1,4,5 1,2 george c. yeoh1,2 1,3 - the journal of ... · (trcn0000095953), lats (kd1)...

YAP regulates TAZ protein accumulation

1

TAZ protein accumulation is negatively regulated by YAP abundance in mammalian cells.

Megan L. Finch-Edmondson1,4,5, Robyn P. Strauss1,2, Adam M. Passman1,2, Marius Sudol4,5,6, George C. Yeoh1,2, and Bernard A. Callus1,3

1School of Chemistry and Biochemistry, University of Western Australia, WA, Australia

2Centre for Medical Research, The Harry Perkins Institute of Medical Research, WA, Australia

3School of Health Sciences, The University of Notre Dame Australia, WA, Australia

4Department of Physiology, NUS Yong Loo Lin School of Medicine, National University of Singapore, Singapore.

5Mechanobiology Institute (MBI), National University of Singapore, Singapore.

6Institute of Molecular and Cell Biology (IMCB), A*STAR, Singapore.

*Running title: YAP regulates TAZ protein accumulation

To whom correspondence should be addressed: Megan L. Finch-Edmondson, Mechanobiology Institute (MBI) T-Lab, National University of Singapore #10-01 5A Engineering Drive 1, 117411, Tel.: +65-8458-5290; E-mail: [email protected] Keywords: yes-associated protein (YAP); transcriptional coactivator with PDZ-binding motif (TAZ); Hippo pathway; protein degradation; post-transcriptional regulation; glycogen synthase kinase 3 (GSK-3). Background: Hippo pathway effectors YAP and TAZ are transcriptional coactivators that regulate cellular proliferation and tumorigenesis. Results: YAP negatively regulates TAZ abundance in a GSK-3-dependent manner. Conclusion: Changes in YAP abundance results in compensatory changes in TAZ to maintain Hippo signaling homeostasis. Significance: This initial reporting of a direct relationship between YAP and TAZ abundances has profound implications for understanding their biological functions. ABSTRACT

The mammalian Hippo signaling pathway regulates cell growth and survival and is frequently dysregulated in cancer. YAP and TAZ are transcriptional coactivators that function as effectors of this signaling pathway. Aberrant YAP and TAZ activity is reported in several human cancers, and normally the expression and nuclear localisation of these proteins is tightly regulated. We sought to establish whether a direct relationship exists between YAP and TAZ. Using knockdown and overexpression experiments we show YAP

inversely regulates the abundance of TAZ protein by proteasomal degradation. Interestingly this phenomenon was uni-directional since TAZ expression did not affect YAP abundance. Structure/function analyses suggest that YAP-induced TAZ degradation is a consequence of YAP-targeted gene transcription involving TEAD factors. Subsequent investigation of known regulators of TAZ degradation using specific inhibitors revealed a role for heat shock protein 90 and glycogen synthase kinase 3 but not casein kinase 1 nor LATS in YAP-mediated TAZ loss. Importantly, this phenomenon is conserved from mouse to human, however interestingly, different YAP isoforms varied in their ability to degrade TAZ. Since shRNA-mediated TAZ depletion in HeLa and D645 cells caused apoptotic cell death, we propose that isoform specific YAP-mediated TAZ degradation may contribute to the contradicting roles reported for YAP overexpression. This study identifies a novel mechanism of TAZ regulation by YAP, which has significant implications for our understanding of Hippo pathway regulation, YAP-isoform specific signaling, and the role of

http://www.jbc.org/cgi/doi/10.1074/jbc.M115.692285The latest version is at JBC Papers in Press. Published on October 2, 2015 as Manuscript M115.692285

Copyright 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

http://www.jbc.org/cgi/doi/10.1074/jbc.M115.692285


2

these proteins in cell proliferation, apoptosis and tumorigenesis.

YAP (yes-associated protein) and TAZ (transcriptional coactivator with PDZ-binding motif) are effectors of Hippo signaling in mammalian cells (1,2), which promote growth and survival via the transcription of genes involved in cell growth including connective tissue growth factor (3,4), amphiregulin (5,6), survivin (7), and cyclin A (8). This is demonstrated by numerous studies in vitro, using cell lines whereby knockdown or overexpression of YAP or TAZ results in changes in cellular proliferation, and in some studies apoptotic resistance (8-12). Moreover, studies in which the expression of YAP and/or TAZ was dysregulated in tissues including liver, skin, intestine and neural tube have confirmed a role for these effectors in proliferative processes in vivo (7,13-16).

Due to their pro-proliferative and anti-apoptotic properties, it is not surprising that YAP and TAZ function as oncogenes. Numerous studies have revealed that YAP and TAZ induce cellular traits characteristic of tumorigenic transformation including growth factor-independent proliferation, anchorage-independent growth and triggering of epithelial-mesenchymal transition (17,18). Dysregulation of YAP/TAZ expression has also been reported in most solid cancer types including ovarian, brain, liver, lung, and breast cancers (19-22), and targeting the Hippo pathway to alter YAP/TAZ activity has shown promise as a novel strategy for cancer treatment (for a comprehensive review see 23). Interestingly, a pro-apoptotic role for YAP has also been reported, mediated by association with p73 in response to apoptotic stimuli such as DNA damage in cell lines (24-27). In support of this, YAP has been reported as a tumor suppressor in human breast and colorectal cancers (28,29).

Given the significant role of these transcriptional coactivators in growth and tumorigenesis, the expression and nuclear localisation of YAP and TAZ is necessarily tightly regulated. The Hippo pathway negatively regulates YAP/TAZ abundance as well as their nuclear localisation. Activated by upstream signals such as cell-cell contact, Mst1/2 phosphorylates and thereby activates LATS 1/2 kinase(s) resulting in the phosphorylation of YAP and TAZ, leading to their cytoplasmic sequestration and inhibition of target gene transcription (1,7,25,30). More

recently, it was shown that an additional LATS 1/2 phosphorylation site in YAP and TAZ provides the priming signal for subsequent phosphorylation by casein kinase 1 delta/epsilon (CK1δ/ε) (31,32). Phosphorylation on this phosphodegron site promotes β-TrCP binding and recruitment of the SCFβ-TrCP E3 ligase complex for subsequent ubiquitination and proteasomal degradation.

Similarly, glycogen synthase kinase-3 alpha and beta (GSK-3α/β) has been shown to promote TAZ degradation by phosphorylating TAZ on two N-terminal phosphodegron sites in response to PI3K/Akt signaling (33). Interestingly, this phosphodegron is not conserved in YAP. An alternate mechanism proposes that GSK-3 does not directly phosphorylate TAZ, but rather GSK-3 phosphorylates β-catenin which interacts with Axin1, TAZ and β-TrCP to form the β-catenin destruction complex leading to TAZ degradation (34,35).

