerGenet Cytogenet 87:29–33.

Enlund F, Behboudi A, Andren Y, Oberg C, Lendahl U, Mark J,Stenman G. 2004. Altered Notch signaling resulting from expres-sion of a WAMTP1-MAML2 gene fusion in mucoepidermoid car-cinomas and benign Warthin’s tumors. Exp Cell Res 292:21–28.

Eveson JW, Cawson RA. 1986. Warthin’s tumor (cystadenolym-phoma) of salivary glands. A clinicopathologic investigation of 278cases. Oral Surg Oral Med Oral Pathol 61:256–262.

Foschini MP, Malvi D, Betts CM. 2005. Oncocytic carcinoma arisingin Warthin tumour. Virchows Arch 446:88–90.

Gadient SE, Kalfayan B. 1975. Mucoepidermoid carcinoma arisingwithin a Warthin’s tumor. Oral Surg Oral Med Oral Pathol 40:391–398.

Gallo O. 1995. New insights into the pathogenesis of Warthin’stumour. Eur J Cancer B Oral Oncol 31:211–215.

Honda K, Kashima K, Daa T, Yokoyama S, Nakayama I. 2000. Clo-nal analysis of the epithelial component of Warthin’s tumor. HumPathol 31:1377–1380.

Hrynchak M, White V, Berean K, Horsman D. 1994. Cytogeneticfindings in seven lacrimal gland neoplasms. Cancer Genet Cyto-genet 75:133–138.

Johansson M, Mandahl N, Johansson L, Hambraeus G, Mitelman F,Heim S. 1995. Translocation 11;19 in a mucoepidermoid tumor ofthe lung. Cancer Genet Cytogenet 80:85–86.

Lewis PD, Baxter P, Paul Griffiths A, Parry JM, Skibinski DO. 2000.Detection of damage to the mitochondrial genome in the onco-cytic cells of Warthin’s tumour. J Pathol 191:274–281.

Maiorano E, Lo Muzio L, Favia G, Piattelli A. 2002. Warthin’stumour: A study of 78 cases with emphasis on bilaterality, multifo-cality and association with other malignancies. Oral Oncol 38:35–40.

Mark J, Dahlenfors R, Stenman G, Nordquist A. 1989. A humanadenolymphoma showing the chromosomal aberrations del(7)(p12p14-15) and t(11;19)(q21;p12-13). Anticancer Res 9:1565–1566.

Mark J, Dahlenfors R, Stenman G, Nordquist A. 1990. Chromo-somal patterns in Warthin’s tumor. A second type of human be-nign salivary gland neoplasm. Cancer Genet Cytogenet 46:35–39.

Martins C, Fonseca I, Roque L, Soares J. 1997. Cytogenetic charac-terisation of Warthin’s tumour. Oral Oncol 33:344–347.

Martins C, Cavaco B, Tonon G, Kaye FJ, Soares J, Fonseca I. 2004.A study of MECT1-MAML2 in mucoepidermoid carcinoma andWarthin’s tumor of salivary glands. J Mol Diagn 6:205–210.

Mitelman F, Johansson B, Mertens F. 2007. The impact of transloca-tions and gene fusions on cancer causation. Nat Rev Cancer7:233–245.

Nagao T, Sugano I, Ishida Y, Tajima Y, Furuya N, Kondo Y, NagaoK. 1998. Mucoepidermoid carcinoma arising in Warthin’s tumourof the parotid gland: Report of two cases with histopathological,ultrastructural and immunohistochemical studies. Histopathology33:379–386.

Nordkvist A, Gustafsson H, Juberg-Ode M, Stenman G. 1994.Recurrent rearrangements of 11q14-22 in mucoepidermoid carci-noma. Cancer Genet Cytogenet 74:77–83.

Okabe M, Miyabe S, Nagatsuka H, Terada A, Hanai N, Yokoi M,Shimozato K, Eimoto T, Nakamura S, Nagai N, Hasegawa Y, Ina-gaki H. 2006. MECT1-MAML2 fusion transcript defines a favor-able subset of mucoepidermoid carcinoma. Clin Cancer Res12:3902–3907.

Onder T, Tiwari RM, van der Waal I, Snow GB. 1990. Malignantadenolymphoma of the parotid gland: Report of carcinomatoustransformation. J Laryngol Otol 104:656–661.

