Vol. 10, No. 6MOLECULAR AND CELLULAR BIOLOGY, June 1990, p. 2960-29650270-7306/90/062960-06$02.00/0Copyright © 1990, American Society for Microbiology

Base Pairing between the 3' Exon and an Internal Guide SequenceIncreases 3' Splice Site Specificity in the Tetrahymena Self-Splicing

rRNA IntronEUN RAN SUH AND RICHARD B. WARING*

Department of Biology, Temple University, Philadelphia, Pennsylvania 19122

Received 24 January 1990/Accepted 16 March 1990

It has been proposed that recognition of the 3' splice site in many group I introns involves base pairingbetween the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies,R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We haveexamined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatorymutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3'splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A)which resulted in an adenine instead of a guanine being the last base of the intron. These results show that theproposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against.Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site.

RNA splicing requires not only that a particular splice sitebe recognized well enough to react efficiently but also that itbe the sole site of reactivity. The group I intron of the largerRNA of Tetrahymena thermophila is self-splicing, beingable to catalyze its own excision and the ligation of itsflanking exons in the absence of proteins (8). Splice siterecognition can therefore be accomplished by the RNAitself. Splicing of some group I introns requires proteins invitro and in vivo (reviewed in reference 5). It is likely thatsome of these proteins are required to accomplish catalysisper se, but it is also possible that some contribute to thespecificity of splice site selection. Splicing occurs by twotransesterification reactions. First, the 3' hydroxyl of a freeguanosine attacks the 5' splice site (5'SS), and then the 3'hydroxyl of the released 5' exon attacks the 3' splice site(3'SS) to generate ligated exons and the released intron (8).Davies et al. (9, 27) and Michel et al. (18) presented

general models for the RNA secondary structure of group Iintrons. They proposed that a region of the intron pairedwith the nucleotides spanning the 5'SS and that this pairinghelped to define the 5'SS. Davies et al. (9, 27) also proposedthat an extension of this region, known as the internal guidesequence (IGS), paired with the start of the 3' exon and sohelped to bring the splice sites within the distance of aphosphodiester bond. A somewhat similar model was pro-posed for the splicing of the group I mitochondrial rRNAintron in yeast cells (4).

Experimental data strongly support the interaction of the5'SS and the IGS (2, 28). By contrast, Been and Cech, usingthe Tetrahymena intron, showed that the interaction with the3' exon sequence was not required for recognition of the3'SS (1). However, such experiments are usually performedwith RNA transcripts generated in vitro and therefore trun-cated shortly after the 3'SS. RNA precursors transcribed invivo frequently have extensive stretches of RNA down-stream of introns and are therefore more likely to havepotential competing 3'SSs. The identification of a cryptic3'SS in one of our transcripts led us to reevaluate the role of

* Corresponding author.

the interaction of the 3' exon and the IGS in the specificity ofsplice site selection. We conclude that base pairing betweenthe two regions of RNA can play a role in selecting againstundesirable cryptic 3'SSs in group I introns.

MATERIALS AND METHODS

Plasmid construction. DNA fragments containing the in-tron and flanking exons (26) (see Fig. 1) were shuttled asEcoRI-HindIII fragments into the various vectors describedbelow. Mutations were made as described by Kunkel (16),using the M13mpl8 vector. Oligonucleotides were synthe-sized by the Temple University Macromolecular SynthesisCenter.. Mutations were verified by DNA sequence analysis.Intron fragments were then subcloned into RNA transcrip-tion vector pSP65, which uses SP6 RNA polymerase, to givepSPTT14 (28), or pIBI24, which uses T7 RNA polymerase,to give pTT14 (24). pDU14 and mutant derivatives weresynthesized by cloning a double-stranded DNA fragmentsynthesized from two oligonucleotides into ScaI-HindIII-digested pTT14.RNA transcription and splicing. Transcription plasmids

