búsqueda de péptidos antimicrobianos nuevos en secreciones
TRANSCRIPT
1
Búsqueda de péptidos antimicrobianos nuevos en secreciones de piel de ranas
TESIS PRESENTADA AL DEPARTAMENTO DE CIENCIAS BIOLÓGICAS DE LA UNIVERSIDAD DE LOS ANDES COMO REQUISITO PARCIAL PARA
OPTAR AL TÍTULO DE DOCTOR EN CIENCIAS-BIOLOGÍA
CAROLINA MUÑOZ CAMARGO
Directora: HELENA GROOT, Directora del Laboratorio de Genética Humana,, Universidad de los Andes. Bogotá, Colombia.
Co-director: EDUARDO MITRANI, Universidad Hebrea de Jerusalén. Jerusalén, Israel.
Universidad de los Andes
Departamento de Ciencias Biológicas
Laboratorio de Genética Humana
Bogotá, D.C.
2015
2
AGRADECIMIENTOS
A mi familia
A la Dra. Helena Groot,
Eduardo Mitrani,
Ester Boix
Vivian Salazar
A los evaluadores
Al grupo del Laboratorio de Genetica Humana
Martha Vives
A las fuentes finaciadoras
Fundación Bolivar Davivienda, Labbrands, Facultad de Ciencias, proyecto semilla, fondo de Helena Groot.
3
Búsqueda de péptidos antimicrobianos nuevos en secreciones de piel de ranas
AGRADECIMIENTOS .............................................................................................. 2
Resumen .................................................................................................................. 7
1. Introducción .......................................................................................................... 9
2. Planteamiento del problema y justificación ........................................................ 12
3. Estado del arte y marco teórico .......................................................................... 14
3.1. Situación de resistencia de microorganismo patógenos a los antibióticos .. 14
3.2. Generalidades de péptidos antimicrobianos ................................................ 16
3.3. Clasificación de los péptidos antimicrobianos .............................................. 17
3.4. Mecanismos de acción de los péptidos antimicrobianos ............................. 19
3.4.1. Modelo de barril ..................................................................................... 20
3.4.2. Modelo de poro toroidal ......................................................................... 21
3.4.3. Modelo de alfombra ............................................................................... 21
3.4.4. Blancos intracelulares ............................................................................ 21
3.5. Mecanismos de resistencia a PAM en bacterias ......................................... 22
3.5.1.Remodelamiento de superficie ............................................................... 22
3.5.2. Biofilms .................................................................................................. 23
3.5.3. Degradación proteolítica ........................................................................ 23
3.6. Péptidos antimicrobianos de anfibios ........................................................... 24
3.6.1. Estructura de las glándulas granulares o serosas ................................. 24
3.6.2. Estructura génica de los PAM de anfibios ............................................ 25
3.7. Obtención de secreciones de piel de ranas in vivo ...................................... 26
3.8. Obtención de secreciones in vitro ................................................................ 27
3.8.1 Cultivo de micro-órganos y sus propiedades .......................................... 27
4
3.9. Estrategias para identificación de péptidos .................................................. 27
4.Objetivo General .................................................................................................. 29
4.1.Objetivos Específicos ....................................................................................... 29
5. Capítulo 1 ........................................................................................................... 30
5.1 Resumen .......................................................................................................... 30
5.2.Conclusiones capítulo 1 ................................................................................... 31
6. Capítulo 2 ........................................................................................................... 32
6.1. Resumen ......................................................................................................... 32
6.4.Conclusiones capítulo 2 ................................................................................... 33
7. Conclusiones Generales .................................................................................... 34
8. Referencias ........................................................................................................ 35
9. Anexo 1. Tabla de especies de ranas colectadas .............................................. 43
10. Productos adicionales ...................................................................................... 44
10.1 Codirección de trabajos .............................................................................. 44
7
Búsqueda de péptidos antimicrobianos nuevos en secreciones de piel de ranas
Resumen La piel de las ranas es la primera línea de defensa contra patógenos y
depredadores. Las secreciones que produce la piel de estos organismos son una
fuente de péptidos con amplio espectro de actividades antimicrobianas que
pueden ser desarrollados en agentes con potencial terapéutico. En este grupo de
investigación se ha utilizado la técnica de cultivo de micro-órganos (MOs) para la
obtención in vitro de las secreciones de piel de 49 especies de ranas, la cual ha
demostrado ser una forma efectiva de obtener cantidades suficientes de
secreciones para el análisis de actividad, la identificación y la caracterización de
péptidos antimicrobianos. Al utilizar estas sustancias secretadas en el medio de
cultivo, denominadas Medios Condicionados (MC), se encontró actividad contra
bacterias Gram positivas y Gram negativas, y contra el virus de la fiebre amarilla,
sin ser tóxicos para células somáticas. A partir de estos resultados y por medio de
técnicas como MS/MS, RACE-PCR, y métodos bioinformáticos, se seleccionaron
siete péptidos candidatos nuevos y la buforina II, todos ellos identificados a partir
de los MC y MOs de varias especies de ranas colombianas. Se sintetizaron los
siete candidatos y la buforina II, y se realizó una caracterización biológica de estos
en mezcla para determinar su efecto citotóxico en diferentes líneas celulares, y su
actividad antimicrobiana contra cepas de bacterias de referencia de Escherichia
coli, Sthaphylococcus aureus, Pseudomonas aeruginosa (PA01y PA14). En cuanto
a su actividad individual, se encontró que tres de los ocho péptidos candidatos
inhiben el crecimiento de las cepas evaluadas y los otros cinco péptidos
candidatos presentaron una baja actividad antibacteriana. A partir de estos
resultados se realizó la caracterización biofísica de los dos candidatos nuevos, el
primero, se identificó a partir de MOs de la rana Phyllomedusa bicolor y
relacionado con la familia de las Dermaseptinas (AL). El segundo, se identificó a
8
partir de MOs de la rana Sphaenorhynchus lacteus, relacionado con péptidos
pertenecientes a las frenatinas y denominado Frenatina 2.3 S (F 2.3S). Éste fue
reportado por primera vez por nuestro grupo de investigación (Laboratorio de
Genética Humana de la Universidad de los Andes), en el Genbank (número de
acceso: AGB51284. El tercero, la buforina II se identificó previamente en una rana
del genero Bufo y en éste trabajo se identificó a partir de MOs de la rana
Sphaenorhynchus lacteus. Para los dos candidatos nuevos se confirmó la
estructura de α-hélice con dicroísmo circular. En cuanto a la buforina II, reportes
previos, indican que inhibe el crecimiento de las bacterias E. coli, S. aureus, y su
mecanismo de acción no involucra rompimiento de membranas citoplasmáticas, lo
cual también pudimos confirmar en este trabajo. Para el péptido F2.3S se encontró
que presenta mayor actividad que la buforina II contra bacterias Gram negativas y
su mecanismo de acción está relacionado con la despolarización de la membrana
citoplasmática y posterior lisis. Por último, el péptido AL resultó ser menos potente
que el péptido frenatina 2.3S y la buforina II, y su mecanismo de acción al parecer
no despolariza ni rompe la membrana de forma significativa.
En resumen en éste trabajo se determinó que el cultivo de MOs, es una
herramienta útil para obtener secreciones de piel de ranas (Medios
Condicionados), determinar su actividad antimicrobiana y a partir de estas
caracterizar los péptidos antimicrobianos presentes. A partir de MOs y Medios
Condicionados de las especies con mejores resultados antimicrobianos, se
identificaron ocho péptidos, siete de estós candidatos nuevos para la ciencia y la
buforina II reportada anteriormente. Para estos ocho péptidos se encontró que en
combinación presentan actividad potente contra cepas de referencia de
Pseudomonas aeruginosa. Además, tres de los ocho péptidos evaluados de forma
individual fueron activos contra bacterias Gram+ y Gram-.
9
1. Introducción Los anfibios ocupan un amplio rango de hábitats y condiciones ecológicas para lo
cual fueron necesarias diferentes adaptaciones fisiológicas, morfológicas,
bioquímicas y de comportamiento. La piel de los anfibios representa una de estas
adaptaciones y sobresale como un órgano complejo con funciones físico-químicas
vitales para estos organismos. Entre las más importantes están la respiración,
osmorregulación y defensa1.
Por esta razón, la piel de los anfibios tiene unas características especiales, como
el presentar varios tipos de glándulas, entre ellas las mucosas y las granulares.
Las glándulas mucosas se encargan de evitar la desecación por pérdida de agua y
prevenir daño mecánico. Las glándulas granulares, por su parte, generan gran
interés porque son las encargadas de sintetizar un amplio rango de moléculas que
protegen la rana de los depredadores y de la invasión de microorganismos2.
Esta protección se basa en la producción de aminas biogénicas (anestésicos,
paralizantes), alcaloides (la mayoría en dendrobátidos o ranas venenosas),
esteroides (bufogeninas y bufotoxinas) y péptidos antimicrobianos (PAM, en
inglés “AMPs”)1,2. Los últimos, son codificados en el genoma, pueden almacenarse
en altas concentraciones y estar disponibles para actuar inmediatamente exista
contacto con microorganismos3.
El número y diversidad de los PAM en las secreciones de piel de las ranas es
sorprendentemente alto y de acuerdo con esto en el 20034 se proyectaba que
5000 especímenes de ranas existentes podrían producir aproximadamente
100000 PAM diferentes. Teniendo en cuenta esta hipótesis y de acuerdo con los
PAM de ranas reportados (1050 secuencias) en la base de datos “Collection of
Antimicrobial Peptides” (CAMP)5 la investigación en este campo es todavía
incipiente. En Colombia, por ejemplo, en donde se reporta el 10% del total de
anfibios del mundo6 7 es un área de investigación poco explorada que tiene un alto
potencial para aplicación en diferentes campos de la salud. Especialmente en el
relacionado con búsqueda de nuevos agentes antimicrobianos, teniendo en cuenta
10
el desarrollo de resistencia a medicamentos, no solo de bacterias sino también de
virus, parásitos y hongos 8.
En este grupo de investigación se implementó una metodología9,10para obtener las
secreciones de la piel de las ranas. Esta técnica está basada en la preparación de
fragmentos de órganos, que preservan el microambiente encontrado por las
células epiteliales in vivo, con una geometría y dimensiones del fragmento de piel
que aseguran la apropiada difusión de nutrientes y gases entre las células
cultivadas. Estos fragmentos se llaman micro-órganos (MOs), para distinguirlos de
otros tejidos que no presentan la estructura y función de un órgano verdadero en
una escala microscópica.
La aproximación metodológica de este trabajo se divide en cuatro capítulos. El
primero comprende la implementación de la técnica de micro-órganos de piel
(SMOs del inglés skin micro-organs), para obtener las secreciones de varias
especies de ranas y la posterior confirmación de que éstos transcriben genes de
PAM. Así mismo, se evaluó la actividad de estas secreciones contra bacterias
Gram positivas y Gram negativas, al igual que con diferentes líneas celulares
somáticas.
En el segundo capítulo, se muestran los resultados de la actividad protectora de
las secreciones de diferentes especies de ranas contra la cepa vacunal del virus
de la fiebre amarilla (YFV), resultados que indican que las secreciones de la rana
Sphaenorhynchus lacteus, confieren una alta protección contra la entrada del virus
de la fiebre amarilla. Por esta razón, se realizó una caracterización de las
secreciones de ésta rana por medio de la técnica de RACE-PCR, con la cual se
identificó un péptido antimicrobiano nuevo (Número de acceso: AGB51284.1),
relacionado con la familia de las frenatinas. Finalmente, se evaluó la actividad
citotóxica y antiviral de este péptido.
En el tercer capítulo, se presentan los resultados de la identificación de siete
péptidos candidatos nuevos y la buforina II. Éste último péptido identificado
anteriormente a partir de tejido estomacal en Bufo bufo gargarizans11 y en este
11
trabajo por primera vez identificado en piel de S. lacteus. Estos péptidos fueron
obtenidos por espectrometría de masas MS/MS, a partir de las secreciones de las
ranas con mejores resultados experimentales contra bacterias y escogidos por sus
características por medio de un análisis bioinformático a partir de una lista original
de 70 candidatos. Así mismo, se evaluó la actividad citotóxica de estos ocho
péptidos, en combinación y por separado, para determinar y comparar su efecto
en células somáticas. Además, se determinó su actividad contra bacterias de
cepas de referencia (E. coli, S. aureus, P. aeruginosa).
Por último, en el cuarto capítulo, se muestran los resultados de la caracterización
biofísica de los péptidos candidatos más potentes: buforina II, F2.3S y AL. Se
realizaron ensayos de despolarización de la membrana citoplasmática de E. coli,
rompimiento de membrana y modelos de membranas basadas en liposomas para
estos tres péptidos. Además, se determinó la capacidad de agregación de estos
candidatos con el uso de metodologías como actividad mínima aglutinadora y
agregación por dispersión dinámica de luz; y su estructura secundaria por medio
de dicroísmo circular.
12
2. Planteamiento del problema y justificación Desde el origen de las bacterias hace aproximadamente 3500 millones de años,
estas han co-evolucionado con antibióticos naturales presentes en su ambiente.
Contrario a la creencia común de que la exposición a estos está confinada a la era
de los antibióticos, existen evidencias que sugieren que los genes de resistencia
han estado presentes en las bacterias desde antes de la era antibiótica12. Por
ejemplo se han encontrado trazas de tetraciclina en esqueletos humanos que
datan de los años 350-550 EC (era común). Este hecho solo puede ser explicado
después de la exposición a materiales que contienen tetraciclina en la dieta de
estas personas antiguas. El hallazgo de tetraciclina en los huesos se explica
porque éste es el único antibiótico que es un agente quelante y que además se
incorpora en el conocido mineral de los huesos, hidroxiapatita, presente también
en los dientes. Por esta razón rastrear otros antibióticos en poblaciones antiguas
es mucho más difícil12.
Por su parte, en el establecimiento de la era antibiótica se introdujo el uso de la
penicilina en 1940, descubierta dos décadas antes por Alexander Fleming, quien
advirtió del potencial desarrollo de resistencia a la penicilina si era utilizada en
pocas cantidades y por corto tiempo13. La penicilina es el ejemplo más común de
un antibiótico, cuya definición es la de una droga capaz de matar o detener el
crecimiento bacteriano14. El periodo entre 1950 y 1970 fue la época dorada en el
descubrimiento de nuevos antibióticos, pero desde entonces esta área de
investigación se ha centrado en la modificación de las clases existentes de
antibióticos para combatir las infecciones producidas por patógenos emergentes y
re-emergentes 15. El problema de la resistencia y multi-resistencia bacteriana a los
antibióticos disponibles es a nivel mundial, los datos para los Estados Unidos,
indican que cada año, se infectan con bacterias resistentes 2 millones de personas
y mueren 23000 por causa directa de estas infecciones14. A esto se suma, el
sobrecosto que genera al sistema de salud, el cual se estima es de 1.5 billones de
dólares cada año12. De acuerdo con esto, las opciones de tratamiento para
infecciones existentes o multiresistentes son limitadas y como resultado aumentan
13
las tasas de morbilidad y mortalidad.
Las alternativas que se contemplan como promisorias para enfrentar este
problema de salud pública, son la fagoterapia16 y la exploración de compuestos
producidos por plantas y animales17. En este sentido, los esfuerzos de este grupo
de investigación están centrados en la búsqueda de péptidos antimicrobianos
(PAM) secretados por la piel de ranas. Según datos oficiales del Instituto Von
Humbolt 6,7,Colombia posee el 10% de la biodiversidad de especies de anfibios del
mundo y se ha reportado por diversos autores que las secreciones secreciones
de estos organismos son una fuente importante de PAM, que actúan en conjunto
confiriéndole a la rana protección contra bacterias, hongos y virus 18,19. Teniendo
en cuenta esto, existen altas probabilidades de encontrar nuevas moléculas con
actividad antimicrobiana, que ayuden a contrarestar el problema creciente de la
resistencia a los antibióticos convencionales.
La línea de investigación enfocada en la búsqueda de antimicrobianos secretados
por la piel de diferentes especies de ranas colombianas, tuvo su inicio con el
convenio entre el Laboratorio de Genética Humana de la Universidad de los
Andes, y el Laboratorio Cell and Developmental biology de la Universidad Hebrea
de Jerusalén. En el marco de esta colaboración se implementó la técnica de
cultivo de micro-órganos, descrita por el profesor Eduardo Mitrani10, para la
obtención de las secreciones de piel de ranas in vitro. La utilización de esta
técnica con piel de ranas, ha demostrado ser una forma efectiva de obtener
cantidades suficientes de secreciones para análisis de actividad, identificación y
caracterización de PAM.
14
3. Estado del arte y marco teórico
3.1. Situación de resistencia de microorganismo patógenos a los antibióticos
La penicilina fue descubierta por Alexander Fleming en 1928, y en 1940, varios
años antes de la introducción de esta como tratamiento contra infecciones, se
identificaron las penicilasas, enzimas también llamadas β-lactamasas que
disminuyen la eficiencia del antibiótico20. Lo interesante de estos hallazgos y que
concuerda con recientes descubrimientos es que se ha demostrado la presencia
de numerosos genes de resistencia a antibióticos y que además, ahora se
encuentra que estos son componentes naturales de las poblaciones bacterianas.
Lo cual es indicativo de que los genes de resistencia han estado presentes a lo
largo de la evolución13. De acuerdo con esto, en la tabla 1 se muestra una
compilación de antibióticos y sus mecanismos de resistencia.
En el caso de la estreptomicina, esta fue introducida especialmente para el
tratamiento de tuberculosis en 1944, sin embargo, desde entonces se empezaron
a reportar casos de resistencia y por ello fue necesaria la combinación de varios
antibióticos (isoniazida, rifapentina, pirazinmide, estreptomicina o etambutol) para
esta infección. A pesar de ello, Mycobacterium tuberculosis es uno de los
patógenos comúnmente asociados con multiresistencia (multidrug resistsnt MDR)
y que representa un problema grave en salud pública13.
15
Tabla modificada de 13,21,22,23,24,25
Con respecto a la resistencia el European Centre for Disease Prevention and
Control (ECDC) en colaboración con el Centers for Disease Control and
Prevention (CDC), han catalogado los microorganismos de acuerdo con su perfil
de resistencia de la siguiente manera. Microorganismos multiresistentes (MDR)
son aquellos que presentan resistencia a tres o más clases de antibióticos26.