The discordance between these studies may be explained by species and cell-specific differences as one utilised mouse NIH3T3 fibroblasts (33) whereas the other used human cells, namely MCF10A-MII pre-malignant breast cancer and HEK293 cells (34). This is supported by the observation that NIH3T3 and HeLa cells exhibit significant differences in the phosphorylation of N- and C-terminal phosphodegrons, with respect to TAZ degradation (33).

Whilst there is an abundance of evidence that shows expression of both YAP and TAZ can have significant effects on a multitude of cell types a direct relationship, if any, between the two proteins has yet to be demonstrated. To address this knowledge gap in Hippo signaling we sought to determine whether the abundance of YAP and TAZ is linked. Surprisingly, modulating YAP abundance either by over-expression or gene knockdown using shRNA resulted in a concomitant decrease or increase in TAZ abundance respectively. Interestingly, this inverse relationship was uni-directional and only observed upon modulation of YAP levels and not following changes to TAZ abundance. This relationship has profound implications for Hippo signaling and cancer. EXPERIMENTAL PROCEDURES

Antibodies and chemicals – Anti-YAP (#4912) for Western blotting, Anti-TAZ (V386) (#4883) for Western blotting, Anti-GSK-3α


3

(#4337), Anti-GSK-3β (#12456), Anti-Phospo-GSK-3α/β (Ser21/9) (#8566), MG-132 (#2194), Anti-GAPDH (D16H11) XP (#5174) and Leptomycin B (LMB, #9676) were purchased from Cell Signaling Technology (Genesearch, Arundel, QLD). Anti-YAP for immunofluorescence has been described previously (25). Anti-TAZ (#560235) for immunofluorescence was purchased from BD-Biosciences (Zuellig Pharma, Singapore). Alexa-488 Donkey-Anti-Mouse (#A21202) and Alexa-488 Goat-Anti-Rabbit (#A11034) were purchased from Thermo Fisher Scientific. Anti-β-Actin (#A1978), 4-hydroxytamoxifen (4HT, #H7904), Cycloheximide (CHX, #C7698), DMSO (#D8418), Calpain inhibitor I (LLnL) (#A6185) and 17-(Allylamino)-17-demethoxy-geldanamycin (17-AAG, #A8476) were purchased from Sigma-Aldrich (Castle Hill, NSW). Anti-LATS 1 (#A300-477A) and Anti-LATS 2 (#A300-479A) were purchased from Bethyl laboratories Inc (VWR International, Muarrie, QLD). CK1 inhibitor IC261 (#400090) and GSK-3 inhibitor IX (BIO, #361550) were purchased from Merck Millipore (Kilsyth, VIC). Q-Val-Asp (non-omethylated)-OPh pan caspase inhibitor (Q-VD) (#IMI-2309) was purchased from Imgenex (Jomar Bioscience, Welland, SA).

Plasmids and cDNAs – Marius Sudol (National University of Singapore) generously provided plasmids containing cDNAs for hYAP1-2α and hYAP1-1β (36) and mouse YAP (mYAP, NCBI NM_009534.3). mYAP mutants WW1*/WW2* (W184A, P187A, W243A, and P246A), SH3* (P272A), and TEAD* (S79A) (see Fig. 2C) were generated using site-directed mutagenesis. Truncation mutants were generated by PCR using primers: 5’GTAGGATCCATGGAGCCCGCGCAACA and 5’GTGTCTAGACTATGGGCTCTGGGGAGCCAA for ΔCT, 5’GTGTCTAGACTATAACCACGTGAGAAATGGGCTCTGGGGAGCCAAGGGT for ΔTAD, and 5’GTGTCTAGACTAGCTTTCTTTATCTAGCTTGGTG for ΔPDZ (see Fig. 2C). hYAP1-1α was generated by overlapping PCR of hYAP1-2α and hYAP1-1β using primers: 5’GTAAGATCTGCCACCATGGATCCCGGGCAGCA with 5’CTGCCGAAGCAGTTCTTGCTGTTTCAG and

5’CTGAAACAGCAAGAACTGCTTCGGCAG with 5’GTGTCTAGACTATAACCATGTAAGAAAGCT. Mouse TAZ (mTAZ) (NCBI NM_133784.3) was amplified from cDNA prepared from mRNA isolated from a murine liver progenitor cell (LPC) line and cloned into pCR-TOPO2.1 (Life Technologies, Mulgrave, VIC). All constructs were then sub-cloned into the 4HT-inducible lentiviral expression vector, pF-5xUAS-MCS-W-SV40puro (37,38, and see Fig. 1D). Stable gene knockdown was performed using lentiviral shRNAs. Control (Con) (SHC202), YAP (KD) (TRCN0000238432), mouse TAZ (KD1) (TRCN0000095951), mouse TAZ (KD2) (TRCN0000095953), LATS (KD1) (TRCN0000274539), LATS (KD2) (TRCN0000274541), human TAZ (KD1) (TRCN0000319149), and human TAZ (KD2) (TRCN0000370007) shRNA MISSION plasmids were purchased from Sigma.

Cell culture – MEFs, NIH3T3 and HEK293T cells were provided by David Vaux (Walter and Eliza Hall Institute (WEHI, VIC). HeLa and D645 cells were obtained from David Huang (WEHI) and John Silke (WEHI), respectively. MCF-7 cells were provided by Louise Wedlock (UWA). Cells were maintained in DMEM (Life Technologies, #11885) supplemented with 10% (v/v) fetal bovine serum (FBS), 50 U/mL penicillin G/50 µg/mL streptomycin, 2 mM L-glutamine in a humidified atmosphere of 10% CO2 at 37°C. EpH4-Ev (EpH4) cells were purchased from ATCC (ATCC CRL-3063) and were maintained in DMEM (Biowest, #L0102) supplemented with 10% (v/v) FBS, 100 U/mL penicillin G/100 µg/mL streptomycin in a humidified atmosphere of 5% CO2 at 37°C.

Actin-EGFP LPCs were generated by GCY and cultured in Williams’ Medium E (Sigma, #W4125-10X1L) supplemented with 5% (v/v) FBS 2.5 µg/mL amphotericin B, 80 U/mL penicillin G/675 µg/mL streptomycin, 2 mM L-glutamine, 10 µg/mL Humulin R U-100 (UWA Pharmacy, Nedlands, WA), 30 ng/mL insulin-like growth factor II (ProSpec Ness-Ziona, Israel #CYT-265) and 20 ng/mL epidermal growth factor (BD Biosciences, North Ryde, NSW #354001) in a humidified atmosphere of 5% CO2 at 37°C.

The generation of lentiviruses and 4HT-inducible cell lines have been described before (37,39). Gene expression in target cells was induced by the addition of 100 nM 4HT. Stable knockdown cells were generated by infection with


4

shRNA-bearing lentiviruses and selection with puromycin.

Generation of YAP CRISPR-Cas9 cell line – WT EpH4 cells were transfected with the GeneArt CRISPR Nuclease vector with orange fluorescent protein reporter (Thermo Fisher Scientific, #A21174) containing mYAP-targeting guide RNA sequence 5’GCCCAAGTCCCACTCGCGAC using Lipofectamine2000 (Thermo Fisher Scientific) according to the manufacture’s instructions. Three days post-transfection single cells expressing OFP were sorted into 96-well plates, subsequently expanded, and individually screened for loss of YAP protein expression by Western blot.