were linearized with PvuII. Transcription reaction mixtures(20 pI) contained 40 mM Tris (pH 7.5), 6 mM MgCl2, 2 mMspermidine, 10 mM dithiothreitol, 100 ,ug of bovine serumalbumin per ,lI, 1 U of SP6 (2 U for T7) RNA polymerase perRI (United States Biochemical Corp.), 1 U of RNasin per plA(Promega Biotec), 50 to 75 ,ug of DNA per ml, 0.02 mM (0.1mM for T7 RNA polymerase) GTP, 5 ,uCi of [32P]GTP (NewEngland Nuclear Corp.), and 0.4 mM each of the remainingnucleoside triphosphates. Incubation was at 37°C for 1 h.The reaction mixtures were phenolized and ethanol precip-itated, and precursor RNA was purified on 7 M urea-5.5%polyacrylamide gels. RNA was located by autoradiography.Acrylamide strips were cut out, and the RNA was elutedovernight in 0.3 M sodium acetate-20 mM Tris (pH 8.0)-2mM EDTA at 4°C and ethanol precipitated twice. Theexperiment with preparation 1 (see Table 1) was performedin the laboratory of R. W. Davies, and the RNA was furtherpurified on Nensorb cartridges (New England Nuclear).

Standard splicing conditions were 50 mM Tris (pH 7.5)-S5

2960

on April 16, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

3'SS SELECTION IN A GROUP I INTRON 2961

A. 5SSE V

5E(24)

SELE 1

CRLE | I

134 1 5E I

B. pDU14 ccS H

ACTCGTAAGGCCTCGTAAGGAAGCTTII

5SS 1st 3SS 2nd 3SS

FIG. 1. RNA transcription constructs and P10 mutations. (A) The precursor transcript from pSPTT14 consists of 5' exon, intron, and 3'exon of 24, 414, and 214 bases, respectively. Arrowheads indicate splice sites. CR1 marks the site of the +110 cryptic 3'SS. The 134-baseband is described in Materials and Methods. Vector (Eli) and Tetrahymena (_) sequences are shown. E, EcoRI; B, BglII; S, ScaI; H,HindIll; P, PvuII. The insert shows the IGS, located a few bases downstream of the 5'SS, paired with the 5' exon (P1) and the 3' exon (P10)after guanosine (G*) has cleaved the 5'SS; the 3' exon is indicated by lowercase letters. The 28 mutation simultaneously changes the +4 g

to c and the +5 g to c. The 29 mutation simultaneously changes C17 to G and C18 to G. Throughout this work 28 and 29 are referred to as singlemutations. CRIVS and IVS, Cryptic and normal excised introns, respectively; CRLE and LE, cryptic and normal ligated exons, respectively;E, exon; CR3E, cryptic 3' exon. (B) The precursor transcript from pDU14 which contains an 8-base duplication of the 3'SS. The equivalent28 mutation is shown. SP6 RNA polymerase adds 1 to 2 (or more for T7 polymerase) random non-template-directed bases to the 3' terminiof transcripts (28). For convenience, the sizes attributed to RNA splicing products do not take this fact into account.

mM MgCl2-100 mM (NH4)2SO4-0.2 mM GTP for 30 min at30°C unless otherwise stated. Hydrolysis conditions were 50mM Tris (pH 9.0-S5 mM MgCl2-100 mM (NH4)2SO4 for 30min at 37°C. Splicing was stopped by the addition of 1volume of loading dye (95% formamide, 20 mM EDTA, 0.1%bromophenol blue, 0.1% xylene cyanol).RNA analysis and electrophoresis. RNA fragments were

sequenced by primer extension with mouse mammary leu-kemia virus reverse transcriptase (Bethesda Research Lab-oratories, Inc.) as described previously (28). Splicing reac-tions were run on 7 M urea-5.5% polyacrylamide gels. Allautoradiography for quantitative purposes was performed atroom temperature without an intensifier screen. RNA wasquantified by using an UltroScan densitometer (Pharmacia)(preparation 2; see Table 1) or a Joyce Lobell densitometer(preparation 1, Table 1). The data were converted to molarratios by dividing by the number of G residues in eachfragment.

Aberrant splicing at the cryptic 3'SS produced unligated 3'exon. It also produced a 134-base fragment (see Fig. 1 and2). This is the size expected of the product of a sequence ofevents involving cleavage at the cryptic site (by directcleavage or exon reopening; see below) to release the104-base cryptic 3' exon, followed (or preceded) by cleavageat the 5'SS, followed by ligation of the 5' exon (24 bases) atthe normal 3'SS to the truncated 3' exon of 110 bases.Because of a higher level of aberrant splicing in preparation2, the yields of RNA in this experiment (see Fig. 2) werecorrected as follows: actual IVS = IVSobS - 134, actualCRIVS = CRIVSobS + 134, and actual CRLE = CRLEobS +cryptic 3' exon, where IVS is normal excised intron, CRIVSis cryptic excised intron, CRLE is cryptic ligated exon, andobs is observed.

