Bioresource Technology 161 (2014) 200–207

Contents lists available at ScienceDirect

Bioresource Technology

journal homepage: www.elsevier .com/locate /bior tech

Biomass production and nutrients removal by a new microalgae strainDesmodesmus sp. in anaerobic digestion wastewater

http://dx.doi.org/10.1016/j.biortech.2014.03.0340960-8524/� 2014 Elsevier Ltd. All rights reserved.

⇑ Corresponding author at: PO Box 50, No. 17 Qinghua Donglu, Haidian District,Beijing 100083, PR China. Tel.: +86 10 6273 7858; fax: +86 10 6273 7885.

E-mail address: zhouyg@cau.edu.cn (Y. Zhou).

Fang Ji a,e, Ying Liu b,e, Rui Hao c, Gang Li d,e, Yuguang Zhou a,e,⇑, Renjie Dong a,e

a College of Engineering/Biomass Engineering Center, China Agricultural University, PR Chinab College of Agriculture and Biotechnology, China Agricultural University, PR Chinac College of Food Science and Nutritional Engineering, China Agricultural University, PR Chinad College of Water Resources and Civil Engineering, China Agricultural University, PR Chinae Key Laboratory of Clean Production and Utilization of Renewable Energy, Ministry of Agriculture, PR China

h i g h l i g h t s

� A new strain of algae was isolatedfrom fresh water.� This novel strain was identified as

Desmodesmus sp. by 18s rRNA andITS1 analysis.� This strain could grow in anaerobic

digestion wastewater (ADW).� Maximum nutrients removal was

observed at 10.0% ADW.� This strain could remove 100% NH4–

N, TP and PO4–P, and 75.50% TN at10.0% ADW.

g r a p h i c a l a b s t r a c t

a r t i c l e i n f o

Article history:Received 9 January 2014Received in revised form 27 February 2014Accepted 4 March 2014Available online 18 March 2014

Keywords:Desmodesmus sp.Anaerobic digestion wastewater (ADW)Nutrient removalBiomass production

a b s t r a c t

Anaerobic digestion wastewater (ADW), which contains large amount of nitrogen and phosphorus, par-ticularly high concentration of ammonium, might lead to severely environmental pollution. A new uni-cellular green microalgae species from a wetland at the Olympic Forest Park, Beijing, China wasscreened based on its growth rates and nutrients removal capability under ADW. Results of 18s rDNAand ITS1 analysis indicated that this strain have a close relationship with Desmodesmus sp., named asEJ9-6. Desmodesmus sp. EJ9-6 could remove 100% NH4–N (68.691 mg/L), TP (4.565 mg/L) and PO4–P(4.053 mg/L), and 75.50% TN (84.236 mg/L) at 10.0% ADW, which the highest biomass production was0.412 g/L after 14 d cultivation. Maximum nutrients removal was observed at 10.0% ADW with dailyremoval rates of TN, NH4–N, TP and PO4–P at 4.542, 5.284, 0.326 and 0.290 mg/L/d, respectively.

� 2014 Elsevier Ltd. All rights reserved.

1. Introduction

With the rapid increasing of globally energy demands and fossilfuel crisis, more attention has been paid on the production of thesubstitute energy sources (Pittman et al., 2011). Microalgae,

especially unicellular eukaryotic algae have higher oil productionyield than that of the best oilseed crops in terms of land area thatrequired for cultivation (Brennan and Owende, 2010; Stephenset al., 2010). Therefore, energy from microalgae could be a poten-tial bioenergy in future (Wijffels and Barbosa, 2010). However,the formidable cost for microalgae biofuel production has con-strained on the development in industrialized production (Huet al., 2012). A large quantity of water is consumed during micro-algae cultivation, which occupies 10–20% of the total cost of algaeproduction (Subhadra, 2011; Sander and Murthy, 2010). Hence,

F. Ji et al. / Bioresource Technology 161 (2014) 200–207 201

combining algae biomass production with organic wastewatertreatment can mitigate costs in algae-oriented biofuel industry.