Cell lysis and immunoblotting – Cell lysates were prepared as described before (40). Lysates (50 µg) were separated by SDS-PAGE and transferred to Hybond C nitrocellulose membrane (GE, Castle Hill, NSW). Membranes were immunoblotted with antibodies and detected with chemiluminescence essentially as described before (39) except Tris-buffered saline containing 0.1% Tween-20 (v/v) was used for washing membranes.

Immunofluorescent staining – Cells were grown on glass coverslips and fixed for 10 min with 4% paraformaldehyde in PBS. TAZ immunofluorescence staining was performed as described previously (20) using Anti-TAZ (1/200) and Alexa-488 Anti-mouse secondary (1/200), with block solution and diluents prepared using bovine serum albumin (BSA). YAP immunofluorescence staining was performed using a modified protocol; cells were first permeabilized using PBS containing 0.1% (v/v) Triton X-100 (PBST) for 15 min at room temperature before washing three times with PBS, then another three times with PBS containing 0.5% (w/v) BSA. Cells were blocked with 5% (w/v) BSA in PBS for 30 min at 37°C, washed three times with PBST before incubation in Anti-YAP diluted (1/5000) in PBST containing 1% (w/v) BSA overnight at 4°C. After three washes with PBST cells were incubated with Alexa-488 Anti-rabbit secondary (1/300) diluted in PBS containing 0.5% (w/v) BSA for 1 hour at room temperature. After final washes coverslips were mounted onto slides using ProLong Diamond Antifade mountant with DAPI (ThermoFisher Scientific) and allowed to cure overnight. Stained cells were visualised using the EVOS FL cell imaging system.

Cell proliferation assay – Cells were seeded in 96-well plates at 1x104 cells/mL and cell

confluency as a percentage of total area was measured twice daily using a CellaVista (Roche).

Quantitative real time PCR (qPCR) – The transcript abundance of YAP was determined using primers 5’CAGGAATTATTTCGGCAGGA and 5’CATCCTGCTCCAGTGTAGGC with Roche Universal Probe Library (UPL) probe 71. TAZ abundance was determined using primers 5’GTTCCAGCTCGTCAGTTCG and 5’TGCGTGACGTGGATGACT with UPL probe 70. TAF4A was used to normalise gene expression for YAP and TAZ using primers 5’CCACAGCAGATCCAACTGAA and 5’GGTAACACGGTGGGTTTCAC with UPL probe 71. qPCR amplification was performed using the LightCycler 480 System (Roche) using Roche LightCycler 480 Probes Master (#04707494001) with 0.2 µM of each primer, and 0.15 µM UPL probe and the following cycling conditions: 95°C for 10 min, then 55 cycles of 95°C for 10 s followed by 59°C for 30 s, and finally 40°C for 30 s.

Crystal violet staining of cells – Cells in 60 mm culture dishes were washed once with PBS before being fixed with PBS containing 1% (v/v) glutaraldehyde (Sigma, #G6257) for 10 min at room temperature. Cells were washed twice with PBS before being stained with a 0.1% (w/v) crystal violet (Sigma, #C3886) solution for 20 min at room temperature. Cells were washed three times with water and dried overnight. RESULTS

To determine whether a relationship exists between the abundance of YAP and TAZ, initially YAP expression was abolished in murine cells using shRNA. Consistent with reports in other cell lines (10,41), ablation of YAP in LPCs decreased cellular proliferation (Fig. 1A) in cells with undetectable YAP expression as determined by Western blot (Fig. 1B). Surprisingly, TAZ abundance was significantly increased in the YAP knockdown (KD) cells compared to uninfected wild-type (WT) cells, or those infected with the non-targeting control (Con) shRNA (Fig. 1B). To ascertain whether the increased TAZ abundance following YAP knockdown was specific to LPCs, YAP was ablated in NIH3T3 cells and immortalised MEFs with shRNA. Consistent with the LPC data, YAP was effectively depleted in both KD cell lines, and TAZ abundance was modestly, but consistently, increased in NIH3T3


5

KD and MEF KD cells compared to Con and WT cells, respectively (Fig. 1B).

Increased TAZ abundance upon shRNA-mediated YAP depletion was confirmed using CRISPR-Cas9 gene disruption to generate a YAP null clone of EpH4 cells (Fig. 1C). YAP knockout significantly increased TAZ abundance by Western blot, and this increase was also detectable by immunofluorescent staining for TAZ in these cells compared to WT (Fig. 1C).

To test whether increased YAP expression can reduce the abundance of TAZ, and also to eliminate the possibility that increased TAZ in the YAP depleted cells resulted from selection of cells with inherently higher TAZ expression, a short-term, 4HT-inducible expression system was utilized (Fig. 1D). As expected, treatment of parental NIH3T3 cells (NIH) with 4HT for 24 h had no effect on YAP or TAZ abundance, whereas a significant increase in YAP was observed within 8 h of 4HT addition in YAP-inducible NIH3T3 cells (NIH iYAP) (Fig. 1E). Noticeably, this was accompanied by a significant decrease in TAZ abundance after 16 h of 4HT treatment (Fig. 1E). The finding that YAP induction decreases TAZ abundance was subsequently confirmed in YAP-inducible MEFs and LPCs (Fig. 1E). Importantly, the effect on TAZ was specific to YAP since treatment of parental NIH3T3 cells with 4HT alone did not affect TAZ abundance.

To determine whether the decrease in TAZ abundance was the result of altered TAZ mRNA expression qPCR analysis was performed. Treatment of YAP-inducible NIH3T3 cells for 48 h with 4HT resulted in a 38-fold increase in YAP mRNA (p<0.01) (Fig. 1F), which was consistent with changes observed at the protein level (Fig. 1E). Interestingly, TAZ mRNA expression was not significantly altered following 48 h of 4HT treatment (Fig. 1F). Collectively these results show that YAP post-transcriptionally modulates TAZ abundance and this is not due to cell selection during continuous passage but is rather a direct consequence of YAP abundance.

Since YAP and TAZ are similarly regulated within cells (1,30-32), it was hypothesised that TAZ might similarly regulate YAP abundance. To investigate this, LPCs were infected with lentivirus bearing TAZ-specific shRNA. Despite a significant reduction in TAZ abundance in both TAZ shRNA infected LPC lines (KD1 or KD2), YAP abundance was unchanged (Fig. 1G). Next, to determine whether TAZ overexpression could

alter YAP abundance, TAZ-inducible NIH3T3 cells (NIH iTAZ) were generated. Despite a significant increase in TAZ 24 h post 4HT treatment, no change in YAP abundance was observed (Fig. 1G). From these experiments it was concluded that the level of TAZ protein does not affect YAP abundance. Furthermore this indicates that in addition to the regulatory mechanisms shared by YAP and TAZ, the abundance of TAZ is further modulated by a direct effect of YAP, but not vice versa. This is, at least in part, a possible consequence of differences in protein stability.