RESULTS

P10 mutations and a cryptic 3'SS. The validity of thepairing between the 3' exon and the IGS (called P10) wastested by making separate mutations (Fig. 1) in each com-

ponent of the pairing. The mutations were chosen so that ifthey were both present, base pairing potential would berestored. If the individual mutations both reduced splicingand the double mutation restored splicing, this wouldstrongly support the validity of the P10 interaction. Thephenotypes were assayed in an in vivo heterologous systemand in vitro.The Tetrahymena intron was inserted into the ,-galactosi-

dase alpha-peptide region of the Escherichia coli bacterio-phage vector M13mpl8 to give M.TT14 (the equivalent ofM.TET.14 [28]) in such a way that only if splicing occurredwould alpha peptide be expressed (26). ,B-Galactosidaseactivity is detected histochemically as blue plaques oninfected bacterial lawns on solid agar. Tight splicing muta-tions give white plaques. M.TT14 carrying either mutation28 (3' exon) or mutation 29 (IGS) (Fig. 1) was pale blue andcould be phenotypically distinguished- from M.TT14. How-ever, when both mutations were present, the phenotype wasrestored to a blue color indistinguishable from that of thewild type (data not shown).DNA fragments carrying the constructs described above

were shuttled into transcription vectors to perform in vitroRNA splicing assays (Fig. 1). Initially, transcripts wereobtained from plasmids linearized with HindlIl which gen-erated 3' exons of only 35 bases. The rate of splicing wasunaltered by the 28 3' exon mutation (10). Splicing at the5'SS for both mutation 29 and the double mutation was

slowed, making it difficult to examine the effect on splicing at

B3sS

Sy

IVS (414)

CR1H v p

3E (214)

CRIVS (524)

110

3E

CR3E

CR3E

110

P1295.' IIIUU - GG

GGGAGGUUUCCAUUUA

UCGuaagguag28Ai PI28

mmmmff... ::::=

VOL. 10, 1990

on April 16, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

2962 SUH AND WARING

1 mM 200 uM G T P about 10 to 15% of the time in the wild-type construct (Fig.A O~ B c: 2 and Table 1).cco CO > g cc z 0s 3:Splicing at mutant 3'SSs and at several cryptic sites

-c -c frequently produces a higher level of unligated 5' and 3'exons than normal, and, where characterized, the 3' exons

PRE have an extra G base attached at the 5' end (E. R. Suh andPRE R. B. Waring, unpublished results). This could occur in two

_ :_-Cs vs _ st= ways. The 3'SS could be cleaved directly by GTP in a

VIS-15 standard transesterification reaction; a possible precedentfor this exists (15). Alternatively, and the possibility wecurrently favor (Suh and Waring, unpublished data), GTPcould be reopening the ligated exons via a transesterificationreaction similar to 5'SS cleavage. This reaction would beanalogous to those in which the intron is used as an RNase

Lt L E (29). Conditions have been identified under which ligated

3 E exons can be reopened during splicing of group II introns(14). Whatever the mechanism used, we note that thecleaved sites are still being recognized as splice sites. The

_d_ CR LE degree of aberrant splicing at the +110 cryptic site was notalways the same (in Table 1, preparation 1 gave negligibleaberrant splicing; see also Materials and Methods) andincreased as the concentration of GTP increased (Fig. 2 and

-CR3E 3).

Introduction of the 28 3' exon mutation increased utiliza-tion of the cryptic 3'SS two to threefold (Fig. 2 and Table 1).The presence of the 29 IGS mutation alone had little effect onthe relative use of the cryptic site. However, addition of the