Resistencia extrema (extensively drug-resistant XDR), cuando el microorganismo
presenta resistencia a todos los antibióticos de primera línea y al menos a tres de
16
la segunda línea y panresistencia (pandrug resistant PDR), cuando los
mircoorganismos son resistentes a todos los antimicrobianos disponibles26.
Por otro lado, dentro de los patógenos considerados de alto interés en salud
pública por su prevalencia están las bacterias Gram positivas como Enteroccocus
resistentes a vancomicina (VRE) y Staphyloccocus aureus resistentes a meticilina
(MRSA) y las Gram negativos en la lista ESKAPE (Enterococcus faecium,
Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumanii,
Pseudomonas aeruginosa y especies de Enterobacter) y representan un gran reto
a la hora de su tratamiento27. En el caso de las bacterias VRE y MRSA
recientemente se aprobó el uso de Synercid y daptomicina22. Sin embargo para las
bacterias Gram negativas no se aprueban nuevos antibióticos hace décadas.
Como consecuencia se han empezado a utilizar medicamentos como colisitin
(polimixina) como de primera línea, aun cuando este medicamento fue catalogado
como muy tóxico hace 40 años, cuando fue decubierto28. Además, datos de la
Food and Drug Administration (FDA) de Estados Unidos entre el 2013 y el 2016 se
han aprobado para su uso seis antibióticos (Ceftazidime+avibactam, dalbavancin,
oritavancin, cestalozane+tazobactam, telavancin y bedaquiline), la mayoría
antibióticos existentes (lipopeptidos) con modificaciones y otros combinaciones de
cefalosporinas con inhibidores de β-lactamasas29.
3.2. Generalidades de péptidos antimicrobianos
Una amplia variedad de organismos producen péptidos antimicrobianos (PAM)
como parte de su primera línea de defensa 30,31. Los PAM han sido aislados de
microorganismos, hongos, insectos y otros invertebrados, plantas, anfibios, aves,
peces y mamíferos, incluyendo humanos. En las bases de datos especializadas
como Antimicrobial peptide database (APD)32 y Collection of antimicrobial peptides
(CAMP)5,33 se reportan cientos de péptidos relacionados con el sistema inmune
innato. Sus características más relevantes es que son cortos (12 a 100
aminoácidos), están cargados positivamente (carga neta de +2 a +9), son
17
anfipáticos (cara hidrofílica externa y cara hidrofóbica interna) y, en la mayoría de
los casos, presentan una hidrofobicidad mayor al 30% 31.
La expresión de estos PAM puede ser constitutiva o inducible por estímulo de
infección o un estímulo inflamatorio, como el generado por citocinas
proinflamatorias, bacterias o moléculas de bacterias que inducen la innmunidad
innata, por ejemplo lipopolisacáridos (LPS)31. Algunos de estos péptidos son
potentes agentes antimicrobianos que actúan directamente contra el
microorganismo y otros han sido descritos como moléculas efectoras del sistema
inmune innato. Son capaces de promover fagocitocis, estimular la liberación de
prostaglandinas, neutralizar los efectos sépticos de los LPS y promover el
reclutamiento y acumulación de células que intervienen en la respuesta
inflamatoria, promover angiogénesis e inducir cicatrización34.
Los PAM se sintetizan principalmente en tejidos epiteliales regularmente
expuestos al ataque microbiano como la piel, intestino y pulmones. Si
comparamos los PAM con las inmunoglobulinas se puede decir que los PAM se
sintetizan cien veces más rápido que la inmunoglobulinas y a menor costo
metabólico, pueden almacenarse a altas concentraciones, estar disponibles para
actuar inmediatamente y se liberan o producen cuando células especializadas se
estimulan por contacto con un amplio espectro de microorganismos 35.
3.3. Clasificación de los péptidos antimicrobianos
La gran mayoria de PAM son péptidos catiónicos, los cuales se dividen en tres
clases. La primera clase compuesta por peptidos lineares α-hélice, la segunda
clase compuesta por péptidos de un aminoacido específico (prolina, arginina y
otros residuos) y la tercera clase que incluye a los péptidos que tienen residuos de
cisteinay forma puentes disulfuro y láminas β (Tabla 2).
3.3.1. Péptidos antimicrobianos α-hélice: para este grupo se han descrito PAM de
diferentes origenes entre ellos: las magaininas (rana), dermaseptinas (rana) y las
cecropinas (plantas),. Estos PAM no contienen cisteína y en sistemas acuosos
presentan una estructura desordenada pero adoptan una conformación α-hélice
18
en solventes orgánicos como trifluoroetanol R (reproduce las condiciones
hidrofóbicas de la membrana), lo cual explica su acción a nivel de membrana. La
hélice representa una superficie hidrofóbica y otra altamente positiva que permite
la interacción con los lípidos de la membrana 36.
Tomado y modificado de 37,38
3.3.2. Péptidos antimicrobianos ricos en cisteína: un gran número de PAM
contienen residuos de pares de cisteínas que son oxidados para formar puentes
disulfuro internos. Estos péptidos que contienen cisteiínas pueden formar
estructuras de lámina-β en solución38. A este grupo pertenecen las defensinas
(vertebrados, plantas e insectos), las cuales se agrupan en varias clases según la
localización de los pares de cisteína, estructura tridimensional y similitud de
secuencias. Dependiendo del número de residuos de cisteína (la mayoría entre 2 y
8) y sus pares estos péptidos pueden adoptar conformación de lámina-β con triple
cadena (estructura de la mayoría de las defensinas de vertebrados) u Horquilla- β
“β-hairpin like” (por ejemplo thanatinas en artrópodos, brevininas y esculetinas de
anfibios) o la mezcla de la estructura hélice-α / lámina-β presente en defensinas
19
de invertebrados, defensinas de plantas y defensinas de algunos mamíferos 36,38
(Tabla 3).
3.3.3. Péptidos antimicrobianos con alto contenido de un aminoácido: tienen una
alta concentración del mismo aminoácido, el cual puede ser triptófano, prolina o
histidina, como se presenta en las apidaecina, abaecina y otras. Su estructura
presenta diferentes patrones de soluciones acuosas, pero se vuelven estables en
presencia de fosfolípidos 38
3.4. Mecanismos de acción de los péptidos antimicrobianos
El mecanismo de acción clásico de los PAM involucra su habilidad para causar
daño a nivel de membrana. Los PAM pueden interactuar con microorganismos por
fuerzas electrostáticas entre la carga positiva de sus aminoácidos y las cargas
negativas de la superficie de la membrana. Se ha sugerido que precisamente la
composición de la superficie de las membranas es la encargada de dar la
especificidad de los PAM. En este caso la sensibilidad de las células, tanto
procariotas como eucariotas, está dada directamente por las propiedades
fisicoquímicas de los lípidos que se encuentran en ambos tipos de membranas39.
Por ejemplo, en membranas de mamíferos, los lípidos más comunes en la cara
extracelular de la bicapa son fosfolípidos neutros, como la fosfatidilcolina y la
20
esfingomielina. En las bacterias en cambio, la membrana está esencialmente
compuesta por lípidos de carga negativa, tales como fosfatidilglicerol (PG),
cardiolipina y zwiteriones como el fosfatidiletanolamina (PE)37.Además, las
bacterias Gram negativas tienen lipopolisacáridos (LPS) en su membrana externa
y las bacterias Gram positivas presentan polisacáridos ácidos (ácido teicoico y
teicuronico) en la pared celular, que también están involucrados en la interacción
con los PAM. Se ha demostrado que la carga total negativa de las membranas
bacterianas tiene un papel importante en la unión de los PAM a estos
microorganismos 37.
Aunque se desconocen muchos detalles sobre los mecanismos de acción de los
PAM α-hélice, como las dermaseptinas, se considera que actúan directamente
sobre la membrana celular y que su secuencia de aminoácidos es importante, ya
que, si se sustituyen aminoácidos que alteren la polaridad del péptido, su actividad
disminuye.39.
Los mecanismos por los cuales los PAM pueden atravesar las membranas
microbianas no son comunes para todos los péptidos y dependen de propiedades
moleculares tanto de los péptidos como de los lípidos de la membrana. Los PAM
pueden inducir diferentes daños en las membranas, entre ellos, formación de
poros, separación de fases, disrupción de la membrana lipídica y formación de
micelas 40. Se han propuesto algunos modelos que pueden explicar la disrupción
de membranas por la interacción con PAM, entre ellos el modelo de barril (barrel-
stave), el modelo de poro toroidal (toroidal pore) y el modelo de alfombra
(carpet)37(Figura 1).
3.4.1. Modelo de barril Este sugiere que los péptidos forman un poro transmebranal por la inserción
directa en la bicapa lipídica. En este modelo los péptidos se unen a la membrana
como monómeros, que luego se agregan y forman un poro transmembranal
similiar a un barril sin fondo cuyas paredes son los péptidos helicoidales. El
reclutamiento adicional de monómeros aumenta el tamaño del poro, permitiendo
que el contenido citoplasmático se libere, ocurra pérdida del equilibrio osmótico y
21
pérdida del potencial de membrana que lleva finalmente a la muerte celular37. Los
péptidos se agregan y se insertan en la bicapa de modo que las regiones
hidrofóbicas de los péptidos se alinean con la región lipídica de la membrana,
dejando regiones hidrofílícas hacia el lumen central. En este modelo, las
estructura secundarias, tales como α-hélice y β-láminas39 son esenciales para la
formación del poro.
3.4.2. Modelo de poro toroidal Un toroide se define como una superficie generada por una curva cerrada al girar
alrededor de un eje contenido en su plano y que no la corta. En el modelo de poro
toroidal, los péptidos unidos se agregan y se insertan e inducen la monocapa de
lípidos a curvarse a través del poro, de modo que las regiones polares de ambas
capas de la membrana se unen. A diferencia del modelo anterior, se forma un
canal mixto por las cabezas polares de los lípidos de membrana y por lo péptidos
insertados en ella. Este tipo de mecanismo ha sido encontrado en péptidos como
Magainina (rana) y Mellitina (abeja)40.
3.4.3. Modelo de alfombra En este modelo, los péptidos se acumulan cubriendo la superficie de la membrana
como una alfombra, afectando la arquitectura de ésta y actuando como un
detergente. Los péptidos no se insertan en la membrana sino que se asocian con
la cara externa y cuando alcanzan una concentración crítica, interrumpen la
continuidad de la membrana mediante sus regiones hidrofóbicas y la desintegran
formando micelas4,41.
3.4.4. Blancos intracelulares Aunque la mayoría de los péptidos interactúan directamente con los lípidos de la
membrana, recientemente se ha propuesto que pueden existir otros mecanismos
diferentes a los de la disrupción de la membrana y lisis celular. Muchas evidencias
indican que algunos PAM pueden intervenir directamente con blanco intracelular,
lo cual afecta la viabilidad de las bacterias. Las bacteriocinas, son un ejemplo de
lantibióticos que intervienen en la síntesis de la pared celular y la buforina II se ha
visto interrumpe la síntesis de ADN y proteínas, sin romper la membrana37.
22
Figura 1. Resumen del amplio espectro de interacciones asociadas a los PAM.
Mecanismos de acción y de resistencia a PAM. Imagen tomada de y editada de40 .
3.5. Mecanismos de resistencia a PAM en bacterias
Aunque menos frecuente que los antibióticos convencionales ya se reporta
resistencia de bacterias patógenas a PAM, se ha visto que estas bacterias han
desarrollado estrategias naturales e inducidas de resistencia a AMP como
resultado de la co-evolución de los PAM y las bacterias42.En general, una bacteria
resistente a un PAM ha desarrollado múltiples estrategias que normalmente son
controladas por respuestas coordinadas de estrés y reguladas por operones. Las
más comunes involucran el cambio en la superficie celular de la bacteria y el
bloqueo de la entrada del PAM39 A continuación los diferentes mecanismos de
resistencia reportados para PAM.
3.5.1.Remodelamiento de superficie Esto ocurre cuando las bacterias Gram negativas y Gram positivas modifican los
componentes de la pared celular para reducir la carga neta negativa de la
superficie. Las bacterias Gram negativas enmascaran la carga negativa de lípido
23
LPS adicionando un grupo amino y las bacterias Gram positivas utilizan la D-
alanilación para modificar los ácidos teicoicos43. En este tipo de mecanismo se
encuentra rigidez de la membrana S. aureus44 y su reacción a concentraciones
sub-letales de PAM como Magainin y Gramicidin; además de la formación de
cápsulas de polisacáridos K. pneumonie45 que le confieren resistencia a PAM
como defensin, lactoferrin y polimixin B. Otro ejemplo de resistencia es el que se
presenta en P. aeruginosa a polimixina B e indolicin mediado por sistemas
reguladores.
3.5.2. Biofilms Los biofilms son comunidades microbianas que consisten en células adheridas a
superficies bióticas o abióticas, embebidas en una matriz exo-polimérica. La
resistencia de estas estructuras a diversos químicos y a agentes antimicrobianos y
físicos es bien conocida y es una de las principales causas de infecciones
persistentes 39.
Se ha encontrado que uno de los componentes mayoritarios de la matriz
exopolimérica es ADN y éste, a su vez, se ha relacionado como un agente
quelante de cationes que induce resistencia en aminoglucósidos y PAM en P.
aeuroginosa. Además, se ha reportado que esta matriz puede generar cambios
conformacionales y agregación de los PAM46.
3.5.3. Degradación proteolítica En este mecanismo se ha observado que tanto bacterias Gram positivas como
Gram negativas producen peptidasas y proteasas que degradan PAM. Los
péptidos lineares son el principal blanco de este tipo de enzimas, debido a que los
sitios proteolíticos están más expuestos a clivaje39. Un ejemplo de este
mecanismo de resistencia lo presentan las bacterias patógenas P. aeruginosa,
Enterococcus faecalis, Proteus mirabilis, S. aureus y Staphyloccus pyogenes39.
3.5.4. Bombas de eflujo
Las bombas de eflujo son transportadores dependientes de energía que evitan la
entrada de compuestos tóxicos y es uno de los principales mecanismos de
24
resistencia de bacterias patógenas a diferentes clases de antibióticos. Este tipo de
mecanismo se ha reportado para S. aureus frente a el PAM tPMP-139.
3.6. Péptidos antimicrobianos de anfibios
3.6.1. Estructura de las glándulas granulares o serosas La estructura de la piel de los anfibios les confiere unas características especiales
comparadas con otros animales. De forma general, la piel está compuesta por
dos capas: la epidermis y la dermis. En la epidermis o “stratum corneum” se
encuentran localizadas varias capas de células encargadas del revestimiento; en
la dermis (capa interna) se localizan diferentes estructuras importantes como las
glándulas mucosas encargadas del equilibrio osmótico y respiración (evitan la
desecación)35. Las glándulas granulares neuroendocrinas (Figura 2) sintetizan y
almacenan componentes con actividad biológica entre ellos los PAM que tienen
función de defensa contra microorganismos y grandes depredadores47. El
contenido de estos péptidos puede ser liberado por estrés, estimulación
adrenérgica o cualquier herida, la liberación ocurre en la superficie de la piel de
las ranas. En la dermis también se encuentran los cromatóforos y el estrato
compacto35,38.
Figura 2. Sección dorsal de piel de Rana esculenta teñida con haematoxilina-eosina. 1)
Epidermis, 2) Cromátoforo, 3) glándula granular o serosas, 4) glándula mucosa (Tomado
de 35).
Las glándulas granulares son controladas por un mecanismo neurológico
simpático de axones con terminaciones en el intersticio entre el mioepitelio y las
1
3
2 4
25
unidades secretoras. Estas unidades son intradérmicas y formadas por células
sincitiales. En los anuros el citoplasma de las glándulas serosas es rico en
gránulos y el lumen esta reducido a una pequeña y vacía cavidad. La contracción
de los miocitos que rodean las glándulas causa una descarga sincronizada de su
contenido por un mecanismo de tipo holocrino, además de liberación de
fragmentos de citoplasma35.
3.6.2. Estructura génica de los PAM de anfibios El grado de polimorfismo de los PAM está asociado con la actividad
antimicrobiana que se requiera para el desarrollo de un anfibio en un entorno
específico.
El patrón diversificante del locus de los péptidos antimicrobianos puede ser parte
de una estrategia evolutiva desarrollada por los anfibios como resultado del
cambio a nuevos nichos ecológicos donde los agentes depredadores en este caso
los microorganismos tienen una tasa de mutación y cambio muy rápida. Este tipo
de selección diversificante es similar a la que ocurre en otro genes relacionados
con la inmunidad adquirida48.
Además, se ha determinado que la organización de las secuencias precursoras
de PAM tiene componentes característicos que son: una pre-proregión N-terminal
común, que es altamente conservada (incluso entre especies y familias), seguida
por un dominio C-terminal con diferencias marcadas que corresponde al péptido
maduro (Figura 3). La pre-proregión conservada se compone del péptido señal de
22 residuos, seguido por 16-25 residuos de la propieza ácida que termina con una
típica señal procesadora Lisina-Arginina. La alta similitud de las pre-proregiones
de precursores que dan origen a péptidos antimicrobianos muy diversos y en
diferentes especies de ranas sugiere que esos genes pertenecen a una familia
multigénica originada a partir de un ancestro común 49,50.
26
Figura 3. A) Esquema del gen codificante (ARNm) de Dermaseptina S de Phyllomedusa
sauvegi. Se compone de una región conservada entre péptidos de diferentes familias,
compuesta por el péptido señal (contenida en el primer exón) y la propieza ácida
(contenida en el segundo exón). El péptido antimicrobiano se localiza en el segundo exón
y es altamente variable, cuando se almacena en la glándula granular se separa de la
señal péptidica. B) alineamiento de las secuencias aminoácidos obtenidos a partir de
ADNc para las Dermaseptinas S1, S6, S8, S11, S12, S13 , S10 y S9 de piel de
Phyllomedusa sauvegi (Tomado y editado de 51).
De forma similar a lo que ocurre en otros PAM de origen animal, en los anfibios
son sintetizados como largos productos inactivos que después se convierten en un
producto final, por un proceso de clivaje proteolítico. Se ha demostrado que los
PAM originados en las glándulas granulares del género Rana y Bombina son
inducibles ya que se expresan en respuesta a exposiciones con microorganismos,
además se ha demostrado que sus regiones promotoras están reguladas por NF-
kB/Ik Bα los cuales están altamente conservados a lo largo de los diferentes phyla
desde insectos hasta mamíferos52.