Anaerobic digestion is an efficient approach for waste treatmentwhere organic materials are converted into biogas (methane), withthe production of clean energy. At the same time, this process alsoproduces digestate (Morken et al., 2013). Biogas digested effluent isa new type of green fertilizer with comprehensive nutrients, whichcan promote the growth of crops. However, without sufficienttreatment, that wastewater might create severely environmentalpollution (Salminen et al., 2001). Therefore, the integration ofanaerobic digestion wastewater (ADW) treatment and algae bio-mass production could be one of viable ways to reduce the riskof nitrogen and phosphorus pollutions from anaerobic digestion.

Many studies have focussed on nutrient removal form munici-pal wastewater, agricultural wastewater and Industrial wastewa-ter by microalgae (Wang and Lan, 2011; Senthil et al., 2010; Wuet al., 2012), whereas, it is less reported for the cultivation of mic-roalgae in ADW (Table 1) because the process of digestion wouldconsume a large of organic nutrients and produce high concentra-tion of ammonium (Cai et al., 2013b). Only a few species of micro-algae has been found and can grow in ADW (e.g. Chlorella sp. andScenedesmus sp.). It is necessary to isolate potential microalgaespecies in order to investigate the coupling of advanced ADWtreatment and biomass production.

This work studies the potential of a new species of microalgaeisolated from wild in order to promote biomass production, whichis context of the removal of nitrogen and phosphorus from ADW.

2. Methods

2.1. Species sampling and microalgae pre-cultures

Desmodesmus sp. EJ9-6 was isolated in August 2011 from theOlympic Forest Park (40�702900 N, 116�23003300 E), Beijing, China. Inthis study, totally 20 strains of microalgae were isolated and green

Table 1Comparison of major nutrient removal rates by microalgae cultivation in various ADW co

Wastewater category Gassource

Microalgaespecies

Cp

Digested dairy manure (20�dilution)

CO2 Chlorella sp. 2

Anaerobically digested dairymanure(50� dilution)

2–3% CO2 Neochloris oleoabundans 1

Anaerobic digestion effluent frompiggery farm (10� dilution)

Scenedesmus accuminatus 1

Biogas effluent from an anaerobicdigester (6� dilution)

Biogas Chlorella sp. 6

Anaerobically digested cattle slurryand whey (20� dilution)

CO2 Chlorella vulgaris 2

Anaerobic digestion effluent 3% air Synechocystis sp. 1

a Total Kjeldahl nitrogen (TKN).b Estimated from 100% removal of NH4–N after 21 d.c Estimated from 78.3% removal of TKN after 21 d.d Estimated from 34.3% removal of TP after 21 d.e Estimated from biomass production of 1.71 g/L after 21 d.f Estimated from 90% to 95% removal of initial N after 6 d.g Estimated from 83.94% removal of TN after 6 d.h Estimated from 80.43% removal of TP after 6 d.i Estimated from biomass production of 615.84 mg/L after 6 d.j Estimated from 100% removal of TN after 10 d.k Estimated from 100% removal of NH4–N after 10 d.

m Estimated from 100% removal of TP after 10 d.

microalgae Desmodesmus sp. EJ9-6 was selected based on itsgrowth rates and nutrients removal capability under ADW.

Desmodesmus sp. EJ9-6 was purified by serial dilutions and platestreaking in 1.5% agar Blue–Green (BG-11) medium (Rippka et al.,1979) containing following components (per liter) 1500 mgNaNO3, 40 mg K2HPO4, 75 mg MgSO4�7H2O, 36 mg CaCl2�2H2O,6 mg citric acid, 6 mg ferric ammonium citrate, 1 mg EDTANa2,20 mg Na2CO3, 2.86 mg H3BO3, 1.86 mg MnCl2�4H2O, 0.22 mgZnSO4�7H2O, 0.39 mg Na2MoO4�2H2O, 0.08 mg CuSO4�5H2O, and0.05 mg Co(NO3)2�6H2O. The pH value of medium was titrated to7.0 with 1 mol/L HCl. The plates were incubated for 2–3 weeksand after the colony formation, isolated single colonies werepicked up.

The microalgae seed were cultivated in 50 mL autoclaved BG-11medium in 100 mL Erlenmeyer flasks. Individual colonies wereinoculated into medium within a forced ventilation clean bench(SW-CJ-2FD, Suzhou Antai Airtech, China). The flasks were thenincubated in a growth chamber at 24 ± 1 �C under light intensityof 120 ± 2 lmol/(m2 s)�1 by fluorescent lights and light/dark cycles(L:D) of 15:9 h for 14 d. Periodic agitations were performed forthree times each day.

