- 15 -

대 한 주 산 회 지 제27권 제1호, 2016Korean J Perinatol Vol.27, No.1, Mar., 2016http://dx.doi.org/10.14734/kjp.2016.27.1.15

� Original article �

retardation, learning disability, and epilepsy.1, 2 It is

important to identify and develop therapeutic pro­

cedures to reduce brain injury in neonates with HIE.

The immature brain has generally been considered

to be resistant to the damaging effects of hypoxia and

hypoxic­ischemic (HI). However, it is now appreciat­

ed that there are specific periods of increased sus­

ceptibility, which relate to the maturational stage at

the time of the insult.3

The central nervous system (CNS) consists of

the brain and the spinal cord. The brain is made up

of ex tensive and complex networks of neurons and

Perinatal hypoxic­ischemic encephalopathy (HIE)

following asphyxia during antepartum, intrapartum

and postpartum remains a common cause of chronic

handicapping conditions of cerebral palsy, mental

Received: 9 December 2015, Revised: 17 February 2016Accepted: 22 February 2016Correspondence to: Kim Woo Taek, M.D. Division of Neonatology, Department of Pediatrics, School of Medicine, Catholic University of Daegu, 33, Duryugongwon-ro 17-gil, Namgu, Daegu 42472, KoreaTel: +82-53-650-4250, Fax: +82-53-622-4240 E-mail: wootykim@hanmail.net

Copyrightⓒ 2016 by The Korean Society of PerinatologyThis is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/license/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided that the original work is properly cited. The Korean Journal of Perinatology · pISSN 1229-2605 eISSN 2289-0432 · e-kjp.org

Brain-Derived Neurotrophic Factor (BDNF) Exerts a

Protective Effect via an Anti-Apoptotic Mechanism

on Hypoxic-Ischemic Injury in the Rat Brain

Bong Jae Kim, M.D., Hyun Seuk Lee, M.D., Yoon Ho Han, M.D., Ji Eun Jeong, M.D., Eun Joo Lee, M.D., Eun Jin Choi, M.D. and Woo Taek Kim, M.D.

Department of Pediatrics, School of Medicine, Catholic University of Daegu, Daegu, Korea

Purpose: Perinatal hypoxic-ischemic (HI) brain injury remains a common cause of chronic handicapping con-ditions of cerebral palsy, mental retardation, learning disability, and epilepsy. HI brain injury induces cell death via either necrosis or apoptosis. Brain-derived neurotrophic factor (BDNF) is a member of the neurotrophin family. It plays key roles in survival, differentiation, and maintenance of neurons. This study was to investigate the neuroprotective effects of BDNF via the mechanisms of anti-apoptosis in HI brain injury by using cortical astrocyte and neuronal cell culture. Methods: Cortical astrocytes culture of 1-day-old Sprague-Dawley (SD) rat pups and embryonic cortical neuronal cell culture of SD rats at 14-day gestation were done. The Normoxia group was prepared in 5% CO2 incubators and the Hypoxia group and Hypoxia+BDNF group (after treatment with BDNF for 24 hours) were placed in 1% O2 incubators (94% N2, 5% CO2) for 6 or 18 hours. The expression of Bcl-2 and Bax were assess-ed by real-time PCR and western blot. The caspase-3 activation was evaluated by caspase activity assay kit.Results: In astrocyte and neuronal cell, the expressions of Bcl-2 in the hypoxia groups were reduced compared to the normoxia groups, whereas, those in the Hypoxia+BDNF groups were increased compared to the hypoxia groups. However, the expressions of Bax and caspase-3 and the ratio of Bax/Bcl-2 were revealed reversely. In astrocyte, Hypoxia group for 6 hours was not significantly altered in Bcl-2, Bax expressions.Conclusion: BDNF neuroprotective effects on HI brain injury in neonatal rats may occur via anti-apoptotic mechanism.

Key Words: Anti-apoptosis, Brain-derived neurotrophic factor, Hypoxia-ischemia, Neuroprotection

Bong Jae Kim, et al. : - BDNF Effects on HI Brain Injury -

- 16 -

their supporting cells termed as glial cells. Neurons

are an electrically excitable cell that processes and

transmits information through electrical and chemical

signals. Astrocytes, the most abundant glial cell

types, are well known protectors of neurons. These

cells secrete a great variety of neurotrophic factors

and protect neurons against excitatory amino acids

(EAA), oxi dative injury.4

In neonatal brains, HI brain injury induces cell

death via either necrosis or apoptosis. Apoptosis is

an essential mechanism of maintaining homeostasis

during development. Whereas apoptotic cell death

usually happens in the developing brain where it is

responsible for the physiological removal of over

neurons.5 Apoptosis is an active cell death modulated

by pro­apoptotic (Bax, Bak, Bok etc.) and anti­

apoptotic (Bcl­2, Bcl­xL, Bcl­w etc.) genes. The

over­expression of the anti­apoptotic Bcl­2 inhibits

apoptosis, but Bax over­expression forms Bax ho­

modimers that advance apoptosis.6­8 Caspase­3 has

been related to neuronal apoptosis during brain de­

velopment and to delayed neuronal cell death after

brain insult.9 Activated caspase­3 is directly res­

ponsible for proteolytic cleavages of a variety of basic

proteins involving cytoskeletal proteins, kinases, and

DNA­repair enzymes.10 In addition to morphological

evidence of apoptosis, Cheng et al. (1998)11 found

evidence of delayed caspase­3 activity following HI.