Ruebner B, Bramhall JL. 1960. Malignant papillary cystadenomalymphomatosum. Report of a case, with a brief review of the liter-ature. Arch Pathol 69:110–117.

Seifert G. 1997. Bilateral mucoepidermoid carcinomas arising inbilateral pre-existing Warthin’s tumours of the parotid gland. OralOncol 33:284–287.

Seifert G, Hennings K, Caselitz J. 1986. Metastatic tumors to the pa-rotid and submandibular glands—Analysis and differential diag-nosis of 108 cases. Pathol Res Pract 181:684–692.

Sobrinho-Simoes M, Maximo V. 2006. Warthin’s tumour. VirchowsArch 448:877–878.

Sobrinho-Simoes M, Maximo V, Castro IV, Fonseca E, Soares P, Gar-cia-Rostan G, Oliveira MC. 2005. Hurthle (oncocytic) cell tumorsof thyroid: Etiopathogenesis, diagnosis and clinical significance.Int J Surg Pathol 13:29–35.

Stenman G. 2005. Fusion oncogenes and tumor type specificity—Insights from salivary gland tumors. Semin Cancer Biol 15:224–235.

Stenman G, Petursdottir V, Mellgren G, Mark J. 1998. A child with at(11;19)(q14-21;p12) in a pulmonary mucoepidermoid carcinoma.Virchows Arch 433:579–581.

Takezawa K, Jackson C, Gnepp DR, King TC. 1998. Molecularcharacterization of Warthin tumor. Oral Surg Oral Med OralPathol Oral Radiol Endod 85:569–575.

Teymoortash A, Werner JA. 2005. Tissue that has lost its track: War-thin’s tumour. Virchows Arch 446:585–588.

Teymoortash A, Krasnewicz Y, Werner JA. 2006. Clinical features ofcystadenolymphoma (Warthin’s tumor) of the parotid gland: A ret-rospective comparative study of 96 cases. Oral Oncol 42:569–573.

Therkildsen MH, Christensen N, Andersen LJ, Larsen S, KatholmM. 1992. Malignant Warthin’s tumour: A case study. Histopathol-ogy 21:167–171.

Tirado Y, Williams MD, Hanna EY, Kaye FJ, Batsakis JG, El-NaggarAK. 2007. CRTC1/MAML2 fusion transcript in high grademucoepidermoid carcinomas of salivary and thyroid glands andWarthin’s tumors: Implications for histogenesis and biologicbehavior. Genes Chromosomes Cancer 46:708–715.

Tonon G, Modi S, Wu L, Kubo A, Coxon AB, Komiya T, O’Neil K,Stover K, El-Naggar A, Griffin JD, Kirsch IR, Kaye FJ. 2003.t(11;19)(q21;p13) translocation in mucoepidermoid carcinoma cre-ates a novel fusion product that disrupts a Notch signaling path-way. Nat Genet 33:208–213.

Williamson JD, Simmons BH, El-Naggar A, Medeiros LJ. 2000.Mucoepidermoid carcinoma involving Warthin tumor. A report offive cases and review of the literature. Am J Clin Pathol 114:564–570.

Winnes M, Enlund F, Mark J, Stenman G. 2006. The MECT1-MAML2 gene fusion and benign Warthin’s tumor: Is theMECT1-MAML2 gene fusion specific to mucoepidermoid carci-noma? J Mol Diagn 8:394–395.

Wu L, Liu J, Gao P, Nakamura M, Cao Y, Shen H, Griffin JD. 2005.Transforming activity of MECT1-MAML2 fusion oncoprotein ismediated by constitutive CREB activation. EMBO J 24:2391–2402.

Zhou S, Kachhap S, Sun W, Wu G, Chuang A, Poeta L, GrumbineL, Mithani SK, Chatterjee A, Koch W, Westra WH, Maitra A,Glazer C, Carducci M, Sidransky D, McFate T, Verma A, CalifanoJA. 2007. Frequency and phenotypic implications of mitochon-drial DNA mutations in human squamous cell cancers of the headand neck. Proc Natl Acad Sci USA 104:7540–7545.

Genes, Chromosomes & Cancer DOI 10.1002/gcc

314 BELL ET AL.