3.7. Obtención de secreciones de piel de ranas in vivo
Las dos formas más utilizadas para obtener secreciones de piel de ranas son la
electroestimulación2,3 y la estimulación adrenérgica por medio de inyección
subcutánea53 para la liberación artificial del contenido de las glándulas a la
superficie de la piel. Por ejemplo, utilizando inyección de norepinefrina en
experimentos con Xenopus laevis se encontró que a mayor estimulación, mayor
27
cantidad de recuperación de péptidos54.Según estos autores, la recuperación y
producción de PAM puede variar entre una y seis semanas dependiendo del
método utilizado y la cantidad de estímulo recibido por la rana. Actualmente estás
dos metodologías son las más utilizadas para la obtención de secreciones de piel
de rana y su caracterización bioquímica.Sin embargo, para la confirmación de
PAM y estudios genómicos es necesario sacrificar el espécimen.
3.8. Obtención de secreciones in vitro
3.8.1 Cultivo de micro-órganos y sus propiedades Se ha observado que las interacciones específicas entre las células epiteliales y el
estroma, además de ser conservadas a través de la evolución, son críticas en la
determinación de la apropiada proliferación, diferenciación y función de cada tejido
epitelial. Se ha demostrado que fragmentos de órgano mantenidos in vitro que
mantengan un grosor (150 µm distancia entre células y medio de cultivo) que
permita que estas interacciones se mantengan, presentan una función normal del
órgano y fueron denominados como micro-órganos (MOs)10. En general, los MOs
pueden permanecer viables por varios meses y cumplir con las funciones celulares
del órgano del que son derivados. Por ejemplo, transcribir genes específicos,
llevar a cabo funciones metabólicas, mantener la proliferación celular del tejido55,56
y capacidad de secretar proteínas al medio de cultivo57. Por otro lado, se adaptó la
tecnología de cultivo de MOs de piel de rana para estudiar la actividad de las
secreciones obtenidas in vitro. Se encontró que comparado con las secreciones
obtenidas in vivo con inyección de norepinefrina las secreciones del cultivo de
MOs fueron más activas contra diferentes bacterias. Además, para estudios tanto
bioquímicos como genómicos se pueden utilizar las secreciones y los MOs
almacenados en el banco de sustancias y tejido9.
3.9. Estrategias para identificación de péptidos
Para la identificación y caracterización de proteínas en mezclas complejas se han
utilizado estrategias con tecnologías de alta resolución para la separación, entre
ellas espectrometría de masas, geles de electroforesis 2D (Two Dimensional
Electrophoresis), digestión con tripsina, fragmentación y secuenciación de
28
proteínas utilizando MS/MS (Tandem Mass Espectrometry) y posterior
identificación interrogando bases de datos58. La peptidómica, por su parte es una
disciplina derivada que recoge los principios básicos de la proteómica y está
enfocada en la caracterización de péptidos de bajo peso molecular. Esta no
requiere protocolos de fragmentación antes del análisis por MS, pero además
difiere en que la separación inicial se realiza por 2D-HPLC (Two Dimensional High
Performance Liquid Cromatography) en lugar de gel de electroforesis 2D. Sin
embargo, una de las limitantes de estas técnicas es que se necesita cantidad
considerable de muestra y no son eficientes en organismos con poca información
en las bases de datos59.
Con el fin de superar estas limitantes, se empezaron a utilizar técnicas como: MS
acoplada con sistemas acuosos como cromatografía líquida a nanoescala (nano
Liquid Cromathography), ionización por electrospray (Electrospray Ionización, ESI)
y el láser matriz asistida desorción/ionización (Matrix-Assisted Laser
Desorption/Ionization , MALDI) 59.
En el caso de identificación de PAM en secreciones de ranas se han integrado
técnicas moleculares utilizando ADNc, nano UPLC MS/MS (Ultra Performance
Liquid Chromatography) que permite la integración de tecnologías moleculares en
ausencia de información en las bases de datos60. Ésta técnica requiere de
nanogramos a picogramos de secreciones para un completo análisis, lo cual indica
que con la secreción de una sola rana es posible hacer todo el estudio. Este punto
no solo simplifica considerablemente el análisis sino además protege de una
manera significativa a la biodiversidad del hábitat natural ocupado por estos
animales.
29
4.Objetivo General • Identificar nuevos péptidos antimicrobianos a partir de secreciones de piel
de ranas y caracterizar su actividad biológica.
4.1.Objetivos Específicos
-Determinar la actividad antibacteriana de los medios condicionados
obtenidos de micro-órganos de piel de ranas contra bacterias de interés
clínico.
-Evaluar la actividad citotóxica de los medios condicionados de ranas en
células somáticas.
-Evaluar la expresión del gen dermaseptina B4 en los cultivos de micro-
órganos .de una especie para la cual se haya reportado previamente
este gen.
-Determinar la actividad antiviral de los medios condicionados contra el
virus de la fiebre amarilla.
-Identificar precursores génicos de péptidos antimicrobianos a partir de
micro-órganos de las ranas con mejor actividad antimicrobiana.
-Identificar péptidos antimicrobianos con herramientas proteómicas y
bioinformáticas de las secreciones de las especies con potente actividad
antimicrobiana.
-Evaluar la actividad biológica de los candidatos identificados.
-Determinar las propiedades biofísicas de los candidatos con mejor
actividad biológica.
30
5. Capítulo 1 Los micro-órganos de piel de ranas secretan potentes agentes antimicrobianos en cultivo.
Los resultados de la primera parte del trabajo quedaron consignados en la siguiente publicación: Skin micro-organs from several frog species secrete a repertoire of powerful antimicrobials in culture, Journal of antibiotics, 2012.
5.1 Resumen En este artículo se describe la implementación de la técnica de cultivo de MOs
para la obtención de secreciones de piel de ranas. Se muestra que la estructura
histológica de la piel de las ranas permanece intacta en los MOs y que se
mantienen la secreción de sustancias con potente actividad antibacteriana.
Nuestra estrategia fue crear un banco de secreciones de piel de ranas de
diferentes especies, denominadas como medios condicionados. Este banco está
conformado por los medios condicionados de alrededor de 50 especies, algunas
de ellas de particular interés por ser endémicas y otras por estar en peligro de
desaparecer. Finalmente, mostramos los resultados antibacterianos de los medios
condicionados de las especies más potentes sin que presenten toxicidad contra
células somáticas.
ORIGINAL ARTICLE
Skin micro-organs from several frog species secretea repertoire of powerful antimicrobials in culture
Helena Groot1, Carolina Munoz-Camargo1, Johanna Moscoso1, Gina Riveros1, Vivian Salazar1,Franz Kaston Florez2 and Eduardo Mitrani3
This work is an attempt to take advantage of the rich biodiversity that exists in Colombia in order to start a systematic analysis
of antimicrobial substances that have emerged through amphibian evolution. For this purpose we have developed a technique
to grow intact frog skin derived micro-organs (SMOs) in vitro in the absence of serum. We show that in SMOs, the skin glands
remain intact and continue to secrete into the medium substances with potent antibacterial activity, for several days in culture.
Our strategy has been to create a bank of substances secreted by amphibian skin from different species. This bank contains at
present around 50 species and is of particular importance as some of the species are in danger of disappearing. We show that
some of the species tested displayed very strong antibacterial activity without being toxic to somatic cell lines, even at 10-fold
higher concentration.
The Journal of Antibiotics advance online publication, 4 July 2012; doi:10.1038/ja.2012.50
Keywords: antibacterial activity; frog secretions; gene expression; skin culture
INTRODUCTION
In spite of significant advances in molecular biology, more than 40%of compounds used by modern medicine are derived from nature. Incertain areas, such as antimicrobials, anticancer, antihypertensive andanti-inflammatory drugs, the numbers are even higher and constituteabout 75% of the total.1,2 Frogs and toads have developed a successfulstrategy for surviving microbe-laden hostile environments, which relyheavily on the secretion of chemical cocktails from specialized skinglands.3 These secretions not only produce large amounts ofbiologically active peptides that are similar to mammalianneuropeptides and hormones, but they also contain a rich arsenalof broad-spectrum, cytolytic antimicrobial peptides.4,5 Their highdegree of chemical complexity is evidenced by the fact that theycontain proteins, peptides, biogenic amines, alkaloids and other as yetuncharacterized biochemicals. Interestingly, peptides have o5 kDamolecular mass are the predominant molecules in the secretions ofmany frogs,6 Five thousand living anuran frog species may produceabout 100 000 different antimicrobial peptides. Colombia has B10%of the world’s biodiversity with more than 700 amphibian speciesrepresenting a ‘natural treasure trove’ for novel discovery.7,8
We have adapted the micro-organ (MO) technology to study thein vitro secretions of frog skin derived MOs (SMOs) in serum-free
defined-media. The technology is based on the fact that preservation
of the basic epithelial–mesenchymal interactions allows for highly
complex ex vivo function of epidermal cells. The approach is based on
the preparation of organ fragments that preserve the basic
microenvironment encountered by epithelial cells in vivo but with
geometry and dimensions that ensure appropriate diffusion of
nutrients and gases to all cells in culture.9,10 Such fragments have
been termed MOs to distinguish them from other tissue fragments
that do not encompass the true organ structure.9,11,12
In the present work we report the collection and initial character-ization of activities of frogs collected from highly varied habitats ofColombia. In addition we have collected DNA and RNA samples fromeach species for our records and for further analysis. We haveobtained both in vivo and in vitro secretions and we further showthat MOs prepared from frog skin (SMOs) can be successfullycultured for several days in vitro. During that period the frog SMOssecrete into the serum-free medium a whole repertoire of substanceswith powerful broad-spectrum antibacterial activities. Activitiesobtained from in vitro secretions were found, in most cases and thesame concentrations, to be higher per gram of tissue than the actualsecretions in vivo. More importantly, these active secretions werefound not to be toxic to somatic cells even at 10-fold higherconcentrations. We also confirmed that frog SMOs transcribe house-keeping genes when cultured for several days in serum-free medium.
MATERIALS AND METHODS
Frogs specimensWe have created a bank of skin secretions from 50 species of frogs collected
from different regions of Colombia including the Guajira, upper Magdalena
Valley, Amazone region, Andes piedmont and at the base of the eastern
1Laboratory of Human Genetics, Department of Biological Sciences, Universidad de los Andes, Bogota, Colombia; 2Fundacion Nativa, Bogota D.C., Colombia and 3Institute ofLife Sciences, Hebrew University of Jerusalem, Jerusalem, IsraelCorrespondence: Professor E Mitrani, Institute of Life Sciences, Hebrew University of Jerusalem, Silverman Building, Room 3-524, Givat Ram, Jerusalem 91904, Israel.E-mail: [email protected]
Received 2 March 2012; revised 9 May 2012; accepted 15 May 2012
The Journal of Antibiotics (2012) 00, 1–7& 2012 Japan Antibiotics Research Association All rights reserved 0021-8820/12
www.nature.com/ja
mountain range. Some of the species examined include: Hypsiboas lanciformis,
Sphaenorhynchus lacteus, Hypsiboas boans, Dendrobates truncatus and Pipa
pipa. The frogs were kept alive in a purpose-built amphibian facility at
25±1 1C under a 12-h light/dark cycle and fed with fruit flies three times per
week.13 All procedures involving frogs adhered to resolution 008430 of the
Ministry of Health for the use of animals in research and the guidelines of the
ethical committee on animal research from the Andes University. All captures
were performed under the collection license No. 2 of the 20th of January 2009,
from the Ministerio de Medio Ambiente, Colombia.
In vivo frog skin secretionsIn vivo skin secretions were obtained from dorso-lateral skin folds by first
washing the live animals with sterile distilled water and then were softly dried.
This washing was followed by a s.c. injection of 70ml (10mg ml�1) of
norepinephrine3 per gram of animal weigh. Four minutes after injection, the
secretions were collected by washing the frog with 1 ml cm�2 of skin of a
solution containing 70% Dulbecco’s modified Eagle’s medium (DMEM), 30%
H2O, over a period of 10 min and the solution obtained was then aliquoted
and stored frozen at �80 1C before analysis.
Frog skin MOsAdult specimens were anesthetized and killed applying 100 mg MS222 (3-
aminobenzoic acid ethyl ester methanesulfonate salt, Sigma), directly to the
tongue. Skin were removed immediately after the animals were killed and
washed twice for 30 min with 70% DMEM supplemented with penicillin
(1000 IUml�1), streptomycin (1000 IUml�1) and fungizone (1mg ml�1). Skin
fragments from dorsal and ventral regions were cut into 4 mm width and
30 mm length flaps, and then transverse sectioned under sterile conditions
parallel to the shortest dimension every 300 mm using a Mc Ilwain Tissue
Chopper (Stoelting Co., Wood Dale, IL, USA). The SMOs obtained (4 mm
long � 0.3 mm wide) were washed five times for 10 min with 70% DMEM
supplemented with penicillin (1000 IUml�1)/streptomycin (1000 IUml�1)
and fungizone (1mg ml�1), and then twice for 10 min in 70% DMEM
containing no antibiotics, nor antimycotic agents. Finally, 40 SMOs (0.5 cm2
of skin equivalent) were cultured per well in 500ml of serum-free 70% DMEM
(Sigma-Aldrich, St Louis, MO, USA). No exogenous growth factors were
added to the medium. The cultures were kept at 26 1C in 5% CO2, in 24-well
plates.9
Frog skin secretionsThe media in which the SMOs were maintained in culture, denoted as
conditioned media (CM), contained the in vitro secretions derived from frog
skin. The CM was collected every day and replaced by the same volume of
fresh 70% DMEM. Medium collected at days 1, 2 and 3 were filtered (0.2mm
pore size) and labeled CM1, CM2 and CM3, respectively, aliquoted and stored
at �80 1C until required. Total concentration of skin peptides in each CM
ranged between 300mg and 600mg ml�1 of CM, and was determined using a
nanodrop 2000 with the protocol of A205 custom method for protein and
peptide quantification (Thermo Scientific, Austin, TX, USA). Also, we used
bradykinin (RPPGFSPFR) (Sigma Chemical, St Louis, MO, USA) to establish a
standard curve.14
HistologyHistology was done by preparing 8 mm thick paraffin sections. SMOs were
fixed for 30 min in phosphate buffered solution containing 4% paraformalde-
hyde, rinsed, dehydrated and embedded in paraffin. Staining was done with
hematoxylin/eosin according to routine histological methods.15
Antibacterial assayThe antibacterial activities of frog skin secretions were tested using growth
inhibition assays against human pathogenic bacteria. Colonies of Staphylococ-
cus aureus, Escherichia coli, Salmonella sp. and Enterobacter cloacae (all isolated
from clinical cases) were selected from agar and incubated overnight at 37 1C
on BHI media (Brain Heart Infusion). Following incubation, the bacterial
suspension was adjusted to achieve an OD (OD595) of 0.04 and used as
inoculum for the growth inhibition assay, plated in 96-well microtiter plates
plus increasing amounts (0, 5 and 25% of CM. A total volume of 100ml was
obtained by adding the required volume of 70% DMEM. The positive control
wells received SMO culture media (serum-free 70% DMEM (Sigma-Aldrich)
instead of CM and negative control wells received 2mg ml�1 of ampicillin.13
Each test was performed in duplicate for each experimental condition. Plates
were incubated at 37 1C and the OD595 was read at three different time points:
6, 8 and 24 h.
Growth inhibition was calculated using the following formula ((positive
control OD�sample OD)/(positive control OD))� 100 and expressed as a
percentage.13
Cell cultureThe cell lines used for the cytotoxicity of the CM, were Cricetulus griseus ovary
chinese hamster cells (CHO-K1 cell line ATCC CCL-61, ATCC, Manassas, VA,
USA), Canis familiaris Madin-Darby canine kidney (MDCK cell line ATCC
CCL-34) and Cercopithecus aethiops African monkey kidney cells (COS-7cell
line ATCC CRL-1651), respectively. The CHO-K1 cell line was grown as a
monolayer culture in RPMI 1640 medium and MDCK and COS-7 in DMEM.
Both media were supplemented with 10% FBS, (100 IUml�1)/streptomycin
(100 IUml�1) and fungizone (1mg ml�1). The cultures were maintained at
37 1C in a humidified 5% CO2 atmosphere.
Cytotoxicity assayCell toxicity was monitored by determining the effect of the CM dilution (10
and 50%) on cell viability. Each CM dilution was made by diluting the
collected CM with culture medium and added it to confluent CHO-K1 cell
monolayers (3� 105 cells per ml) in flat-bottomed, 96-well, microtiter tray.
The cells with the CM dilutions were incubated at 37 1C in humidified 5% CO2
for 48 h.
The cytotoxicity was determined by colorimetric methods based on the
reduction of tetrazolium salts by viable cells (MTT assay).16
Briefly, 10ml of MTT solution (2 mg ml�1 phosphate buffered saline
solution) were added to each well of the microtiter tray after 48 h of
incubation. The tray was then incubated at 37 1C for 4 h more. To dissolve
the formazan crystals, 70ml of dimethylsulphoxide was added to each well.
After shaking the tray for 10 min, whereby formazan crystals were completely
dissolved, the absorbance of the wells was read in a computer-controlled
microplate reader (Bio-Rad, Philadelphia, PA, USA) at 595 nm. The percentage
of viable treated cells was calculated in relation to untreated controls (viability
percentage¼OD-treated cells/OD control cells� 100%). The untreated
control was taken as 100%.
RT-PCR analysisFor each sample, total RNA was extracted from five equal-sized SMOs, with
acid-guanidine and phenol as described,17 and reverse-transcribed (Promega
Corporation, Madison, WI, USA). RT-PCR was done by running parallel
reactions for each set of primers. Dermaseptin B4 primers were designed based
on the published sequence of Phyllomedusa bicolor.18
Primer sets were as follows:
b-actin 50-CGGAACCGCTCATTGCC-30
50-ACCACAACTGTGCCCATCTA-30
Dermaseptin B4 50-GACCAGACATGGCTTTCCT-30
50-TTGCTCCCTTGATTTCCA-30
PCR products obtained were gel-purified, and sequenced using an ABI
Prism 310 automated sequencer (Applied Biosystems, Carlsbad, CA, USA).
The sequence obtained was subjected to homology search using the BLAST
tool available at the NCBI database.
Statistical analysisShapiro–Wilk normality tests were performed on all data and one-way analysis
of variances were applied after the distributions of data were found to meet the
assumptions for parametric tests. Student’s t-tests were used to compare the
significance of growth inhibition and Tukey tests were used to compare
significance of cytotoxicity effects. All statistics were performed using the
software Statistics version 9 (StatSoft, Tulsa, OK, USA).