Neurotrophins (NTs) are a family of proteins that

regulate neuronal survival, development, and func­

tion.12 Brain­derived neurotrophic factor (BDNF), a

member of the NT family, protects neurons against

different types of brain injury13 and also plays key

roles in survival, differentiation, and maintenance

of peripheral and central neurons.14 BDNF counter­

regulate Bcl­2 and Bax expression after cerebral

ischemia15 and protect against neonatal HI brain

injury.16

In this study, we determined the neuroprotective

effects of BDNF via the mechanisms of anti­apoptosis

in HI brain injury by using cortical astrocyte and

neuronal cell culture of rats. A potential role of BDNF

was assessed by real­time PCR and western blot of

the proapoptotic protein Bax and the anti­apoptotic

protein Bcl­2. The effect was also evaluated via cas­

pase­3 activation.

Materials and Methods

1. Materials (Chemicals and Reagents)

BDNF, Caspase­3/CPP32 Colorimetric Assay

kit were obtained from BioVision Inc. (Milpitas, CA,

USA). Poly­D­lysine was from Sigma (St. Louis,

MO, USA). Rabbit polyclonal microtubule­associated

pro tein 2 (MAP2), Glial fibrillary acidic protein

(GFAP), mouse monoclonal Bcl­2 and secondary

goat anti­mouse, or rabbit IgG­HRP, Fluorescein

isothiocyanate (FITC) antibodies, β­actin were

purchased from Santa Cruz Biotechnology (Santa

Cruz, CA, USA). Rabbit polyclonal Bax was purchased

from Cell Sig naling Technology Inc. (Danvers,

MA, USA). 3­ (4,5­dimethylthiazol­2­yl)­2,5­

diphenyl­tetra zolium bromide (MTT) was purchased

from Duchefa (Haarlem, The Netherlands). Hanks'

balanc ed salt solution (HBSS), Neurobasal media,

B27 supplement, glutamax I, 4­(2­hydroxyethyl)­

1­piperazineethanesulfonic acid (HEPES) were

purchased from GibcoBRL (Invitrogen, Grand Island,

NY, USA). Dulbecco's Mo dified Eagle's Medium

DMEM (high glucose, low glucose), Ham's F12,

fetal bovine serum (FBS), peni cillin­streptomycin,

and trypsin­EDTA were obtained from Hyclone

Laboratories (Logan, UT, USA). Complete protease

inhibitor cock tail tablets were purchased from Roche

김봉재 외 : - 저산소성 허혈성 뇌손상에서 BDNF의 효과-

- 17 -

Appli ed Science (Mann heim, Germany). Enhanced

Chemilumino scence (ECL) plus western blotting

detection system was purchased from Amersham

Biosciences Corp. (Pis cataway, NJ, USA). SUPEX was

purchased from Neuronex (Pohang, Korea).

2. Cortical astrocyte and neuronal cell cultures

This study was performed in accordance with

the approved animal use guidelines of the Catholic

University of Daegu. Cortical astrocytes used for the

primary cultures were also isolated from neonatal

Sprague Dawley (SD) rats (both sexes) at day 1

postnatally.17 Briefly, the brains removed and trans­

ferred into prechilled HEPES under sterile condition.

And men inges were carefully removed. Then the

cortex was chopped into pieces and resuspended in

3 mL 0.25% trypsin solution. After 5 min incubation

at 37℃, FBS was added to stop the action of trypsin.

The cells were dispersed gently and centrifuged at

1,000 rpm for 5 min. Cells were isolated by filtering

the suspension through 80 mesh screens. After

wash ing the sus pension in PBS centrifuged at 200 g

for 5 min. The final pellet was resuspended in DMEM

(high glucose) supplemented with 10% FBS, 25 mm

HEPES, 2 mm l­glutamine, 100 U/mL penicillin,

and 100 lg/mL streptomycin. Cells were seeded

onto 100 mm dishes. The cultures were incubated

in a humidified incubator at 37℃ under 5% CO2. To

hypoxia, the cultures were washed with serum­free

medium, and fresh medium containing low glucose

was added to culture dish.

Culture of cortical neuronal cells from rat embryos

was performed using the Brewer method.18 Disso­

ciated cultures from SD rat embryonic (E14, both

sexes) cerebral cortical neurons were prepared as

follows: the isolated cortices free of meninges were

dissected at 37℃ HBSS containing 1 mM sodium

pyruvate and 10 mM HEPES (pH 7.4). The dissected

brain cortical tissues were then placed in 2 mL trypsin

and incubated at 37℃ for 1 min. After washing five

times with 10 mL HBSS, the cells were moved in 1

mL HBSS, and dispersed by pipetting 6­7 times with

a small­bore Pasteur pipette. The cell suspension

was centrifuged at 1,000 rpm at 25℃ for 5 min and

pellets were washed with HBSS (without phenol red).

The pellet was resuspended in Neurobasal media

supplemented with 2% B27 and 0.5 mM glutamax

Ⅰ. Cells were plated in each dish precoated with 50

µg/mL poly­D­lysine. Cultures were maintained in

Neu robasal media at 37°C in a humidified atmosphere

containing 5% CO2. Half of the medium was changed

every 3 days.

