Wesley Leftwich

Abstract

The purpose of this experiment is to extract certain genes encoded to convert B-Carotene

to astaxanthin in Haematococcus pluvialis and insert these genes into a hairy root. The genes

required to do so include Beta carotene ketolase, or BKT, and Beta carotene hydroxylase, or

BCH. Haematococcus pluvialis produces the carotenoid astaxanthin naturally under high stress

or direct sunlight to protect itself from damage, and this quality also proves to benefit humans.

Astaxanthin is a commercially valuable ketocarotenoid. Like all ketocarotenoids, astaxanthin

contains a keto group and hydroxyl group, which make them good antioxidants. It also helps in

eye and skin health, and has other positive attributes for humans including anti-inflammatory

properties, anticancer activity, enhances immune responses, and restrains oxidation of low-

density lipoproteins.

Introduction

The ketocarotenoid astaxanthin (3, 3-dihydroxy-4,4-diketo-carotene) has been used as a

pigmentation source for fish aquaculture and egg yolks, and also serves as a potent antioxidant

(Kobayashi 1992). Although the actual role of astaxanthin is unknown, it is known that it plays a

role in photoprotection and protection from oxidative stress. The green alga, Haematococcus

pluvialis, produces the highest astaxanthin accumulation, reaching up to 4% by dry weight, and

is relatively easy to maintain, which makes it an appropriate source for astaxanthin production

(Steinbrenner and Linden 2001). H. pluvialis produces astaxanthin in response to environmental

stress such, as high light intensity, salt stress, nitrogen limitation, and iron stress (Steinbrenner

and Linden 2001). This purpose of this work was to clone the genes, Beta carotene ketolase and

Beta carotene hydroxylase, that H. pluvialis utilizes to convert Beta-carotene to astaxanthin and

insert those genes into a hairy root. The enzymes encoded by these genes belong to a family of

enzymes that take part in the biochemistry of carotenogenesis (Hirschberg 2001). The sequences

of the genes in this family are extremely conserved across crop plants, making it possible to

insert genes from different plants into others that participate in some form of carotenogenesis, to

make carotenoids that would not normally be made in those crops (Fraser 1997). The BKT and

BCH genes are novel genes that are the best known sequences that which convert B-carotene to

astaxanthin, thus acquiring those genes is important in order to engineer them into other

organisms (Fraser 1997), such as feed for farm-raised salmon and chickens, giving the salmon

and egg yolk’s their yellow, red, or orange pigment color. Astaxanthin was needed as a

supplement for farm-raised salmon because farm-raised fish do not have access to the algae and

other feed available in the open sea, which is how wild salmon receive astaxanthin. Additionally,

egg yolk needed to be pigmented for consumer preference. These supplements began as a

pigmentation additive, but turned out to be also beneficial for proper growth and as a powerful

antioxidant.

The carotenoid biosynthetic pathway. Arrow with a square in the middle means β-carotenoid ketolase is needed, and an arrow with a circle in the middle means β-carotenoid hydroxylase is needed.

Materials and Methods

In order to clone the BKT and BCH genes from H. pluvialis the algae need to be induced

to produce astaxanthin followed by the mRNAs of the genes being made into cDNA. The

cDNAs will then be put into a vector for plant transformation, which in this experiment was the

agrobacterium, p201crtB-2, containing the kanamycin resistance gene. The promoter and

terminator used for the cDNA cassettes will be from pGmubi-sgfp-nos, since the soybean,

tobacco, lima bean, and carrot hairy roots all recognize the Gmubi promoter and terminator, and

will perform direct expression of the gene such a promoter and terminator contains. In between

the Gmubi promoter and terminator sites is a gfp gene. This gene serves as space in which the

BKT/BCH gene will be inserted. The Gmubi-sgfp-nos section will be cut out of the pGmubi-

sgfp-nos vector and then inserted into each of the three shuttles. Shuttles will be needed to insert

both the cassettes containing the BKT and BCH genes into the p201 crtB-2 vector in order to

make a binary vector, since the production of astaxanthin from Beta-carotene in H. pluvialis

requires both the Beta-carotene hydoxylase gene and Beta-carotene ketolase gene. Then, the gfp

gene will be removed and replaced with either of the BKT and BCH genes. At this point the

vector present contains the BKT/BCH gene with the Gmubi promoter and terminator, and shuttle

containing the Ppo, Sce, or both restriction sites. It is these restriction sites, present in all the

shuttles and p201 crtB-2 vector, that make the insertion of two cassettes possible.