2.2. Amplification and sequencing of 18S rDNA and ITS1

Although rRNA genes are present in high copy numbers and thesensitivity of their detection on many dramatically increased byuse of PCR, internal transcribed spacer (ITS) regions are divergentand distinctive (Turenne et al., 1999). Polymeric Chain Reaction(PCR) primers for 18S rDNA and ITS1 (Table 2) were synthesizedby the Sangon Biotech (Shanghai) Co., Ltd., China. The DNA of mic-roalgae was extracted using the NuClean PlantGen DNA kit (BeijingComWin Biotech Co., Ltd., China) according to the manufacturer’sinstructions.

The 18S rDNA PCR reaction mixture contained 1 lL of DNA tem-plate, 1 lL of each primer, 4 lL of dNTP, 10 lL of 5 � Q5 buffer,

nditions.

ultivationeriod (d)

Initialnutrient(mg/L)

Nutrientremoval(mg/L/d)

Dry cellweight(g/L/d)

References

1 NH4–N = 89.1 4.24b 0.0814e Wang et al. (2010)TKNa = 172.8 6.44c

TP = 12.485 0.20d

6 NH4–N = 42 6.48f 0.0883 Levine et al. (2011)

0 NH4–N = 120 5.20 0.0458 Park et al. (2010)

TN = 59.57 8.33g 0.1026i Yan and Zheng (2013)TP = 6.21 0.83h

1 NH4–N = 81.7 5.2 0.25 Franchino et al. (2013)PO4–P = 3.65 0.19

0 TN = 80 8.0j 0.1509 Cai et al. (2013a)NH4–N = 68 6.8k

TP = 11.43 1.143m

Table 2PCR primers used in this study.

Primers Target Sequence Direction

18S rDNA FWa 18S 50 AAGTATAAACTGCTTATACTGTGAA30

Forward

18S0 rDNA RVa 18S 50 CCTACGGAAACCTTGTTACGACT 30 ReverseITS1 FWb ITS1 50 AGTCGTAACAAGGTTTCCGTAGG 30 ForwardITS2 RVb ITS1 50 TATGCTTAAGTTCAGCGGGTAAT 30 Reverse

a Designed by DNAMAN (USA) and Primer 5.0 (Canada).b Ji et al. (2013).

Table 3Physicochemical characteristics of ADW.

Parameter Unit Concentration

pH – 9.18COD mg/L 6900 ± 53TN mg/L 928.46 ± 4.64NH4–N mg/L 824.55 ± 4.20NO3–N mg/L 84.46 ± 2.86NO2–N mg/L N.D.a

TP mg/L 45.72 ± 0.55PO4–P mg/L 39.68 ± 0.37

a N.D., Not detected.

202 F. Ji et al. / Bioresource Technology 161 (2014) 200–207

0.5 lL of Q5 DNA Polymerase (New England Biolabs, USA) and10 lL of 5 � Q5 High GC Enhancer in a volume of 50 lL. PCR ther-mal program included an initial pre-heating denaturation at 98 �Cfor 60 s, followed by 37 cycles of denaturation at 98 �C for 20 s,annealing at 58 �C for 30 s and extension at 72 �C for 45 s, and a fi-nal 180 s extension at 72 �C with a thermal cycler (Biometra TGRA-DIENT, Germany). The ITS1 PCR thermal program was also thesame as the above except temperature of primer annealing at52 �C.

PCR products were sequenced by the Life Technologies Corpora-tion (China). Comparisons for similar sequences were carried outusing the BLAST Program (NCBI BLAST, USA).

2.3. ADW collection

The ADW employed in this study, was collected from Beilangz-hong pig farm biogas plant, Beijing, China. The ADW sample wasimmediately filtered using 1.2 lm glass microfiber filters (What-man Inc., USA) to remove large particles and microorganisms, thenstored at 4 �C to avoid variation of wastewater composition.