The cultured cells were divided into five groups: N,

normoxia; 6H, hypoxia for 6 hr; 6HB; hypoxia for 6 hr

after treatment with BDNF for 24 hr; 18H, hypoxia for

18 hr; 18HB; hypoxia for 18 hr after treatment with

BDNF for 24 hr. The N group was prepared in 5% CO2

incubators while the other groups were cultured in

1% O2 incubators (94% N2, 5% CO2). To determine the

time of hypoxia, we re ferred to the studies of Callahan

et al.19 and Hong et al.20

3. Immunofluorescence

At the indicated time points, cells cultured on poly­

D­lysine coated plastic coverslips were fixed with

4% formaldehyde for 30 min at room temperature.

Sub sequently, cells were rinsed with PBS and per­

meabilized with 0.25% Triton X­100 for 5 min. After

two washes with PBS, cells were incubated with

blocking solution (1% bovine serum albumin in PBS)

for 1 hr, followed by primary polyclonal antibody

against MAP2 (1:50), GFAP (1:100) overnight at 4℃.

Cells were then washed in PBS three times (5 min

each) and subsequently incubated in FITC goat anti­

Bong Jae Kim, et al. : - BDNF Effects on HI Brain Injury -

- 18 -

rabbit (1:200) secondary antibody at 37°C for 30

min. Cells were washed three times with PBS. DAPI

(1 µg/mL) was included in the final wash to stain the

nuclei. Coverslips were attached on slides, mounting

medium (Dako, Glostrup, Denmark) was added, and

the pre paration was covered with a glass coverslip.

Cover slips detected by fluorescence microscopy (TE

2000­U, Nikon instruments Inc., NY, USA).

4. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-

tetrazolium bromide (MTT) assay

The MTT assay was used for estimation of cell vi­

ability and growth. MTT was dissolved at a concen­

tration of 5 mg/mL. 10 µL of the 5 mg/mL MTT stock

solution was added to each well. After 4 hr of incu­

bation at 37℃, media was removed and added 100 µL

of the lysing buffer (Dimethyl sulfoxide (DMSO): 95%

ethanol=1:1). Absorbance of the samples was read at

540 nm using a microtiter plate enzyme­link ed im­

munosorbent assay (ELISA) reader. The amount of

formazan produced is proportional to the number of

live and metabolically active cells.

5. RNA extraction and real-time PCR

Total RNA was extracted from tissue with TRIzol

reagent (Invitrogen Corporation, Calsbad, CA, USA).

Briefly, cells were homogenized in 1 mL of TRIzol

reagent. Total RNA was separated from DNA and

proteins by adding chloroform and was precipitated

using isopropanol. The precipitate was washed twice

in 100% ethanol, air­dried, and re­diluted in diethy­

plyrocarbonate (DEPC)­treated distilled water. The

amount and purity of extracted RNA was quantitated

by spectrophotometry (GeneQuantTM pro RNA/

DNA calculator, GE Healthcare, USA), and the RNA

was stored at ­70℃ pending further processing. For

re verse transcription, total RNA (2 µg) was reverse

transcribed for 1 hr at 37℃ in a reaction mixture

containing 20 U RNase inhibitor (Promega, Madison,

WI, USA), 1 mM dNTP (Promega), 0.5 ng oligo­(dT)

15 primer (Promega), 1 x RT buffer and 200 U M­

MLV reverse transcriptase (Promega). The reaction

mixture was then incubated at 95℃ for 5 min to stop

the reaction. The cDNA was stored at ­20℃ until

further processing.

Real­time PCR was performed in 48­well PCR

plates (Mini OpticonTM Real­Time PCR System, Bio­

rad, USA) using the iQTM SYBR Green Supermix

(Bio­rad Laboratories, CA, USA). Amplification

conditions are shown in Table 1. It was the same for all

apoptotic mRNA assayed: 95℃ for 5 min, followed by

40 cycles of 95℃ for 40 sec, annealing temperature

for 45 sec, and 72℃ for 45 sec. Real­time PCR data

were analysed with LightCycler software (BIORad

Lab, Hercules, CA, USA). All experiments were per­

formed at least in six times.

6. Rat astrocyte, neuronal cell protein extraction

Samples of astrocyte, neuronal cell were homoge­

nized and total protein was extracted using a protein

Table 1. Primer Pairs and Annealing Temperatures for Real-Time PCRName Primer Sequence (5'-3') Annealing Amplicon size (bp)Bcl-2 F: TTGACGCTCTCCACACACATG 57℃ 89

R: GGTGGAGGAACTCTTCAGGGABax F: TGCTGATGGCAACTTCAACT 55℃ 110

R: ATGATGGTTCTGATCAGCTCGΒ-Actin F: TTGCTGATCCACATCTGCTG 53℃ 146

R: GACAGGATGCAGAAGGAGAT

김봉재 외 : - 저산소성 허혈성 뇌손상에서 BDNF의 효과-

- 19 -

lysis buffer containing complete protease inhibitor

cocktail tablets, 1 M Tris­HCl (pH 8.0), 5 M NaCl, 10%

Nonidet P­40 and 1 M 1,4­dithio­DL­threitol (DTT).

After incubation for 10 min on ice, the samples were

centrifuged at 12,000 rpm at 4℃ for 30 min and the

supernatant was transferred to a new tube. Proteins

were quantified using the Pierce BCA Protein Assay

Kit (Thermo Scientific, Rockford, USA) and taking

spectrophotometric readings at 540 nm.