Frog skin micro-organs secrete antimicrobialsH Groot et al
2
The Journal of Antibiotics
RESULTS
Xenopus SMOs remain viable for several days in cultureAs a first step we used Xenopus laevis as a source of SMOs. We foundthat Xenopus SMOs remain viable for at least 1 week in vitro whencultured in 70% DMEM in the absence of serum at 26 1C and 5%CO2. Figure 1a shows one SMO stained with MTT (right) ascompared with an unstained SMO on the left after 8 days in culture.Figures 1b and c show standard hematoxilin eosin 8mm histologysections of Xenopus SMOs after 8 days in culture at differentmagnifications, to indicate that both the epidermis remains stratifiedand the glands retain their intact architecture.
Frog skin secretes antibacterial substances for several days whencultured as SMOs in serum-free medium in vitroIn order to determine whether frog-derived SMOs secrete into themedium antibacterial activity, CM obtained as described in themethods section was tested against four strains of bacteria: S. aureus,Salmonella sp., E. cloacae and E. coli. For each assay the in vivo skinsecretions from each species was also collected as described above andtested in parallel to the in vitro secretions. In some cases as the oneshown in Figure 2, CM was more powerful than the in vivo secretion.In others (Figure 3), a more similar pattern of activity was observedfrom the in vivo secretions as compared with the in vitro secretions.SMO cultures have been prepared from all species collected and CMhas been systematically tested against the four bacterial strains asdescribed in the previous section. On the whole, antibacterial activitywas found in all species tested. Some of the species that showed morepowerful antibacterial activities were tested further for their effect onsomatic cell lines.
Figure 1 (a) MTT viability test of SMOs. (b) Light microscopic section of dorsal skin Xenopus laevis stained with haematoxilin-eosin. (c) Higher
magnification illustrating an intact serous granular gland. A full color version of this figure is available at The Journal of Antibiotics journal online.
Figure 2 Comparison of antibacterial activity from in vivo (IV) (a) whole skin
secretions and (b) SMOs in vitro secretion of Sphaenorhynchus lacteus.
Bacterial growth control—no CM added—(solid bar), increasing amounts of
CM 5% (light bar) and 25% (gray bar) of CM. The data are presented as
the mean of two replicate samples from two independent experiments.
*Po0.05.
Frog skin micro-organs secrete antimicrobialsH Groot et al
3
The Journal of Antibiotics
Secretions from SMOs in culture are not toxic to somatic cell lineseven at 10-fold higher concentrationsAs mentioned earlier, the major obstacle to the use of peptide-basedanti-infective agents as useful drugs is their toxicities, particularly ifthey are to be administered systemically.19 We were therefore interestedto determine the toxicity of in culture secretions of frog SMOs. To thatextent CM from the same species were tested in parallel against threedifferent vertebrate somatic cell lines: CHO-K1, COS-7 and MDCK.As shown in Figure 4, CM taken after 2 days (CM2 (A)) from SMOcultures of H. boans inhibited bacterial activity even when only 5% ofCM was added to the test system. Yet, as shown in Figure 4b CM2even at a concentration 10 times higher was found to have no effect oncell growth of any of the cell lines tested. Similarly CM4 (data notshown) from the same species was found not to inhibit cell growth ofthe CHO-K1 cell line, but had a roughly 50% decrease in the numberof COS-7 and MDCK cells as compared with untreated controls.Figure 5 shows that CM obtained from SMOs derived from D.truncatus after 3 days in culture (CM3) (Figure 5a) inhibited bacterialactivity in a dose-dependent manner. Yet no effect was observed with a50% concentration of the same conditioned medium (CM3) in theviability of any of the somatic cell lines tested (Figure 5b). Comparisonof Figures 6a and b show that CM obtained from P. pipa after 1 day inculture (Figure 6a) had a powerful antibacterial activity. This activitywas found not only not to be toxic to the somatic cell lines tested butalso to be stimulatory to MDCK cells (Figure 6b).
SMOs from P. bicolor transcribe a dermaseptin geneWe were particularly interested in determining if the frog-derivedSMOs were de-novo transcribing tissue-specific genes. To that extent
and in order to obtain a measure of integrity and viability of thecultures, SMO samples obtained from P. bicolor., S. lacteus, H. boansand D. truncatus (data not shown), were cultured as described above,samples removed every 24 h and total RNA prepared. Viability wasconfirmed by the integrity of the RNA during 1 week in culture. Allfour species transcribed at steady levels the housekeeping gene actinfor the whole culture period of 6 days (data not shown). Furthermore,Figure 7 shows that SMO cultures continue to transcribe mRNAs atsustained levels for a whole week in vitro.
Using primers directed to highly conserved regions of DermaseptinB4, bands were amplified, as expected, from SMOs derived fromP. bicolor. Interestingly, a band was also amplified in samples obtainedfrom S. lacteus. The identities of the bands obtained were confirmedby sequencing. Sequences from both species showed 98% identity onthe conserved region. The sequence of the variable region obtainedfrom P. bicolor was found to be 93% similar both in size and insequence to those reported for the Phyllomedusinae subfamily asexpected. However, the variable region obtained from S. lacteus wasfound to be considerably shorter and only 49% similar to that of thePhyllomedusinae subfamily (data not shown).
Patterns of bacterial inhibition do not seem to be related to specifichabitatsActivities of the different species tested have been summarized inTable 1. The table shows concentration of conditioned mediumrequired to bring about 50% inhibition of bacterial cell growth(bacterial inhibition LD50). Antibacterial activities are organized inTable 1 by species and their habitat and site of origin. No specificpatterns of activities could be assigned to particular habitats. For
Figure 3 Comparison of antibacterial activity from in vivo (IV) (a) whole skin
secretions and (b) SMOs in vitro secretion CM taken 1 day after culture of
Hypsiboas lanciformis. Bacterial growth control—no CM added—(solid bar),
increasing amounts of CM 5% (light bar) and 25% (gray bar) of CM. The
data are presented as the mean of two replicate samples from two
independent experiments. *Po0.05, **Po0.001.
Figure 4 Secretion from SMOs of Hypsiboas boans (a) inhibited bacterial
activity, CM obtained after 2 days, (b) with virtually no effect (CM2) on cell
viability. Bacterial growth control—no CM added—(solid bar), increasing
amounts of CM 5% (light bar and 25% (gray bar) of CM in antibacterial
assays, 10% (light bar) and 50% (gray bar) in cytotoxic assays. The data
are presented as the mean of two replicate samples from two independent
experiments. **Po0.001.
Frog skin micro-organs secrete antimicrobialsH Groot et al
4
The Journal of Antibiotics
example, CM1 of H. lanciformis found in Leticia (Amazon) displayedan LD50 of 5% in S. aureus and salmonella and of 25% in E. Cloacae.Yet, 70% CM1 was required to bring about the same level ofinhibition in E. coli. In contrast, a CM1 concentration of 35% wasrequired from Hypsiboas hobssi, found in the same habitat asH. lanciformis in order to achieve the same LD50 in all four bacterialspecies tested. CM1 derived from cultures of Scinax cruentommusobtained from the same area on the Amazon basin was found to havea much weaker antibacterial activity on all bacterial species tested(data not shown). If we now look at species collected in otherdifferent and varied habitats we see that some like Centrolene sp. werehighly active in all species tested while Scinax ruber showed varied butgenerally lower activities. Only 5% of CM3 of D. truncatus (from thesame habitat) was required for an LD50 for three of the species tested,and more than 70% was required to bring about the same LD50 inE. cloacae. In contrast, P. pipa obtained in Leticia (Amazon) displayedhigh activity for S. aureus and E. cloacae, and intermediate activityagainst Salmonella and against E. coli (see Table 1). Clearly, there doesnot seem to be any specific pattern that assigns specific activities tocertain habitats.
DISCUSSION
We have shown in the past that preservation of the epithelial–mesenchymal interactions in mammalian SMOs allows keratinocytesto continue to proliferate, and to transcribe epidermal-specific genesfor long periods when cultured in defined medium in the absence ofserum or exogenous factors.9,12 SMOs were found to retain thoseproperties irrespective of whether they were derived from new born oradult skin even though they were cultured in serum-free medium. In
the present work we show that in frog-derived SMOs, not only doepidermal cells continue to transcribe housekeeping and tissue-specificgenes, but also that whole secretory glands remain functional forseveral days in culture. In fact we show that secretions from frog SMOsin culture were, in several cases, more powerful antibacterial agentsthan those obtained from in vivo secretions. These results takentogether indicate that frog SMO culture can provide a powerfulmethod to identify secretory molecules from frog skin. As the SMOsact as bioreactors, the amount of secretion that can be obtained peranimal is amplified thus minimizing the number of specimensrequired for the characterization process.
Our strategy has been first to create a bank of substances secretedby amphibian skin from a variety species living in far and variedhabitats of Colombia. This bank is of particular importance as someof the species are in danger of disappearing. It is has been suggestedthat every species harbors a unique, specific collection of antimicro-bial peptides, tuned to defend the organism against microorganismsthat it is likely to encounter.13
As shown in Table 1, we do not seem to find any specific pattern,which assigns specific activities to certain habitats. In fact what seemsto be the case is the opposite. On second thoughts, this may beunderstood on the bases that the habitats visited are extremely rich inmicrobial diversity. Around 8000 species of prokaryotes have beendescribed but they form only a very small fraction of the truediversity.20 Techniques based on analysis of environmental DNA let tosuggest that the total number of species of bacteria (as based on thecurrent broad species definition) may be in the order of 109–1012.21
Thus, it is unlikely that amphibian species have become specializedbut rather have developed a broad-spectrum strategy in order to cope
Figure 5 Secretions from SMOs of Dendrobates truncatus CM3 (a) inhibit
bacterial in a dose-dependent manner and (b) are not toxic to somatic
cell lines. Antibacterial assay—no CM3 added—(solid bar), increasing
amounts of CM3 5% (light bar) and 25% (gray bar). Cytotoxic assays: 10%
of CM3 (light bar), 50% of CM3 (gray bar). The data are presented as the
mean of two replicate samples from two independent experiments.
**Po0.001.
Figure 6 Secretions from SMOs of Pipa pipa (a) inhibited bacterial activity
while at the same time (b) stimulated growth of MDCK cells in culture. CM
was taken after first day of SMO culture (CM1). Antibacterial assay: no CM1
added (solid bar), increasing amounts of CM1: 5% (light bar) and 25%
(gray bar). Cytotoxic assay: 10% of CM1 (light bar), 50% of CM3 (gray bar).
The data are presented as the mean of two replicate samples from two
independent experiments. *Po0.05, **Po0.01.
Frog skin micro-organs secrete antimicrobialsH Groot et al
5
The Journal of Antibiotics
with such variety. It is this line of though that directed our approachnot towards individual substances but rather to a whole repertoire ofsubstances that act in synergism, with the mixture having up to a10-fold greater antibiotic activity than the peptides separately.13,22
The methodology presented here allows for in vitro production,analysis and characterization of the ‘natural mixture’ of compoundssecreted by different anuran species in order to cope with the highlyhostile environment in which they live. In this respect it should bepointed out that some of the activities reported here, as shown inFigures 5 and 6, were very potent against various pathogenic bacteriawithout having any toxic effects on somatic cells even at 10-foldhigher concentrations.
It is becoming clear that each ranin or hylid frog species producesits own set of antimicrobial peptides. Some of these peptides differ byonly a few amino acid substitutions or deletions and have similarbiochemical characteristics (that is, dermaseptins B1 and B2).23
Many infections that would have been cured easily by antibiotics inthe past now are resistant, resulting in sicker patients and longerhospitalizations. The economic impact of antibiotic-resistant infec-tions is estimated to be between $5 and $24 billion per year in theUnited States alone.24 There is therefore an urgent need for novelantibiotics, many peptides with antibacterial properties have beenidentified in the past from other species and several are in stage III ofclinical trials. A recent review lists seven companies involved in thedevelopment of antibacterial peptides as drugs.25 There are, however,
many challenges awaiting solution: in order to be a good candidatefor therapeutic use, a drug needs to show appropriate function, lowtoxicity, have stability in vivo and be reasonably inexpensive tomanufacture. So far only a few cationic peptides have made their wayto clinical trials and only two are used in topical creams andsolutions. A problem associated with administering cationicpeptides as a treatment for infection is the ability to direct thepeptides to the appropriate locations with the accuracy of white bloodcells after crossing the epidermal barrier.2 When injected i.v. thepeptides are required to infiltrate healthy tissue in order to reach theappropriate locations, which can be a very slow process. The host’ssystem can also act on the peptides; for example, the presence ofproteases can inactivate peptides before they reach their destination.26
A major problem that limits the systemic use of these compounds istoxicity.19 In the present work, we have started to address this latterpoint. We believe the reason that we found, on the one hand a strongantibacterial activity and on the other, hardly any toxicity is becauseof the approach taken where the whole repertoire of skin secretionsinstead of individual components was tested for activity. Thus, wehave screened for activities, which are likely the result of synergismbetween various substances secreted by the skin of the different frogspecies. The next step is to work with those species where the mostpowerful and specific activities (that is, no toxicity to somatic cells)have been obtained. Peptide composition of CM secreted by thesespecies is being characterized by LC MS/MS (data not shown).
Figure 7 Gene expression were produced in SMOs from Phyllomedusa bicolor. (a) Amplification for specific antimicrobial gene dermseptin B4
(GI:3256038). (b) Alignment of nucleotide sequence of encoding precursor of dermaseptin B4 (DB4), data base (db) and P. bicolor (ClustalW Tool). The
putative signal peptide (single-underlined), mature processed peptide (dashed line), processing site KR, stop codon (bold) and nucleotides conserved
(asterisks) are indicated.
Table 1 Comparison of the antibacterial activities from frog skin secretions of different regions of Colombia
Site of origin
Antibacterial inhibition LD50
Frog species Type of habitat S. aureus Salmonella E. cloacae E. coli
Hypsiboas lanciformis Leticia (Amazone) 5 5 25 470
Hypsiboas hobssi Tropical moist lowland forests 35 35 35 35
Cochranella punctulata endemic Mariquita (Tolima) 5 5 5 20
Scinax ruber Tropical dry forests and rainforest 70 35 35 35
Pleurodema brachyops Palomino (Guajira) 70 5 20 470
Pseudis paradoxa Tropical dry forests 5 35 5 5
Frog skin micro-organs secrete antimicrobialsH Groot et al
6
The Journal of Antibiotics
Once the sequence identity of the various peptides is obtained, thepeptides will be synthesized and different cocktails tested again forantimicrobial activity. Furthermore, it is believed that comparison ofcombinations of peptides obtained in the different secretions vis a vistheir biological activity will help formulate better and more specificantibiotics.
ACKNOWLEDGEMENTSThis work was supported by a grant from Colciencias CODE 1204-343-19173,
and by the Fondo para las investigaciones Facultad de ciencias University of
los Andes. Bogota, Colombia.
1 Newman, D. J. & Cragg, G. M. Natural products as sources of new drugs over the 30years from 1981 to 2010. J. Nat. Prod. 75, 311–335 (2012).
2 Nakatsuji, T. & Gallo, R. L. Antimicrobial peptides: old molecules with new ideas.J. Invest. Dermatol. 132, 887–895 (2012).
3 Rollins-Smith, L. A., Reinert, L. K., Miera, V. & Conlon, J. M. Antimicrobial peptidedefenses of the Tarahumara frog, Rana tarahumarae. Biochem. Biophys. Res. Commun.297, 361–367 (2002).
4 Vanhoye, D., Bruston, F., Nicolas, P. & Amiche, M. Antimicrobial peptides from hylidand ranin frogs originated from a 150 million years old ancestral precursors with aconserved signal peptide but a hypermutable antimicrobial domain. Eur. J. Biochem.270, 2068–2081 (2003).
5 Conlon, J. M., Al-Ghaferi, N., Abraham, B. & Leprince, J. Strategies for development ofnaturally-occurring antimicrobial peptides into therapeutically valuable anti-infectiveagents. Methods 42, 349–357 (2007).
6 Chen, T., Zhou, M., Gagliardo, R., Walker, B. & Shaw, C. Elements of the granular glandpeptidome and transcriptome persist in air-dried skin of the South American Orange -legged leaf frog, Phyllomedusa hypocondrialis. Peptides 27, 2129–2136 (2006).
7 Acosta-Galvis, A. Ranas Salamandras y Caecilias (Tetrapoda: Amphibia) de Colombia.Biota Colombiana 1, 289–319 (2000).
8 Lynch, J. D. & Suarez-Mayorga, A. M. In: Colombia Diversidad Biotica IV: El Chocobiogeografico/Costa Pacıfica (ed. Orlando Rangel, J.) 633–667 (Instituto de CienciasNaturales, Ch. - Bogota, 2004).
9 Mitrani, E., Nadel, G., Hasson, E., Harari, E. & Shimoni, Y. Epithelial–mesenchymalinteractions allow for epidermal cells to display an in vivo-like phenotype in vitro.Differentiation 73, 79–87 (2005).
10 Revel, A., Laufer, N., Ben Meir, A., Lebovich, M. & Mitrani, E. Micro-organ ovariantransplantation enables pregnancy: a case report. Hum. Reprod. 26, 1097–1103(2011).
11 Hasson, E. et al. Skin-derived micro-organs induce angiogenesis in rabbits. J. Vasc.Res. 43, 139–148 (2006).
12 Voisine, P. et al. Skin-derived micro-organ autotransplantation as a novel approachfor therapeutic angiogenesis. Am. J. Physiol. Heart Circ. Physiol. 294, 213–219(2008).
13 Schadich, E., Cole, A. L., Squire, M. & Mason, D. Skin peptides of different life stagesof Ewing’s tree frog. J. Exp. Zool. A Ecol. Genet. Physiol. 313, 532–537 (2010).
14 Woodhams, D. C. et al. Population trends associated with skin peptide defenses against
chytridiomycosis in Australian frogs. Oecologia 146, 531–540 (2006).15 Lacombe, C. et al. Peptide secretion in the cutaneous glands of South American tree
frog Phyllomedusa bicolor: an ultrastructural study. Eur. J. Cell Biol. 79, 631–641(2000).
16 Klajnert, B. et al. Biological properties of low molecular mass peptide dendrimers. Int.J. Pharm. 309, 208–217 (2006).
17 Chomczynski, P. & Sachi, N. Single- step method of RNA isolation by acid guanidiniumthiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159 (1987).
18 Charpentier, S. et al. Structure, synthesis, and molecular cloning of dermaseptins B, afamily of skin peptide antibiotics. J. Biol. Chem. 273, 14690–14697 (1998).