2.4. Experimental procedures

Batch experiments were performed after microalgae strain wascultivated in 5.0% ADW for one month to obtain stable characteris-tics. Three levels of ADW concentration were chosen, 2.5%, 5.0%and 10.0% ADW allowed by the initial concentration used. Theother conditions were prepared as mentioned in Section 2.1 andbiomass concentration was controlled at around OD 0.1 after inoc-ulation. The other flasks filled with same concentration ADW with-out algae addition were set up for control experiments. All theexperiments were carried out in three replicates.

2.5. Nutrients analysis

For physicochemical analysis of ADW, the solution pH was mea-sured with a pH meter (Orion-3 STAR, Orion Corporation, USA).Samples were filtered using a 0.45 lm glass microfiber filters(Whatman, USA). Then the filtrates were appropriately dilutedand analyzed chemical oxygen demand (COD) according to theHach DR 2700 Spectrophotometer Manual (Hach Company, USA;Hach, 2008). Total nitrogen (TN) and total phosphorus (TP) weredetermined colorimetrically as nitrate and phosphate after thesamples had been oxidized. Ammonia nitrogen (NH4–N) and phos-phate (PO4–P) were measured following the UV/Vis-spectrophoto-metric method (National Standard Method of China; Wei et al.,2002). The amounts of nitrite nitrogen (NO2–N) and nitrate nitro-gen (NO3–N) were determined with a flow injection analyzer(AA3, Seal Analytical, Ltd., UK).

The physicochemical characteristics of the ADW are presentedin Table 3.

Nutrient removal efficiencies were calculated using in Eq. (1):

Ri ¼ ðSi0 � SitÞ=Si0 ð1Þ

Where: Ri is the removal efficiency of substrate i (TN, NH4–N, TP, orPO4–P); Si0 is the initial concentration of i; and Sit is the final con-centration of i after t days cultivation.

The rate of nutrient removal was calculated according to Eq. (2):

ri ¼ ðSi0 � SitÞ=ðti � t0Þ ð2Þ

Where: ri (g/L/d) is the removal rate of substrate i (TN, NH4–N, TP,or PO4–P); Si0 is the initial concentration of i; and Sit is the final con-centration of i at time t.

2.6. Determination of microalgae growth

Microalgae production was determined by measuring the opti-cal density of samples at 680 nm (OD680) using a spectrophotome-ter (UV-7504PC, Xinmao Instrument, Shanghai, China) as anindicator of cell density. Biomass concentration was evaluatedusing the method of dry cell weight (DCW; Ho et al., 2010). TheDCW showed a linear relationship with OD680, as follows:

y ¼ 0:2706x� 0:0178ðR2 ¼ 0:991; P < 0:05Þ ð3Þ

Where: y (g/L) is the DCW; x is the absorbance at 680 nm.

3. Results and discussion

3.1. Isolation and identification of microalgae

The cells of Desmodesmus sp. EJ9-6 are few in number, varyingfrom two to four, and united into a frond by a hyaline matrix.The cell was ellipse in shape, smooth surface and cell size isapproximately 5.0–7.0 lm in length, and 2.0–4.0 lm in width un-der optical microscope (Fig. 1).

The 18S rRNA gene sequence amplified from this strain is1097 bp in length with no heterogeneity while the ITS1 was600 bp, and showed similarities with other known sequences fromgreen algae based on the BLAST results, ranging in homology from99% with Desmodesmus sp. Mary 6/3 T-2d and Desmodesmus sp.Tow 10/11 T-2W (Johnson et al., 2007). The phylogenetic analysisindicated that this strain have a close relationship with Desmodes-mus sp., named EJ9-6 (Fig. 1).

3.2. ADW nutrients removal by algae growth

As shown in Table 3, the ADW contains relatively high levels ofTN, especially NH4–N while NO3–N, NO2–N and PO4–P are verylow. Generally, a proper NH4–N concentration was reported as20 mg/L for microalgae growth (Azov and Goldman, 1982). TheADW needs to be diluted first due to toxic effect of high concentra-tion ammonium on microalgae growth (Chen et al., 2011; Pecciaet al., 2013). The removal of nitrogen (TN and NH4–N) and phos-phorus (TP and PO4–P) from ADW by Desmodesmus sp. EJ9-6 culti-vation as a function of incubation time are shown in Figs. 2 and 3,respectively.