7. Sodium dodecyl sulfate-polyacrylamide gel

electrophoresis (SDS-PAGE) and western blot

analysis

Equal amounts of proteins (30 µg) were subjected

to 12% SDS­PAGE after denaturing in 5 x SDS gel­

loading buffer (60 mM Tris­HCl pH 6.8, 25% glycerol,

2% SDS, 14.4 mM 2­mercaptoehanol and 0.1% bro­

mophenol blue) in boiling water for 10 min. After elec­

trophoresis, proteins were electrotransferred to a

polyvinylidene difluoride (PVDF) membrane (Millipore,

Bedford, MA, USA) at a constant voltage of 10 V for

30 min. After transfer, the membrane was washed

twice with 1 x Tris­buffered saline (TBS) plus 0.1%

Tween­20 (TBST, pH 7.4) and preincubated with a

blocking buffer (5% nonfat dry milk in TBST) at room

temperature for 1 hr. The blots were then incubated

with rabbit polyclonal Bax and mouse monoclonal Bcl­

2, β­actin primary antibodies at 1:1,000 dilutions in

TBST at 4℃ overnight. Following primary antibody

incubations, the blots were incubated with secondary

anti­rabbit or anti­mouse antibody conjugated with

horseradish peroxidase at 1:2,000 dilution at room

temperature for 1 hr. Finally, the membrane was

washed and developed using the ECL plus or SUPEX

reagents. The intensities of the western blot bands

were measured using a densitometer (Multi Gauge

Software, Fuji Photofilm).

8. Caspase-3 activation

The activity of caspase­3 was measured using a

colorimetric assay kit according to the manufacturer's

instructions. Briefly, at the indicated time points,

cultured cells were collected into a test tube, followed

by centrifugation. The pellet was re suspended in

a lysis buffer provided by the kit. Cell lysates were

incubated at 37°C for 2 hr with 200 µM DEVD­p­

nitroanilide (pNA). Spectrophotometric detection of

the chromophore pNA after cleavage from the labeled

caspase substrates was then performed. Samples

were read at 405 nm in a microtiter plate reader. All

experiments were performed at least in four times.

9. Statistical analysis

Data were analyzed using the SPSS version 12.0

statistical analysis package. Examined data were

assessed using the t­test and ANOVA. In each test,

the data were expressed as the mean±SD, and P<0.05

was accepted as statistically significant.

Results

1. The identity of astrocytes and neuronal cells

Cellular characterization was performed by immu­

nofluorescence analysis using polyclonal antibodies

against GFAP or MAP2 with double­labelling by

means of DAPI in order to score the proportion of as­

trocyte and neuronal cell in cultures. More than 95 %

of the cells have been shown to present immunore­

activity for GFAP, MAP2 (Fig. 1A, 1B).

2. Cell viabilities according to administration with

BDNF in hypoxic ischemic brain cells injury

To determine the protective effects of BDNF in the

cultured dispersed astrocyte (Fig. 2A) and neuronal

cell (Fig. 2B) after a hypoxic (1% O2) insult, the most

Bong Jae Kim, et al. : - BDNF Effects on HI Brain Injury -

- 20 -

effective concentration of the drug was determined

by measuring the relative cell viabilities of BDNF

in different concentrations (50, 100, and 200 ng/

mL).21 The drug­treated groups (6HB, 18HB) were

compared to the N group and cell viabilities were

determined by the MTT assay. The results showed

that the best concentration for relative cell viabilities

of BDNF was 100 ng/mL, respectively, therefore, we

used 100 ng/mL of BDNF in the experiments.

3. The expressions of Bcl-2 and Bax mRNAs

by real-time PCRs in the rat cortical astrocyte

culture

In primary astrocytes, the expression of Bcl­2

mRNA (Fig. 3A) decreased in the 18H group com­

pared to the N group, and increased in the 18HB group

compared to the 18H group (P<0.05). In contrast, Bax

mRNA (Fig. 3B) level and the ratio of Bax/Bcl­2 (Fig.

3C) were reversed under the same experimental

conditions. However, 6H group was not significantly

altered in Bcl­2, Bax mRNA levels.

Fig. 1. Fluorescence images (x 200) of rat cortical astrocyte and neuronal cell cultured for 10 days and stained for the appropriate phenotypic markers. Nuclei were stained with DAPI (blue). Approximately 95% of the cells stain positive for astrocyte marker GFAP (green) (A), more than 95% of the cells are positive for the neuronal cell marker MAP2 (green) (B).

Fig. 2. Cell viability was measured by 3-(4,5-dimethylthiazol-2-yl) -2,5-diphenyl-tetrazolium bromide (MTT) assay. Cultured dispersed astrocytes or neuronal cells were prepared with different concentrations of brain-derived neurotrophic factor (BDNF) for 24 hours before a hypoxic insult for 6 or 18 hours. The concentration of drug was 5, 100, and 200 ng/mL. The damaged cells were restored following administration of BDNF. The effective doses were 100 ng/mL in the HB groups both astrocyte and neuronal cell. N, normoxia; 6H, hypoxia for 6 hours; 6HB; hypoxia for 6 hours after treatment with BDNF; 18H, hypoxia for 18 hours; 18HB; hypoxia for 18 hours after treatment with BDNF. *P<0.05, statistically significant vs. N.

김봉재 외 : - 저산소성 허혈성 뇌손상에서 BDNF의 효과-

- 21 -

Fig. 3. Real-time PCRs of Bcl-2 (A; N, 100±5.0; 6H, 107.2±5.3; 6HB, 112.9±5.6; 18H, 52.3±2.6; 18HB, 73.2±3.7) and Bax (B; N, 100±2.0; 6H, 102.1±2.9; 6HB, 103.8±2.1; 18H, 115.6±1.7; 18HB, 113.7±3.0) mRNAs and the ratio of Bax/Bcl-2 were revealed in the cortical astrocyte culture. BDNF was administered at 100 ng/mL. N, normoxia; 6H, hypoxia for 6 hours; 6HB; hypoxia for 6 hours after treatment with BDNF; 18H, hypoxia for 18 hours; 18HB; hypoxia for 18 hours after treatment with BDNF. *P<0.05, statistically significant vs. H.