FIG. 2. Utilization of a cryptic 3'SS is dependent on P10 pairing

strength. (A) Precursor RNAs were spliced in 50mM Tris (pH 7.5)-5 29 mutation Into the 28 transcript completely suppressedmM MgCl2-100 mM (NH4)2S04-GTP for 30 min at 30°C. (B) activation of the cryptiC Site by the 28 mutation. In fact, thePrecursor RNAs were hydrolyzed as for panel A but in the absence cryptic site was used less in the double mutant than in theof GTP and at pH 9.0 for 30 min at 37°C. 28 and 29 are, respectively, wild type. These data support the proposal that base pairingthe 3' exon and the IGS intron mutations in P10; 2829 is the double between the IGS and the 3' exon plays a role in themutation. PRE, precursor; 5EI, intron plus 5' exon; 3E, 3' exon; specificity of 3'SS selection. Analysis of the transcripts withCRIVS and IVS, cryptic and normal excised introns, respectively; shortened 3' exons confirms that this pairing is not strictlyCRLE and LE, cryptic and normal ligated exons, respectively; required for splice site reactivity.CR3E, cryptic 3' exon. For 134, see Materials and Methods. C, The 3'SS of the wild-type Tetrahymena intron is suscep-

399-base circular form of the excised intron (30); L-15, reopened tible to hydrolysis, and at pH 9.0 considerable cleavage

circular intron (30); C., intron cyclized at the 5'SS (10). The very takes place (31). Limited hydrolysis of the 5'SS can occur at

faint band above the intron band in panel A is probably 5EI. Thebottom region of the gel was exposed longer than the rest of the gel. pH 9.0 in the absence of GTP, and this leads to a low level

WT, Wild type. of ligated exons. The 28 mutation abolished production ofligated exons at pH 9, presumably because it preventedhydrolysis of the 5'SS. Furthermore, hydrolysis of thecryptic 3'SS did not occur at pH 9.0 (Fig. 2B). This argues

the 3'SS. However, when the 3' exon of these transcripts that 5'SS hydrolysis is dependent upon the structure of thewas increased to 214 bases by linearizing the plasmids with 3'SS and that 3'SS hydrolysis depends upon a different or

PvuII, a cryptic 3'SS was discovered. This 3'SS was located more stringent means of 3'SS recognition than does 3'SS110 bases downstream of the normal 3'SS and was utilized splicing.

TABLE 1. Relative utilization of cryptic site in P10 mutantsa

Prepn 2Prepn 1, 30°C

Mutant 3OoCb 37°C

CRIVS/IVS CRLE/LE CRIVS/IVS CRLE/LE CRIVS/IVS CRLE/LE

None (WT)C 0.08 0.08 0.16 0.18 0.07 d28 0.25 0.25 0.34 0.44 0.16 0.1729 0.12 0.07 0.11 0.162829 0.04 0.02 0.03

a For the differences between preparations 1 and 2, see Materials and Methods. CRIVS/IVS is the molar ratio of cryptic intron generated by using the cryptic3'SS to normal intron. CRLE/LE is the molar ratio of cryptic to normal ligated exons. Splicing conditions were as described for Fig. 2, using 200 ,uM GTP.Aberrant splicing at the cryptic 3'SS can produce unligated 3' exon. Because of a higher level of aberrant splicing in preparation 2, the yields of RNA in thisexperiment were corrected as described in Materials and Methods.

b From the data shown in Fig. 2.c WT, Wild type.d -, The level of the cryptic product was too low to determine an accurate ratio.

MOL. CELL. BIOL.

on April 16, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

3'SS SELECTION IN A GROUP I INTRON 2963

4 14 A 28414A 21 2 3 4 5 1 2 3 4 5 1

CR C- -C -

PRE\13E -I-

CR IVS*

IVS/

!9414A 2829414A2 3 4 5 1 2 3 4 5

ma

A.

28414AACG U

- _m-

LE- _3E-

*'=4.

CR LE-

CR 3E-

FIG. 3. Mutation of intron terminal G base amplifies effect of PlOmutations. Splicing reactions were performed at 37°C as describedfor Fig. 2, with the addition of 2 mM spermidine (this does not effect3'SS selection per se). GTP concentrations were 0 (lanes 1), 0.2 ,uM(lanes 2), 20.0 ,uM (lanes 3), 1.0 mM (lanes 4), and 2.0 mM (lanes 5).RNA molecules generated in 414A mutants by cleavage at cryptic 5'splice sites in the 3' exon are indicated (0). Other labels are asdescribed in the legend to Fig. 2. The ligated exons and 3' exons ofthe +4 and +5 cryptic 3'SSs in 414A.29 are indicated (> and 4).