Accordingly, H. pluvialis will be grown on media described by Kobayashi et. al. (1992) and

then manipulated to over-produce astaxanthin by induction with sodium chloride. Past

experiments have used sodium acetate, FeSO4, sodium chloride, continuous high light, and

nitrogen deficiency in varying combinations and degrees to induce production of astaxanthin, but

sufficient results were obtained in the past by using sodium chloride alone. This will make it

easier to locate the RNAs of the BKT and BCH genes and clone them from H. pluvialis

(Kobayashi 1992; Huang 2005; Zhu 2009).

The first goal was to determine the best treatment with which to induce astaxanthin

production. Accordingly, experiments were performed to compare NaCl (100 mM total

concentration), sodium acetate (45mM), ferrous sulfate (450 µM), sodium acetate (45 mM) with

ferrous sulfate (450 µM), and continuous high light (>100 μE/m2/s, 24oC – 32oC)(Kobayashi

1992; Huang 2005). Results were calculated by looking for the red pigment that which

astaxanthin produces in the green algae. The best results were observed under continuous high

light conditions without supplements, because only under this condition did the algae assume the

red pigmentation. (see new Results section at bottom)

After 24 hours in high light the H. pluvialis initially started to express the BKT and BCH

genes to synthesize astaxanthin. After 48 hours of high light, H. pluvialis turned a visible red

color, and astaxanthin production was noticeable. Samples between 90-110 mg of the algae in

all three stages (green: under no stress conditions, brown: after 24 hours of high light, and red:

after 48 hours of high light) were taken and ground up with a mortar and pestle in liquid nitrogen

in order to isolate the RNA content in the tissue. Also to note: It became aware that the algae

was contaminated in the tubes they were delivered in, so therefore when grown in flasks,

contaminants were present. This did not affect the algae’s ability to produce astaxanthin though,

and no alterations were made considering BKT and BCH mRNAs were extracted successfully.

The picture to the left displays Haematococcus pluvialis without any high light stress and no obvious astaxanthin production. The picture to the right displays H. pluvialis after 48 hours of high light stress with obvious astaxanthin production.

The tube to the left is a picture of the astaxanthin production of H. pluvialis after 24 hours of high light. This was the tissue used to extract the RNA from the cells, since astaxanthin was in the process of being produced at this stage. The middle tube is a picture of H. pluvialis without any exposure to high light. The right tube is a picture of the astaxanthin production after 48 hours of high light.

The RNA for BKT and BCH was extracted with the materials and guide provided by

Spectrum Plant Total RNA kit, user guide catalog numbers STRN10, STRN50, and STRN250.

Then cDNA was synthesized and PCR followed using Invitrogen SuperScript III Reverse

Transcriptase catalog number 18080-093. PCR reactions to amplify the specific regions of DNA

were as follows.

P primers:

BKT2

Forward: 5’-CCTGCCTAAGTCGAAGAATG-3’

Reverse: 5’-TCACCAGCGGAGGGAC-3’

BKT1

Forward: 5’-GTTTGTGCGCCTCGAC-3’

Reverse: 5’-CCAGCTAGGCAGGAACCA-3’

BCH

Forward: 5’-TTTCACAAGCCCGTGAGC-3’

Reverse: 5’-CTGGTTCCGCACCCTAC-3’

Oligo dT primer (which makes cDNA with any RNA starting with a poly A):

TTTTTTTTTTTTTTTTTT

NCBI Nucleotide Database was used to find sequences of the BKT and BCH DNA. The

accession numbers for the genes are: AF162276 (for BCH), X86782 (for BKT1), and D45881.1

(for BKT2). Next Redasoft Visual Cloning was used to make a map of the genes, and finally

Gene Runner to make primers.

Map of genes using RedaSoft Visual Cloning

Following, the Blunt-End cloning protocol from Fermentas Life Sciences CloneJet PCR

cloning kit #K1231, #K1232 was used to ligate the PCR products with pJET1.2 blunt cloning

vector, and the Sigma GenElute Plasmid Miniprep Kit was used to isolate the pJET1.2 and PCR

product plasmid DNA.

The CloneJet and PCR gene from the ligation were used for a bacterial transformation

using New England BioLabs High Efficiency Transformation Protocol (C2987H) and selected

for ampicillin resistant colonies. The genes in the E. coli transformation could then be sent to be

sequenced. (BKT1 was sequenced and from here forward, BKT1 was used for the β-ketolase

gene).