Fig. 4. Real-time PCRs of Bcl-2 (A; N, 100±4.5; 6H, 42.3±6.7; 6HB, 76.3±3.9; 18H, 30.8±4.0; 18HB, 62.9±5.5), Bax (B; N, 100±3.7; 6H, 121.0±5.2; 6HB, 95.9±7.1; 18H, 173.5±2.9; 18HB, 126.1±6.4) mRNAs and the ratio of Bax/Bcl-2 were revealed in the embryonic cortical neuronal cell culture. BDNF was administered at 100 ng/mL. N, normoxia H, hypoxia for 6 hours; 6HB; hypoxia for 6 hours after treatment with BDNF; 18H, hypoxia for 18 hours; 18HB; hypoxia for 18 hours after treatment with BDNF. *P<0.05, statistically significant vs. H.

Bong Jae Kim, et al. : - BDNF Effects on HI Brain Injury -

- 22 -

4. The expressions of Bcl-2 and Bax mRNAs by

real-time PCRs in the rat cortical neuronal cell

culture

In neuronal cells, the expression of Bcl­2 mRNA

(Fig. 4A) decreased in the H groups (6H, 18H) com­

pared to the N group, and increased in the HB groups

(6HB, 18HB) compared to the H groups (P<0.05). In

contrast, Bax mRNA level (Fig. 4B) and the ratio of

Bax/Bcl­2 (Fig. 4C) were reversed under the same

experimental conditions.

5. The expressions of Bcl-2 and Bax proteins

by western blots (Fig. 5A) in the rat cortical

astrocyte culture

In primary astrocytes, the expression of Bcl­2

protein (Fig. 5B) decreased in the 18HB group com­

pared to the N group, and increased in the 18HB group

compared to the 18H group (P<0.05). In contrast,

Bax protein (Fig. 5C) level and the ratio of Bax/Bcl­2

(Fig. 5D) was reversed under the same experimental

conditions. However, 6H group was not significantly

altered in Bcl­2, Bax protein levels.

6. The expressions of Bcl-2 and Bax proteins

by western blots (Fig. 6A) in the rat cortical

neuronal cell culture

In neuronal cells, the expression of the Bcl­2 pro­

tein (Fig. 6B) decreased in the H groups (6H, 18H)

compared to the N group, and increased in the HB

groups (6HB, 18HB) compared to the H groups (P<

0.05). In contrast, Bax protein (Fig. 6C) level and the

ratio of Bax/Bcl­2 (Fig. 6D) were a reverse of this

behavior.

7. Activation of DEVD-specific caspase-3 by

colorimetric substrate DEVD-pNA

In astrocyte, the activations of caspase­3 increas­

ed in the 18H group when compared to those of the N

Fig. 5. Western blots (A) of Bcl-2 (B; N, 100±2.0; 6H, 94.9±1.8; 6HB, 98.0±0.6; 18H, 75.4±0.73; 18HB, 89.8±2.1) and Bax (C; N, 100±5.5; 6H, 105.8±4.8; 6HB, 102.5±4.2; 18H, 151.5±6.1; 18HB, 111.9±5.6) and the ratio of Bax/Bcl-2 were revealed in the cortical astrocyte culture (n=4). BDNF was administered at 100 ng/mL. N, normoxia; 6H, hypoxia for 6 hours; 6HB; hypoxia for 6 hours after treatment with BDNF; 18H, hypoxia for 18 hours; 18HB; hypoxia for 18 hours after treatment with BDNF. *P<0.05, statistically significant vs. H.

김봉재 외 : - 저산소성 허혈성 뇌손상에서 BDNF의 효과-

- 23 -

group and decreased in the 18HB group when com­

pared to those of the 18H group. However, exposure

of astrocyte to 6 hr of hypoxia did not increase cas­

pase­3 activity compared with normoxia (Fig. 7A,

P<0.05)

In neuronal cell, the activations of caspase­3 in­

creased in the H groups (6H, 18H) when compared to

those of the N group and decreased in the HB groups

(6HB, 18HB) when compared to those of the H groups

(Fig. 7B).

Fig. 6. Western blots (A) of Bcl-2 (B; N, 100±2.0; 6H, 42.1±3.2; 6HB, 82.3±1.9; 18H, 30.9±4.9; 18HB, 70.4±5.2), Bax (C; N, 100±5.7; 6H, 145.6±6.9; 6HB, 105.5±7.2; 18H, 164.3±8.1; 18HB, 121.9±3.7) and the ratio of Bax/Bcl-2 were revealed in the embryonic cortical neuronal cell culture (n=4). BDNF was administered at 100 ng/mL. N, normoxia; 6H, hypoxia for 6 hours; 6HB; hypoxia for 6 hours after treatment with BDNF; 18H, hypoxia for 18 hours; 18HB; hypoxia for 18 hours after treatment with BDNF. *P<0.05, statistically significant vs. H.