To confirm whether differences exist between YAP and TAZ protein stability, NIH3T3 cells were treated with CHX to block protein synthesis. CHX treatment led to a faster decrease in TAZ abundance compared to YAP (Fig. 2A). Conversely, inhibition of the proteasome by treatment with MG-132, led to a rapid accumulation of TAZ but not YAP indicating TAZ is more rapidly turned over and significantly less stable than YAP (Fig. 2A).

To discern the method of TAZ depletion following YAP induction YAP-inducible cells were independently treated with MG-132 to block proteasomal degradation, NH4Cl to disrupt lysosomal-facilitated degradation by increasing the pH of intracellular vesicles, or LLnL to block the calcium-dependent neutral cysteine protease calpain I. Treatment with MG-132 protected TAZ from YAP-induced depletion in YAP-inducible cells whereas NH4Cl and LLnL failed to prevent TAZ loss (Fig. 2B). Similarly, treating cells with LMB to inhibit nuclear export, completely blocked YAP-induced TAZ degradation after 24 h of 4HT treatment (Fig. 2B). These results indicate that upon YAP induction, TAZ is proteasomally degraded within the cytoplasm, which is consistent with the established mechanism of TAZ degradation (32,33,42).

To determine which YAP domain/s are required to induce TAZ degradation several mYAP deletion constructs were generated and the ability of these mutants to promote TAZ degradation after 24 h of induction was assessed. Deletion of YAP’s transcriptional activation domain (TAD) and PDZ-binding motif (construct ∆CT) totally abolished YAP-mediated TAZ degradation compared to WT YAP (Fig. 2C), and deletion of either of these domains (∆TAD or ∆PDZ) revealed that both are necessary to induce TAZ degradation. Mutation of YAP’s WW domains (WW1*/WW2*) or SH3-binding domain


6

(SH3*) did not affect YAP’s ability to degrade TAZ whereas disruption of YAP’s TEAD-binding domain (TEAD*) with the point mutation, S79A, partially blocked TAZ degradation compared to WT YAP (Fig. 2C). Together, this data suggests that the PDZ-binding and transcription activation domains are necessary to promote TAZ degradation and that this is at least partly mediated by DNA-binding TEAD factors.

Since phosphorylation of YAP and TAZ by LATS 1/2 kinase(s) is necessary for CK1-mediated degradation (32), we hypothesised that LATS 1/2 may mediate YAP-induced TAZ degradation. The heat shock protein 90 (Hsp90) inhibitor 17-AAG was shown to deplete LATS 1 and 2 leading to a decrease in YAP phosphorylation in A549 and MCF10A cells (43). Treatment of NIH iYAP cells with 17-AAG blocked the increase of LATS 1 induced by YAP overexpression, though it only partially blocked the increase of LATS 2 (Fig. 3A). Strikingly, 17-AAG treatment completely prevented YAP-induced TAZ degradation (Fig. 3A), indicating that a Hsp90 substrate, possibly LATS kinase, mediates YAP-induced TAZ degradation. To address this, shRNAs were utilised to ablate LATS 1/2 abundance. However, partial knockdown of LATS 1 and 2 failed to prevent YAP-induced TAZ degradation (Fig. 3B). Whilst not conclusive, this suggests that LATS kinases are possibly not involved.

Since the requirement of the LATS kinases for YAP-induced TAZ degradation was inconclusive, the role of other known mediators of TAZ degradation, CK1δ/ε and GSK-3α/β, were investigated. Treatment of NIH iYAP cells with the CK1δ/ε inhibitor IC261 in combination with 4HT was unable to prevent YAP-induced TAZ degradation (Fig. 3C), suggesting that the reported LATS 1/2-CK1δ/ε mechanism of TAZ degradation is not involved.

Next we investigated the involvement of GSK-3α/β in YAP-induced TAZ depletion. Strikingly, treatment with the GSK-3 inhibitor BIO completely blocked YAP-mediated TAZ degradation (Fig. 3D). Treatment with an independent inhibitor of GSK-3 (LiCl) similarly protected TAZ from degradation in YAP-inducible NIH3T3 cells (Fig. 3E). Since GSK-3 is reported to phosphorylate and degrade TAZ (33), we hypothesised that YAP induction might increase GSK-3 activity, resulting in TAZ phosphorylation and subsequent degradation. To test this, we

assessed the relative abundance of GSK-3 phosphorylation on serine residues 21 and 9 for GSK-3α and β respectively following YAP induction as an indicator of GSK-3 activity (reviewed in 44). Surprisingly, no significant change in the relative abundance of phospho-GSK-3 was observed following YAP induction for up to 24 h (Fig. 3F). These results indicate that whilst YAP overexpression does not directly modulate GSK-3 activity, active GSK-3α/β is still required for YAP-induced TAZ degradation.

To investigate whether YAP-induced TAZ degradation is conserved in human cells, HeLa and D645 human cell lines were generated that can be induced to express three of the eight isoforms of human YAP (hYAP): hYAP1-1α, hYAP1-1β and hYAP1-2α (36). Consistent with mouse cell data, induction of hYAP1-2α, which is most similar to mYAP (90% similarity; 84% identity) led to a significant reduction in TAZ abundance in the two cell lines (Fig. 4A). Induction of hYAP1-1α, which differs from hYAP1-2α by the absence of YAP’s second WW domain, led to a reduction in TAZ comparable to hYAP1-2α (Fig. 4A). Surprisingly, induction of hYAP1-1β, which harbours an insertion of four amino acids within the leucine zipper motif of YAP’s TAD, was significantly less effective at inducing TAZ depletion compared to hYAP1-1α hYAP1-2α, despite being expressed at an even higher level (Fig. 4A). These results indicate that isoform specific differences affect the ability of YAP to degrade TAZ.

Despite YAP being a bona fide oncogene, overexpression of hYAP isoforms can result in apoptotic cell death in human cells (45). Since TAZ is reported to promote cell proliferation and protect cells from apoptosis (8), we hypothesised that in human cells YAP-induced TAZ depletion may inhibit cell growth and cause loss of cell viability. To examine this, TAZ was knocked down in HeLa and D645 cells using two independent shRNAs (Fig. 4B). Strikingly, TAZ depletion in both cell lines drastically reduced cell number after seven days as evaluated by clonogenic assay (Fig. 4C). To determine whether the reduced number of cells following TAZ knockdown was a result of increased cell death, shRNA infected HeLa and D645 cells were treated with the pan-caspase inhibitor Q-VD immediately following selection to block apoptosis (46). Treatment with Q-VD markedly increased the number of adherent TAZ knockdown cells at six


7

days post-infection, whilst having minimal effect on Con cells (Fig. 4D and E). Together, these results indicate that TAZ depletion induces cell growth inhibition and apoptotic cell death in these cells and likely contributes to previously reported cell death induced by YAP over-expression. DISCUSSION

The novel results presented here unequivocally show that YAP abundance regulates TAZ protein accumulation in human and murine cells. Using an inducible overexpression system that afforded data that was not confounded by selection bias we demonstrated that YAP-induced TAZ degradation occurs rapidly, within 8-16 h of YAP expression, and it is a direct consequence of YAP abundance on TAZ protein.

