Wastewater Irrigation Increases the Abundance of Potentially HarmfulGammaproteobacteria in Soils in Mezquital Valley, Mexico

Melanie Broszat,a,b Heiko Nacke,c Ronja Blasi,a,b Christina Siebe,d Johannes Huebner,a,e Rolf Daniel,c Elisabeth Grohmanna,b

University Medical Centre Freiburg, Division of Infectious Diseases, Freiburg, Germanya; Albert Ludwigs University Freiburg, Institute for Biology II, Microbiology, Freiburg,Germanyb; Georg August University Göttingen, Institute of Microbiology and Genetics, Göttingen, Germanyc; Universidad Nacional Autónoma de México, Instituto deGeología, Ciudad Universitaria, Mexico City, Mexicod; Hauner Children’s Hospital, Division of Pediatric Infectious Diseases, Ludwig Maximilians University Munich, Munich,Germanye

Wastewater contains large amounts of pharmaceuticals, pathogens, and antimicrobial resistance determinants. Only a little isknown about the dissemination of resistance determinants and changes in soil microbial communities affected by wastewaterirrigation. Community DNAs from Mezquital Valley soils under irrigation with untreated wastewater for 0 to 100 years wereanalyzed by quantitative real-time PCR for the presence of sul genes, encoding resistance to sulfonamides. Amplicon sequencingof bacterial 16S rRNA genes from community DNAs from soils irrigated for 0, 8, 10, 85, and 100 years was performed and re-vealed a 14% increase of the relative abundance of Proteobacteria in rainy season soils and a 26.7% increase in dry season soilsfor soils irrigated for 100 years with wastewater. In particular, Gammaproteobacteria, including potential pathogens, such asPseudomonas, Stenotrophomonas, and Acinetobacter spp., were found in wastewater-irrigated fields. 16S rRNA gene sequencingof 96 isolates from soils irrigated with wastewater for 100 years (48 from dry and 48 from rainy season soils) revealed that 46%were affiliated with the Gammaproteobacteria (mainly potentially pathogenic Stenotrophomonas strains) and 50% with the Ba-cilli, whereas all 96 isolates from rain-fed soils (48 from dry and 48 from rainy season soils) were affiliated with the Bacilli. Up tosix types of antibiotic resistance were found in isolates from wastewater-irrigated soils; sulfamethoxazole resistance was themost abundant (33.3% of the isolates), followed by oxacillin resistance (21.9% of the isolates). In summary, we detected an in-crease of potentially harmful bacteria and a larger incidence of resistance determinants in wastewater-irrigated soils, whichmight result in health risks for farm workers and consumers of wastewater-irrigated crops.

Along with pharmaceuticals, wastewater can contain patho-genic microorganisms, including bacteria resistant to antimi-

crobial substances, and also antimicrobial resistance determinants(1–6). In arid and semiarid areas, wastewater is used for irrigationin agricultural production to alleviate water shortages (7–10). Thecoexistence of antibiotics, pathogens, and antibiotic resistance de-terminants in wastewater raises concerns that antibiotic resistancegenes are mobilized from and disseminated into the environmen-tal collection of antibiotic resistance genes (the environmentalresistome) and transferred to bacteria that are potentially patho-genic to humans (11–13). The release of antibiotics together withthe human-linked microbiota might be particularly important forthe emergence of newly evolving antibiotic-resistant pathogens(1, 14). Environmental reservoirs for antibiotic resistances, espe-cially those affected by anthropogenic activities (e.g., applicationof manure), can serve as “hot spots” for the spread of antibioticresistance genes and antibiotic-resistant bacteria through foodand water, with unknown consequences for human health (14–16). D’Costa and colleagues indicated that soil could serve as anunderestimated reservoir for antibiotic resistance that has alreadyemerged or has the potential to emerge in clinically importantbacteria (17). The first report of a putative link between environ-mental and clinical antibiotic resistance determinants was pub-lished in 1973 by Benveniste and Davies. They detected high sim-ilarities between enzymes conferring gentamicin resistance fromsoil-associated Actinomycetes and enzymes that confer the sameresistance in human pathogens, such as Escherichia coli and Pseu-domonas aeruginosa (18). Recent studies have shown that theCTX-M �-lactamases potentially originated from the environ-mental bacterium Kluyvera ascorbata (19, 20). Furthermore, the

plasmid-carried qnr genes, encoding fluoroquinolone resistance,originated from aquatic bacteria such as Shewanella algae (21–23).Fluoroquinolones are a family of broad-spectrum antibacterialagents that are active against a wide range of Gram-positive andGram-negative bacteria. They act by inhibition of type II DNAtopoisomerases (gyrases) that are required for bacterial DNA rep-lication. Three mechanisms of resistance are known. Some typesof efflux pumps act to decrease intracellular quinolone concentra-tions. In Gram-negative bacteria, plasmid-mediated resistancegenes produce proteins that can bind to DNA gyrase, protecting itfrom the action of quinolones. In addition, mutations at key sitesin DNA gyrase or topoisomerase IV can decrease the binding af-finity for quinolones, decreasing the effectiveness of the drug (24).

There are strong indications for a link between antibiotic resis-tance determinants from the environment and those found inhospitals (13). Another problem is the release of antimicrobialsinto the environment, which might influence the composition of

Received 17 April 2014 Accepted 12 June 2014

Published ahead of print 20 June 2014

Editor: M. V. Yates

Address correspondence to Elisabeth Grohmann,elisabeth.grohmann@uniklinik-freiburg.de.

M.B. and H.N. contributed equally to this article.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.01295-14.

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.01295-14

5282 aem.asm.org Applied and Environmental Microbiology p. 5282–5291 September 2014 Volume 80 Number 17

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

natural bacterial communities and also may change the physiol-ogy of environmental bacteria (25). Thus, wastewater irrigationand other anthropogenic activities, e.g., application of manure,might also change the composition of soil bacterial communities.Some studies have shown that a shift of soil bacterial communitystructure toward a higher abundance of Gammaproteobacteria (8,26) results from an input of organic carbon sources or irrigationwith treated wastewater. Gammaproteobacteria are a class of med-ically, ecologically, and scientifically important groups of bacteria,such as the Enterobacteriaceae (e.g., E. coli), Vibrionaceae, Pseu-domonadaceae, and Xanthomonadaceae (e.g., Stenotrophomonasmaltophilia). An exceedingly large number of important patho-gens belongs to this class, such as Salmonella (enteritis and typhoidfever), Vibrio cholerae (cholera), Pseudomonas aeruginosa (lunginfections), and Klebsiella pneumoniae (pneumonia). S. malto-philia is found in various natural environments, such as soil, wa-ter, and plants, but also occurs in the hospital environment andmay cause infections that affect the bloodstream, respiratory tract,urinary tract, and surgical sites.

Frenk et al. (8) compared pyrosequencing data on bacterial 16SrRNA genes from soils irrigated with treated wastewater and thosefrom soils irrigated with freshwater. They observed an increase inthe proportion of Gammaproteobacteria during the irrigation sea-son (dry season) and a return to the “baseline state” in the rainyseason.