Fig. 7. Astrocyte (A) and neuronal cell (B) were plated dish 24 hours before the induction of apoptosis. After treatment with 100 ng/mL BDNF for 24 hours before a hypoxic insult, the activity of caspase-3 was assayed using a caspase-3/CPP32 colorimetric assay kit. *P<0.05, statistically significant vs. N.

Bong Jae Kim, et al. : - BDNF Effects on HI Brain Injury -

- 24 -

Discussion

Oxidative neuronal damage contributes to the pa­

thogenesis of many different neurodegenerative

conditions such as ischemic stroke, Alzheimer’s dis­

ease, Parkinson’s disease.22 Cerebral HI is rapidly

followed by prolonged periods of delayed cell death or

apoptosis, and inflammation.23

Cortical progenitor cells follow an intrinsic de­

velopmental sequence both in vivo and in vitro.

The generation of all cell types in the cortex hap­

pens in temporally distinct, albeit overlapping,

phases. Neurons are generated first, followed by

astrocytes, and then oligodendrocytes. In rats, neu­

rogenesis peaks at E14, astrocytogenesis at P2, and

oligodendrocytogenesis at P14.24 To date, a lot of

effort has been expended to explain the molecular

mechanisms within neurons that me diate neuronal

death during stroke and hypoxia. Although this ap­

proach certainly has advantage, astrocytes also play

important roles in health and disease. Astrocytes

provide a supporting role for neuronal integrity, cere­

bral vascular development, and neuroprotection.25

Several reports show that astrocytes are active part­

ners with neurons and brain vasculature participating

in communication that changes neuronal survival

and physiology.26, 27 We successfully cultured the rat

cerebral cortical astrocytes and neurons in vitro.

The cells grew and differentiated very well in the

improved culture of respective medium. No obvious

degeneration of the cultured astrocytes or neurons

was seen even after 14 days in vitro. The astrocyte

cells were identified with anti­GFAP polyclonal

antibody and neuronal cells with anti­MAP2 poly­

clonal antibodies. The purification of astrocytes and

neurons are more than 95%.

During brain development, a large amount of neu­

rons suffer apoptosis to help sculpt neural networks.28

Therefore, neurons in the developing brain are primed

to suffer apoptosis, and the apoptotic pathway can be

without difficulty activated in response to damage.29

Prominent components of apoptosis such as Bcl­

230 and Bax31 and caspase­311 are upregulated in

the immature when compared to the adult brain and

could be expected to have a key role in pathological

situations also. Upregulated Bcl­2 expression results

in survival while upregulated Bax expression results

in apoptosis.32 Bcl­2 and Bax are also thought to play

a role in cell death following HI. Multiple reports have

demonstrated that cerebral ischemia changes the

expression of Bcl­2 and Bax proteins.33, 34

HI brain damage in the human perinatal period

causes significant long­term neurobehavioral dys­

function, while BDNF pretreatment is protective

against brain injury.35 Moreover, BDNF in vitro has

been demonstrated to prevent apoptosis.36 The study

of Schäbitz et al.15 has shown that BDNF treatment

decreased expression of Bax and counter­regulated

Bcl­2 in neurons. Several reports have suggested

that BDNF can protect neurons from hypoglycemia,

ischemia, hypoxia and neurotoxicity induced injury.37, 38

We assessed the expression of Bcl­2 mRNAs and

proteins as anti­apoptosis and the expression of

Bax as pro­apoptosis to detect the apoptosis feature

following the perinatal HI brain injury. In the present

study, the expression of Bcl­2 was decreased in the H

groups as compared to the normoxia group, whereas it

was increased in the BDNF­treated groups. By con­

trast, the expressions of Bax and the ratio of Bax/Bcl­

2 were inversely related. These results suggest that

BDNF might exert some neuroprotective effect via an

anti­apoptotic mechanism. However, astrocytes were

no differences in the expression of Bcl­2 and Bax

김봉재 외 : - 저산소성 허혈성 뇌손상에서 BDNF의 효과-

- 25 -

among the normoxia and 6 hr of hypoxia treatment,

but significant increase was shown between 18 hr of

hypoxia and normoxia. Shorter periods of exposure

to hypoxia were not injurious to these cells.19 Astro­

cytes were very resistant to hypoxia, but less so to

simulated ischemia (under both conditions the glu­

tamate concentrations in the media remained low).39

Caspase­3 is known to be a major contributor

to the apoptotic machinery in many cell types, de­

velopment of selective and potent caspase­3 inhi­

bitors has emerged as a therapeutic target. Intracere­

broventricular (ICV) injection of BDNF prior to HI

injury almost completely abolished evidence of HI­

induced caspase­3 activation in vivo.10

In this study, astrocytes were no differences in the

proportion of caspase­3 activation among the nor­

moxia and 6 hr of hypoxia, but significant increase

was shown between 18 hr of hypoxia and normoxia.

The study of Al Ahmad et al.40 has shown that maxi­

mal caspase­3 activation occurred at 48 hr of hypo­

xia. In the other groups, BDNF treatment blocks

almost all caspase­3 activation and cleavage of its

substrates, resulting in significant neuroprotection

against HI­induced cortical cells injury.

In conclusion, our experiments demonstrate that

BDNF is able to prevent the degeneration of neo­

natal cerebral cells caused by hypoxic insult. In ad­

dition, BDNF neuroprotective effects on HI brain

injury in neonatal rats may occur via anti­apoptotic

mechanism. The present study may be useful for the

further development of clinical therapies for perinatal

HI encephalopathy induced by cerebral hypoxia.