19 Conlon, J. M. & Sonnevend, A. Antimicrobial peptides in frog skin secretions. MethodsMol. Biol. 618, 3–14 (2010).
20 Dykhuizen, D. E. Santa Rosalia revisited: why are there so many species of bacteria?Antonie Leeuwenhoek 73, 25–33 (1998).
21 Vaisman, N. & Oren, A. Salisaeta longa gen. nov., sp. nov., a red, halophilic member ofthe Bacteroidetes. Int. J. Syst. Evol. Microbiol. 59, 2571–2574 (2009).
22 Li, J. et al. Anti-infection peptidomics of amphibian skin. Mol. Cell Proteomics 6,
882–894 (2007).23 Nicolas, P. & El Amri, C. The dermaseptin superfamily: a gene-based combinatorial
library of antimicrobial peptides. Biochem. Biophys. Acta 1788, 1537–1550 (2009).24 Monaghan, R. L. & Barrett, J. F. Antibacterial drug discovery—then, now and the
genomics future. Biochem. Pharmacol. 71, 901–909 (2006).25 Davies, J. How to discover new antibiotics: harvesting the parvome. Curr. Opin. Chem.
Biol. 15, 5–10 (2011).26 Meng, H. Therapeutic peptides containing fluorinated amino acids. Ph.D., Tufts
University (2009).
Frog skin micro-organs secrete antimicrobialsH Groot et al
7
The Journal of Antibiotics
31
5.2.Conclusiones capítulo 1
-Se implementó el sistema de cultivo de micro-órganos de piel de ranas para la
obtención de las secreciones de diferentes especies de ranas de Colombia.
-Se determinó que lo MOs mantienen la estructura de la piel y de las glándulas
granulares.
-Se encontró que los MC obtenidos en cultivo de MOS tiene actividad
antimicrobiana y no son tóxicos para células somáticas.
- Se confirmó que los MOs de Phyllomedusa bicolor transcriben el gen de DB4 en
cultivo.
32
6. Capítulo 2 En éste capítulo se presentan los resultados de la siguiente publicación Frog skin
cultures secrete Anti-yellow fever compounds, en Journal of antibiotics, 2016
6.1. Resumen Los PAM son considerados candidatos promisorios para futuros usos terapéuticos,
de acuerdo con la necesidad de desarrollar nuevos antimicrobianos y la re-
emergencia de la infección con Flavivirus, como el virus de la fiebre amarilla. En
éste artículo se compara la actividad antiviral de los medios condicionados de
siete especies de ranas contra el virus de la fiebre amarilla (virus vacunal cepa
17D). Se encontró que las secreciones que mejor actividad presentan son las de la
piel de las ranas Sphaenorhynchus lacteus y Cryptobatrachus boulongeri. En
particular para las secreciones de S. lacteus se encontró que inhiben la lisis viral
de las células Vero-E6 hasta en la concentración viral más alta (10LD50). Además,
a partir de los MOs cultivados de está especie se identificó un péptido nuevo
relacionado con la familia de las frenatinas. Se evaluó la actividad antiviral de éste
péptido y se encontró un 35% de protección celular sin presentar toxicidad a las
células a hasta diez veces la concentración .
ORIGINAL ARTICLE
Frog skin cultures secrete anti-yellow fever compounds
Carolina Muñoz-Camargo1, Margarita Correa Méndez1, Vivian Salazar1, Johanna Moscoso1, Diana Narváez1,Maria Mercedes Torres1, Franz Kaston Florez2, Helena Groot1 and Eduardo Mitrani3
There is an urgent need to develop novel antimicrobial substances. Antimicrobial peptides (AMPs) are considered as promising
candidates for future therapeutic use. Because of the re-emergence of the Flavivirus infection, and particularly the yellow fever
virus (YFV), we have compared the antiviral activities from skin secretions of seven different frog species against YFV (strain
17D). Secretions from Sphaenorhynchus lacteus, Cryptobatrachus boulongeri and Leptodactylus fuscus displayed the more
powerful activities. S. lacteus was found to inhibit viral lysis of Vero E6 cells even at the highest viral concentration evaluated of
10 LD50. We also report the identification of a novel frenatin-related peptide from S. lacteus and found that this peptide—on its
own—can lead to 35% protection against YVF, while displaying no cytotoxicity against somatic cells even at fivefold higher
concentrations. These results are attractive and support the need for continued exploration of new sources of AMPs from frog
skin secretions such as those described here in the development of new compounds for the treatment of infectious diseases in
general and specific viral infections in particular.
The Journal of Antibiotics advance online publication, 6 April 2016; doi:10.1038/ja.2016.16
INTRODUCTION
Skin secretions of advanced frogs (suborder: Neobatrachia) are by farthe most important source of antimicrobial peptides (AMPs) withseveral of peptide antibiotics found in different frog species.1 Thesesecretions not only produce large amounts of biologically activepeptides that are similar to mammalian neuropeptides and hormones,but also contain a rich arsenal of broad-spectrum cytolytic AMPs.2,3
Amphibian AMPs have typical features like short length of amino-acidresidues (11–46), an amphipathic structure (α-helix) and a cationiccharge.4 These features have an important role in the antimicrobialactivity and have been effective against bacteria,5,6 fungi7,8 andviruses.9–11
The yellow fever virus (YFV) is a member of the Flaviviridae familythat has re-emerged with a large number of infections worldwide.12
This disease was recently described among one of the most lethal viraldiseases for which no approved antiviral therapy has yet beendiscovered.13 Infections with YFV cause a severe febrile disease withhemorrhage, multi-organ failure and shock, with a mortality rate up to50%.14,15 YFV is a zoonotic agent: even though there is a safe andefficient vaccine available, the virus is reintroduced from animalreservoirs into human populations.16 South America and Sub-SaharanAfrica are endemic regions with an estimated number of 200 000reported cases per year.17 Moreover, the recent increase in the densityand distribution of the urban mosquito vector, Aedes aegypti, hasraised the risk of infection and spread of YFV.16,18
On the basis of the above considerations, we have evaluated theanti-YFV activities of the skin secretions from seven frog species and
their cytotoxicity. We found that secretions from S. lacteus,C. boulengeri and L. fuscus have the most potent activity againstYFV infection in Vero cells. In S. lacteus secretions, we used rapidamplification (RACE)-PCR and degenerate primers, to elucidate thesequence of a novel frenatin-related AMP. We further show that thisnewly identified AMP can display—on its own—moderate cellularprotection against YFV-infected Vero cells without causing significantcytotoxicity, even at high peptide concentration.
MATERIALS AND METHODS
Frog skin micro-organs and secretionsWe used the skin secretions from different frogs collected around Colombia.These regions include the Guajira, the upper Magdalena Valley, the Amazonregion and the Andean piedmont. The selected species were Sphaenorhynchuslacteus, Cryptobatrachus boulengeri, Leptodactylus fuscus, Pristimantis medemi,Trachycephalus venulosus, Hypsiboas lanciformis and Hypsiboas fasciatus. Allprocedures were adhered to the license No. 2 of the 20th of January 2009, andrealized according to the access to genetic resources contract N° 26 of 2009from the Ministerio de Medio Ambiente, Colombia.The technique used to obtain frog skin micro-organs (SMOs) and frog skin
in vitro secretions, denominated as conditioned media (CM), was obtained byculturing the SMOs in serum-free media for 24 h as described previously.19
Total protein concentration from each CM culture ranged from 300 to600 μg ml− 1. It was determined using the peptide bradykinin standard curve(RPPGFSPFR) (Sigma Chemical, Houston, TX, USA).20 CM was tested atvarious concentrations ranging from 50% diluted with equal volume of serum-free culture media to 5% CM obtained by diluting the CM with 95% serum-free media.
1Laboratory of Human Genetics, Department of Biological Sciences, Universidad de los Andes, Bogotá, Colombia; 2Fundación Nativa, Bogotá, Colombia and 3Institute of LifeSciences, Hebrew University of Jerusalem, Givat Ram, Jerusalem, IsraelCorrespondence: H Groot, Laboratory of Human Genetics, Department of Biological Sciences, Universidad de los Andes, Cr. 1 Nº 18A-10 Building M1- 2 floor, Bogotá 110321,Colombia.E-mail: [email protected] 20 May 2015; revised 11 January 2016; accepted 20 January 2016
The Journal of Antibiotics (2016), 1–8& 2016 Japan Antibiotics Research Association All rights reserved 0021-8820/16www.nature.com/ja
Molecular cloning of cDNAs by 30RACE that may encode AMPsTotal RNA was extracted from five S. lacteus SMOs after 2 days in culture byTRIzol Reagent (Invitrogen, Carlsbad, CA, USA) as described previously.21
cDNA was synthesized by SMART Techniques using the SMART RACE cDNAAmplification Kit (Clontech, Palo Alto, CA, USA), according to the manu-facturer’s protocol. The 30RACE reactions employed a UPM primer(supplied with the kit) and a degenerate sense primer S1 (5′ACTTTCYGAWTTRYAAGMSCARABATG3′) that was designed previously.22
cDNAs from Phyllomedusa species. The PCR was performed under thefollowing conditions: 97 °C for 7 min; followed by 35 cycles at 95 °C for 45 s,52 °C for 30 s and 72 °C for 30 s and a final extension at 72 °C for 10 min. ThePCR products were cloned into the pGEM®-T Easy Vector System (Promega,Madison, WI, USA) using standard procedures. E. coli white positive colonieswere screened with M13 primers (Forward 5′-d(CGCCAGGGTTTTCCCAGTCACGAC)-3′, Reverse 5′-d(TCACACAGGAAACAGCTATGAC)-3′).Amplification products of the expected sizes (400–500 base pairs) were sequencedby the Applied Biosystems Genetic Analyzer (ABI PRISM 3500, CA, USA). Weused the program BLASTn (Smith-Waterman)23 from the National Center forBiotechnology (NCBI) and the ClustalW224 alignment program from TheEuropean Bioinformatics Institute (EMBL-EBI) to analyze the sequencesobtained.
Peptide synthesisThe frenatin 2.3S peptide (F2.3S GLVGTLLGHIGKILGG) described in thisstudy was synthesized by solid phase supplied by GL Biochem (Shanghai,China). The crude synthetic peptide was purified on a Venusil XBP-C18RP-HPLC column (4.6 mm×250 mm), eluting at a flow rate of 1 ml perminute by a linear gradient of acetonitrile in 0.1% trifluoroacetic acid in waterby reversed-phase HPLC. The purity (498%) and identity of the syntheticpeptide was confirmed by electrospray MS.
Cell culture and YFV stocksThe cell lines used to test the cytotoxicity of the CMs cultures were Chinesehamster (Cricetulus griseus) ovary cells (CHO-K1 ATCC CCL-61) and Africanmonkey (Cercopithecus aethiops) kidney cells (Vero E6 cell line ATCCCRL-1586). The CHO-K1 cell line was grown as a monolayer culture inRoswell Park Memorial Institute medium (RPMI-1640) and Vero E6 cell line inDubelcco’s Modified Eagle Medium (DMEM). Both media were supplementedwith 10% FBS, penicillin (1000 IU ml− 1), streptomycin (1000 IU ml− 1) andfungizone (1 μg ml− 1 amphothericin B). Both were maintained at 37 °C in ahumidified 5% CO2 atmosphere.Vaccine strain 17D (Stamaril, Pasteur Merieux, Connaught, Lyon, France)
was used as a source of YFV, which has been previously used to studyalternative treatments of yellow fever infections.25 This vaccine contains 1000mouse LD50 (lethal dose at which 50% of the subjects will die due to viralinfection) viral units and was adjusted at 0.1 LD50, 1 LD50 and 10 LD50, dilutedin DMEM non-supplemented.
MTT assayCitotoxicity assay. Cell monolayers were trypsinized, washed with culturemedium and plated in flat-bottomed 96-well microtiter trays with 3× 105 cellsper ml for CHO-K1 cells. After 24 h incubation, each diluted CM was added tothe appropriate wells and the plates were incubated for 48 h at 37 °C in ahumidified incubator with 5% CO2. The supernatants were removed from thewells, and cell viability was evaluated using the MTT technique described belowfor the antiviral colorimetric assay.
The percentage of viable treated cells was calculated in relation to untreatedcontrols (viability percentage= treated cells OD/untreated cells OD×100%).
YFV infection and antiviral colorimetric assay. The infectivity of the 17D strainover the Vero E6 cell line (3× 105 cells per ml) was evaluated in a 6- day timeinterval.25 Confluent Vero E6 cells in flat-bottomed, 96-well microtiter trayswere infected with YFV (vaccine) strain 17D at 0.1 LD50, 1 LD50 and 10 LD50,and incubated at 37 °C in humidified 5% CO2. Cell viability was measured dailyby the MTT colorimetric technique (3-(4,5-dimethylthiazol-2-yl)-2,5-diphe-nyltetrazolium bromide).26 Briefly, the supernatants were removed from the
wells and 10 μl of MTT (Sigma) (5 mg ml− 1 in PBS) was added to each well.The plates were incubated for 2 h at 37 °C, and 70 μl of DMSO was added tothe wells to dissolve de MTT crystals. The plates were placed on a shaker for15 min, and the optical density was determined at 595 nm (OD595) on amicroplate absorbance spectrophotometer (Bio-Rad, Philadelphia, PA, USA).
The antiviral assay was performed using confluent Vero E6 cell monolayersin flat-bottomed 96-well microtiter trays. Three dilutions of frog skin secretions(CMs) were prepared (at 5, 25 and 50%) and were added 1 h before viralinfection. Three viral concentrations (0.1 LD50, 1 LD50 and 10 LD50) were used,and these samples were incubated at 37 °C in a humidified 5% CO2
atmosphere. To determine the antiviral activity of the F 2.3S, confluent VeroE6 cell monolayers were first exposed to twofold serial dilutions (from20 μg ml− 1) of this peptide. In this assay, we used the high viral YFVconcentration 10 LD50 and incubation conditions as described above. Controlsconsisted of untreated infected, treated uninfected and untreated uninfectedcells. Finally, cell viability was evaluated by MTT as described above.
The 50% cytotoxic concentration (CC50) of the test CMs is defined as theconcentration that reduces the OD595 of treated uninfected cells to 50% ofuntreated uninfected cells. The 50% antiviral effective concentration, i.e., 50%inhibitory concentration of the viral effect (IC50), is expressed as theconcentration that achieves 50% protection of treated infected cells fromYFV induced destruction.
The percent protection was calculated by the following formula:
[(A−B)/C−B)× 100]
where A is the absorbance of the test sample, B is the absorbance of thevirus-infected control (no compound) and C is the absorbance of untreateduninfected cells, and it is expressed as ‘% of control’.26
Data analysisAll results were represented as means± s.d. of three replicates. Differencesamong data were determined by one-way analysis of variance (ANOVA)followed by Tukey and Dunnett’s test. Data were considered statisticallysignificant at a P-valueo0.05.
RESULTS
Frog skin in vitro secretions were obtained by culturing frog SMOs inserum-free media, for 24 h and collecting the CM as describedpreviously.19
Cytotoxicity of frog skin secretions in CHO-K1 cell lineAll evaluated CMs were not cytotoxic to the CHO-K1 cell line (Figure 1).CM from H. fasciatus was not toxic and moreover, was found tostimulate the growth of the CHO-K1 cells even at the highestconcentration tested of 50% CM.
YFV infectivity on Vero E6 cell lineThe infectivity of YFV was evaluated at three concentrations (0.1 LD50,1 LD50 and 10 LD50) on the Vero E6 cell line. All doses tested showeda marked cell death after 6 days (Figure 2), as a consequence ofmaximal viral infectivity in agreement with previous reports.27
Frog skin secretions protect Vero E6 cells from viral infection anddeathAs can be seen in Figures 3a and b, highly potent inhibition of YFVinfection was observed even at the highest viral concentration tested of10 LD50. In particular when infected cells were treated with 50% ofCM from S. lacteus and C. boulengeri. These CMs also had a protectiveeffect on Vero E6 cells viability in the presence of 0.1 LD50 and 1 LD50
YFV even at the lowest CM concentrations tested (5%). Similar resultswere observed when cells were infected and treated with CMs fromL. fuscus (Figure 3c). However, the protective effect was lowercompared with CM from S. lacteus and C. boulengeri.
anti-YFV activities from frog skin secretionsC Muñoz-Camargo et al
2
The Journal of Antibiotics
The other CMs evaluated (H. fasciatus, P. medemi, H. lanciformis andT. venulosus) were less effective against YFV infection. Nevertheless,significant antiviral activity was also detected (Figures 4a and d).The first panel of Figures 3a–c and 4a–d shows the cytotoxic effect
of different CMs on Vero E6 cells. Six out of seven CMs were found tobe not cytotoxic. Only CM from T. venulosus at the highestconcentration tested (50%) was found to display slight toxicity onVero E6 cells.
Frenatin 2.3S derived from S. lacteus has anti-YFV activityEncouraged by the anti-YFV results observed with secretions fromS. lacteus CM, we have attempted to characterize the composition ofthe AMPs present in these frog skin secretions. To that extent, we haveused a reverse genetics approach using degenerate primers based onconserved sequences of several AMPs secreted by Phyllomedusa,22 asdescribed in Materials and Methods section. Several clones wereisolated and three clones were selected for sequencing (Sl-5, Sl-11 andSl-16). The three clones were found to code for the same AMPprecursor (Figure 5).The cDNA sequence is 317-bp long with an open reading frame
(ORF) that encodes a peptide of 71 amino-acid residues in length. ABLASTn search in the Genbank Database revealed that our sequencehas the characteristic structure of anuran AMP precursors containing aputative signal peptide, an N-terminal acidic spacer domain, a Lys-Arg
(K-R) processing site and the mature AMP at the C-terminus. Thesignal peptide was identical in structure to frenatin 1.1 from Litoriainfrafrenata,28 but it shows differences in the region localized on theacidic spacer domain and also in the frenatin encoding regions.Alignments of both full-length nucleic acid sequences (Figure 6) madeusing the ClustalW software revealed that preprofrenatin exhibited anidentity of 66.7% at the amino-acid level. The new sequence wasdeposited in the database on 2012 (Accession no. AGB51284.1) andwas confirmed and further characterized by Conlon et al.5
To test the antiviral activity of the newly found AMP, wesynthesized the peptide based on the previously characterized F 2.3Sas described in Materials and Methods section. Figure 7a shows that ata concentration of 20 μg ml− 1 has a 35% protective effect in Vero E6cells infected with YFV (10 LD50). It should be noted that this peptidewas also tested and found not to be cytotoxic at 100 μg ml− 1 to VeroE6 cells as shown in Figure 7b.