However, the influence of long-term irrigation with untreatedwastewater on bacterial soil communities has not been studied sofar. Here we investigated the effects of wastewater irrigation fordifferent periods on the occurrence of pathogenic bacteria andantibiotic resistance determinants in the affected Mezquital Valleysoils and compared wastewater-irrigated soils with rain-fed agri-culture in the same area, incorporating possible seasonal effects bysampling the same soils in the rainy and dry seasons. In previousstudies, we detected an increase in the relative abundance of sulresistance genes, encoding resistance toward sulfonamides, and anaccumulation of antibiotics during long-term wastewater irriga-tion in the Mezquital Valley soils (27). Sulfonamides are bacterio-static antibiotics that inhibit conversion of p-aminobenzoic acidto dihydropteroate, which bacteria need for folate synthesis and,ultimately, purine and DNA synthesis. Resistance in Gram-nega-tive enteric bacteria is plasmid borne and is due mainly to thepresence of sul1 and sul2 genes, encoding drug resistance variantsof the dihydropteroate synthase enzyme in the folic acid pathway(28).

We hypothesize that irrigation with untreated wastewaterchanges the composition of soil bacterial communities towardincreased abundances of potentially harmful bacteria and thatwastewater-derived pathogens can survive in the environment,which might pose risks to people living in the area and to consum-ers of agricultural products from wastewater-irrigated fields.

MATERIALS AND METHODSStudy sites and soil sampling. Over the past century, the irrigated area ofthe Mezquital Valley has increased due to the expansion of the MexicoCity Metropolitan Area (MCMA). We selected sites with different dura-tions of irrigation with untreated wastewater (nonirrigated control anddurations of 8, 10, 85, and 100 years; referred to as the “soil chronose-quence”) for our study. All of them were sampled in either August 2009(rainy season) or March 2011 (dry season). All soils have been irrigatedwith MCMA wastewater, which has been well mixed, especially over lon-ger periods, because of the extensive pumping and diversion of wastewa-

ter within the MCMA and the Mezquital Valley irrigation system. Fromeach field, a sample composed of 48 subsamples distributed equidistantlywithin the whole field was taken with an auger at a depth of 0 to 30 cm. Soilsamples were collected, transported to the laboratory at 4°C, and stored at�20°C until DNA extraction. Soil properties are given in Table 1.

Properties of the soil samples. To determine soil pH, 10 g of each soilsample was suspended at a soil-to-liquid ratio of 1:2.5 (soil– 0.01 MCaCl2). Subsequently, the pH in the supernatant was measured with aglass electrode (31). For determinations of the total organic carbon con-tent (TOC), the total carbon content (TC), and the total nitrogen content(TN), 0.5 g of each composite soil sample was suspended in 100 ml dis-tilled water and homogenized with Ultra-Turrax (T10 Basic; IKA-WerkeGmbH & Co. KG, Staufen, Germany). The samples were measured with aTOC analyzer (Shimadzu TOC-VCPN; Shimadzu Deutschland GmbH,Duisburg, Germany). For evaluations of TOC, TC, and TN, standardcurves were generated with serial dilutions of the standards and measuredfive times. For TC measurement, a potassium hydrogen phthalate solu-tion (2.125 g/liter potassium hydrogen phthalate; equivalent to 1 g carbonper liter) was used; for inorganic carbon, a sodium carbonate solution(4.100 g Na2CO3 and 3.500 g NaHCO3 per liter; equivalent to 1 g inor-ganic carbon per liter) was used; and for TN measurement, a potassiumnitrate solution (7.219 g potassium nitrate; equivalent to 1 g nitrogen perliter) was used, following the manufacturer’s instructions.

Total DNA extraction from soils. Total DNAs were extracted from500-mg soil samples from fields irrigated with wastewater for 0, 8, 10, 85,and 100 years (triplicates of four soil samples from the dry season and foursoil samples from the rainy season), using a NucleoSpin Soil kit accordingto the manufacturer’s protocol (Macherey-Nagel, Düren, Germany). Ali-quots of total DNA from the soil samples were analyzed by pyrosequenc-ing of the 16S rRNA gene.

Amplification of partial 16S rRNA genes and pyrosequencing. TheV2-V3 region of the 16S rRNA gene was amplified by PCR, using totalDNAs from the different soil samples as starting material. Each PCR mix-ture (50 �l) contained 10 �l 5-fold reaction buffer (Phusion HF buffer;Thermo Fisher Scientific, Inc., Waltham, MA), a 200 �M concentration ofeach deoxynucleoside triphosphate, 5% dimethyl sulfoxide (DMSO), 0.5U Phusion hot-start high-fidelity DNA polymerase (Thermo Fisher Sci-entific, Inc.), 10 to 200 ng DNA as the template, and 4 �M (each) primers.Primers used were 101F, containing Roche 454 pyrosequencing adaptorB, and 515R, containing a sample-specific MID (extended multiplex iden-tifier; 10 nucleotides) and Roche 454 pyrosequencing adaptor A (Table 2).The PCRs were initiated at 98°C (30 s), followed by 25 cycles of 98°C (10s), 69°C (30 s), and 72°C (20 s) and a final incubation at 72°C for 10 min.All samples were amplified in triplicate, purified using a peqGold gel ex-traction kit (Peqlab Biotechnologie GmbH, Erlangen, Germany) as rec-ommended by the manufacturer, and pooled in equal amounts. Quanti-fication of PCR products was performed using a Quant-iT dsDNA BRassay kit and a Qubit fluorometer (Life Technologies, Darmstadt, Ger-many). The sequences of the partial 16S rRNA genes were determined

TABLE 1 Characteristics of the analyzed soil samplesb

SampleID

Irrigationtime (yr) Season pH TOC (%) TC (%) TN (%)

C/Nratio

DS0 0 Dry 6.3 0.91 0.95 0.05 17.8RS0 0 Rainy 7.3a 1.53a 1.62a 0.15a 10.8DS8 8 Dry 6.7 1.16 1.21 0.10 12.4RS10 10 Rainy 8.2 1.84 2.56 0.18 14.2DS85 85 Dry 6.7 2.06 2.15 0.19 11.3RS85 85 Rainy 6.4 2.26 2.30 0.29 7.9DS100 100 Dry 6.9 3.15 3.25 0.30 10.9RS100 100 Rainy 7.4a 2.43a 2.56a 0.25a 10.2a Data from reference 29.b TOC, TC, and TN were measured as described previously (30).

Gammaproteobacteria in Wastewater-Irrigated Soils

September 2014 Volume 80 Number 17 aem.asm.org 5283

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

using a Roche GS-FLX 454 pyrosequencer (Roche, Mannheim, Germany)and Titanium chemistry as recommended by the manufacturer.