Acknowledgements

This work was supported by the grant of Research

Institute of Medical Science, Catholic University of

Daegu (2010)

References

1) Kaltschmidt C, Kaltschmidt B, Neumann H, Wekerle H, Baeuerle PA. Constitutive NF-kappa B activity in neurons. Mol Cell Biol 1994;14:3981-92.

2) Volpe JJ. Perinatal brain injury: from pathogenesis to neuroprotection. Ment Retard Dev Disabil Res Rev 2001; 7:56-64.

3) Vannucci SJ, Hagberg H. Hypoxia-ischemia in the immature brain. J Exp Biol 2004;207:3149-54.

4) Lamigeon C, Bellier JP, Sacchettoni S, Rujano M, Jacque-mont B. Enhanced neuronal protection from oxidative stress by coculture with glutamic acid decarboxylase-expressing astrocytes. J Neurochem 2001;77:598-606.

5) Oppenheim RW. Cell death during development of the nervous system. Annu Rev Neurosci 1991;14:453-501.

6) Lalier L, Cartron PF, Juin P, Nedelkina S, Mano S, Bechinger B, et al. Bax activation and mitochondrial insertion during apoptosis. Apoptosis 2007;12:887-96.

7) Oltvai Z. N, Milliman CL, Korsmeyer SJ. Bcl-2 hetero-dimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 1993;74:609-19.

8) Takada N, Yamaguchi H, Shida K, Terajima D, Satou Y, Kasuya A, et al. The cell death machinery controlled by Bax and Bcl-XL is evolutionarily conserved in Ciona intestinalis. Apoptosis 2005;10:1211-20.

9) Han BH, D'Costa A, Back SA, Parsadanian M, Patel S, Shah AR, et al. BDNF blocks caspase-3 activation in neonatal hypoxia-ischemia. Neurobiol Dis 2000;7:38-53.

10) Adamec E, Yang F, Cole GM, Nixon RA. Multiple-label immunocytochemistry for the evaluation of nature of cell death in experimental models of neurodegeneration. Brain Res Brain Res Protoc 2001;7:193-202.

11) Cheng Y, Deshmukh M, D'Costa A, Demaro JA, Gidday J, Shah A, et al. Caspase inhibitor affords neuroprotection with delayed administration in a rat model of neonatal hypoxi-cischemic brain injury. J Clin Invest 1998;101:1992-9.

12) Reichardt LF. Neurotrophin-regulated signalling pathways. Philos Trans R Soc Lond B Biol Sci 2006;361:1545-64.

13) Tapia-Arancibia L, Rage F, Givalois L, Arancibia S. Phy-siology of BDNF: focus on hypothalamic function. Front Neuroendocrinol 2004;25:77-107.

14) Lewin GR, Barde YA. Physiology of the neurotrophins. Annu Rev Neurosci 1996;19:289-317.

15) Schäbitz WR, Sommer C, Zoder W, Kiessling M, Schwanin-

Bong Jae Kim, et al. : - BDNF Effects on HI Brain Injury -

- 26 -

ger M, Schwab S. Intravenous brain-derived neurotrophic factor reduces infarct size and counterregulates Bax and Bcl-2 expression after temporary focal cerebral ischemia. Stroke 2000;31:2212-7.

16) Cheng Y, Gidday JM, Yan Q, Shah AR, Holtzman DM. Marked age-dependent neuroprotection by brain-derived neurotrophic factor against neonatal hypoxic-ischemic brain injury. Ann Neurol 1997;41:521-9.

17) Liu YJ, Zhuang J, Zhu HY, Shen YX, Tan ZL, Zhou JN. Cultured rat cortical astrocytes synthesize melatonin: ab-sence of a diurnal rhythm. J Pineal Res 2007;43:232-8.

18) Brewer GJ. Isolation and culture of adult rat hippocampal neurons. J Neurosci 1997;71:143-55.

19) Callahan DJ, Engle MJ, Volpe JJ. Hypoxic injury to de-veloping glial cells: protective effect of high glucose. Pediatr Res 1990;27:186-90.

20) Hong SS, Gibney GT, Esquilin M, Yu J, Xia Y. Effect of pro-tein kinases on lactate dehydrogenase activity in cortical neurons during hypoxia. Brain Res 2004;1009:195-202.

21) Arancibia S, Silhol M, Moulière F, Meffre J, Höllinger I, Maurice T, et al. Protective effect of BDNF against beta-amyloid induced neurotoxicity in vitro and in vivo in rats. Neu robiol Dis 2008;31:316-26.

22) Simonian NA, Coyle JT. Oxidative stress in neurodegenera-tive diseases. Annu Rev Pharmacol Toxicol 1996;36:83-106.

23) Dirnagl U, Iadecola C, Moskowitz MA. Pathobiology of ischaemic stroke: an integrated view. Trends Neurosci 1999; 22:391-7.

24) Sauvageot CM, Stiles CD. Molecular mechanisms con-trolling cortical gliogenesis. Curr Opin Neurobiol 2002;12: 244-9.

25) Garcia CM, Darland DC, Massingham LJ, D'Amore PA. Endothelial cell-astrocyte interactions and TGF beta are required for induction of blood-neural barrier properties. Brain Res Dev Brain Res 2004;152:25–38.

26) Chen Y, Swanson RA. Astrocytes and brain injury. J Cereb Blood Flow Metab 2003;23:137-49.

27) Nedergaard M, Ransom B, Goldman SA. New roles for astrocytes: redefining the functional architecture of the brain. Trends Neurosci 2003;26:523-30.