P10 mutations in a 414A background. In order to amplifythe effect of P10 mutations, we placed the constructs de-scribed above in the background of a leaky 3'SS mutation.The last nucleoside of all group I introns is a guanosine. Ifthis is changed to adenosine (mutation 414A), then at lowGTP concentrations the RNA precursor continues to spliceslowly to produce ligated exon. At high GTP concentrations,unligated 5' and 3' exon fragments are produced. The 3'exon fragment has a GTP molecule attached at its 5' end(Suh and Waring, unpublished results). At high GTP con-centrations, two cryptic 5'SSs are also activated at positions+6 and +11, thus releasing fragments of 209 and 204 bases,respectively; the +6 cryptic 5'SS has been identified before(20).

Interestingly, 414A alone did not increase but possiblydecreased utilization of the cryptic 3'SS. However, a com-bination of mutations 414A and 28 resulted in almost exclu-sive use of the cryptic 3'SS (Fig. 3). When the potential forP10 to pair was restored by the addition of the 29 mutation,the intron reverted to utilization of the normal 3'SS. Thesedata strongly support the hypothesis that P10 plays a role in3'SS selection.

If the 29 and 414A mutations were combined, then splicingoccurred neither at the normal nor at the +110 cryptic sitebut at two new cryptic sites, +4 and +5 (the major site)bases downstream of the normal 3'SS (Fig. 3 and 4).

Utilization of a synthetic duplication of the 3'SS. The role ofP10 was also tested in a situation in which an 8-baseduplicate of the 3'SS (CUGUAAGG) was placed 10 basesdownstream of the normal splice site to give plasmid pDU14(Fig. 1). The same P10 mutations as those used earlier (Fig.

A _of

& 41C _

0-uU

GA-A v.G _umC 0-A IV

AA

3'

GU

NG

N

A AA-.3_

FIG. 4. Precise locations of cryptic 3'SSs. RNAs were se-quenced by using reverse transcriptase and dideoxynucleotides. Thelabeling shows the RNA sequence, the complement of the cDNAsequence obtained. (A) The + 110 cryptic 3'SS was mapped by usingRNA from the 414A.28 mutant. 414A.29 has two splice sites at +4and +5 so the sequences overlap, one base out of register, in the 5'exon region. Arrowheads show the exon junctions. (B) The 3' exonof 414A.29 was also sequenced. Three 5' termini were visible (alighter exposure of this region is presented), corresponding to threemajor RNA components. One resulted from activation of the +6cryptic 5'SS by 414A, releasing a fragment of 209 bases (208 plusGTP at the 5' end). The others, 211 and 210 bases in size, were the3' exon fragments corresponding to the cryptic 3' sites at +4 and +5(210 and 209 bases, respectively), but increased by 1 nucleotide,which we believe to be because of the addition of GTP to the 5' end.

1) were introduced into the upstream site. In the absence ofthe mutations, the downstream site was used less than 5% ofthe time. Introduction of either the 28 or 29 P10 mutation didnot significantly alter this pattern. Introduction of both 28and 29 to give two compensatory base pair changes abol-ished all detectable use of the downstream site (data notshown).

DISCUSSION

P10 plays a role in 3'SS specificity. When Davies et al.presented a model for splice site selection in group I introns,it was originally proposed that base pairing between a regionof the intron (the IGS) and the start of the 3' exon was

required for 3'SS selection of most group I introns (9).Weakening of this (P10) pairing by mutation of its introncomponent did not significantly reduce the rate of splicing in

B.

29414AACGU

VOL. 10, 1990

.'

3'

on April 16, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

2964 SUH AND WARING

the Tetrahymena rRNA (1). While this clearly indicates thatP10 is not required for splicing, we present evidence in thiswork that it can play an important role in splice site selectionwhen there are competing 3'SSs. In summary, we show thatmutations which weaken P10 can increase the utilization ofcryptic 3'SSs while mutations which maintain base pairingthrough introduction of compensatory base pairs suppressutilization of alternative splice sites.The 28 mutation in the 3' exon resulted in reduced

,3-galactosidase activity in a heterologous in vivo assay andin increased use of a cryptic 3'SS in vitro. These observa-tions in themselves are not strong evidence for the existenceof P10. In the first case, the 28 mutation changed two aminoacids in the P-galactosidase alpha peptide, and in the second,the 28 mutation could have simply sequestered the 3'SS intoa less accessible structure. The fact that the 29 mutation soeffectively suppressed the effect of the 28 mutation, partic-ularly in the 414A mutational background, argues againstsuch alternative explanations.Michel et al. (17) have also recently provided support for

the existence of P10 by measuring the ratios of unligated 5'exon to ligated exons in P10 mutants in the background ofP9.0 mutations (defined below). P10 mutations do not signif-icantly decrease the rate of release of excised intron (1, 10,17). This could be because cleavage of the 5'SS is ratelimiting or because the rate-limiting step in exon ligation isthe catalytic step, rather than 3'SS binding. It has beenestimated that the effective concentration of the 3'SS isabout 1 mM (23).