Interestingly this phenomenon was uni-directional since modulating TAZ expression levels did not affect YAP protein abundance, and this is reflected in the differences in stability of the two proteins: TAZ is constantly turned over whilst YAP is relatively stable. Consistent with earlier reports in HeLa and MCF10A cells (32) our data showed a significant decrease in TAZ but not YAP abundance upon treatment with an inhibitor of protein synthesis. Moreover inhibition of proteasomal degradation significantly increased TAZ but not YAP abundance similar to that shown for MCF10A and BT549 cells (32). Indeed in U2OS cells it was shown that YAP has a half-life approximately twice that of TAZ (47). The rapid turnover of TAZ relative to YAP affords more avenues for modulation by other factors/pathways to influence its accumulation within cells. Indeed, the uni-directional nature of YAP-TAZ regulation may simply reflect differences in the relative stabilities of the two proteins.

Proteasomal degradation of TAZ in the cytosol was shown to be the mechanism of TAZ depletion upon YAP induction, and this is consistent with the established mechanism of YAP/TAZ degradation (31,32).

Structure/function analyses revealed that YAP’s TAD and PDZ-binding motif, which is essential for nuclear localisation (45,48), are indispensable for TAZ degradation. YAP-TEAD association was also implicated by the partial protection of TAZ degradation afforded by mutation of serine 79 (S79) to alanine. Mutation of S79 has been shown to significantly reduce interaction with TEAD factors, although not entirely (16), which may explain why YAP-

induced TAZ degradation was only partially blocked. These results suggest that YAP-induced TAZ degradation is a consequence of YAP-target gene transcription involving TEAD factors, however these results do not exclude additional non-transcriptional mechanisms.

Whilst Hsp90 inhibition successfully blocked YAP-induced TAZ degradation, there was reasonable concern regarding the specificity of targeting LATS 1/2 via inhibition of the broad acting Hsp90 chaperone. This concern is justified since partial knockdown of LATS 1 and 2 was insufficient to block YAP-induced TAZ degradation. Although not conclusive, this suggests that a Hsp90 substrate other than the LATS kinases mediates this effect. Subsequent investigation into the role of CK1δ/ε and GSK-3α/β in TAZ degradation using inhibitors disclosed a role for GSK-3α/β, but not CK1δ/ε in YAP-induced TAZ degradation. The lack of a requirement for CK1δ/ε in this process adds support to our finding that LATS kinases are not likely involved. Based on current models of TAZ degradation, we would expect CK1δ/ε inhibition to block YAP-induced TAZ degradation if LATS was mediating this effect, however this was not observed.

Our data suggests a role for GSK-3α/β in YAP-induced TAZ degradation. Interestingly, GSK-3 tyrosine (activating) intramolecular autophosphorylation is reportedly mediated by Hsp90 (49). Thus a decrease in Hsp90-mediated GSK-3 activity, and not LATS 1/2 depletion could account for the effectiveness of the Hsp90 inhibitor 17-AAG, and relative ineffectiveness of the LATS shRNAs in preventing YAP-induced TAZ degradation. Importantly however, induction of YAP does not directly alter GSK-3α/β activity based on its phosphorylation status. Therefore we hypothesise that YAP-induction initiates a different signaling event required for TAZ degradation, though what this is remains to be identified.

We considered the possibility that YAP might promote an association of TAZ with the β-catenin destruction complex (34,35). In this model β-catenin is directly ubiquitinated following GSK-3 phosphorylation and serves as a scaffold for TAZ association with β-TrCP/E3 ubiquitin-ligase (34). Using a tandem-ubiquitinated binding entity (TUBE) assay in our system we have found that β-catenin is highly ubiquitinated following YAP induction (data not shown) suggesting TAZ


8

association with β-catenin may be a possible mechanism leading to its degradation following YAP induction.

Here we show that cellular depletion of TAZ by YAP is conserved between mouse and human cells. This is a significant observation since YAP/TAZ dysregulation is a known oncogenic driver in many human cancers (reviewed in 23,50). Interestingly, differences in the effectiveness of TAZ depletion were observed between the human YAP isoforms examined. Specifically that disruption of the leucine zipper motif (also known as the coiled-coil motif) within the TAD of some isoforms significantly reduced YAP’s ability to promote TAZ degradation. This is consistent with data demonstrating the requirement for the TAD to promote TAZ degradation (Fig. 2C). Whilst a leucine zipper is not essential for transcription co-activation within the TAD since for example TAZ does not harbour one in its TAD, it is widely accepted that YAP co-activates transcription by recruiting members of the basal transcription machinery, but may also promote recruitment of other factor/s that are necessary to promote TAZ degradation.

The difference in signaling among YAP’s eight known isoforms is an overlooked area of Hippo signaling. Our data demonstrates that different hYAP isoforms can have significantly varying effects on TAZ abundance, which may influence the biological outcome of YAP overexpression. For instance it may be that a YAP isoform that promotes TAZ degradation is less biologically potent or oncogenic compared to an isoform that does not since the effects of YAP and TAZ are overlapping and additive.

The observation that TAZ depletion in human cells restricts cell growth and causes apoptotic cell death is significant as it helps us to rationalise the reports of YAP overexpression resulting in apoptosis in some cells. Whilst we do not dispute that YAP association with p73 can result in promotion of apoptosis (24-27), undoubtedly YAP-induced TAZ depletion may contribute to cell death. Notably, TAZ knockdown in murine cells had no obvious effect on cell survival (data not shown), suggesting that there are intrinsic differences in the requirement for TAZ in the mouse and human cell lines tested. Moreover, a cell that depends on TAZ for survival may die

upon YAP over-expression as a consequence of the induced TAZ degradation.

The significance of these findings lies in the context of cancer and therapeutic YAP-targeting strategies. Targeting YAP alone may be insufficient to modulate the oncogenic effects of Hippo signaling since YAP and TAZ have overlapping functions and share common target genes (3). For example, to successfully block Hippo pathway-driven proliferation of cancer cells, direct targeting of TAZ, or a combinatorial approach targeting both YAP and TAZ may be more effective since our data suggests this would avoid compensatory increases in TAZ if only YAP was targeted. Furthermore, the ability of YAP to regulate TAZ abundance could explain, in part, how YAP and TAZ possess contradictory roles as both oncogenes and tumor suppressors. Perhaps when YAP is down-regulated or deleted, the resultant increase in TAZ abundance has an overall oncogenic effect. Similarly, for YAP to be oncogenic, the mechanism by which TAZ is degraded may need to be dysregulated to prevent TAZ loss that would otherwise compensate for increased YAP abundance/activity thereby resulting in a net increase in Hippo signaling.