28) Honig LS, Rosenberg RN. Apoptosis and neurologic disease. Am J Med 2000;108:317-30.

29) Olney JW, Tenkova T, Dikranian K, Muglia LJ, Jermako-wicz WJ, D'Sa C, et al. Ethanol-induced caspase-3 activation in the in vivo developing mouse brain. Neurobiol Dis 2002; 9:205-19.

30) Merry DE, Veis DJ, Hickey WF, Korsmeyer SJ. bcl-2 protein expression is widespread in the developing nervous system and retained in the adult PNS. Development 1994;120:301-11.

31) Vekrellis K, McCarthy MJ, Watson A, Whitfield J, Rubin LL, Ham J. Bax promotes neuronal cell death and is down-regulated during the development of the nervous system. Development 1997;124:1239-49.

32) Parikh N, Koshy C, Dhayabaran V, Perumalsamy LR, Sowd hamini R, Sarin A. The N-terminus and alpha-5, alpha-6 helices of the pro-apoptotic protein Bax, modulate functional interactions with the anti-apoptotic protein Bcl-xL. BMC Cell Biol 2007;8:16.

33) Chen J, Graham SH, Nakayama M, Zhu RL, Jin K, Stetler RA, et al. Apoptosis repressor genes Bcl-2 and Bcl-x-long are expressed in the rat brain following global ischemia. J Cereb Blood Flow Metab 1997;17:2-10.

34) Hara A, Iwai T, Niwa M, Uematsu T, Yoshimi N, Tanaka T, et al. Immunohistochemical detection of Bax and Bcl-2 proteins in gerbil hippocampus following transient forebrain ischemia. Brain Res 1996;711:249-53.

35) Almli CR, Levy TJ, Han BH, Shah AR, Gidday JM, Holtz-man DM. BDNF protects against spatial memory deficits following neonatal hypoxia-ischemia. Exp Neurol 2000; 166:99-114.

36) Koh JY, Gwag BJ, Lobner D, Choi DW. Potentiated necrosis of cultured cortical neurons by neurotrophins. Science 1995;268:573-5.

37) Miyata K, Omori N, Uchino H, Yzmafuchi T, Isshiki A, Shibasaki F. Involvement of the brain-derived neurotrophic factor/TrkB pathway in neuroprotective effect of cyclos-porine A in forebrain ischemia. Neuroscience 2001;105:571-8.

38) Barnabé-Heider F, Miller FD. Endogenously produced neurotrophins regulate survival and differentiation of cor-tical progenitors via distinct signaling pathways. J Neurosci 2003;23:5149-60.

39) Sochocka E, Juurlink BH, Code WE, Hertz V, Peng L, Hertz L. Cell death in primary cultures of mouse neurons and astrocytes during exposure to and 'recovery' from hypoxia, substrate deprivation and simulated ischemia. Brain Res 1994;28:21-8.

40) Al Ahmad A, Gassmann M, Ogunshola OO. Maintaining blood-brain barrier integrity: pericytes perform better than astrocytes during prolonged oxygen deprivation. J Cell Physiol 2009;218:612-22.

김봉재 외 : - 저산소성 허혈성 뇌손상에서 BDNF의 효과-

- 27 -

= 국 문 초 록 =

목적: 주산기 저산소성 허혈성 뇌병증은 뇌성마비, 정신지체, 학습 장애, 간질 등 영구적인 신경학적 후유증을 남길

수 있다. 저산소성 허혈성 뇌손상은 necrosis 또는 apoptosis를 통해 세포 죽음을 유도한다. Neurotrophin계에 속한

BDNF는 신경세포의 생존, 분화 및 유지에 중요한 역할을 한다. 이에 본 연구에서는 신생 흰쥐의 대뇌 세포를 사용하여

저산소성 허혈성 뇌손상에서 항 세포사멸사 기전을 통한 BDNF의 신경보호작용 효과를 알아보고자 한다.

방법: 생후 1일된 신생흰쥐의 대뇌피질 세포(성상세포)와 재태기간 14일된 태아흰쥐의 대뇌피질 세포(신경세포)를 각

각 배양하였다. 저산소 상태에 노출시키기 24시간 전, BDNF를 처리 하고 1% 산소(94% N2, 5% CO2)와 low glucose 상

태에서 6시간 또는 18시간 동안 뇌세포손상을 유도하였다. 세포 사멸사와 관련된 Bcl-2와 Bax의 발현을 알아보기 위해

추출된 RNA로 real-time PCR를, 단백질은 western blotting을 시행하였다. Caspase-3 활성은 caspase activity assay

kit로 측정하였다.

결과: 성상세포와 신경세포에서 Bcl-2의 발현은 정상군과 비교했을 때 저산소군에서 감소하였으며, BDNF를 처리한 군

에서는 저산소군 보다 증가하였다. 하지만 Bax 발현과 Bax/Bcl-2의 비, Caspase-3 활성은 반대의 결과로 나타났다. 짧

은 시간인 6시간 동안 저산소 상태에 노출 시킨 성상세포에서는 세포 사멸사와 관련된 발현 반응이 뚜렷하게 나타나지

않았다.

결론: BDNF은 저산소 손상으로 야기된 대뇌세포들의 변질을 항 세포사멸사 조절을 통하여 주산기 저산소성 허혈성 뇌

손상에서 신경보호 역할을 하는 것을 알 수 있었다.

중심 단어: 항-apoptosis, BDNF, 저산소-허혈, 신경보호