Pyrosequencing data processing and statistical analysis. Sequencesshorter than 200 bp, as well as those exhibiting an average quality value of�25, more than two primer mismatches, or long homopolymers (�8 bp),were removed from the data set by employing QIIME, version 1.6 (38). Allremaining primer sequences were truncated using the cutadapt program(39). Removal of potential chimeric sequences was performed by ap-plying Uchime (40), with the Greengenes Gold data set gold_strains_gg16S_aligned.fasta as a reference (41). The Acacia error-correc-tion tool (42) was used to remove noise introduced by ampliconpyrosequencing. Determination of operational taxonomic units (OTUs)was performed using Uclust (43). To taxonomically classify OTUs, partial16S rRNA gene sequences were compared with the SILVA SSU Ref NR 115database (44). A customized script was used to remove all nonbacterialOTUs from the OTU table. Calculations of rarefaction curves, the Chao1index (45), and the Shannon index (46) were conducted using QIIME.

We used two-sample t test analyses and the Mann-Whitney U test fornonparametric data to compare relative abundances of bacterial groupsand diversity and richness estimates between soils collected during the dryand rainy seasons and between wastewater-irrigated and rain-fed soils,using the software package PAST (47). To compare bacterial communitycompositions across all samples, based on weighted UniFrac (48) mea-sures, principal coordinate analysis was performed by using QIIME. Fordetermination of the phylogenetic metric (weighted UniFrac), a phyloge-netic tree was calculated using a PyNAST (49) alignment. This alignmentwas produced by aligning a representative sequence set (one sequencefrom each OTU at a genetic distance of 3%) to Greengenes core set core_set_aligned.fasta (41).

Isolation of soil bacteria. One hundred milligrams of soil per ana-lyzed sample was suspended in 900 �l sodium pyrophosphate (7.5 mM,with 0.05% Tween 80), and subsequently, the bacteria were detached fromthe soil particles through shaking at 1,000 rpm for 45 min (50). After 5min of settling, serial dilutions of the bacterial suspensions were trans-ferred onto tryptic soy agar (TSA) plates and incubated for 24 h at 22°C.Single colonies were picked and purified via two passages on TSA plates.

DNA extraction from bacterial soil isolates. DNA extraction frombacterial soil isolates was performed using a MasterPure Gram-positiveDNA purification kit (Biozym Scientific GmbH, Hessisch Oldendorf,

Germany) according to the manufacturer’s instructions, using 1 ml over-night culture in tryptic soy broth (TSB) incubated at 22°C. The isolatedDNA was applied to amplify the 16S rRNA gene and antibiotic resistancegenes by PCR.

Amplification and sequencing of 16S rRNA genes of soil isolates. Foramplification of the 16S rRNA gene, each 50-�l PCR mixture contained2.5 U Taq polymerase and 1� PCR buffer S (Peqlab BiotechnologieGmbH, Erlangen, Germany), 0.2 �M (each) primers (27F and 1492R[Table 2]), a 0.2 mM concentration of each deoxynucleoside triphos-phate, 2 mM MgCl2, and 20 ng template DNA (genomic DNA of a bacte-rial isolate). DNA amplifications were carried out in an Eppendorf ther-mocycler (Eppendorf Mastercycler for 96-well plates; Eppendorf AG,Hamburg, Germany). The temperature profile consisted of an initial de-naturation step at 95°C for 2 min, followed by 30 cycles of denaturation at95°C for 30 s, primer annealing at 58°C for 45 s, and extension at 72°C for1 min and an additional 7-min elongation step at 72°C. PCR productswere sequenced with primers 63F and 1387R (Table 2) (Beckman CoulterGenomics, Takeley, United Kingdom). Sequences were analyzed byBLASTn searches of the 16S rRNA gene sequence reference database forbacteria and archaea (51; http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Assessment of antibiotic resistance genes by PCR. PCR assays spe-cific for sul (32) and qnr (33) resistance genes were performed as follows.Each 25-�l PCR mixture contained 12.5 �l KAPA2G Fast ReadyMix withdye (Peqlab Biotechnologie GmbH, Erlangen, Germany), 2 to 3 mMMgCl2, and 20 ng genomic DNA of a bacterial isolate. DNA amplificationswere carried out in an Eppendorf thermocycler (Eppendorf Mastercyclerfor 96-well plates; Eppendorf AG, Hamburg, Germany). The temperatureprofile consisted of an initial denaturation step at 95°C for 2 min, followedby 30 cycles of denaturation at 95°C for 30 s, primer annealing at 57°C for45 s for qnr genes and at 65°C for 30 s for sul genes, and extension at 72°Cfor 1 min, with an additional 7-min elongation step at 72°C (only for qnrgenes). Primers used are listed in Table 2. Absolute quantifications of sul1and sul2 genes were performed with serially diluted exogenous standardsthat consisted of purified PCR products. Quantification of absolute targetgene numbers was carried out using a LightCycler 480 instrument (RocheDiagnostics, Mannheim, Germany) as described previously (27).

Antimicrobial susceptibility testing of bacterial isolates. Resistanceof the bacterial isolates to specific antibiotics was determined by the discdiffusion method, performed according to CLSI guidelines (52), with the

TABLE 2 Primer sets used in this study

TargetAmpliconsize (bp) Oligonucleotide Sequence (5= to 3=)a Ta

b (°C) Reference(s)

sul1 158 sul1-FW CACCGGAAACATCGCTGCA 65 32sul1-RV AAGTTCCGCCGCAAGGCT 65 32

sul2 190 sul2-FW CTCCGATGGAGGCCGGTAT 65 32sul2-RV GGGAATGCCATCTGCCTTGA 65 32

qnrA 543 qnrA-F GATAAAGTTTTTCAGCAAGAGG 56 33qnrA-R ATCCAGATCGGCAAAGGTTA 56 33

qnrB 497 qnrB-F AGCGGCACTGAATTTAT 56 33qnrB-R GTTTGCTGCTCGCCAGTC 56 33

qnrS 600 qnrS-F GGAAACCTACAATCATACATA 56 33qnrS-R GTCAGGATAAACAACAATACC 56 33

Bacterial 16SrRNA gene

1,465 27F GAGTTTGATCMTGGCTCAG 58 341492R GGYTACCTTGTTACGACTT 58 34

1,324 63fw CAGGCCTAACACATGCAAGTC 56 351387rev GGGCGGWGTGTACAAGGC 56 35

414 101Fc CCTATCCCCTGTGTGCCTTGGCAGTCTCAGAGTGGCGGACGGGTGAGTAAd 69 36, 37515Rc CCATCTCATCCCTGCGTGTCTCCGACTCAG-MID-CCGCGGCTGCTGGCACe 69 36, 37

a Y � C or T.b Annealing temperature.c Primers for pyrosequencing.d Roche 454 pyrosequencing adaptor B is underlined.e Roche 454 pyrosequencing adaptor A is underlined. MID, sample-specific extended multiplex identifier (10 nucleotides).

Broszat et al.