Nature of the cryptic splice sites. It has been shown that3'SS recognition involves at least two components. Probablythe most important (19) is the last base of the intron, whichis a G in all group I introns (7). It has also been shown thatthe two bases prior to the terminal G (UC in Fig. 5A) pairwith two bases (5' GA) immediately downstream of a con-served sequence called S (17). This pairing is called P9.0.The cryptic 3'SS at +110 retains some of these features (Fig.5C). It has a terminal G, one of the P9.0 base pairs, and apartial P10 pairing. It also has a potentially strong stem-loopstructure 12 bases upstream, as does the normal 3'SS. Weobserved that introduction of 2 compensatory base pairs inP10 of the normal 3'SS reduced utilization of this crypticsite. This could be because the 29 mutation in the IGSslightly weakened the P10 pairing at the cryptic 3'SS (Fig.SB). This explanation would also account for the neutraleffect of the 29 mutation on 3'SS selection (Table 1).The 414A.29 mutant utilized two cryptic 3'SSs, +4 and +5

bases downstream of the normal 3'SS. These two siteswould have a terminal G base on the intron side of the splicesite. They would have poor P9.0 pairings, but it is strikingthat the 29 mutation creates good P10 pairings (Fig. SD).Given the frequency with which the imperfect + 110

cryptic site was utilized in unmutated transcripts, we weresomewhat surprised that an 8-base duplication of the 3'SScompeted so poorly with the normal 3'SS only 10 basesupstream. Weakening of the upstream site P10 failed toactivate the downstream site although two compensatorybase pair changes in the upstream P10, with concomitantweakening of the downstream P10, made selection of theupstream site even stronger. A 414A mutation in the up-stream site fully activates the downstream 3'SS (data notshown). This confirms that the downstream site is recogniz-able. These results are the converse of the situation seenwith the + 110 cryptic site in which a P10 mutation increasedutilization of the cryptic site while the 414A mutation had noeffect or even a negative effect. It is clearly not yet possible

A 5'Exon P1 GAAAUAGCAaauucccacucucu AmlO

1.111. uUGAAAAGGGAGGUUUCCAUUUA

111111. 3'Exon410-ACUCGuaagguagccaaaug

U A Plo *+10Core G

A P9.2 .390GGUUUUGAUUAGUUAUAUGAA

AACUAAUUUGUAUGCGAB

WT

UUCCAUUU3SS 111111.

aagguagc

+ UUCC AUUU110

aagcauaaa

c

28

UUCCAUUU11 II.aaccuagc

UUCC AUUUIII MIiiaagcauaaa

29

UUzGAUUU11 11.aagguagc

UUG.G AUUU11 1111aagcauaaa

2829

UU2GAUUUIII I.aaLccuagc

UUzGG AUUU11 li1aagcauaaa

5'Exon P1 GAAAUAGCAaauucccacucucu A.10

1.111. uUGAAAAGGGAGGUUUCCAUUUA

.111 liii 3'ExonAGCCGgaag uaaagucu

G A ca *+120Core c PlO

A .+100UACAACACACCUUAACACUCG

111111 111111 C< ~~~ UUCCUGUGUGAAAUUGUUAUC

D5 'Exon P1aauucccacucucu

GAAAUAGCA

. . AmlOr UGAAAAGGGAGGUUUGGAUUUAU

CoreL . II I. 3 'ExonACUCAUAAGGuagcc-aaaugccucg*410 AA PlO M+15

FIG. 5. Nature of the cryptic 3'SS and P10 pairings in mutants.(A) Normal 3'SS. (B) Possible P10 pairings at the normal 3'SS andthe downstream + 110 cryptic 3'SS in P10 mutants. Gaps have beeninserted between adjacent nucleotides which lie opposite bulgedbases. (C) The +110 cryptic 3SS in the wild-type precursor. (D) The+4 and +5 cryptic 3'SSs in the 414A.29 double mutant. The stemloop P9.2 is omitted in panel D to save space. Structures are shownwith the 5' splice having occurred. Intron and exon sequences areshown in upper- and lowercase, respectively. Core is the rest of theintron. Mutations are underlined and in italics. Arrowheads signifyany 3'SS.

to accurately predict the identities and behaviors of crypticsites.