Fig. 1. Phylogenetic tree of Desmodesmus sp. EJ9-6 based on partial ITS1 sequences (MEGA5.10) and morphological graph under optical microscope.

F. Ji et al. / Bioresource Technology 161 (2014) 200–207 203

Nitrogen is an important nutrient during the process of micro-algae growth. Since nitrogen can be utilized as nitrate, nitrite orammonium, the production of microalgae biomass response variedwith different sources and amounts (Costa et al., 2001). In thisstudy, nitrogen removal analysis carried out only for TN andNH4–N, because of low NO3–N concentration in the diluted ADW(2.5–8 ppm). The ADW concentration higher than 10.0% were nottested, since high NH4–N concentrations (12.0% AWD, the contentof NH4–N was approximately 100 mg/L) were apparently toxic toDesmodesmus sp., which microalgae was completely bleached afterthree days. The results of NH4–N and TN removal by Desmodesmussp. EJ9-6 cultured in different concentrations of ADW are shown inFig. 2a and b, respectively. For all conditions, nearly all NH4–N wasremoved within 9, 13 and 13 d for 2.5%, 5.0% and 10.0% ADW cul-tivation, respectively. The tendency for TN removal in all concen-

trations was similar to that for NH4–N removal in this study.Comparing to the condition that all the TN had been removed with2.5% ADW, 87.71% and 75.50% of TN were accordingly removedfrom the 5.0% and 10.0% ADW when the tests came to an end,respectively. Similar results were also observed by Hu et al.(2012) who cultured Chlorella sp. in liquid swine manure, indicat-ing that there were still some organic compounds that could not beconverted to ammonium and assimilated by microalgae.

Phosphorus is found in nucleic acids, lipids, proteins, and theintermediates of carbohydrate metabolism and is also an essentialmacro-nutrient for microalgae growth. Fig. 3a and b shows theremoval of PO4–P and TP contaminants form diluted ADW. It wasobserved that the concentrations of PO4–P and TP decreaseddramatically due to their fast assimilation by Desmodesmus sp.EJ9-6 in the first three days, the removal rate of PO4–P could

0.000

10.000

20.000

30.000

40.000

50.000

60.000

70.000

80.000

90.000

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

NH

4-N

(mg/

L)

Days (d)

2.5% control

2.5%

5.0% control

5.0%

10.0% control

10.0%

0.000

10.000

20.000

30.000

40.000

50.000

60.000

70.000

80.000

90.000

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

TN

(mg/

L)

Days (d)

2.5% control

2.5%

5.0% control

5.0%

10.0% control

10.0%

(a)

(b)

Fig. 2. Nitrogen evolution during the culturing period: (a) trends of NH4–N in the different concentrations of ADW; (b) trends of TN in different ADW concentrations.

204 F. Ji et al. / Bioresource Technology 161 (2014) 200–207

almost totally removed in the 2.5% and 5.0% ADW for four dayswhile 51.24% in 10.0% ADW. The significant reduction of PO4–Pwas also reported by Franchino et al. (2013) who achieved around94% PO4–P reduction when treating agro-zootechnical digestatewith algae starting. Fig. 3b illustrates that the removal pattern ofthe TP was similar to the removal pattern of PO4–P in dilutedADW. After 14 days, the TP content was reduced from 0.940,2.503 and 4.565 mg/L (control) to zero in 2.5%, 5.0% and 10.0%ADW, respectively.

It should be noted that phosphorus removal in wastewater isnot only utilized by algae cell, but also by external conditions suchas pH and dissolved oxygen (DO) (Cai et al., 2013b). In general, pHincreased approximately from 9 to 10 during Desmodesmus sp. EJ9-6 growth in diluted ADW. Thus, phosphate will precipitate fromADW as a result of elevated pH and high DO concentration.Although the proportion of abiotic precipitation is hard to quantify,it did not affect the efficiency of result that the algae uptake is stillthe main mechanism of phosphorus removal (Su et al., 2012).

The Desmodesmus sp. EJ9-6 biomass production and nutrientsremoval performance in different concentrations ADW were inves-tigated (Table 4). TN and TP daily removal rate rose as the ADW

concentration increased. Maximum nutrients removal was ob-served at 10.0% ADW with TN, and TP daily removal rate of14.759 and 1.123 mg/L/d while the average daily was 4.542 and0.326 mg/L/d, respectively.