5284 aem.asm.org Applied and Environmental Microbiology

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

following antibiotic discs (Oxoid, Wesel, Germany): ampicillin (25 �g),chloramphenicol (30 �g), erythromycin (10 �g), gentamicin (10 �g),kanamycin (30 �g), oxacillin (5 �g), streptomycin (25 �g), ciprofloxacin(CIP; 5 and 10 �g), doxycycline (30 �g), tetracycline (30 �g), vancomycin(30 �g), and sulfamethoxazole (SMX; 25 �g). Single colonies of bacterialsoil isolates were diluted to an OD630 of 0.16 and streaked with swabsaccording to DIN 58940-3:2007-10 (86). Instead of Mueller-Hinton agar,TSA plates were used and were incubated for 24 h at 22°C.

Nucleotide sequence accession number. All nucleotide sequenceshave been deposited in the Sequence Read Archive of the National Centerfor Biotechnology Information, under accession number SRP037963.

RESULTS AND DISCUSSIONCharacteristics of wastewater-irrigated and rain-fed soils. Irri-gation with untreated wastewater releases organic carbon com-pounds and other nutrients into soils. More nutrients and a higherhumidity over the entire year provide better growth conditions forindigenous bacteria, and possibly also for wastewater-derived bac-teria, and thus might change the composition of soil bacterialcommunities. The organic matter content of the analyzed soilsincreased during long-term irrigation with wastewater (Table 1).In rain-fed soils, TOC ranged from 0.91 to 1.53%, whereas inwastewater-irrigated soils, TOC ranged from 1.06 to 3.35%. Thetotal nitrogen content in the soils varied from 0.05 to 0.15% (rain-fed soils) and from 0.10 to 0.30% (wastewater-irrigated soils). Thesoil pH values varied between 6.7 and 7.4. An increase of soilorganic matter content through wastewater irrigation has alsobeen reported by others (53–58). This results in a rising microbialbiomass and microbial activity (53, 59–61). Furthermore, the in-creased water supply by wastewater irrigation in the dry seasonseems to provide better conditions for microbial proliferation(53). This might also increase the survival rate of wastewater-derived bacteria.

General analysis of the pyrosequencing-derived data set andoverall bacterial diversity and richness. Pyrosequencing of par-tial 16S rRNA genes (V2-V3 region) yielded a total of 452,999sequences across all analyzed soil samples (n � 24). After prepro-cessing, including quality filtering, denoising, and removal ofnonbacterial or chimeric reads, 337,493 sequences, with an aver-age length of 353 bp, were obtained for further analyses (see TableS1 in the supplemental material). Due to the fact that the numberof analyzed sequences per sample has an effect on the predictednumber of OTUs, OTU-based comparisons between the 24 ana-lyzed soils were performed at the same level of surveying effort(11,320 sequences per sample) (62).

Rarefaction curve, richness, and diversity analyses were basedon numbers of OTUs determined at 3 and 20% genetic distances.Comparison of the rarefaction analyses with the number of OTUscalculated by the Chao1 richness estimator revealed that 72.6 to86.8% (20% genetic distance) and 31.0 to 48.2% (3% genetic dis-tance) of the estimated richness were covered by the sequencingeffort (Fig. 1; see Table S2 in the supplemental material). (TheChao1 nonparametric richness estimator was employed to calcu-late the estimated true OTU diversity of the samples.) Thus, we didnot survey the full extent of diversity, but particularly at a 20%genetic distance (phylum level, according to Schloss and Handels-man [63]), a substantial fraction of the bacterial diversity withinindividual soil samples was assessed. Dry season samples exhibitedsignificantly higher OTU numbers, Chao1 richness estimates, andbacterial diversity levels as assessed by the Shannon index (H=)than those of rainy season samples (for 3% genetic distance, P �

0.001; and for 20% genetic distance, P � 0.05) (Fig. 1; see TableS2), likely due to the larger input of wastewater-derived bacteriaduring the irrigation season. Wastewater irrigation had no sta-tistically significant impact on overall bacterial diversity andrichness (Fig. 1; see Table S2), in agreement with the studies ofFrenk et al. (8).

Community compositions in wastewater-irrigated and rain-fed soils. Bacterial 16S rRNA gene sequences were affiliated with23 phyla (see Table S3 in the supplemental material) and 17 can-didate divisions (see Table S4). The dominant phyla and proteo-bacterial classes across all 24 soil samples were Actinobacteria(27.4%), Alphaproteobacteria (14.6%), Acidobacteria (14.0%), Be-taproteobacteria (9.5%), Chloroflexi (9.3%), Gammaproteobacte-ria (8.9%), Firmicutes (5.2%), Deltaproteobacteria (2.7%), Gem-matimonadetes (2.5%), and Planctomycetes (1.9%). These phylaand proteobacterial classes are typically encountered in soil andwere also reported in similar relative abundances in a meta-anal-ysis of 32 soil-derived bacterial 16S rRNA gene libraries (64) andin recent metagenomic as well as metatranscriptomic microbialcommunity analyses (65, 66).

The relative abundances of bacterial phyla and proteobacterialclasses varied between wastewater-irrigated and rain-fed soils(Fig. 2). A shift of the bacterial community toward a higher rela-tive abundance of Gammaproteobacteria was observed in both sea-sons (dry and rainy seasons) in the wastewater-irrigated soilscompared to the rain-fed soils (P � 0.002). With respect to rain-fed soil samples, 3.2 to 5.5% (rainy season) and 3.4 to 4.2% (dryseason) of the bacterial sequences were affiliated with Gammapro-teobacteria, whereas relative abundances of gammaproteobacte-rial sequences determined for wastewater-irrigated soils rangedfrom 5.8 to 10.3% (rainy season) and 8.5% to 17.7% (dry season)(see Table S3 in the supplemental material). Strikingly, more po-tentially harmful Gammaproteobacteria were detected in wastewa-ter-irrigated than in rain-fed soils (Fig. 3). Up to 196-, 28-, and20-fold higher relative abundances of Acinetobacter, Stenotroph-omonas, and Pseudomonas, respectively, were detected in waste-water-irrigated soil than in rain-fed soil during the dry season(Fig. 3). Species within these genera, such as Pseudomonas aerugi-nosa and Acinetobacter baumannii, are representatives of the so-called ESKAPE (Enterococcus faecium, Staphylococcus aureus,Klebsiella species, Acinetobacter baumannii, Pseudomonas aerugi-nosa, and Enterobacter species) organisms that frequently causenosocomial infections (67, 68). They are of main concern due tothe high abundance of multiresistance in these organisms. An-other emerging organism that causes nosocomial and communi-ty-acquired infections is S. maltophilia (69–72). This bacteriumcan be associated with respiratory tract infections (71, 72), espe-cially in hospitalized patients on mechanical ventilation. The highprevalence of Stenotrophomonas, Pseudomonas, and Acinetobacterin the wastewater-irrigated soils indicates an adaptation of waste-water-associated bacteria to the soil environment. These bacteriaserve as carriers of multiresistance and likely increase the dissem-ination of resistance determinants in the environment and toother, potentially more dangerous bacteria. The large increases inrelative abundance of Acinetobacter, Stenotrophomonas, and Pseu-domonas in wastewater-irrigated soil determined for the dry sea-son (P � 0.05) were not detected by statistical analysis for therainy season (Fig. 3). This result might be related to an increasedinput of wastewater-derived bacteria by wastewater irrigation inthe dry season. These findings are in agreement with the studies of

Gammaproteobacteria in Wastewater-Irrigated Soils

September 2014 Volume 80 Number 17 aem.asm.org 5285

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Frenk et al., who demonstrated that the relative abundance ofGammaproteobacteria increases in the irrigation season and de-creases in the rainy season (8). Like Gammaproteobacteria, Beta-proteobacteria were more abundant in all dry season wastewater-irrigated soil samples than in dry season rain-fed soils (P � 0.001)(Fig. 2). However, no medically relevant betaproteobacterial spe-cies were detected. Principal coordinate analysis at a 3% geneticdistance indicated that rain-fed soil samples harbored similarity inoverall bacterial community composition, since they tended tocluster (Fig. 4). An effect of season on overall bacterial communitycomposition was not revealed.