Generality of P10. Neither P9.0 nor P10 is universal. Asmall percentage of group I introns have no PIO pairing,while some have only two base pairs (7, 25). However, themajority of group I introns discovered since this pairing waslast reviewed (25) have a potential P10 pairing of four ormore base pairs. More than half of the group I intronsanalyzed so far (6) have a P9.0 which consists of fewer thantwo base pairs. Some have no standard base pairs but mayuse reverse Hoogsteen base pairs between two A residues.The relative contributions of P9.0 and P10 remain to beestablished.

Implications of P10. Although the binding site for theexogenous guanosine and the terminal G414 has been identi-fied (17), the region of the ribozyme with which the IGSinteracts has not been determined. The limits imposed by

MOL. CELL. BIOL.

on April 16, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

3'SS SELECTION IN A GROUP I INTRON 2965

accounting for a P10 RNA helix should be useful in modelbuilding.

In pre-mRNA splicing, 3'SS recognition depends primar-ily on sequences within the intron. Nevertheless, 3' exonscan contribute to splice site selection in in vitro reactions,especially when the length of the 3' exon is increased (12, 13,21). However, no P10-like interactions between 3' exonsequences and intron sequences have been identified.Group I introns can mobilize through the mediation of

intron-specific endonucleases (reviewed in reference 11).The recognition sites for the endonucleases span both exons.This would ensure that both P1 and P10 are preserved andthat both splice site reactivity and selectivity are maintained.Such models have been discussed recently (3, 22). Confir-mation that P10 plays a role in splice site selection providesexperimental support for these ideas.

ACKNOWLEDGMENTS

R.B.W. is grateful for the help of R. W. Davies, in whoselaboratory this work was initiated.

This work was supported by Public Health Service grants GM41009 and S07 RRO7115 from the National Institutes of Health.

LITERATURE CITED1. Been, M. D., and T. R. Cech. 1985. Sites of circularization of the

Tetrahymena rRNA IVS are determined by sequence andinfluenced by position and secondary structure. Nucleic AcidsRes. 13:8389-8407.

2. Been, M. D., and T. R. Cech. 1986. One binding site determinessequence specificity of Tetrahymena pre-rRNA self-splicing,trans-splicing, and RNA enzyme activity. Cell 47:207-216.

3. Belfort, M. 1989. Bacteriophage introns: parasites within para-sites? Trends Genet. 5:209-211.

4. Bos, J. L., K. A. Osinga, G. Van der Horst, N. B. Hecht, H. F.Tabak, G. B. Van Ommen, and P. Borst. 1980. Splice pointsequence and transcripts of the intervening sequence in themitochondrial 21S rRNA gene of yeast. Cell 20:207-214.

5. Burke, J. M. 1988. Molecular genetics of group I introns: RNAstructures and protein factors required for splicing-a review.Gene 73:273-294.

6. Burke, J. M. 1989. Selection of the 3'-splice site in group Iintrons. FEBS Lett. 250:129-133.

7. Cech, T. R. 1988. Conserved sequences and structures of groupI introns: building an active site for RNA catalysis-a review.Gene 73:259-271.

8. Cech, T. R., A. J. Zaug, and P. J. Grabowski. 1981. In vitrosplicing of the rRNA precursor of Tetrahymena: involvement ofa guanosine nucleotide in the excision of the intervening se-quence. Cell 27:487-496.

9. Davies, R. W., R. B. Waring, J. Ray, T. A. Brown, and C.Scazzocchio. 1982. Making ends meet: a model for RNA splicingin fungal mitochondria. Nature (London) 300:719-724.

10. Davies, R. W., R. B. Waring, and P. Towner. 1987. Internalguide sequence and reaction specificity of group I self-splicingintrons. Cold Spring Harbor Symp. Quant. Biol. 52:165-171.