This study has identified a novel regulatory mechanism that maintains Hippo signaling at constant levels under normal circumstances. Changes in YAP abundance/activity lead to compensatory changes in TAZ. Mechanistically it may be simpler to achieve this if the regulation was one-directional i.e. YAP affects TAZ abundance but not vice-versa. However, it is interesting to speculate that the phenomenon might reflect the biological potency or importance of the two proteins. As highlighted in this study, TAZ is more highly regulated than YAP. Thus it is conceivable that TAZ might be more potent than YAP and existing regulatory mechanisms restrict its detrimental accumulation in cells, which is reflected by its shorter half-life that places a higher energy demand on the cell.

Future work should build on the results presented here to obtain a more complete understanding of the mechanism of TAZ degradation induced by YAP, specifically identifying the links between YAP expression, GSK-3 signaling and TAZ degradation.


9

Acknowledgements: We thank David Vaux, David Huang, John Silke and Louise Wedlock for providing cells, and the Cancer Science Institute of Singapore FACS facility for performing single cell sorting of CRISPR-Cas9 EpH4 cell clones. Conflict of interest: The authors declare that they have no conflicts of interest with the contents of this article. Author contributions: MLFE, BAC, GCY designed the study and wrote the manuscript. MLFE, RPS, AMP and BAC designed, performed and analysed experiments. BAC, GCY and MS provided technical assistance and interpretation of data. All authors analysed the results and approved the final version of the manuscript.


10

REFERENCES 1. Kanai, F., Marignani, P. A., Sarassova, D., Yagi, R., Hall, R. A., et al. (2000) TAZ: a novel

transcriptional co-activator regulated by interactions with 14-3-3 and PDZ domain proteins. EMBO J. 19, 6778-6791

2. Sudol, M. (1994) Yes-associated protein (YAP65) is a proline-rich phosphoprotein that binds to the SH3 domain of the Yes proto-oncogene product. Oncogene 9, 2145-2152

3. Zhang, H., Liu, C. Y., Zha, Z. Y., Zhao, B., Yao, J., et al. (2009) TEAD Transcription Factors Mediate the Function of TAZ in Cell Growth and Epithelial-Mesenchymal Transition. J. Biol. Chem. 284, 13355-13362

4. Zhao, B., Ye, X., Yu, J., Li, L., Li, W., et al. (2008) TEAD mediates YAP-dependent gene induction and growth control. Genes Dev. 22, 1-10

5. Yang, N., Morrison, C. D., Liu, P., Miecznikowski, J., Bshara, W., et al. (2012) TAZ induces growth factor-independent proliferation through activation of EGFR ligand amphiregulin. Cell Cycle 11, 2922-2930

6. Zhang, J., Ji, J. Y., Yu, M., Overholtzer, M., Smolen, G. A., et al. (2009) YAP-dependent induction of amphiregulin identifies a non-cell-autonomous component of the Hippo pathway. Nat. Cell Biol. 11, 1444-1450

7. Dong, J., Feldmann, G., Huang, J., Wu, S., Zhang, N., et al. (2007) Elucidation of a Universal Size-Control Mechanism in Drosophila and Mammals. Cell 130, 1120-1133

8. Wang, L., Chen, Z., Wang, Y., Chang, D., Su, L., et al. (2013) WWTR1 promotes cell proliferation and inhibits apoptosis through cyclin A and CTGF regulation in non-small cell lung cancer. Tumor Biol. 35, 463-468

9. Zhou, Z., Hao, Y., Liu, N., Raptis, L., Tsao, M. S., et al. (2011) TAZ is a novel oncogene in non-small cell lung cancer. Oncogene 30, 2181-2186

10. Diep, C. H., Zucker, K. M., Hostetter, G., Watanabe, A., Hu, C., et al. (2012) Down-Regulation of Yes Associated Protein 1 Expression Reduces Cell Proliferation and Clonogenicity of Pancreatic Cancer Cells. PLoS ONE, 10.1371/journal.pone.0032783

11. Zhou, Z., Zhu, J. S., Xu, Z. P., and Zhang, Q. (2011) Lentiviral vector-mediated siRNA knockdown of the YAP gene inhibits growth and induces apoptosis in the SGC7901 gastric cancer cell line. Mol. Med. Rep. 4, 1075-1082

12. Wang, L., Shi, S., Guo, Z., Zhang, X., Han, S., et al. (2013) Overexpression of YAP and TAZ Is an Independent Predictor of Prognosis in Colorectal Cancer and Related to the Proliferation and Metastasis of Colon Cancer Cells. PLoS ONE, 10.1371/journal.pone.0065539

13. Camargo, F. D., Gokhale, S., Johnnidis, J. B., Fu, D., Bell, G. W., et al. (2007) YAP1 Increases Organ Size and Expands Undifferentiated Progenitor Cells. Curr. Biol. 17, 2054-2060

14. Cao, X., Pfaff, S. L., and Gage, F. H. (2008) YAP regulates neural progenitor cell number via the TEA domain transcription factor. Genes Dev. 22, 3320-3334

15. Lee, M. J., Byun, M. R., Furutani-Seiki, M., Hong, J. H., and Jung, H. S. (2014) YAP and TAZ Regulate Skin Wound Healing. J. Invest. Dermatol. 134, 518-525

16. Schlegelmilch, K., Mohseni, M., Kirak, O., Pruszak, J., Rodriguez, J. R., et al. (2011) Yap1 Acts Downstream of α-Catenin to Control Epidermal Proliferation. Cell 144, 782-795

17. Overholtzer, M., Zhang, J., Smolen, G. A., Muir, B., Li, W., et al. (2006) Transforming properties of YAP, a candidate oncogene on the chromosome 11q22 amplicon. P. Natl. Acad. Sci. USA 103, 12405-12410

18. Lei, Q. Y., Zhang, H. B., Zhao, B., Zha, Z. Y., Bai, F., et al. (2008) TAZ Promotes Cell Proliferation and Epithelial-Mesenchymal Transition and Is Inhibited by the Hippo Pathway. Mol. Cell Biol. 28, 2426-2436

19. Chan, S. W., Lim, C. J., Guo, K., Ng, C. P., Lee, I., et al. (2008) A Role for TAZ in Migration, Invasion, and Tumorigenesis of Breast Cancer Cells. Cancer Res. 68, 2592-2598

20. Cordenonsi, M., Zanconato, F., Azzolin, L., Forcato, M., Rosato, A., et al. (2011) The Hippo Transducer TAZ Confers Cancer Stem Cell-Related Traits on Breast Cancer Cells. Cell 147, 759-772


11

21. Zender, L., Spector, M. S., Xue, W., Flemming, P., Cordon-Cardo, C., et al. (2006) Identification and Validation of Oncogenes in Liver Cancer Using an Integrative Oncogenomic Approach. Cell Death Differ. 125, 1253-1267