Characterization of soil isolates. Bacterial isolates from soilsirrigated with untreated wastewater for 100 years and from soilswhich received only rainwater, from both the dry and rainy sea-sons, were obtained by incubation on TSA plates for 24 to 48 h at23°C. The incubation temperature was chosen because it was themean soil temperature in the Mezquital Valley in the dry season.

TSA is a rich medium and proved to be appropriate for isolation ofdiverse environmental bacteria, as already shown by, e.g., Krish-namurthi and Chakrabarti for soil and Yashiro et al. for the phyl-losphere (73, 74); the predominantly isolated soil bacteria in theirstudies were members of the phylum Firmicutes (most of themBacillus spp.), followed by Actinobacteria and Proteobacteria. Inour study, most bacterial isolates from wastewater-irrigated soils(48 isolates from soil samples collected in the dry season and 48isolates from soil samples collected in the rainy season) belongedto the Bacilli (50%) and the Gammaproteobacteria (46%). Only3% of the isolates belonged to the Actinobacteria, and 1% to theAlphaproteobacteria (Fig. 5A; see Table S6 in the supplementalmaterial). The most abundant genera were Bacillus (47%) andStenotrophomonas (39%), followed by Pseudomonas (5%) andAcinetobacter (2%) (Fig. 5B). For rain-fed soils, all 96 isolates (48isolates from soil samples collected in the dry season and 48 iso-lates from soil samples collected in the rainy season) belonged to

FIG 1 Rarefaction curves indicating the observed numbers of OTUs at genetic distances of 3 and 20% within the analyzed soil samples. Sample abbreviations:RS0, rainy season rain-fed soil; RS10, rainy season soil with 10 years of wastewater irrigation; RS85, rainy season soil with 85 years of wastewater irrigation; RS100,rainy season soil with 100 years of wastewater irrigation; DS0, dry season rain-fed soil; DS8, dry season soil with 8 years of wastewater irrigation; DS85, dry seasonsoil with 85 years of wastewater irrigation; DS100, dry season soil with 100 years of wastewater irrigation. Triplicates were analyzed (indicated by “a,” “b,” and “c”in sample names).

Broszat et al.

5286 aem.asm.org Applied and Environmental Microbiology

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

the Bacilli and, within this class, to the genus Bacillus (see TableS5). Bacillus is ubiquitous in soil environments (75, 76) and canpersist under a variety of conditions due to the ability to formendospores (77, 78).

The taxonomic groups detected (Proteobacteria, Actinobacte-ria, and Bacilli) are typical taxa found in agricultural soils. A rise inthe available soil nutrients and moisture in wastewater-irrigatedsoils leads to an increase in Proteobacteria, particularly Gamma-proteobacteria, in agreement with previous studies (8, 26). Consis-tent with the amplicon data, which revealed a higher relativeabundance of Gammaproteobacteria in wastewater-irrigated soilsthan in rain-fed soils, more isolates belonging to the Gammapro-teobacteria (Stenotrophomonas, Pseudomonas, and Acinetobacter)were obtained from wastewater-irrigated soils than from rain-fedsoils (46% of the isolates from wastewater-irrigated soils versus noisolates from rain-fed soils). The fact that these microorganismswere derived from samples collected in the dry as well as the rainyseason indicates that they have adapted to the wastewater-irri-gated soil environment. Some crops, such as maize and severalherbs, such as Rumex sp., Malva sp., and Chenopodium mexica-num, that grow in wastewater-irrigated fields are consumed by the

people in the Mezquital Valley. In particular, the near-groundherbs are in direct contact with wastewater and wastewater-irri-gated soils. This might imply health risks for consumers of insuf-ficiently washed crops containing wastewater-derived bacteriaand resistance determinants.

Prevalence of multiantibiotic-resistant isolates from waste-water-irrigated soils. All isolates from wastewater-irrigated soilsand from rain-fed soils were tested for susceptibility to 12 differentantibiotics. In addition, the isolates that were resistant to sulfame-thoxazole (SMX) or ciprofloxacin (CIP) were analyzed for thepresence of sul and qnr resistance genes, which encode resistanceto sulfonamides and fluoroquinolones, respectively. These geneswere detected in total DNA of the chronosequence soils. The sul1,sul2, qnrA, qnrB, and qnrS genes were not found in total DNA ofthe isolates. For the qnr genes, this was not surprising, as thesegenes were rarely found in the chronosequence soils (27). Resis-tance to fluoroquinolones is often the result of point mutations intarget genes, such as gyrA, encoding DNA gyrase, and parC, en-coding a type IV topoisomerase (79). Only 3 of 96 isolates fromwastewater-irrigated soils (one Stenotrophomonas, one Bacillus,and one Exiguobacterium isolate) and none of the 96 isolates from

FIG 2 Relative abundances of dominant phyla and proteobacterial classes determined for the analyzed soil samples. Sample abbreviations: RS0, rainy seasonrain-fed soil; RS10, rainy season soil with 10 years of wastewater irrigation; RS85, rainy season soil with 85 years of wastewater irrigation; RS100, rainy season soilwith 100 years of wastewater irrigation; DS0, dry season rain-fed soil; DS8, dry season soil with 8 years of wastewater irrigation; DS85, dry season soil with 85 yearsof wastewater irrigation; DS100, dry season soil with 100 years of wastewater irrigation. Data from analysis of triplicates are illustrated using error bars.

FIG 3 Heat map showing relative abundances of gammaproteobacterial genera as affected by wastewater irrigation during dry as well as rainy season. Triplicateswere analyzed (indicated by “a,” “b,” and “c”).

Gammaproteobacteria in Wastewater-Irrigated Soils

September 2014 Volume 80 Number 17 aem.asm.org 5287

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

rain-fed soils were resistant to low concentrations of the fluoro-quinolone ciprofloxacin (5 �g) (see Tables S5 and S6 in the sup-plemental material). Several isolates, i.e., 32 from wastewater-ir-rigated soils and 18 from rain-fed soils, were resistant to thesulfonamide SMX (25 �g). Interestingly, a considerable numberof isolates belonging to the Bacillaceae were resistant to SMX, in-cluding 18 of the 96 Bacilli isolates from rain-fed soils and 21 of the46 Bacilli isolates from wastewater-irrigated soils.