DISCUSSION
In recent years, the Flavivirus genus has gained further attention dueto re-emergence and increasing incidence of YFV, Dengue and othersmember of this group.16 Infections with YFV are a global public healthproblem and there is an urgent necessity of more potent and safeantivirals. For this reason, our ‘biorational approach’29 is based onchemical prospecting which uses clues from amphibian physiologyand its interaction with the environment. The physiological structureof the skin of these organisms and their exposure to such variedhabitats with high microbial load is the reason why they areconsidered as an interesting model in the search of AMPs withpossible medical and biotechnological significance.In the present study, we evaluated frog skin secretions (CMs) from
seven species against YFV. The results showed that the secretionsfrom S. lacteus, C. boulongery and L. fuscus presented the best antiviralactivity (Figure 3). We found that the frog skin secretions fromS. lacteus had potent anti-YFV activity. We have also first identifiedthe complete precursor of F2.3S from SMOs of S. lacteus after 2 daysin culture, which was deposited in the GenBank accession no.AGB51284.1 and was then confirmed and characterized byConlon et al.5 This AMP is highly related in the signal peptide regionto the previous reported frenatin 1.1 from Litoria infrafrenata(Hylidae, Pelodryadinae), but shows limited similarity with themature peptide28 and also with frenatin 2D from Discoglossus sardus(Alyti-dae).30
Figure 1 Cytotoxic effect of frog skin secretions (CMs 5, 25 and 50%) from seven species in CHO-K1 cell line. Results are reported as percentage ofuntreated controls. The data are presented as the mean of three replicate samples. ANOVA *P-value o0.05.
Figure 2 Vero E6 cell viability after the infection with three viral doses: 0.1LD50, 1 LD50 and 10 LD50 over a period of 6 days. Dunnett’s test indicatedsignificant differences (*P-value o0.05) between each treatment in relationto control.
anti-YFV activities from frog skin secretionsC Muñoz-Camargo et al
3
The Journal of Antibiotics
Figure 3 Potent anti-YFV activity of conditioned media (CM) from (a) Sphaenorhynchus lacteus, (b) Criptobatrachus boulengeri and (c) Leptodactylus fuscuson Vero E6 cells. First panel: cytotoxic effect in Vero E6 cells of the CMs at different concentrations (5, 25 and 50%). The other three panels show Vero E6cells exposed to three concentrations of YFV (0.1 LD50, 1 LD50 and 10 LD50) treated with 5, 25 and 50% of CM. Tukey test *P-value o0.05, **P-valueo0.01, ***P-valueo0.001.
anti-YFV activities from frog skin secretionsC Muñoz-Camargo et al
4
The Journal of Antibiotics
We here further show that this F 2.3S has moderate anti-YFV cellprotective (35%) activity at the high concentration of 20 μg ml− 1. Thefact that total CM from S. lacteus has a much potent activity is notunexpected since most likely—as discussed previously19—antimicro-bial activity secreted by skin of amphibians is unlikely to be caused bya single peptide.31 Experiments are in progress to determine thesequence of other novel AMPs present in the active CMs using LCMS/MS analysis.Although there are no reports of frog AMPs against YFV or other
flaviviruses, there are relevant amphibian AMPs with antiviral proper-ties, like Magainin-1 and 2 (Xenopus laevis)32 and Dermaseptin S1-S5(Phyllomedusa sauvagei), which have activity against herpes simplexvirus type 1 and type 2,9 and caerin 1.1, caerin 1.9 and maculatin 1.1from different species of Australian tree frogs which inhibit HIVinfection.11 In addition, other authors16 found that ivermectin, a
broadly used anti-helminthic drug, presents a potent anti-YFV activity;however, it looses effectiveness against others flaviviruses. Given this,the synergism of this drug with AMPs would be an interesting form topotentiate the antiviral effect of both compounds. Recently, there havebeen reports of proinflammatory and immunomodulatory propertiesfrom S. lacteus frenatins, included F 2.3S5 in response to bacterialinfections. For this reason, we speculate that F2.3S could activate thesignal pathway to recognize and regulate a viral infection response.33
In this regard, AMPs exert broad-spectrum antimicrobial activity,apart from many other potential roles in innate immunity, andrepresent a promising class of antiviral agents including bothenveloped and non-enveloped viruses.34 Recent advances in under-standing the mechanisms of their antiviral action(s) indicate that theyhave a dual role in antiviral defense, acting not only directly on thevirion but also on the host cell.34
Figure 4 Moderate anti-YFV activity of conditioned media (CM) from (a) Hypsiboas fasciatus, (b) Pristimantis medemi, (c) Hypsiboas lanciformis and (d)Trachycephalus venulosus on Vero E6 cells. First panel: cytotoxic effect in Vero E6 cells of the CMs at different concentrations (5, 25 and 50%). The otherthree panels show Vero E6 cells exposed to three concentrations of YFV (0.1 LD50, 1 LD50 and 10 LD50) treated with 5, 25 and 50% of CM. Tukey test*P-value o0.05, **P-value o0.01, ***P-valueo0.001.
anti-YFV activities from frog skin secretionsC Muñoz-Camargo et al
5
The Journal of Antibiotics
It is important, however, to point out that activity of F 2.3S wasspecific against YFV and had no toxic effect in the somatic cells testedas shown in Figure 7.
Another important issue to evaluate in AMPs prospecting is thetoxicity in somatic cells. Consequently, we determined the effect of theCMs from the seven frog species in CHO-K1 and Vero E6 cells atdifferent CM dilutions. The results showed that just T. venulosusreduced the cell viability in CHO-K1 and Vero E6 (Figure 4d), but inboth cases this reduction was not superior to 50%. The other six-frogspecies’ CMs were not cytotoxic for CHO-K1 (Figure 1) and Vero E6(Figures 3 and 4). Additionally, we evaluated the cytotoxicity of F 2.3Sin Vero E6 cells and found that the peptide was not toxic at five timesthe concentration used in the antiviral assay.
Figure 5 Skin micro-organs cDNA sequence from S. lacteus Sl-11 cloneencoding a novel peptide. The amino-acid sequence is given in singleletters. Putative signal peptide sequence is single-underlined, acidicspacer domain is dotted-underlined, processing site K-R (lysine-arginine)is in bold letters, mature peptide sequence is bold-underlined andasterisk indicates stop codon.
Figure 6 Comparison of S. lacteus frenatin peptide (F 2.3S) with theirclose amphibian skin AMPs homolog, frenatin from Litoria genus (F 1.1).Peptide alignment is indicated as follow: (*) conserved amino-acidresidues, (:) amino-acid residues with similar properties, (.) amino-acidresidues dissimilar and (− ) gaps.
Figure 4 Continued
anti-YFV activities from frog skin secretionsC Muñoz-Camargo et al
6
The Journal of Antibiotics
In summary, the results against YFV using CMs from differentfrog’s species demonstrated the antiviral potential of these secretions,especially from S. lateus, C. boulengeri and L. fuscus. Therefore, it canbe concluded that these CMs are good candidates for furtherproteomic and biological characterization. We have also identifiedencoding precursor for F 2.3S peptide from S. lacteus SMOs, whichmay be a key component on facilitating the strong anti-YFV activityfound in skin secretions of S. lacteus.Activity of F 2.3S was specific against YFV and had no toxic effect
against the actual somatic cells tested. We have not tested the activityof F 2.3S peptide against other viruses. However, it is rare that frogswould have developed a mechanism in which a single peptide eitherworks alone or is toxic to only one type of micro-organism. In spite ofthis, it is surprising that F 2.3S can display a 35% YFV inhibition on itsown. As shown here, total CM from S. lacteus has a much potentactivity than the isolated peptide. Most probable—as discussedpreviously19—antimicrobial activity secreted by skin of amphibiansis unlikely to be caused by a single peptide and it is the combinationsof various of them that provide a broader and effective antimicrobialeffect.Accordingly with this, other authors demonstrated that AMPs
individually have a certain spectra of antimicrobial activity, but theiractivity was considerably amplified upon combination with otherpeptides.35 In nature synergism within AMPs contributes to theexplanation of the presence of several peptides in most tissues indifferent species, in order to broaden the antimicrobial spectrumAMPs.36
CONFLICT OF INTERESTThe authors declare no conflict of interest.
ACKNOWLEDGEMENTS
This research was funded by COLCIENCIAS CODE 1204-343, by Comité de
Investigaciones y Postgrados, Facultad de Ciencias from Universidad de los
Andes, Colombia, Fundación Bolivar Davivienda, Labbrands and by a special
grant from the Hebrew University to E.M. We thank Dr Jhon Lynch,
Universidad Nacional de Colombia, Dr Andrew Crawford and Dr Adolfo
Amézquita, Universidad de los Andes for they kind help in the identification of
the species collected Jairo Mendez, Instituto Nacional de Salud for his advice
with the antiviral assays.
1 Waghu, F. H. et al. CAMP: collection of sequences and structures of antimicrobialpeptides. Nucleic Acids Res. 42, 1154–1158 (2014).
2 Conlon, J. M. & Mechkarska, M. Host-defense peptides with therapeutic potential fromskin secretions of frogs from the family pipidae. Pharmaceuticals (Basel) 7,58–77 (2014).
3 Vanhoye, D., Bruston, F., Nicolas, P. & Amiche, M. Antimicrobial peptides from hylidand ranin frogs originated from a 150-million-year-old ancestral precursor with aconserved signal peptide but a hypermutable antimicrobial domain. Eur. J. Biochem.270, 2068–2081 (2003).
4 Conlon, J. M. The contribution of skin antimicrobial peptides to the system of innateimmunity in anurans. Cell Tissue Res. 343, 201–212 (2011).
5 Conlon, J. M. et al. A family of antimicrobial and immunomodulatory peptides related tothe frenatins from skin secretions of the Orinoco lime frog Sphaenorhynchus lacteus(Hylidae). Peptides 56, 132–140 (2014).
6 Mechkarska, M. et al. An analog of the host-defense peptide hymenochirin-1Bwith potent broad-spectrum activity against multidrug-resistant bacteria andimmunomodulatory properties. Peptides 50, 153–159 (2013).
7 Conlon, J. M. et al. Isolation of peptides of the brevinin-1 family with potentcandidacidal activity from the skin secretions of the frog Rana boylii. J. Pept. Res. 62,207–213 (2003).
8 Conlon, J. M. et al. Evaluation of the Skin Peptide Defenses of the Oregon Spotted FrogRana pretiosa Against Infection by the Chytrid Fungus Batrachochytrium dendrobatidis.J. Chem. Ecol. 39, 797–805 (2013).
9 Bergaoui, I. et al. In vitro antiviral activity of dermaseptin S4 and derivatives fromamphibian skin against herpes simplex virus type 2. J. Med. Virol. 85,272–281 (2013).
10 Belaid, A. et al. In vitro antiviral activity of dermaseptins against herpes simplexvirus type 1. J. Med. Virol. 66, 229–234 (2002).
11 Vancompernolle, S. E. et al. Antimicrobial peptides from amphibian skin potentlyinhibit human immunodeficiency virus infection and transfer of virus from dendriticcells to T cells. J. Virol. 79, 11598–11606 (2005).
12 Rushika, P., Mansoora, K. & Richard, J. K. Closing the door on flaviviruses: entry as atarget for antiviral drug design. Antiviral Res. 80, 11–22 (2009).
13 Umamaheswari, A., Kumar, M., Pradhan, D. & Marisetty, H. Docking studies towardsexploring antiviral compounds against envelope protein of yellow fever virus. Interdiscip.Sci. Comput. Life Sci. 3, 64–77 (2011).
14 Monath, T. P. Yellow fever: an update. Lancet Infect. Dis. 1, 11–20 (2015).15 Staples, J. & Monath, T. Yellow fever: 100 years of discovery. J. Am. Med. Assoc. 300,
960–962 (2008).16 Mastrangelo, E. et al. Ivermectin is a potent inhibitor of flavivirus replication specifically
targeting NS3 helicase activity: new prospects for an old drug. J. Antimicrob.Chemother. 67, 1884–1894 (2012).
17 Hill, D. Mapping the risk of yellow fever infection. Curr. Infect. Dis. Rep. 14,246–255 (2012).
18 Ngoagouni, C. et al. Entomological profile of yellow fever epidemics in the CentralAfrican Republic, 2006–2010. Parasit. Vectors 5, 175 (2012).
19 Groot, H. et al. Skin micro-organs from several frog species secrete a repertoire ofpowerful antimicrobials in culture. J. Antibiot. 65, 461–467 (2012).
20 Rollins-Smith, L. A. et al. Activity of antimicrobial skin peptides from ranid frogs againstBatrachochytrium dendrobatidis, the chytrid fungus associated with global amphibiandeclines. Dev. Comp. Immunol. 26, 471–479 (2002).
21 Chomczynski, P. & Sacchi, N. Single-step method of RNA isolation by acidguanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156–159 (1987).
22 Chen, T., Zhou, M., Gagliardo, R., Walker, B. & Shaw, C. Elements of the granular glandpeptidome and transcriptome persist in air-dried skin of the South American orange-leggedleaf frog, Phyllomedusa hypocondrialis. Peptides 27, 2129–2136 (2006).
Figure 7 Antiviral (a) and cytotoxic (b) effect of S. lacteus frenatin 2.3S peptide in Vero E6 cell line infected with YFV (10 LD50). Tukey *P-value o0.05,**P-value o0.01.
anti-YFV activities from frog skin secretionsC Muñoz-Camargo et al
7
The Journal of Antibiotics
23 Altschul, S. F. et al. Gapped BLAST and PSI-BLAST: a new generation of proteindatabase search programs. Nucleic Acids Res. 25, 3389–3402 (1997).
24 Thompson, J. D., Gibson, T. J. & Higgins, D. G. Multiple Sequence Alignment UsingClustalW and ClustalX. Current Protocols in Bioinformatics. (John Wiley & Sons, Inc.,2002).
25 Neyts, J., Meerbach, A., Mckenna, P. & Declercq, E. Use of the yellow fever virusvaccine strain 17D for the study of strategies for the treatment of yellow fevervirus infections. Antiviral Res. 30, 125–132 (1996).
26 Sudo, K., Konno, K., Yokota, T. & Shigeta, S. A screening system for antiviralcompounds against Herpes Simplex Virus type 1 using the MTT method withL929 cells. Tohoku J. Exp. Med. 176, 163–171 (1995).
27 Leyssen, P., De Clercq, E. & Neyts, J. The anti-yellow fever virus activity of ribavirin isindependent of error-prone replication. Mol. Pharmacol. 69, 1461–1467 (2006).
28 Zhou, M., Chen, T., Walker, B. & Shaw, C. Novel frenatins from the skin of theAustralasian giant white-lipped tree frog, Litoria infrafrenata: cloning of precursorcDNAs and identification in defensive skin secretion. Peptides 26, 2445–2451 (2005).
29 Clarke, B. T. The natural history of amphibian skin secretions, their normal functioningand potential medical applications. Biol. Rev. Camb. Philos. Soc. 72,365–379 (1997).
30 Conlon, J. M. et al. An immunomodulatory peptide related to frenatin 2 from skinsecretions of the Tyrrhenian painted frog Discoglossus sardus (Alytidae). Peptides 40,65–71 (2013).
31 Chinchar, V. G. et al. Inactivation of viruses infecting ectothermic animals by amphibianand piscine antimicrobial peptides. Virology 323, 268–275 (2004).
32 Albiol Matanic, V. & Castilla, V. Antiviral activity of antimicrobial cationic peptidesagainst Junin virus and herpes simplex virus. J. Antimicrob. Agents 23,382–389 (2004).
33 Davies, J. & Davies, D. Origins and evolution of antibiotic resistance. Microbiol. Mol.Biol. Rev. 74, 417–433 (2010).
34 Klotman, M. E. & Chang, T. L. Defensins in innate antiviral immunity. Nat. Rev.Immunol. 6, 447–456 (2006).
35 Mor, A., Hani, K. & Nicolas, P. The vertebrate peptide antibiotics dermaseptins haveoverlapping structural features but target specific microorganisms. J. Biol. Chem. 269,31635–31641 (1994).
36 Cassone, M. & Otvos, L. Synergy among antibacterial peptides and betweenpeptides and small-molecule antibiotics. Expert Rev. Anti. Infect. Ther. 8,703–716 (2010).
anti-YFV activities from frog skin secretionsC Muñoz-Camargo et al
8
The Journal of Antibiotics
33
6.2.Conclusiones capítulo 2
-Los medios condicionados de S. lateus y C. boulengeri presentan una potente
actividad antiviral contra el virus de la fiebre amarilla y no son tóxicos para células
somáticas.
-Estos medios condicionados son buenos candidatos para posteriores caracterizaciones proteómicas y biológicas.
-De identificó el precursor completo del péptido F.2.3S derivado de MOs cultivados de S. lacteus.
-En los ensayos antivirales con F 2.3S se encontró que este péptido puede ser un componente importante para activar la respuesta inmune frente al virus de la fiebre amarilla.
-El péptido F2.3S no presenta toxicidad en células Vero E6 a concentraciones de hasta 100 µg/mL.
34
7. Conclusiones Generales
-Se implementó el cultivo de MOs como una nueva forma de obtener secreciones de piel de ranas en cantidades suficientes para análisis de actividad, identificación y caracterización de péptidos antimicrobianos.
-Se encontró que los medios condicionados obtenidos de cultivo de MOs, presentan potente actividad contra bacterias Gram+ y Gram-, el virus de la fiebre amarilla, sin causar daño en líneas celulares, lo cual es un indicador de la eficiencia en recuperación de compuestos de esta nueva técnica.
-A partir de medios condicionados y MOs se identificaron los siete péptidos nuevos y la buforina II en la especie S. lacteus, con lo cual se confirma que esta metodología también es útil para la identificación de PAM.
-Se demostró que los nuevos péptidos tienen potencial para aplicación en el tratamiento de enfermedades infecciosas y de forma interesante se encontró que la combinación de los 8P presentan actividad contra bacterias de interés clínico como P. aeruginosa y S. aureus.
-Los diferentes mecanismos de acción que se evidenciaron en los tres péptidos más potentes son un indicio de su actividad de amplio espectro que podría combatir bacterias multiresistentes, como las mencionadas anteriormente.
35
10. Referencias 1. Clarke BT. The natural history of amphibian skin secretions, their normal
functioning and potential medical applications. Biol Rev Camb Philos Soc. 1997;72(3):365-379. doi:10.1017/S0006323197005045.