The initial N/P ratio did not only affect microalgae growth, butalso directly affected the removal capacities of nitrogen and phos-phorus. According to this study, the concentration of ammonia ishigh while the initial N/P ratio is approximate 20:1. Kim et al.(2013) reported that, the proper N/P ratio depending on the nitro-gen source would be 16:1 for ammonia in advanced wastewatertreatment; and it was expected that a proper N/P ratio would in-crease microalgae growth and removal rates of nitrogen andphosphorus.

3.3. Microalgae biomass production

The growth characteristics of Desmodesmus sp. EJ9-6 under dif-ferent concentration ADW were investigated (as shown in Fig. 4).Compared with the serial dilutions, microalgae grew faster in2.5% ADW during the first seven days, after then, the growthstarted to level off due to earlier exhaustion of less amount of

0.000

1.000

2.000

3.000

4.000

5.000

6.000

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

PO4-

P (m

g/L

)

Days (d)

2.5% control

2.5%

5.0% control

5.0%

10.0% control

10.0%

0.000

1.000

2.000

3.000

4.000

5.000

6.000

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

TP

(mg/

L)

Days (d)

2.5% control

2.5%

5.0% control

5.0%

10.0% control

10.0%

(a)

(b)

Fig. 3. Phosphorus evolution during the culturing period: (a) trends of PO4–P in the different concentrations of ADW; (b) trends of TP in the different concentrations of ADW.

Table 4Microalgae biomass productivities and nutrients removal performance in different ADW concentrations Table 1.

ADW concentrations (%) Assimilation days (d) a Average daily removal rate(mg/L/d)

Maximum daily removal rate (mg/L/d) Biomass production (g/L/d) b

TN NH4–N TP PO4–P TN NH4–N TP PO4–P TN NH4–N TP PO4–P

2.5 12 9 4 4 1.671 2.257 0.235 0.214 3.585 3.914 0.423 0.395 0.0195.0 14 13 8 8 2.916 3.371 0.313 0.300 8.877 7.212 1.487 1.460 0.025

10.0 14 13 14 14 4.542 5.284 0.326 0.290 14.759 12.827 1.123 0.843 0.029

a The number of days when the residue nutrients in culture decreased to a undetectable or became constant.b The biomass production is the average daily productivity when cultivated 14 d.

F. Ji et al. / Bioresource Technology 161 (2014) 200–207 205

nitrogen and phosphorus. In the contrast, microalgae in 5.0% and10.0% growth started slower and picked up in the latter part of cul-tivation period. A similar result was reported for Cholrella sp. culti-vation by Wang et al. (2010). After the first 7 d cultivation, averagedry biomasses of 0.210 ± 0.007, 0.157 ± 0.007 and 0.120 ± 0.001 g/Lwere found in 2.5%, 5.0% and 10.0% ADW conditions, as cultivatedtime goes on, after 14 d, the dry biomass increased to0.272 ± 0.006, 0.351 ± 0.011 and 0.412 ± 0.005 g/L, respectively. It

can be observed from Table 4 that 10.0% ADW is better than othertwo concentrations when cultivated time increased, the maximumbiomass production was 0.029 g DCW/L/d after 14 d. However, themicroalgae biomass was not high compared to the biomass levels(0.025–0.7 g/L) commonly reported in other wastewater cultiva-tion (Pittman et al., 2011). This result might be attributed to thehigh NH4–N and low PO4–P concentration in ADW (Wang et al.,2008).

0.000

0.050

0.100

0.150

0.200

0.250

0.300

0.350

0.400

0.450

0.500

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

Bio

mas

s (g/

L)

Days (d)

2.5%5.0%10.0%

Fig. 4. Dry biomass of Desmodesmus sp. EJ9-6 cultivated in different concentrations of ADW for 14 d.

206 F. Ji et al. / Bioresource Technology 161 (2014) 200–207

4. Conclusion

A new unicellular green microalgae species, Desmodesmus sp.EJ9-6, was isolated and identified from fresh water. It was trainedfor ADW treatment and biomass productivity. Desmodesmus sp.EJ9-6 is in capable of completely depleting nitrogen and phospho-rus form ADW containing high concentration of NH4–N. Maximumnutrients removal was observed at 10.0% ADW with TN, NH4–N, TPand PO4–P daily removal rate of 4.542, 5.284, 0.326 and 0.290 mg/L/d, respectively, which the highest biomass production was0.412 g/L after 14 d cultivation.