In other studies, SMX-resistant Bacilli were isolated from dif-ferent environments, such as wastewater, water, and sediments,on selective plates containing between 50 and 200 �g/ml SMX.But even when isolated under selective pressure, not all resistantisolates contained the sul1, sul2, or sul3 gene (80). Sulfonamideresistance can also occur by other mechanisms, such as modifica-tion of the antibiotic target, e.g., by mutations of the chromo-somal dihydropteroate synthase gene (81). Sulfonamide resis-tance (often also in combination with trimethoprim resistance)has been described for several Bacillus species (82). From waste-water-irrigated soils, 33% of the isolates (n � 96) were resistant toSMX. Twenty-one of the resistant isolates were Bacillus spp., andthe remaining 11 belonged to the genera Stenotrophomonas, Pseu-domonas, and Acinetobacter. In wastewater irrigation fields, moreisolates (51%) were resistant to at least one antibiotic than inrain-fed soils (34%). In particular, the presence of multiresistantbacteria (resistance to �2 antibiotics) was more pronounced inwastewater-irrigated soils (25%) than in rain-fed soils (6%) (seeTables S5 and S6).

In the present study, resistance to oxacillin, erythromycin, van-comycin, and ampicillin was frequently found in isolates fromwastewater-irrigated soils. Other resistances were less frequent(�10%), and no isolate resistant to doxycycline was found (sum-marized in Fig. 6; see Tables S5 and S6 in the supplemental mate-rial). The higher abundance of multiresistant isolates from waste-water-irrigated fields is likely related to the different types of

bacteria isolated from the two irrigation regimens. In wastewater-irrigated soils, three isolates were resistant to three antibiotics, andnine were resistant to more than three antibiotics. For the isolatesfrom rain-fed soils, only two isolates showed resistance to threedifferent antibiotics, and none to more than three antibiotics. Themajority of multiresistant bacteria belonged to the genusStenotrophomonas (see Table S6). 16S rRNA gene sequences of theStenotrophomonas isolates showed highest identities (96 to 99%)to S. maltophilia, an opportunistic bacterial pathogen of environ-mental origin that is associated with several human diseases (69,70, 72). Treatment proves difficult due to this species’ intrinsicantibiotic resistance (69). An increase of the relative abundance ofStenotrophomonas spp. in soils which have been treated by sulfa-diazine-amended manure was observed by Ding et al. (83).

For the clinically relevant species S. maltophilia and P. aerugi-nosa, several studies have reported that multiple-antibiotic resis-tance is due to the overexpression of multidrug efflux pumps (e.g.,SmeDEF or MexA-MexB-OprM) (84, 85). For several environ-mental Pseudomonas isolates, intrinsic multidrug resistance hasbeen reported. Malik and Aleem demonstrated a high prevalenceof antibiotic resistance in Pseudomonas isolates from water andsoil (5). They showed that 87.5% of the Pseudomonas isolates fromwastewater-irrigated soils were resistant to the sulfonamide sulfa-diazine. Furthermore, they revealed that isolates from groundwa-ter-irrigated soils were less resistant to antibiotics than isolatesfrom wastewater-irrigated soils, which is consistent with ourdata (5).

FIG 5 (A) Abundances of bacterial classes in isolates from wastewater-irri-gated soils. (B) Abundances of different bacterial genera in isolates from waste-water-irrigated soils.

FIG 4 Weighted UniFrac 2D principal coordinate analysis plot for beta diver-sity analysis. Sample abbreviations: RS0, rainy season rain-fed soil; RS10, rainyseason soil with 10 years of wastewater irrigation; RS85, rainy season soil with85 years of wastewater irrigation; RS100, rainy season soil with 100 years ofwastewater irrigation; DS0, dry season rain-fed soil; DS8, dry season soil with8 years of wastewater irrigation; DS85, dry season soil with 85 years of waste-water irrigation; DS100, dry season soil with 100 years of wastewater irrigation.

Broszat et al.

5288 aem.asm.org Applied and Environmental Microbiology

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Finally, our data reveal a higher prevalence of Gammaproteo-bacteria, in particular of harmful and multiresistant bacteria, suchas S. maltophilia, in wastewater-irrigated soil. To the best of ourknowledge, this is the first report on the high incidence ofStenotrophomonas spp. in wastewater-irrigated soils. Most of thebacterial isolates from wastewater-irrigated soils were resistant toseveral antibiotics (up to five different antibiotic classes). Thehigher incidence of multiple-antibiotic-resistant bacteria in waste-water-irrigated soils indicates survival of wastewater-derived bacteriain the environment and thus represents an increased risk of antibioticresistance dissemination in the environment. A major health issue isrelated to the observation that near-ground crops that are in directcontact with soil and wastewater are consumed raw by the people inthe Mezquital Valley.

ACKNOWLEDGMENTS

We thank R. Brämer and A. Henninger from the University of AppliedSciences Offenburg for support with the measurement of the chemical soilparameters.

This work was supported by grants GR1792/4-1 and GR1792/4-2from the German Research Foundation and by the Mexican ConsejoNacional de Ciencia y Tecnología (CONACYT) (grants CB 83767 andI 0110-193-10).

REFERENCES1. Baquero F, Martínez J, Cantón R. 2008. Antibiotics and antibiotic resis-

tance in water environments. Curr. Opin. Biotechnol. 19:260 –265. http://dx.doi.org/10.1016/j.copbio.2008.05.006.

2. Bruchmann J, Kirchen S, Schwartz T. 2013. Sub-inhibitory concentra-tions of antibiotics and wastewater influencing biofilm formation andgene expression of multi-resistant Pseudomonas aeruginosa wastewaterisolates. Environ. Sci. Pollut. Res. 20:3539 –3549. http://dx.doi.org/10.1007/s11356-013-1521-4.

3. Chávez A, Maya C, Gibson R, Jiménez B. 2011. The removal of micro-organisms and organic micropollutants from wastewater during infiltra-tion to aquifers after irrigation of farmland in the Tula Valley, Mexico.

Environ. Pollut. 159:1354 –1362. http://dx.doi.org/10.1016/j.envpol.2011.01.008.

4. Levantesi C, La Mantia R, Masciopinto C, Böckelmann U, Ayuso-Gabella MN, Salgot M, Tandoi V, van Houtte E, Wintgens T, Groh-mann E. 2010. Quantification of pathogenic microorganisms and micro-bial indicators in three wastewater reclamation and managed aquiferrecharge facilities in Europe. Sci. Total Environ. 408:4923-4930. http://dx.doi.org/10.1016/j.scitotenv.2010.07.042.

5. Malik A, Aleem A. 2011. Incidence of metal and antibiotic resistance inPseudomonas spp. from the river water, agricultural soil irrigated withwastewater and groundwater. Environ. Monit. Assess. 178:293–308. http://dx.doi.org/10.1007/s10661-010-1690-2.