2. Chen T, Farragher S, Bjourson AJ, Orr DF, Rao P, Shaw C. Granular gland transcriptomes in stimulated amphibian skin secretions. Biochem J. 2003;371(Pt 1):125-130. doi:10.1042/BJ20021343.
3. Simmaco M, Mignogna G, Barra D, Bossa F. Antimicrobial peptides from skin secretions of Rana esculenta. Molecular cloning of cDNAs encoding esculentin and brevinins and isolation of new active peptides. J Biol Chem . 1994;269 (16 ):11956-11961. http://www.jbc.org/content/269/16/11956.abstract.
4. Vanhoye D, Bruston F, Nicolas P, Amiche M. Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain. Eur J Biochem. 2003;270(9):2068-2081. doi:10.1046/j.1432-1033.2003.03584.x.
5. Waghu FH, Gopi L, Barai RS, Ramteke P, Nizami B, Idicula-Thomas S. CAMP: Collection of sequences and structures of antimicrobial peptides. Nucleic Acids Res. 2014;42(D1):1154-1158. doi:10.1093/nar/gkt1157.
6. Galeano S.P., Urbina J.C., Gutiérrez-C.P.D.A. R-CM y PVP. Los anfibios de Colombia, diversidad y estado del conocimiento. Tomo II. In: Informe Sobre El Avance En El Conocimientoy La Información de La Biodiversidad 1998 -2004. Instituto de Investigación de RecursosBiológicos Alexander von Humboldt. BogotáD.C., Colombia. 2 Tomos. Vol ; 2006:92-104.
7. Acosta Galvis A. Lista de los Anfibios de Colombia: Referencia en linea V.05.2015.0 (agosto 2015). http://www.batrachia.com/. 2015. http://www.batrachia.com/.
8. WHO. Antimicrobial resistance: global report on surveillance 2014. http://www.who.int/en/. 2014:257. WHO, Antimicrobial resistance: global report on surveillance 2014. http://www.who.int/drugresistance/documents/surveillancereport/en/, 2014: p. 257.
9. Groot H, Muñoz-Camargo C, Moscoso J, et al. Skin micro-organs from several frog species secrete a repertoire of powerful antimicrobials in culture. J Antibiot (Tokyo). 2012;65(9):461-467.
10. Mitrani E, Nadel G, Hasson E, Harari E, Shimoni Y. Epithelial-mesenchymal interactions allow for epidermal cells to display an in vivo-like phenotype in vitro. Differentiation. 2005;73(2-3):79-87. doi:10.1111/j.1432-0436.2005.07302002.x.
11. Park CBC, Kim MMS, Kim SCS. A novel antimicrobial peptide from Bufo bufo
36
gargarizans. Biochem Biophys Res …. 1996;218(1):408-413. doi:10.1006/bbrc.1996.0071.
12. Aminov RI, Otto M, Sommer A. A brief history of the antibiotic era : lessons learned and challenges for the future. 2010;1(December):1-7. doi:10.3389/fmicb.2010.00134.
13. Davies J, Davies D. Origins and Evolution of Antibiotic Resistance. Microbiol Mol Biol Rev. 2010;74(3):417-433. doi:10.1128/MMBR.00016-10.
14. CDC 2015. Antibiotic / Antimicrobial Resistancee. http://www.cdc.gov/drugresistance/.
15. Chopra I. The 2012 Garrod Lecture: Discovery of antibacterial drugs in the 21st century. 2013;17(November 2012):496-505. doi:10.1093/jac/dks436.
16. Levin BR, Bull JJ. Population and evolutionary dynamics of phage therapy. Nat Rev Micro. 2004;2(2):166-173. http://dx.doi.org/10.1038/nrmicro822.
17. Hancock REW, Sahl H-G. Antimicrobial and host-defense peptides as new anti-infective therapeutic strategies. Nat Biotech. 2006;24(12):1551-1557. http://dx.doi.org/10.1038/nbt1267.
18. Conlon, J. Michael and Sonnevend A. Antimicrobial Peptides in Frog Skin Secretions. In: ANTIMICROBIAL PEPTIDES, Methods Mol Biol. Vol ; 2010:3-14. doi:doi: 10.1007/978-1-60761-594-1_1.
19. Conlon JM. The contribution of skin antimicrobial peptides to the system of innate immunity in anurans. Cell Tissue Res. 2011;343(1):201-212. doi:10.1007/s00441-010-1014-4.
20. Abraham E., Chain E. An enzime from bacteria able to destroy penicillin. Nature. 1940;146:837. doi:doi:10.1038/146837a0.
21. Walsh CT, Wencewicz TA. Prospects for new antibiotics : a molecule-centered perspective. 2013;67(1):7-22. doi:10.1038/ja.2013.49.
22. Tally FP, DeBruin MF. Development of daptomycin for Gram-positive infections. J Antimicrob Chemother. 2000;46(4):523-526. doi:10.1093/jac/46.4.523.
23. Gentry DR, McCloskey L, Gwynn MN, et al. Genetic characterization of Vga ABC proteins conferring reduced susceptibility to pleuromutilins in Staphylococcus aureus. Antimicrob Agents Chemother. 2008;52(12):4507-4509. doi:10.1128/AAC.00915-08.
24. Goldstein EJC, Citron DM, Sears P, Babakhani F, Sambol SP, Gerding DN. Comparative Susceptibilities to Fidaxomicin (OPT-80) of Isolates Collected at Baseline, Recurrence, and Failure from Patients in Two Phase III Trials of Fidaxomicin against Clostridium difficile Infection . Antimicrob Agents Chemother. 2011;55(11):5194-5199. doi:10.1128/AAC.00625-11.
25. Cohen J. Approval of Novel TB Drug Celebrated—With Restraint. Science (80- ). 2013;339(6116):130. http://science.sciencemag.org/content/339/6116/130.abstract.
37
26. Magiorakos a, Srinivasan A, Carey RB, et al. Bacteria : an International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Microbiology. 2011;18(3):268-281. doi:10.1111/j.1469-0691.2011.03570.x.
27. Boucher HW, Talbot GH, Bradley JS, et al. Bad Bugs, No Drugs: No ESKAPE! An Update from the Infectious Diseases Society of America. Clin Infect Dis. 2009;48(1):1-12. doi:10.1086/595011.
28. Falagas ME, Kasiakou SK, Saravolatz LD. Colistin: The Revival of Polymyxins for the Management of Multidrug-Resistant Gram-Negative Bacterial Infections. Clin Infect Dis. 2005;40(9):1333-1341. doi:10.1086/429323.
29. Centerwatch. 2016 FDA Approved Drugs. 2016. http://www.centerwatch.com/drug-information/fda-approved-drugs/year/2016.
30. Hancock RE., Lehrer R. Cationic peptides: a new source of antibiotics. Trends Biotechnol. 1998;16(2):82-88. doi:10.1016/S0167-7799(97)01156-6.
31. Jenssen H, Hamill P, Hancock REW. Peptide antimicrobial agents. Clin Microbiol Rev. 2006;19(3):491-511. doi:10.1128/CMR.00056-05.
32. Wang G, Li X, Wang Z. APD2: The updated antimicrobial peptide database and its application in peptide design. Nucleic Acids Res. 2009;37(SUPPL. 1):933-937. doi:10.1093/nar/gkn823.
33. Thomas S, Karnik S, Barai RS, Jayaraman VK, Idicula-Thomas S. CAMP: a useful resource for research on antimicrobial peptides. Nucleic Acids Res . 2010;38 (suppl 1 ):D774-D780. doi:10.1093/nar/gkp1021.
34. Beisswenger C, Bals R. Functions of antimicrobial peptides in host defense and immunity. Curr Protein Pept Sci. 2005;6(3):255-264. doi:10.2174/1389203054065428.
35. Simmaco M, Mignogna G, Barra D. Antimicrobial peptides from amphibian skin: What do they tell us? Pept Sci. 1998;47(6):435-450. doi:10.1002/(SICI)1097-0282(1998)47:6<435::AID-BIP3>3.0.CO;2-8.
36. Narayana JL, Chen J-Y. Antimicrobial peptides: Possible anti-infective agents. Peptides. 2015:1-7. doi:10.1016/j.peptides.2015.05.012.
37. Brogden KA. Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? Nat Rev Micro. 2005;3(3):238-250. http://dx.doi.org/10.1038/nrmicro1098.
38. Bulet P, Stöcklin R, Menin L. Anti-microbial peptides: from invertebrates to vertebrates. Immunol Rev. 2004;198(1):169-184. doi:10.1111/j.0105-2896.2004.0124.x.
39. Guilhelmelli F, Vilela N, Albuquerque P, Derengowski LDS, Silva-Pereira I, Kyaw CM. Antibiotic development challenges: The various mechanisms of action of antimicrobial peptides and of bacterial resistance. Front Microbiol. 2013;4(DEC):1-12. doi:10.3389/fmicb.2013.00353.
40. Marsh ENG, Buer BC, Ramamoorthy A. Fluorine-a new element in the
38
design of membrane-active peptides. Mol Biosyst. 2009;5(10):1143-1147. doi:10.1039/B909864J.
41. Hancock REW, Chapple DS. MINIREVIEW Peptide Antibiotics. Antimicrob Agents Chemother. 1999;43(6):1317-1323.
42. Peschel A, Sahl H-G. The co-evolution of host cationic antimicrobial peptides and microbial resistance. Nat Rev Micro. 2006;4(7):529-536. http://dx.doi.org/10.1038/nrmicro1441.
43. Hankins J V, Madsen JA, Giles DK, Brodbelt JS, Trent MS. Amino acid addition to Vibrio cholerae LPS establishes a link between surface remodeling in gram-positive and gram-negative bacteria. Proc Natl Acad Sci U S A. 2012;109(22):8722-8727. doi:10.1073/pnas.1201313109.
44. Shireen T, Singh M, Das T, Mukhopadhyay K. Differential Adaptive Responses of Staphylococcus aureus to In Vitro Selection with Different Antimicrobial Peptides. Antimicrob Agents Chemother. 2013;57(10):5134-5137. doi:10.1128/AAC.00780-13.
45. Campos M a, Vargas M a, Regueiro V, Llompart CM, Albertí S, José A. Capsule Polysaccharide Mediates Bacterial Resistance to Antimicrobial Peptides Capsule Polysaccharide Mediates Bacterial Resistance to Antimicrobial Peptides. Infect Immun. 2004;72(12):7107-7114. doi:10.1128/IAI.72.12.7107.
46. Mulcahy H, Charron-Mazenod L, Lewenza S. Extracellular DNA Chelates Cations and Induces Antibiotic Resistance in Pseudomonas aeruginosa Biofilms. PLoS Pathog. 2008;4(11):e1000213. doi:10.1371/journal.ppat.1000213.
47. Nicolas P, Vanhoye D, Amiche M. Molecular strategies in biological evolution of antimicrobial peptides. Peptides. 2003;24(11):1669-1680. doi:10.1016/j.peptides.2003.08.017.
48. Duda TF, Vanhoye D, Nicolas P. Roles of diversifying selection and coordinated evolution in the evolution of amphibian antimicrobial peptides. Mol Biol Evol. 2002;19(6):858-864.
49. Conlon JM. The therapeutic potential of antimicrobial peptides from frog skin. Rev Med Microbiol. 2004;15(1). http://journals.lww.com/revmedmicrobiol/Fulltext/2004/01000/The_therapeutic_potential_of_antimicrobial.3.aspx.
50. Chen T, Walker B, Zhou M, Shaw C. Dermatoxin and phylloxin from the waxy monkey frog, Phyllomedusa sauvagei: cloning of precursor cDNAs and structural characterization from lyophilized skin secretion. Regul Pept. 2005;129(1-3):103-108. doi:10.1016/j.regpep.2005.01.017.
51. Lequin O, Ladram A, Chabbert L, et al. Dermaseptin S9, an α-Helical Antimicrobial Peptide with a Hydrophobic Core and Cationic Termini†. Biochemistry. 2006;45(2):468-480. doi:10.1021/bi051711i.
52. Mangoni ML, Marcellini H. G. L, Simmaco M. Biological characterization and
39
modes of action of temporins and bombinins H, multiple forms of short and mildly cationic anti-microbial peptides from amphibian skin. J Pept Sci. 2007;13(9):603-613. doi:10.1002/psc.853.
53. Giovannini MG, Poulter L, Gibson BW, Williams DH. Biosynthesis and degradation of peptides derived from Xenopus laevis prohormones. Biochem J. 1987;243(1):113-120.
54. Rollins-Smith L a, Reinert LK, O’Leary CJ, Houston LE, Woodhams DC. Antimicrobial Peptide defenses in amphibian skin. Integr Comp Biol. 2005;45(1):137-142. doi:10.1093/icb/45.1.137.
55. Hasson E, Gallula J, Shimoni Y, Grad-Itach E, Marikovsky M, Mitrani E. Skin-derived micro-organs induce angiogenesis in rabbits. J Vasc Res. 2006;43(2):139-148. doi:10.1159/000090943.
56. Voisine P, Rosinberg A, Wykrzykowska JJ, et al. Skin-derived microorgan autotransplantation as a novel approach for therapeutic angiogenesis. Am J Physiol Heart Circ Physiol. 2008;294(1):H213-H219. doi:10.1152/ajpheart.00112.2007.
57. MITRANI E, PEARLMAN A, STERN B, et al. Biopump: Autologous skin-derived micro-organ genetically engineered to provide sustained continuous secretion of therapeutic proteins. Dermatol Ther. 2011;24(5):489-497. doi:10.1111/j.1529-8019.2012.01457.x.
58. Nägele E, Vollmer M, Hörth P, Vad C. 2D-LC/MS techniques for the identification of proteins in highly complex mixtures. Expert Rev Proteomics. 2004;1(1):37-46. doi:10.1586/14789450.1.1.37.
59. Ivanov VT, Yatskin ON. Peptidomics: a logical sequel to proteomics. Expert Rev Proteomics. 2005;2(4):463-473. doi:10.1586/14789450.2.4.463.
60. Wang L, Evaristo G, Zhou M, et al. Nigrocin-2 peptides from Chinese Odorrana frogs - Integration of UPLC/MS/MS with molecular cloning in amphibian skin peptidome analysis. FEBS J. 2010;277(6):1519-1531. doi:10.1111/j.1742-4658.2010.07580.x.
61. Leica. Performing a Hematoxylin and Eosin Stain - a Step by Step Guide. http://www.leicabiosystems.com/pathologyleaders/performing-a-hematoxylin-and-eosin-stain-a-step-by-step-guide/.
62. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162(1):156-159. doi:http://dx.doi.org/10.1016/0003-2697(87)90021-2.
63. Schadich E, Cole ALJ, Squire M, Mason D. Skin peptides of different life stages of Ewing’s tree frog. J Exp Zool Part A Ecol Genet Physiol. 2010;313 A(8):532-537. doi:10.1002/jez.582.
64. Li J, Xu X, Xu C, et al. Anti-infection peptidomics of amphibian skin. Mol Cell Proteomics. 2007;6(5):882-894. doi:10.1074/mcp.M600334-MCP200.
65. Lacombe C, Cifuentes-Diaz C, Dunia I, Auber-Thomay M, Nicolas P, Amiche M. Peptide secretion in the cutaneous glands of South American tree frog
40
Phyllomedusa bicolor: an ultrastructural study. Eur J Cell Biol. 2000;79(9):631-641. doi:10.1078/0171-9335-00085.
66. Woodhams D, Rollins-Smith L, Carey C, Reinert L, Tyler M, Alford R. Population trends associated with skin peptide defenses against chytridiomycosis in Australian frogs. Oecologia. 2006;146(4):531-540. doi:10.1007/s00442-005-0228-8.
67. Charpentier S, Amiche M, Mester J, et al. Structure, Synthesis, and Molecular Cloning of Dermaseptins B, a Family of Skin Peptide Antibiotics. J Biol Chem . 1998;273 (24 ):14690-14697. doi:10.1074/jbc.273.24.14690.
68. Leyssen P, De Clercq E, Neyts J. The Anti-Yellow Fever Virus Activity of Ribavirin Is Independent of Error-Prone Replication. Mol Pharmacol . 2006;69 (4 ):1461-1467. doi:10.1124/mol.105.020057.
69. Neyts J, Meerbach A, Mckenna P, Declercq E. Use of the yellow fever virus vaccine strain 17D for the study of strategies for the treatment of yellow fever virus infections. Antiviral Res. 1996;30(2-3):125-132. doi:10.1016/0166-3542(96)89697-5.
70. Sudo K, Konno K, Yokota T, Shigeta S. A Screening System for Antiviral Compounds against Herpes Simplex Virus Type 1 Using the MTT Method with L929 Cells. Tohoku J Exp Med. 1995;176(3):163-171. doi:10.1620/tjem.176.163.
71. Chen T, Zhou M, Gagliardo R, Walker B, Shaw C. Elements of the granular gland peptidome and transcriptome persist in air-dried skin of the South American orange-legged leaf frog, Phyllomedusa hypocondrialis. Peptides. 2006;27(9):2129-2136. doi:10.1016/j.peptides.2006.04.006.
72. Conlon JM, Mechkarska M, Radosavljevic G, et al. A family of antimicrobial and immunomodulatory peptides related to the frenatins from skin secretions of the Orinoco lime frog Sphaenorhynchus lacteus (Hylidae). Peptides. 2014;56:132-140. doi:10.1016/j.peptides.2014.03.020.
73. Zhou M, Chen T, Walker B, Shaw C. Novel frenatins from the skin of the Australasian giant white-lipped tree frog, Litoria infrafrenata: Cloning of precursor cDNAs and identification in defensive skin secretion. Peptides. 2005;26(12):2445-2451. doi:10.1016/j.peptides.2005.05.019.
74. Pantic JM, Radosavljevic GD, Jovanovic IP, Arsenijevic NN, Conlon JM, Lukic ML. In vivo administration of the frog skin peptide frenatin 2.1S induces immunostimulatory phenotypes of mouse mononuclear cells. Peptides. 2015;71:269-275. doi:10.1016/j.peptides.2015.03.028.
75. Albiol Matanic V, Castilla V. Antiviral activity of antimicrobial cationic peptides against Junin virus and herpes simplex virus. J Antimicrob Agents. 2004;23(4):382-389. doi:http://dx.doi.org/10.1016/j.ijantimicag.2003.07.022.
76. Klotman ME, Chang TL. Defensins in innate antiviral immunity. Nat Rev Immunol. 2006;6(6):447-456. http://dx.doi.org/10.1038/nri1860.