Acknowledgements

This investigation was financially supported by The Chinese Na-tional Advanced Technology Development Program (Grant No.2013AA065802), The Chinese National ‘‘Twelfth Five-Year’’ Planfor Science & Technology Supporting Project (Grant No.2012BAD47B03), The China Scholarship Council Fund, The ChineseUniversities Scientific Fund (Grant No. 2013YJ007), and BeijingMunicipal Key Discipline of Biomass Engineering.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.biortech.2014.03.034.

References

Azov, Y., Goldman, J.C., 1982. Free ammonia inhibition of algal photosynthesis inintensive cultures. Appl. Environ. Microbiol. 43 (4), 735–739.

Brennan, L., Owende, P., 2010. Biofuels from microalgae—a review of technologiesfor production, processing, and extractions of biofuels and co-products. Renew.Sust. Energ. Rev. 14 (2), 557–577.

Cai, T., Ge, X., Park, S.Y., Li, Y., 2013a. Comparison of Synechocystis sp. PCC6803 andNannochloropsis salina for lipid production using artificial seawater andnutrients from anaerobic digestion effluent. Bioresour. Technol. 144, 255–260.

Cai, T., Park, S.Y., Li, Y., 2013b. Nutrient recovery from wastewater streams bymicroalgae: status and prospects. Renew. Sust. Energ. Rev. 19, 360–369.

Chen, M., Tang, H., Ma, H., Holland, T.C., Simon Ng, K.Y., Salley, S.O., 2011. Effect ofnutrients on growth and lipid accumulation in the green algae Dunaliellatertiolecta. Bioresour. Technol. 102 (2), 1649–1655.

Costa, J.A.V., Cozza, K.L., Oliveira, L., Magagnin, G., 2001. Different nitrogen sourcesand growth responses of Spirulina platensis in microenvironments. World J.Microbiol. Biotechnol. 17 (5), 439–442.

Franchino, M., Comino, E., Bona, F., Riggio, V.A., 2013. Growth of three microalgaestrains and nutrient removal from an agro-zootechnical digestate.Chemosphere 92 (6), 738–744.

Hach, 2008. Procedure Manual. Hach, Loveland, CO, USA.Ho, S.H., Chen, C.Y., Yeh, K.L., Chen, W.M., Lin, C.Y., Chang, J.S., 2010.

Characterization of photosynthetic carbon dioxide fixation ability ofindigenous Scenedesmus obliquus isolates. Biochem. Eng. J. 53 (1), 57–62.

Hu, B., Min, M., Zhou, W., Du, Z., Mohr, M., Chen, P., Zhu, J., Cheng, Y., Liu, Y., Ruan, R.,2012. Enhanced mixotrophic growth of microalga Chlorella sp. on pretreatedswine manure for simultaneous biofuel feedstock production and nutrientremoval. Bioresour. Technol. 126, 71–79.

Ji, F., Hao, R., Liu, Y., Li, G., Zhou, Y., Dong, R., 2013. Isolation of a novel microalgaestrain Desmodesmus sp. and optimization of environmental factors for itsbiomass production. Bioresour. Technol. 148, 249–254.

Johnson, J.L., Fawley, M.W., Fawley, K.P., 2007. The diversity of Scenedesmus andDesmodesmus (Chlorophyceae) in Itasca State Park, Minnesota, USA. Phycologia46 (2), 214–229.

Kim, S., Lee, Y., Hwang, S.J., 2013. Removal of nitrogen and phosphorus by Chlorellasorokiniana cultured heterotrophically in ammonia and nitrate. Int. Biodeterior.Biodegrad. 85, 511–516.

Levine, R.B., Costanza-Robinson, M.S., Spatafora, G.A., 2011. Neochloris oleoabundansgrown on anaerobically digested dairy manure for concomitant nutrientremoval and biodiesel feedstock production. Biomass Bioenerg. 35 (1), 40–49.