22. Steinhardt, A. A., Gayyed, M. F., Klein, A. P., Dong, J., Maitra, A., et al. (2008) Expression of Yes-Associated Protein, YAP, in Common Solid Tumors. Hum. Pathol. 39, 1582-1589

23. Johnson, R., and Halder, G. (2014) The two faces of Hippo: targeting the Hippo pathway for regenerative medicine and cancer treatment. Nat. Rev. Drug Discov. 13, 63-79

24. Basu, S., Totty, N. F., Irwin, M. S., Sudol, M., and Downward, J. (2003) Akt Phosphorylates the Yes-Associated Protein, YAP, to Induce Interaction with 14-3-3 and Attenuation of p73-Mediated Apoptosis. Mol. Cell 11, 11-23

25. Oka, T., Mazack, V., and Sudol, M. (2008) Mst2 and Lats Kinases Regulate Apoptotic Function of Yes Kinase-associated Protein (YAP). J. Biol. Chem. 283, 27534-27546

26. Strano, S., Monti, O., Pediconi, N., Baccarini, A., Fontemaggi, G., et al. (2005) The Transcriptional Coactivator Yes-Associated Protein Drives p73 Gene-Target Specificity in Response to DNA Damage. Mol. Cell 18, 447-459

27. Levy, D., Adamovich, Y., Reuven, N., and Shaul, Y. (2008) Yap1 Phosphorylation by c-Abl Is a Critical Step in Selective Activation of Proapoptotic Genes in Response to DNA Damage. Mol. Cell 29, 350-361

28. Yuan, M., Tomlinson, V., Lara, R., Holliday, D., Chelala, C., et al. (2008) Yes-associated protein (YAP) functions as a tumor suppressor in breast. Cell Death Differ. 15, 1752-1759

29. Barry, E. R., Morikawa, T., Butler, B. L., Shrestha, K., de la Rosa, R., et al. (2013) Restriction of intestinal stem cell expansion and the regenerative response by YAP. Nature 493, 106-110

30. Hao, Y. W., Chun, A., Cheung, K., Rashidi, B., and Yang, X. L. (2008) Tumor Suppressor LATS1 Is a Negative Regulator of Oncogene YAP. J. Biol. Chem. 283, 5496-5509

31. Zhao, B., Li, L., Tumaneng, K., Wang, C. Y., and Guan, K. L. (2010) A coordinated phosphorylation by Lats and CK1 regulates YAP stability through SCF beta-TRCP. Genes Dev. 24, 72-85

32. Liu, C. Y., Zha, Z. Y., Zhou, X., Zhang, H., Huang, W., et al. (2010) The Hippo Tumor Pathway Promotes TAZ Degradation by Phosphorylating a Phosphodegron and Recruiting the SCF-βTrCP E3 Ligase. J. Biol. Chem. 285, 37159-37169

33. Huang, W., Lv, X., Liu, C., Zha, Z., Zhang, H., et al. (2012) The N-terminal Phosphodegron Targets TAZ/WWTR1 Protein for SCFbeta-TrCP-dependent Degradation in Response to Phosphatidylinositol 3-Kinase Inhibition. J. Biol. Chem. 287, 26245-26253

34. Azzolin, L., Zanconato, F., Bresolin, S., Forcato, M., Basso, G., et al. (2012) Role of TAZ as Mediator of Wnt Signaling. Cell 151, 1443-1456

35. Azzolin, L., Panciera, T., Soligo, S., Enzo, E., Bicciato, S., et al. (2014) YAP/TAZ Incorporation in the β-Catenin Destruction Complex Orchestrates the Wnt Response. Cell 158, 157-170

36. Gaffney, C. J., Oka, T., Mazack, V., Hilman, D., Gat, U., et al. (2012) Identification, basic characterization and evolutionary analysis of differentially spliced mRNA isoforms of human YAP1 gene. Gene 509, 215-222

37. Callus, B. A., Ekert, P. G., Heraud, J. E., Jabbour, A. M., Kotevski, A., et al. (2008) Cytoplasmic p53 is not required for PUMA-induced apoptosis. Cell Death Differ. 15, 213-215

38. Dunning, C. J. R., McKenzie, M., Sugiana, C., Lazarou, M., Silke, J., et al. (2007) Human CIA30 is involved in the early assembly of mitochondrial complex I and mutations in its gene cause disease. EMBO J. 26, 3227-3237

39. Lupas, A., Van Dyke, M., and Stock, J. (1991) Predicting Coiled Coils from Protein Sequences. Science 252, 1162-1164

40. Callus, B. A., Verhagen, A. M., and Vaux, D. L. (2006) Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation. FEBS J. 273, 4264-4276

41. Fu, D., Lv, X., Hua, G., He, C., Dong, J., et al. (2014) YAP regulates cell proliferation, migration, and steroidogenesis in adult granulosa cell tumors. Endocr. Relat. Cancer 21, 297-310


12

42. Melvin, A. T., Woss, G. S., Park, J. H., Dumberger, L. D., Waters, M. L., et al. (2013) A Comparative Analysis of the Ubiquitination Kinetics of Multiple Degrons to Identify an Ideal Targeting Sequence for a Proteasome Reporter. PLoS ONE 8, e78082

43. Huntoon, C. J., Nye, M. D., Geng, L., Peterson, K. L., Flatten, K. S., et al. (2010) Heat Shock Protein 90 (HSP90) Inhibition Depletes LATS1 and LATS2, Two Regulators of the Mammalian Hippo Tumor Suppressor Pathway. Cancer Res. 70, 8642-8650

44. Medina, M., and Wandosell, F. (2011) Deconstructing GSK-3: The Fine Regulation of Its Activity. Int. J. Alzheimers Dis. 2011, 479249

45. Oka, T., and Sudol, M. (2009) Nuclear localization and pro-apoptotic signaling of YAP2 require intact PDZ-binding motif. Genes Cells 14, 607-615

46. Caserta, T. M., Smith, A. N., Gultice, A. D., Reedy, M. A., and Brown, T. L. (2003) Q-VD-OPh, a broad spectrum caspase inhibitor with potent antiapoptotic properties. Apoptosis 8, 345-352

47. Vigneron, A. M., Ludwig, R. L., and Vousden, K. H. (2010) Cytoplasmic ASPP1 inhibits apoptosis through the control of YAP. Genes Dev. 24, 2430-2439

48. Oka, T., Remue, E., Meerschaert, K., Vanloo, B., Boucherie, C., et al. (2010) Functional complexes between YAP2 and ZO-2 are PDZ domain-dependent, and regulate YAP2 nuclear localization and signalling. Biochem J. 432, 461-472

49. Lochhead, P. A., Kinstrie, R., Sibbet, G., Rawjee, T., Morrice, N., et al. (2006) A Chaperone-Dependent GSK3β Transitional Intermediate Mediates Activation-Loop Autophosphorylation. Mol. Cell 24, 627-633