77. Barel G, Ginzberg I. Potato skin proteome is enriched with plant defence
41
components. J Exp Bot. 2008;59(12):3347-3357. doi:10.1093/jxb/ern184.
78. Sol A, Skvirsky Y, Nashef R, et al. Actin Enables the Antimicrobial Action of LL-37 Peptide in the Presence of Microbial Proteases. J Biol Chem. 2014;289(33):22926-22941. doi:10.1074/jbc.M114.579672.
79. Beer I, Barnea E, Ziv T, Admon A. Improving large-scale proteomics by clustering of mass spectrometry data. Proteomics. 2004;4(4):950-960. doi:10.1002/pmic.200300652.
80. Jackway RJ, Pukala TL, Maselli VM, et al. Disulfide-containing peptides from the glandular skin secretions of froglets of the genus Crinia: Structure, activity and evolutionary trends. Regul Pept. 2008;151(1-3):80-87. doi:10.1016/j.regpep.2008.06.004.
81. King JD, Mechkarska M, Coquet L, et al. Host-defense peptides from skin secretions of the tetraploid frogs Xenopus petersii and Xenopus pygmaeus, and the octoploid frog Xenopus lenduensis (Pipidae). Peptides. 2012;33(1):35-43. doi:10.1016/j.peptides.2011.11.015.
82. Conlon JM, Coquet L, Leprince J, et al. Peptidomic analysis of skin secretions from Rana heckscheri and Rana okaloosae provides insight into phylogenetic relationships among frogs of the Aquarana species group. Regul Pept. 2007;138(2-3):87-93. doi:10.1016/j.regpep.2006.08.007.
83. Abbassi F, Oury B, Blasco T, et al. Isolation, characterization and molecular cloning of new temporins from the skin of the North African ranid Pelophylax saharica. Peptides. 2008;29(9):1526-1533. doi:10.1016/j.peptides.2008.05.008.
84. Haney EF, Nazmi K, Bolscher JGM, Vogel HJ. Structural and biophysical characterization of an antimicrobial peptide chimera comprised of lactoferricin and lactoferrampin. Biochim Biophys Acta - Biomembr. 2012;1818(3):762-775. doi:10.1016/j.bbamem.2011.11.023.
85. Singh PK, Tack BF, McCray PB, Welsh MJ. Synergistic and additive killing by antimicrobial factors found in human airway surface liquid. Am J Physiol Lung Cell Mol Physiol. 2000;279(5):L799-L805.
86. Cassone M, Otvos L. Synergy among antibacterial peptides and between peptides and small-molecule antibiotics. Expert Rev Anti Infect Ther. 2010;8(6):703-716. doi:10.1586/eri.10.38.
87. Lüders T, Birkemo GA, Fimland G, Nes IF, Lu T, Nissen-meyer J. Strong Synergy between a Eukaryotic Antimicrobial Peptide and Bacteriocins from Lactic Acid Bacteria Strong Synergy between a Eukaryotic Antimicrobial Peptide and Bacteriocins from Lactic Acid Bacteria. Appl Environ Microbiol. 2003;69(3):1797-1799. doi:10.1128/AEM.69.3.1797.
88. Zhou Y, Peng Y. Synergistic effect of clinically used antibiotics and peptide antibiotics against gram-positive and gram-negative bacteria. Exp Ther Med. 2013;6(4):1000-1004. doi:10.3892/etm.2013.1231.
89. Nishida M, Imura Y, Yamamoto M, Kobayashi S, Yano Y, Matsuzaki K.
42
Interaction of a Magainin−PGLa Hybrid Peptide with Membranes: Insight into the Mechanism of Synergism†. Biochemistry. 2007;46(49):14284-14290. doi:10.1021/bi701850m.
90. Shai Y. Mechanism of the binding, insertion and destabilization of phospholipid bilayer membranes by α-helical antimicrobial and cell non-selective membrane-lytic peptides. Biochim Biophys Acta - Biomembr. 1999;1462(1-2):55-70. doi:10.1016/S0005-2736(99)00200-X.
91. Park CB, Kim HS, Kim SC. Mechanism of action of the antimicrobial peptide buforin II: buforin II kills microorganisms by penetrating the cell membrane and inhibiting cellular functions. Biochem Biophys Res Commun. 1998;244(1):253-257. doi:10.1006/bbrc.1998.8159.
92. Nicolas P, El Amri C. The dermaseptin superfamily: A gene-based combinatorial library of antimicrobial peptides. Biochim Biophys Acta - Biomembr. 2009;1788(8):1537-1550. doi:10.1016/j.bbamem.2008.09.006.
93. Hao G, Shi Y-H, Tang Y-L, Le G-W. The membrane action mechanism of analogs of the antimicrobial peptide Buforin 2. Peptides. 2009;30(8):1421-1427. doi:10.1016/j.peptides.2009.05.016.
94. Park CB, Yi KS, Matsuzaki K, Kim MS, Kim SC. Structure-activity analysis of buforin II, a histone H2A-derived antimicrobial peptide: the proline hinge is responsible for the cell-penetrating ability of buforin II. Proc Natl Acad Sci U S A. 2000;97(15):8245-8250. doi:10.1073/pnas.150518097.
95. Elmore DE. Insights into buforin II membrane translocation from molecular dynamics simulations. Peptides. 2012;38(2):357-362. doi:10.1016/j.peptides.2012.09.022.
96. Gorr S-U, Sotsky JB, Shelar AP, Demuth DR. Design of bacteria-agglutinating peptides derived from parotid secretory protein, a member of the bactericidal/permeability increasing-like protein family. Peptides. 2008;29(12):2118-2127. doi:10.1016/j.peptides.2008.09.019.
97. Irie M, Nitta K NT. Biochemistry of frog ribonucleases. Cell Mol Life Sci. 1998;54(8):775-784.
98. Cruz J, Ortiz C, Guzmán F, Cárdenas C, Fernandez-Lafuente R, Torres R. Design and activity of novel lactoferrampin analogues against O157:H7 enterohemorrhagic escherichia coli. Biopolymers. 2014;101(4):319-328. doi:10.1002/bip.22360.
43
11. Anexo 1. Tabla de especies de ranas colectadas Nº Especie Lugar de colecta
1 Scinax ruber Armero-Guayabal (Tolima) 2 Dendropsophus labialis Cundinamarca 3 Hypsiboas crepitans Armero-Guayabal (Tolima) 4 Cochranella sp. Albania (Mariquita , Tolima) 5 Dendrobates truncatus Armero-Guayabal (Tolima) 6 Rhinella marina Armero-Guayabal (Tolima) 7 Phyllomedusa sp. Anapoima (Cundinamarca) 8 Dendropsophus microcephalus Armero-Guayabal (Tolima) 9 Pseudis paradoxa Palomino (Guajira)
10 Pleurodema brachyops Palomino (Guajira) 11 Leptodactylus bolivianus Leticia (Amazonas) 12 Rhinella granulosa Leticia (Amazonas) 13 Hypsiboas boans Albania (Mariquita , Tolima) 14 Hypsiboas lanciformis Leticia (Amazonas) 15 Sphaenorhynchus dorisae Leticia (Amazonas) 16 Dendropsophus triangulum Leticia (Amazonas) 17 Scinax garbei Leticia (Amazonas) 18 Scinax cruentommus Leticia (Amazonas) 19 Hypsiboas fasciatus Leticia (Amazonas) 20 Leptodactylus leptodactyloides Leticia (Amazonas) 21 Trachycephalus typhonius Albania (Mariquita , Tolima) 22 Pipa pipa Leticia (Amazonas) 23 Hypsiboas punctatus Leticia (Amazonas) 24 Leptodactylus colombiensis Leticia (Amazonas) 25 Pristimantis taeniatus Leticia (Amazonas) 26 Sachatamia punctulata Albania (Mariquita ,Tolima) 27 Leptodactylus sp. Albania (Mariquita ,Tolima) 28 Engystomops pustulosus Armero-Guayabal (Tolima) 29 Centrolene sp. Albania (Mariquita ,Tolima) 30 Hypsiboas cinerascens Albania (Mariquita ,Tolima) 31 Pristimantis medemi Villavicencia (Meta) 32 Cryptobatrachus boulengeri Rio Ancho, Palomino (Guajira) 33 Aromobates saltuensis Rio Ancho, Palomino (Guajira) 34 Scinax rostratus Rio Ancho, Palomino (Guajira)
35 Leptodactylus savagei Rio Ancho, Palomino (Guajira) 36 Espadarana prosoblepon Libano (Tolima) 37 Rulyrana susatamai Linano (Tolima) 38 Pseudopaludicola sp. Rio Ancho, Palomino (Guajira) 39 Scarthyla vigilans Rio Ancho, Palomino (Guajira) 40 Dendropsophus microcephalus Rio Ancho, Palomino (Guajira) 41 Relictivomer pearsei Sabana Larga (Casanare) 42 Phyllomedusa hypochondrialis Sabana Larga (Casanare) 43 Rheobates palmatus Armero-Guayabal (Tolima) 44 Leptodactylus melanonotus Armero-Guayabal (Tolima) 45 Rhinella margaritifera Armero-Guayabal (Tolima) 46 Dendropsophus mathiassoni Santa María (Boyáca) 47 Pristimantis frater Santa María (Boyáca) 48 Pristimantis savagei Santa María (Boyáca) 49 Lithobates vaillanti Orocué (Casanare) 50 Adenophrine adiastola Orocué (Casanare)
44
12. Productos adicionales 12.1 Co-dirección de trabajos
-Actividad Antimicrobiana de Secreciones de Piel De Ranas y Su Relación con Variables Bioclimáticas: un Estudio a Nivel Inter e Intraespecie.
Trabajo de grado pregrado 2016
Estudiante: Laura Guevara
Microbiología- Biología
Directora Microbiología: Helena Groot
Director Biología: Adolfo Amézquita
Co-directora: Carolina Muñoz
-Actividad Biológica de Nuevos Péptidos de Piel de Ranas con Potencial Antimicrobiano en Microorganismos Resistentes.
Tesis de Maestría 2015
Estudiante: Sandra Camargo
Directora: Helena Groot
Co-directora: Carolina Muñoz
14 Hipótesis, Apuntes cientí!cos uniandinos, núm. 16, 2014
Pensamos en las ranas como animales de sangre fría, que viven en su mayoría cerca de ríos, quebradas, lagos, estanques y charcos. Sin embargo, estos extraordinarios organismos son una muestra exitosa de adaptación a distintos tipos de hábitats. A lo largo de su evolución, las ranas han logrado ingeniárselas para manejar la deseca-ción en áreas desérticas, conquistar el suelo y las copas de los árboles, y hasta son capaces de tolerar condicio-nes de congelamiento extremo.
El éxito en la colonización de todos los continentes, con excepción de la Antártida, depende de muchas adaptaciones morfológicas, !siológicas, bioquímicas y de comportamiento. Por esto no deja de sorprendernos el importante papel de un órgano tan frágil como la piel de
[ notas. CIENCIAS BIOLÓGICAS ]
El secreto antimicrobiano de las histonasCarolina Muñoz CamargoM. Sc. Estudiante de doctorado en Ciencias Biológicas en la Universidad de los [email protected]
Valeriano LópezPh. D. Profesor de catedra del Departamento de Ciencias Biológicas de la Universidad de los [email protected]
Helena GrootM. Sc. Profesora titular del Departamento de Ciencias Biológicas de la Universidad de los [email protected]
Fuente: https://www.!ickr.com/photos/e_monk/
Universidad de los Andes, Facultad de Ciencias 15
estos animales, que a pesar de esa fragilidad, está diseñada para sortear adversidades como la desecación y les otorga pro-tección frente a amenazas de su propio hábitat, como puede ser la invasión de pequeños grandes enemigos, como son las bacterias y los hongos. Las moléculas que intervienen en su mecanismo de defensa frente a estos parásitos son de gran in-terés hoy en día, no solo por su importancia en la supervivencia propia de las ranas, sino también por su potencial como nuevos medicamentos para los humanos.
En la piel de las ranas se localizan las llamadas glándulas granulares, encargadas de la síntesis y el almacenamiento de estas moléculas de defensa. En ellas se sintetiza una gran va-riedad de moléculas, entre ellas los péptidos antimicrobianos (AMP). Los AMP son pequeñas moléculas peptídicas produci-das por organismos de todo tipo y que forman parte del sis-tema inmune innato. Entre las características más relevantes está su pequeño tamaño (están constituidas por entre 10 y 50 aminoácidos), lo que hace que puedan transportarse con enor-me facilidad. La mayoría tiene carga positiva (en general +2 a +9), y una buena proporción de los residuos son hidrofóbicos (más del 30%) [1, 2].
En cuanto a su mecanismo de acción, anteriormente se pensaba que radicaba en una única estrategia basada en el aumento de la permeabilidad de la membrana del patógeno. Hoy en día con-tamos con la descripción de varios mecanismos, algunos invo-lucrados en la formación de poros en la membrana, agregación de los lípidos de la membrana y de unión al ADN sin alteración de la membrana [3].
Hasta el momento se han registrado aproximadamente dos mil secuencias de péptidos y proteínas con actividad antimicro-biana, de origen natural muy diverso [4]. Pero el secreto mejor guardado de este tipo de moléculas es que se pueden producir a partir de fragmentos de proteínas con una función biológica
diferente a la de AMP. Hace algunas décadas se creía que las histonas solo tenían funciones en el núcleo de la célula como proteínas encargadas del empaquetamiento y la regulación de los genes en eucariotas. En la actualidad sabemos que tienen funciones extracelulares que están relacionadas con el siste-ma inmune innato. Su actividad como AMP se ha descrito en diferentes animales, como peces, mariscos y ranas. En estas últimas se descubrió la buforina, el primer AMP derivado de una histona del que se tuvo noticia, y cuyo nombre se debe a la rana Bufo gargarizans, en la que fue identi!cada.
La buforina, como los demás AMP, se genera como una pre-proteína, es decir, su forma activa es liberada una vez que se corta la histona H2A en un sitio de reconocimiento. Tras este procesamiento se genera el AMP con las características ante-riormente mencionadas, que posteriormente es secretado para cumplir su función antibacteriana. La buforina I es un AMP de 39 aminoácidos, idéntico al N- terminal de la histona H2A, y cuya función comprobada es la de actuar como efector del sistema inmune; en otras palabras, ayuda al sistema inmune a activarse ante infecciones [5].
Por otro lado, la buforina II, que consta de 21 aminoácidos, deriva de la buforina I y actúa directamente como un AMP de amplio espectro. De acuerdo con lo reportado, presenta activi-dad contra bacterias gram positivas, gram negativas, bacterias multirresistentes, hongos y células cancerígenas. La buforina II es uno de los AMP que cuentan con un mecanismo de acción independiente del rompimiento de la membrana de la bacteria. En este mecanismo juega un papel muy importante la prolina 11 (!gura 1). Se ha demostrado que este aminoácido está directa-mente involucrado en el paso del AMP a través de la membrana de las bacterias, con independencia de que exista un receptor, sin alterar la membrana. Luego de atravesar dicha membrana, interactúa con el ADN de la bacteria para, !nalmente, interrum-pir los procesos vitales de la misma [5].
Figura 1. Representación de la estructura de alfa hélice de la buforina II, péptido antimicrobiano derivado de la histona H2A. Fuente: [5]
Espiral aleatorio Alfa hélice Puente prolina Alfa hélice
16 Hipótesis, Apuntes cientí!cos uniandinos, núm. 16, 2014
POTENCIAL TERAPÉUTICO DE LOS AMP
A partir de los resultados de diferentes trabajos, encontramos que estas moléculas no solo pueden ser utilizadas como tra-tamiento individual, sino que también podrían ser usadas en sinergia con antibióticos convencionales, como inmunoestimu-ladores, para ayudar al sistema inmune a detectar infecciones difíciles y como agentes neutralizantes de toxinas, para evitar sepsis en los pacientes. Además, como en el uso de cualquier medicamento, debe existir un índice terapéutico, es decir, un equilibrio entre la efectividad del medicamento contra un blanco especí!co y los efectos adversos que pueda causar en el hos-pedero. Se ha observado que la buforina II no presenta actividad hemolítica contra eritrocitos humanos, incluso en concentracio-nes doscientas veces mayores a las requeridas para inhibir el crecimiento de bacterias [6].
A pesar de su potencial como nuevos antibióticos, hay dos in-convenientes puntuales para el uso de las buforinas y muchos otros AMP: la posibilidad de que sean degradados por proteasas y el costo de su producción. En lo que respecta a la degradación, hoy en día se trabaja en modi!car químicamente los AMP con el !n de evitar su degradación, y en utilizar un transportador que los libere en su blanco. En cuanto al costo, se busca una solu-ción que involucre la producción de los AMP en Escherichia coli, tratando de neutralizar la carga de los AMP para evitar la lisis de la bacteria en donde se producen.
Por otro lado, desde hace algunos años el Laboratorio de Gené-tica Humana de la Universidad de los Andes viene trabajando en
la identi!cación y el potencial terapéutico de los AMP en algunas especies comunes de ranas de Colombia. Este es un campo de investigación de amplias posibilidades para nuestro país, si se tiene en cuenta la biodiversidad de este grupo de animales y el potencial para la salud humana y animal en la actualidad, cuando los antibióticos convencionales están perdiendo la bata-lla contra las infecciones. •
REFERENCIAS
[1] Clarke BT. The natural history of amphibian skin secretions, their normal functioning and potential medical applications. Biological Reviews 1997; 72(3): 365-379.
[2] Melzer S, Clerens S, Bishop PJ. Skin gland morphology and secretory peptides in naturalized litoria species in New Zea-land. Journal of Herpetology 2013; 47(4): 565-574.
[3] Guilhelmelli F et al. Antibiotic development challenges: the va-rious mechanisms of action of antimicrobial peptides and of bacterial resistance. Frontiers in Microbiology 2013; 4: 353.
[4] Wang G, Li X, Wang Z. APD2: the updated antimicrobial pep-tide database and its application in peptide design. Nucleic Acids Res 2009; 37 (Database issue): D933-7.
[5] Cho JH, Sung BH, Kim SC. Buforins: histone H2A-derived an-timicrobial peptides from toad stomach. Biochim Biophys Acta 2009; 1788(8): 1564-1569.
[6] Kawasaki H, Iwamuro S. Potential roles of histones in host defense as antimicrobial agents. Infectious Disorders - Drug Targets 2008; 8(3): 195-205.
Histona H2AFuente: http://upload.wikimedia.org/wikipedia/commons/5/5e/Protein_H2AFJ_PDB_1aoi.png