Morken, J., Sapci, Z., Strømme, J.E.T., 2013. Modeling of biodiesel production in algaecultivation with anaerobic digestion (ACAD). Energ. Policy. 60, 98–105.

Park, J., Jin, H.F., Lim, B.R., Park, K.Y., Lee, K., 2010. Ammonia removal from anaerobicdigestion effluent of livestock waste using green alga Scenedesmus sp. Bioresour.Technol. 101 (22), 8649–8657.

Peccia, J., Haznedaroglu, B., Gutierrez, J., Zimmerman, J.B., 2013. Nitrogen supply isan important driver of sustainable microalgae biofuel production. TrendsBiotech. 31 (3), 134–138.

Pittman, J.K., Dean, A.P., Osundeko, O., 2011. The potential of sustainable algal biofuelproduction using wastewater resources. Bioresour. Technol. 102 (1), 17–25.

Rippka, R., Deruelles, J., Waterbury, J.B., Herdman, M., Stanier, R.Y., 1979. Genericassignments, strain histories and properties of pure cultures of Cyanobacteria. J.Gen. Microbiol. 111, 1–61.

Salminen, E., Rintala, J., Härkönen, J., Kuitunen, M., Högmander, H., Oikari, A., 2001.Anaerobically digested poultry slaughterhouse wastes as fertiliser inagriculture. Bioresour. Technol. 78 (1), 81–88.

Sander, K., Murthy, G.S., 2010. Life cycle analysis of algae biodiesel. Int. J. Life CycleAssess. 15 (7), 704–714.

Senthil, C., Ashish, B., Hunt, R.W., Das, K.C., 2010. Microalgae cultivation in awastewater dominated by carpet mill effluents for biofuel applications.Bioresour. Technol. 101 (9), 3097–3105.

Stephens, E., Ross, I.L., King, Z., Mussgnug, J.H., Kruse, O., Posten, C., Borowitzka,M.A., Hankamer, B., 2010. An economic and technical evaluation of microalgalbiofuels. Nat. Biotechnol. 28, 126–128.

Su, Y., Mennerich, A., Urban, B., 2012. Comparison of nutrient removal capacity andbiomass settleability of four high-potential microalgal species. Bioresour.Technol. 124, 157–162.

F. Ji et al. / Bioresource Technology 161 (2014) 200–207 207

Subhadra, B.G., 2011. Water management policies for the algal biofuel sector in theSouthwestern United States. Appl. Energ. 88 (10), 3492–3498.

Turenne, C.Y., Sanche, S.E., Hoban, D.J., Karlowsky, J.A., Kabani, A.M., 1999. Rapididentification of fungi by using the ITS2 genetic region and an automatedfluorescent capillary electrophoresis system. J. Clin. Microbiol. 37 (6), 1846–1851.

Wang, B., Li, Y., Wu, N., Lan, C.Q., 2008. CO2 bio-mitigation using microalgae. Appl.Microbiol. Biotechnol. 79, 707–718.

Wang, B., Lan, C.Q., 2011. Biomass production and nitrogen and phosphorusremoval by the green alga Neochloris oleoabundans in simulated wastewater andsecondary municipal wastewater effluent. Bioresour. Technol. 102 (10), 5639–5644.

Wang, L., Li, Y., Chen, P., Min, M., Chen, Y., Zhu, J., Ruan, R.R., 2010. Anaerobicdigested dairy manure as a nutrient supplement for cultivation of oil-rich greenmicroalgae Chlorella sp. Bioresour. Technol. 101 (8), 2623–2628.

Wei, F., Qi, W., Bi, T., Sun, Z., Huang, Y., Shen, Y., 2002. Water and WastewaterMonitoring and Analysis Method, fourth ed. China Environmental SciencePress, Beijing.

Wijffels, R.H., Barbosa, M.J., 2010. An outlook on microalgal biofuels. Science 329,796–799.

Wu, L.F., Chen, P.C., Huang, A.P., Lee, C.M., 2012. The feasibility of biodieselproduction by microalgae using industrial wastewater. Bioresour. Technol. 113,14–18.

Yan, C., Zheng, Z., 2013. Performance of photoperiod and light intensity on biogasupgrade and biogas effluent nutrient reduction by the microalgae Chlorella sp.Bioresour. Technol. 139, 292–299.