11. Dujon, B. 1989. Group I introns as mobile genetic elements:facts and mechanistic speculations-a review. Gene 82:91-113.

12. Furdon, P. J., and R. Kole. 1988. The length of the downstreamexon and the substitution of specific sequences affect pre-mRNA splicing in vitro. Mol. Cell. Biol. 8:860-866.

13. Hampson, R. K., L. L. Follette, and F. M. Rottman. 1989.Alternative processing of bovine growth hormone mRNA isinfluenced by downstream exon sequences. Mol. Cell. Biol.9:1604-1610.

14. Jarrell, K. A., C. L. Peebles, R. C. Dietrich, S. L. Romiti, andP. S. Perlman. 1988. Group II intron self-splicing. Alternatereaction conditions yield novel products. J. Biol. Chem. 263:3432-3439.

15. Kay, P. S., P. Menzel, and T. Inoue. 1988. Two guanosinebinding sites exist in group I self-splicing IVS RNAs. EMBO J.7:3531-3537.

16. Kunkel, T. A. 1985. Rapid and efficient site-specific mutagenesiswithout phenotypic selection. Proc. Natl. Acad. Sci. USA82:488-492.

17. Michel, F., M. Hanna, R. Green, D. P. Bartel, and J. W. Szostak.1989. The guanosine binding site of the Tetrahymena ribozyme.Nature (London) 342:391-395.

18. Michel, F., A. Jacquier, and B. Dujon. 1982. Comparison offungal mitochondrial introns reveals extensive homologies inRNA secondary structure. Biochimie 64:867-881.

19. Price, J. V., and T. R. Cech. 1988. Determinants of the 3' splicesite for self-splicing of the Tetrahymena pre-rRNA. Genes Dev.2:1439-1447.

20. Price, J. V., J. Engberg, and T. R. Cech. 1987. 5' exonrequirement for self-splicing of the Tetrahymena thermophilapre-rRNA and identification of a cryptic 5' splice site in the 3'exon. J. Mol. Biol. 196:49-60.

21. Reed, R., and T. Maniatis. 1986. A role for exon sequences andsplice-site proximity in splice site selection. Cell 46:681-690.

22. Scazzocchio, C. 1989. Group I introns: do they only go home?Trends Genet. 5:168-172.

23. Tanner, N. K., and T. R. Cech. 1987. Guanosine bindingrequired for cyclization of the self-splicing intervening sequenceribonucleic acid from Tetrahymena thermophila. Biochemistry26:3330-3340.

24. Waring, R. B. 1989. Identification of phosphate groups impor-tant to the self-splicing of the Tetrahymena rRNA intron asdetermined by phosphorothioate substitution. Nucleic AcidsRes. 17:10281-10293.

25. Waring, R. B., and R. W. Davies. 1984. Assessment of a modelof intron RNA secondary structure relevant to RNA self-splicing. Gene 28:277-291.

26. Waring, R. B., J. Ray, S. E. Edwards, R. W. Davies, and C.Scazzocchio. 1985. The Tetrahymena rRNA intron self-splices inE. coli: in vivo evidence for the importance of key base-pairedregions of RNA for RNA enzyme function. Cell 40:371-380.

27. Waring, R. B., C. Scazzocchio, R. W. Davies, and T. A. Brown.1983. A close relationship between certain nuclear and mito-chondrial introns: implications for the mechanism of RNAsplicing. J. Mol. Biol. 167:595-605.

28. Waring, R. B., P. Towner, S. J. Minter, and R. W. Davies. 1986.Splice-site selection by a self-splicing RNA of Tetrahymena.Nature (London) 321:133-139.

29. Zaug, A. J., M. D. Been, and T. R. Cech. 1986. The Tetrahy-mena ribozyme acts like an RNA restriction endonuclease.Nature (London) 324:429-433.

30. Zaug, A. J., P. J. Grabowski, and T. R. Cech. 1983. Autocata-lytic cyclization of an excised intervening sequence RNA is acleavage ligation reaction. Nature (London) 301:578-583.

31. Zaug, A. J., J. R. Kent, and T. R. Cech. 1985. Reactions of theintervening sequence of the Tetrahymena rRNA precursor: pHdependence of cyclization and site-specific hydrolysis. Bio-chemistry 24:6211-6218.

VOL. 10, 1990

on April 16, 2018 by guest

http://mcb.asm

.org/D

ownloaded from