Next, the genes were cloned into a pGmubi-sgfp-nos vector, using shuttles pM05Ppo/Sce,

pM05Sce, and pM05Ppo which facilitate the cloning of both the hydroxylase and ketolase genes

genes via mega nuclease cloning sites. Primers were ordered that were specific for a phusion

PCR for Infusion cloning. This means that every primer began with fifteen bases of the

sequence that preceded the sequence of interest, which were both the Transit Peptide and either

of the H. pluvialis genes.

--(15)-- --(15)-- Gmubi promoter TP H.p. gene Nos-terminator

←--(15)- ←--(15)-

Primers included:

1)TP:BKT1 F, GGAAGAGTAAAGTGCATGCAGCTAGCAGCGACAG

2)BKT1:TP R, CGCTGCTAGCTGCATGCACTTTACTCTTCCACCATTG

3)TP:BCH F, GGAAGAGTAAAGTGCATGCTGTCGAAGCTGCAGTC

4)BCH:TP R, CAGCTTCGACAGCATGCACTTTACTCTTCCACCATTG

5)GmU_P:TP F, TCGACAGGATCCCTTCTATGATATCCTCTTCC 6)Nos_T:BKT1 R, AATGTTTGAACGATCTGCAGCTAGGCAGGAACCAGACCTC 7)Nos_T:BCH R, AATGTTTGAACGATCTGCAGCTACCGCTTGGACCAGTCC

Clontech Phusion PCR for Infusion Cloning: H2O 6μl 2X Phusion HF MasterMix 10μl Primer 1 10μM 1μl Primer 2 10μM 1μl Template 1ng/μl 2μl Final 20μl 1) 98° 1 min 2) 98° 10 sec 3) 55° 10 sec 4) 72° 15 sec 5) 72° 5 min Steps 2-4 were repeated 25x’s Reactions with the GmU_P:TP and H.P_gene:TP primers had a p201 TPB template, and reactions with TP:H.P_gene and Nos_T:H.P_gene had their respective pJet H.P. gene as a template.

Phusion PCR for Infusion Cloning 1: Gmubi p:TP and BCH:TP 2:Gmubi p:TP and BKT1:TP 3: TP:BCH and nos_T:BCH 4: TP:BKT1 and nos_T:BKT1 The shuttles were then cut with EcoRV, and the pGmubi-sgfp-nos was cut with EcoRI

and ApaI. The cut Gmubi-sgfp-nos was treated with T4 DNA polymerase and 2mMdNTP,

incubated for 15 minutes at 12 C, and then treated with EDTA and incubated at 75 C for twenty

minutes in order to blunt the EcoRI overhang. The cut shuttles were treated with TSAP, so that

they would remain cut, and incubated at 37 C for 15 minutes, then heat inactivated by incubating

at 74 C for fifteen minutes.

The Gmubi-sgfp-nos cut and treated with T4 was run on a gel containing Cyt and gel-

purified using Zymoclean Gel Recovery Kit Catalog Nos. D4001 and D4002. The cut Gmubi-

sgfp-nos with each shuttle were ligated using Fermentas Life Sciences Rapid DNA Ligation Kit

#K1421, #K1422, #K1423. The control was the Ppo/Sce shuttle by itself without the Gmubi-

sgfp-nos. This control was to test to see whether the TSAP worked. The three reactions with

each shuttle and Gmubi-sgfp-nos along with the control (only Ppo/Sce) were then transformed

using New England BioLabs High Efficiency Transformation Protocol (C2987H) and ampicillin

plates. Unfortunately, the control for the experiment had as much or more colonies as the other

three experiment.

To rectify this, a gel was run for the shuttles and Zymoclean Gel Recovery Kit Catalog

Nos. D4001 and D4002 was used to recover only the Ppo/Sce shuttles that remained cut. And, as

before the Gmubi-sgfp-nos was recovered from a gel as well. This was followed by the same

ligation and bacterial transformation steps.

pGmU-gfp-nos cut with ApaI and EcoRIHF, which was treated with T4 polymerase. The circled DNA was the DNA recovered from the gel.