6. Rizzo L, Manaia C, Merlin C, Schwartz T, Dagot C, Ploy IM, Fatta-Kassinos D. 2013. Urban wastewater treatment plants as hotspots forantibiotic resistant bacteria and genes spread into the environment: a re-view. Sci. Total Environ. 447:345–360. http://dx.doi.org/10.1016/j.scitotenv.2013.01.032.

7. Elifantz H, Kautsky L, Mor-Yosef M, Tarchitzky J, Bar-Tal A, Chen Y,Minz D. 2011. Microbial activity and organic matter dynamics during 4years of irrigation with treated wastewater. Microb. Ecol. 62:973–981.http://dx.doi.org/10.1007/s00248-011-9867-y.

8. Frenk S, Hadar Y, Minz D. 2014. Resilience of soil bacterial communityto irrigation with water of different qualities under Mediterranean cli-mate. Environ. Microbiol. 16:559 –569. http://dx.doi.org/10.1111/1462-2920.12183.

9. Siebe C, Cifuentes E. 1995. Environmental impact of wastewater irriga-tion in central Mexico: an overview. Int. J. Environ. Health Res. 5:161–173. http://dx.doi.org/10.1080/09603129509356845.

10. Jimenez B, Chávez A. 2004. Quality assessment of an aquifer rechargedwith wastewater for its potential use as drinking source: “El MezquitalValley” case. Water Sci. Technol. 50:269 –276.

11. Baquero F, Blázquez J. 1997. Evolution of antibiotic resistance. TrendsEcol. Evol. (Amst.) 12:482– 487. http://dx.doi.org/10.1016/S0169-5347(97)01223-8.

12. Cantón R. 2009. Antibiotic resistance genes from the environment: aperspective through newly identified antibiotic resistance mechanisms inthe clinical setting. Clin. Microbiol. Infect. 15:20 –25. http://dx.doi.org/10.1111/j.1469-0691.2008.02679.x.

13. Wright GD. 2010. Antibiotic resistance in the environment: a link to theclinic. Curr. Opin. Microbiol. 13:589 –594. http://dx.doi.org/10.1016/j.mib.2010.08.005.

FIG 6 Percentages of antibiotic-resistant isolates from wastewater-irrigated soils and rain-fed soils. CIP, ciprofloxacin (5 �g); Kana, kanamycin (30 �g); SMX,sulfamethoxazole (25 �g); Tet, tetracycline (30 �g); Doxy, doxycycline (30 �g); Gm, gentamicin (10 �g); Amp, ampicillin (25 �g); Sm, streptomycin (25 �g);Oxa, oxacillin (5 �g); Cm, chloramphenicol (30 �g); Van, vancomycin (30 �g); Em, erythromycin (10 �g); ww, wastewater.

Gammaproteobacteria in Wastewater-Irrigated Soils

September 2014 Volume 80 Number 17 aem.asm.org 5289

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

14. Martinez JL. 2009. The role of natural environments in the evolution ofresistance traits in pathogenic bacteria. Proc. Biol. Sci. 276:2521–2530.http://dx.doi.org/10.1098/rspb.2009.0320.

15. Gatica J, Cytryn E. 2013. Impact of treated wastewater irrigation onantibiotic resistance in the soil microbiome. Environ. Sci. Pollut. Res.20:3529 –3538. http://dx.doi.org/10.1007/s11356-013-1505-4.

16. Zhang X, Zhang T, Fang HHP. 2009. Antibiotic resistance genes in waterenvironment. Appl. Microbiol. Biotechnol. 82:397– 414. http://dx.doi.org/10.1007/s00253-008-1829-z.

17. D’Costa VM, McGrann KM, Hughes DW, Wright GD. 2006. Samplingthe antibiotic resistome. Science 311:374 –377. http://dx.doi.org/10.1126/science.1120800.

18. Benveniste R, Davies J. 1973. Aminoglycoside antibiotic-inactivatingenzymes in actinomycetes similar to those present in clinical isolates ofantibiotic-resistant bacteria. Proc. Natl. Acad. Sci. U. S. A. 70:2276 –2280.http://dx.doi.org/10.1073/pnas.70.8.2276.

19. Cantón R, Coque TM. 2006. The CTX-M beta-lactamase pandemic.Curr. Opin. Microbiol. 9:466 – 475. http://dx.doi.org/10.1016/j.mib.2006.08.011.

20. Humeniuk C, Arlet G, Gautier V, Grimont P, Labia R, Philippon A.2002. Beta-lactamases of Kluyvera ascorbata, probable progenitors ofsome plasmid-encoded CTX-M types. Antimicrob. Agents Chemother.46:3045–3049. http://dx.doi.org/10.1128/AAC.46.9.3045-3049.2002.

21. Poirel L, Liard A, Rodriguez-Martinez J, Nordmann P. 2005. Vibrion-aceae as a possible source of Qnr-like quinolone resistance determinants.J. Antimicrob. Chemother. 56:1118 –1121. http://dx.doi.org/10.1093/jac/dki371.

22. Poirel L, Rodriguez-Martinez J, Mammeri H, Liard A, Nordmann P.2005. Origin of plasmid-mediated quinolone resistance determinantQnrA. Antimicrob. Agents Chemother. 49:3523–3525. http://dx.doi.org/10.1128/AAC.49.8.3523-3525.2005.

23. Sánchez MB, Hernández A, Rodríguez-Martínez JM, Martínez-Martínez L, Martínez JL. 2008. Predictive analysis of transmissible quin-olone resistance indicates Stenotrophomonas maltophilia as a potentialsource of a novel family of Qnr determinants. BMC Microbiol. 8:148.http://dx.doi.org/10.1186/1471-2180-8-148.

24. Robicsek A, Jacoby GA, Hooper DC. 2006. The worldwide emergence ofplasmid-mediated quinolone resistance. Lancet Infect. Dis. 6:629 – 640.http://dx.doi.org/10.1016/S1473-3099(06)70599-0.

25. Martinez JL. 2009. Environmental pollution by antibiotics and by antibi-otic resistance determinants. Environ. Pollut. 157:2893–2902. http://dx.doi.org/10.1016/j.envpol.2009.05.051.

26. Eilers KG, Lauber CL, Knight R, Fierer N. 2010. Shifts in bacterialcommunity structure associated with inputs of low molecular weight car-bon compounds to soil. Soil Biol. Biochem. 42:896 –903. http://dx.doi.org/10.1016/j.soilbio.2010.02.003.

27. Dalkmann P, Broszat M, Siebe C, Willaschek E, Sakinc T, Huebner J,Amelung W, Grohmann E, Siemens J. 2012. Accumulation of pharma-ceuticals, Enterococcus, and resistance genes in soils irrigated with waste-water for zero to 100 years in central Mexico. PLoS One 7:e45397. http://dx.doi.org/10.1371/journal.pone.0045397.