50. Harvey, K. F., Zhang, X., and Thomas, D. M. (2013) The Hippo pathway and human cancer. Nat. Rev. Cancer 13, 246-257


13

FOOTNOTES This work was supported by a grant from the Association of International Cancer Research (09-0084) and a Research Fellowship and grants (APP1010749 and APP1067515) from the Cancer Council of Western Australia awarded to BAC. MLF was a recipient of an Australian Postgraduate Award and top-up scholarships from the University of Western Australia (UWA) and the National Stem Cell Foundation of Australia. RPS is a recipient of a Prescott Postgraduate Scholarship. AMP was a recipient of a University Postgraduate Award from UWA, and top-up scholarships from UWA and the Cancer Council of Western Australia. The abbreviations used are: YAP, yes-associated protein; TAZ, transcriptional coactivator with PDZ-binding motif; CK1, casein kinase 1; GSK-3, glycogen synthase kinase 3; LMB, Leptomycin B; 4HT, 4-hydroxytamoxifen; CHX, Cycloheximide; 17-AAG, 17-(Allylamino)-17-demethoxy-geldanamycin; hYAP, human YAP; mYAP, mouse YAP; mTAZ, mouse TAZ; LPC, liver progenitor cell; Con, control; KD, knockdown; WT, wild-type; TAD, transcriptional activation domain; Hsp90, heat shock protein 90. FIGURE LEGENDS FIGURE 1. YAP inversely regulates TAZ abundance in mammalian cells. (A) Wild-type (WT) liver progenitor cells (LPCs) were stably infected with lentivirus bearing control (Con) or YAP-specific (KD) shRNAs. Cell confluency of stable cell lines was measured using a CellaVista. Data is presented as mean ± SEM (n=3). (B) WT LPCs, NIH3T3 cells and MEFs were stably infected with lentivirus bearing control (Con) or YAP-specific (KD) shRNAs. (C) WT EpH4 cells were transfected with mYAP-targeting CRISPR-Cas9 plasmid and a YAP null clone (YAP CRISPR) was selected and immunostained for YAP and TAZ. (D) Schematic representation of the 4HT inducible lentiviral expression system. Constitutive expression of the GEV16 transcription factor (GEV16 TF) is driven by the Ubiquitin promoter. Following addition of 4HT, GEV16 TF translocates to the nucleus where its GAL4-DNA binding domain directs binding to GAL4 upstream activating sequences (5xUAS) to drive expression of YAP or TAZ gene expression. (E) WT NIH3T3 cells (NIH), and YAP-inducible (iYAP) NIH cells, MEFs and LPCs were treated with or without 4HT for 24 h or as indicated. (F) NIH iYAP cells were treated with or without 4HT for 48 h. Total RNA was harvested and qPCR analysis was performed to determine relative YAP and TAZ mRNA expression. Data is presented as mean + SEM (n=3), with expression in non-4HT treated cells arbitrarily set to 1.0. Statistical analysis was performed using a one-way ANOVA with Tukey’s multiple comparison test, **p<0.01. (G) WT LPCs were stably infected with lentivirus bearing control (Con) or mouse TAZ-specific (KD1 and KD2) shRNAs. TAZ-inducible NIH3T3 cells (NIH iTAZ) were treated with 4HT for 24 h to induce TAZ expression. Cell lysates were separated by SDS-PAGE, transferred to membrane and immunoblotted for YAP, TAZ and the loading control β-Actin or GAPDH, as indicated. Size markers are shown in kilodaltons. FIGURE 2. YAP-induced TAZ degradation requires YAP transactivation and PDZ-binding domains. (A) NIH3T3 cells were treated with 20 µg/mL cycloheximide (CHX), or 2.5 µM MG-132, as indicated. (B) NIH3T3 inducible YAP (iYAP) cells were treated with or without 4HT in the presence of vehicle, 1 µM MG-132, 50 mM ammonium chloride (NH4Cl), or 20 nM Leptomycin B (LMB), and HeLa iYAP cells were treated with 1 µM LLnL for 24 h as indicated. *High chemiluminescence intensity resulted in membrane damage and loss of signal. (C) NIH3T3 inducible cells were treated with or without 4HT for 24 h to induce the expression of wild-type mYAP (WT), ΔCT, ΔTAD, ΔPDZ, WW1*/WW2*, SH3* and TEAD* constructs as indicated. Cell lysates were separated by SDS-PAGE, transferred to membrane and immunoblotted for YAP, TAZ and the loading control β-Actin, as indicated. Size markers are shown in kilodaltons. FIGURE 3. Induction of YAP does not alter GSK-3 activity but YAP-induced TAZ degradation requires GSK-3. (A, C-E) NIH3T3 inducible YAP (iYAP) cells were treated with or without 4HT in the presence of Hsp90 inhibitor (17-AAG) (A), CK1δ/ε inhibitor (IC261) (C), GSK-3α/β inhibitor IX (BIO) (D), or


14

lithium chloride (LiCl) (E) at the indicated concentrations for 24 h. (B) WT NIH iYAP cells were infected with lentivirus bearing control (Con) or LATS-specific (KD1 or KD2) shRNAs. Cells were then treated with or without 4HT for 24 h. (F) NIH iYAP cells were treated with or without 4HT for the indicated times. Harvested cell lysates were separated by SDS-PAGE, transferred to membrane and immunoblotted for YAP, TAZ, LATS 1, LATS 2, GSK-3α, GSK-3β, p-GSK-3α/β (S21/9), and β-Actin as indicated. Size markers are shown in kilodaltons. FIGURE 4. Certain YAP isoforms induce TAZ degradation and loss of TAZ causes apoptosis. (A) HeLa and D645 cells stably expressing inducible hYAP1-1α (1-1α), hYAP1-1β (1-1β) or hYAP1-2α (1-2α) were treated with or without 4HT for 24 h as indicated before being harvested. (B) Wild-type HeLa and D645 cells were stably infected with lentiviruses bearing control (Con) or human TAZ-specific (KD1 and KD2) shRNAs. After selection with puromycin for 24 h cells were trypsinised and harvested. Cell lysates were separated by SDS-PAGE, transferred to membrane and immunoblotted for YAP, TAZ and β-Actin as indicated. Size markers are shown in kilodaltons. (C) HeLa and D645 Con, KD1 and KD2 cells from (B) were counted and 5x104 cells plated into 60 mm dishes and cultured for 7 d. Cells were then fixed with glutaraldehyde and stained using crystal violet. HeLa (D) and D645 (E) Con, KD1 and KD2 cells were prepared as in (C) except cells were plated in the presence (+) or absence (-) of 20 µM Q-VD and cultured for 6 d before capturing images. Scale bar represents 100µm.


15

Figure 1


16

Figure 2


17

Figure 3


18

Figure 4

1,4,5 1,2 george c. yeoh1,2 1,3 - the journal of ... · (trcn0000095953), lats (kd1)...

Documents