Ppo, Sce, and Ppo/Sce cut with EcoRV. The DNA circled was the DNA recovered from the gel using a blade for precision

This change amended the problem and the control culture (the Ppo/Sce without Gmubi-

sgfp-nos) had fewer colonies than did the Ppo/Sce-Gmubi-sgfp-nos. Colony screening isolated

individual colonies for growth by using a bacterial hood to add 2.5 ml of LB Broth, 2.5 μl AMP

100 mg/ml to equal 100 μg/ml and one single colony from the ampicillin plates to each tube.

Three tubes for each of the three plates were made. After the cultures grew over night a Sigma

GenElute Plasmid Miniprep Kit was used for the colonies to isolate the plasmid DNA from E.

coli cultures. A restriction enzyme cut followed, which cut out the gfp section of the Ppo/Sce-

Gmubi-sgfp-nos with the restriction enzymes PstI and NcoI.

A gel was run in order to make sure the gfp portion of the plasmid was removed, and a

gel recovery using Zymoclean Gel Recovery Kit Catalog Nos. D4001 and D4002 purified only

the cut Ppo/Sce-Gmubip-nos without the gfp region. This was then stored in case complications

arose that meant some uncut Ppo/Sce-Gmubip-sgfp-nos remained in the reaction.

Results of cutting the Ppo/Sce-Gmubi-sgfp-nos, which cut out the gfp portion. The circled DNA

was the DNA purified from gel recovery. The bottom left lanes were the gfp regions and the two

right lanes were uncut Ppo/Sce-Gmubi-sgfp-nos for comparison sake.

After the gfp region was cut out the Ppo/Sce-Gmubi-nos was recombined with the

InFusion PCR products of the transit peptide (Gmubi:TP/BCH:TP) and pJet H.P. gene (i.e.

TP:BCH/nos_T:BCH) using Clontech In-Fusion Advantage PCR Cloning Kit Protocol-at-a-

Glance (PT4065-2). And then transformation into E. coli followed using New England BioLabs

High Efficiency Transformation Protocol (C2987H) and ampicillin plates.

Next, what will happen is that a colony screening for the recombined Ppo/Sce-Gmubip-

TP-BCH-nos_T will pick out specific colonies for amplification and sequencing. The colony

screening entails using the phusion primers to make a PCR reaction that will amplify the specific

Ppo/Sce-Gmubip-TP-BCH-nos_T region of DNA to be sequenced. But also, a new ampicillin

resistant plate will be used to plate the same colony that was used for the PCR reaction so that

the colony is saved. Following, TP-BCH will be cut with I-SceI and I-PpoI to release TP-BCH in

order to insert it into the p201 crtB-2 (which is an agrobacterium). The Ppo/Sce shuttle will go

first into the p201crtB-2 vector, followed by the Ppo and Sce shuttles. This order is necessary so

that more than one cassette can be inserted into the p201crtB-2 vector. Also, it is necessary to

use the p201crtB-2 vector with Ppo/Sce, Ppo, Sce as shuttles because it is a binary vector, which

will give the agrobacterium more flexibility in terms of the hairy root that will accept it.

Results

Accumulation of astaxanthin in H. pluvialis: In cultures with NaCl, sodium acetate,

ferrous sulfate, or sodium acetate and ferrous sulfate supplements H. pluvialis remained its usual

green coloration, but in the high light experimental, red pigment was apparent. The best results

were observed under continuous high light conditions without supplements, because only under

this condition did the algae assume the red pigmentation.

References

Huang, Jun-Chao, Feng Chen, Gerhard Sandmann. “Stress-related differential expression of

multiple β-carotene ketolase genes in the unicellular green alga Haematococcus

pluvialis.” Journal of Biotechnology. 122. (2006): 176-185

Kobayashi, Makio, Toshihide Kakizono, and Shiro Nagai. “Enhanced Carotenoid Biosynthesis

by Oxidative Stress in Acetate-Induced Cyst Cells of a Green Unicellular Alga,

Haematococcus pluvialis.” Applied and environmental Microbiology. 59.3 (1993): 867-

73

Steinbrenner, Jens and Hartmut Linden. “Regulation of Two Carotenoid Biosynthesis Genes

Coding for Phytoene Synthase and Carotenoid Hydroxylase during Stress-Induced

Astaxanthin Formation in the Green Alga Haematococcus pluvialis.” Plant Physiology.

125.

(2001): 810-17.

Zhu, Changfu, Shaista Naqvi, Teresa Capell, and Paul Christou. "Metabolic

engineering of ketocarotenoid biosynthesis in higher plants." Archives of

Biochemistry and Biophysics . 483. (2009): 182-90.