28. Sköld O. 2000. Sulfonamide resistance: mechanisms and trends. DrugResist. Updat. 3:155–160. http://dx.doi.org/10.1054/drup.2000.0146.

29. Chapela LM. 2010. Variabilidad temporal en el contenido de metalespesados en suelos regados con aguas resiudales en el Valle del Mezquital:México. Master’s thesis. Universidad Nacional Autónoma de México,Mexico City, Mexico.

30. Schlichting E, Blume HP, Stahr K. 1995. Bodenkundliches Praktikum.Eine Einführung in pedologisches Arbeiten für Oekologen, insbesondereLand- und Forstwirte, und für Geowissenschaftler. Blackwell Wissen-schaft, Berlin, Germany.

31. Will C, Thürmer A, Wollherr A, Nacke H, Herold N, Schrumpf M,Gutknecht J, Wubet T, Buscot F, Daniel R. 2010. Horizon-specificbacterial community composition of German grassland soils, as revealedby pyrosequencing-based analysis of 16S rRNA genes. Appl. Environ. Mi-crobiol. 76:6751– 6759. http://dx.doi.org/10.1128/AEM.01063-10.

32. Luo Y, Mao D, Rysz M, Zhou Q, Zhang H, Xu L, Alvarez PJJ. 2010.Trends in antibiotic resistance genes occurrence in the Haihe River,China. Environ. Sci. Technol. 44:7220 –7225. http://dx.doi.org/10.1021/es100233w.

33. Guillard T, Cavallo JD, Cambau E, Duval V, Bajolet O, Brasme L, deChamps C, Vernet-Garnier V. 2010. Mise au point d’une technique dePCR en temps réel pour la détection rapide des gènes qnr chez des entéro-

bactéries productrices de bêta-lactamases à spectre étendu. Pathol. Biol.58:430 – 433. http://dx.doi.org/10.1016/j.patbio.2009.03.003.

34. Fredriksson NJ, Hermansson M, Wilén B-M. 2013. The choice of PCRprimers has great impact on assessments of bacterial community diversityand dynamics in a wastewater treatment plant. PLoS One 8:e76431. http://dx.doi.org/10.1371/journal.pone.0076431.

35. Marchesi JR, Sato T, Weightman AJ, Martin TA, Fry JC, Hiom SJ,Dymock D, Wade WG. 1998. Design and evaluation of useful bacterium-specific PCR primers that amplify genes coding for bacterial 16S rRNA.Appl. Environ. Microbiol. 64:795–799.

36. Lane DJ. 1991. 16S/23S rRNA sequencing, p 115–175. In Stackebrandt E,Goodfellow M (ed), Nucleic acid techniques in bacterial systematics.Modern microbiological methods. Wiley, Chichester, New York.

37. Schmalenberger A, Schwieger F, Tebbe CC. 2001. Effect of primershybridizing to different evolutionarily conserved regions of the small-subunit rRNA gene in PCR-based microbial community analyses and ge-netic profiling. Appl. Environ. Microbiol. 67:3557–3563. http://dx.doi.org/10.1128/AEM.67.8.3557-3563.2001.

38. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD,Costello EK, Fierer N, Peña AG, Goodrich JK, Gordon JI, Huttley GA,Kelley ST, Knights D, Koenig JF, Ley RE, Lozupone CA, McDonald D,Muegge BD, Pirrung M, Reeder J, Sevinsky JR, Turnbaugh PJ, WaltersWA, Widmann J, Yatsunenko T, Zaneveld J, Knight R. 2010. QIIMEallows analysis of high-throughput community sequencing data. Nat.Methods 7:335–336. http://dx.doi.org/10.1038/nmeth.f.303.

39. Martin M. 2011. Cutadapt removes adapter sequences from high-throughput 699 sequencing reads. EMBnet J. 17:10 –12. http://dx.doi.org/10.14806/ej.17.1.200.

40. Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R. 2011. UCHIMEimproves sensitivity and speed of chimera detection. Bioinformatics 27:2194 –2200. http://dx.doi.org/10.1093/bioinformatics/btr381.

41. DeSantis TZ, Hugenholtz P, Larsen N, Rojas M, Brodie EL, Keller K,Huber T, Dalevi D, Hu P, Andersen GL. 2006. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB.Appl. Environ. Microbiol. 72:5069 –5072. http://dx.doi.org/10.1128/AEM.03006-05.

42. Bragg L, Stone G, Imelfort M, Hugenholtz P, Tyson GW. 2012. Fast,accurate error-correction of amplicon pyrosequences using Acacia. Nat.Methods 9:425– 426. http://dx.doi.org/10.1038/nmeth.1990.

43. Edgar RC. 2010. Search and clustering orders of magnitude faster thanBLAST. Bioinformatics 26:2460 –2461. http://dx.doi.org/10.1093/bioinformatics/btq461.

44. Pruesse E, Quast C, Knittel K, Fuchs BM, Ludwig W, Peplies J, Glöck-ner FO. 2007. SILVA: a comprehensive online resource for qualitychecked and aligned ribosomal RNA sequence data compatible with ARB.Nucleic Acids Res. 35:7188 –7196. http://dx.doi.org/10.1093/nar/gkm864.

45. Chao A, Bunge J. 2002. Estimating the number of species in a stochasticabundance model. Biometrics 58:531–539. http://dx.doi.org/10.1111/j.0006-341X.2002.00531.x.

46. Shannon CE. 1948. A mathematical theory of communication. Bell Syst.Tech. J. 27:379–423. http://dx.doi.org/10.1002/j.1538-7305.1948.tb01338.x.

47. Hammer Ø, Harper DAT, Ryan PD. 2001. PAST: paleontological statis-tics software package for education and data analysis. Palaeontol. Elec-tron. 4:1–9.

48. Lozupone C, Knight R. 2005. UniFrac: a new phylogenetic method forcomparing microbial communities. Appl. Environ. Microbiol. 71:8228 –8235. http://dx.doi.org/10.1128/AEM.71.12.8228-8235.2005.

49. Caporaso JG, Bittinger K, Bushman FD, DeSantis TZ, Andersen GL,Knight R. 2010. PyNAST: a flexible tool for aligning sequences to a tem-plate alignment. Bioinformatics 26:266 –267. http://dx.doi.org/10.1093/bioinformatics/btp636.

50. Böckelmann U, Szewzyk U, Grohmann E. 2003. A new enzymaticmethod for the detachment of particle associated soil bacteria. J. Micro-biol. Methods 55:201–211. http://dx.doi.org/10.1016/S0167-7012(03)00144-1.

51. Zhang Z, Schwartz S, Wagner L, Miller W. 2000. A greedy algorithm foraligning DNA sequences. J. Comput. Biol. 7:203–214. http://dx.doi.org/10.1089/10665270050081478.

52. CLSI. 2012. Performance standards for antimicrobial susceptibility test-ing; 22nd informational supplement. CLSI document M100 –S22. Clinicaland Laboratory Standards Institute, Wayne, PA.

53. Friedel JK, Langer T, Siebe C, Stahr K. 2000. Effects of long-term wastewater irrigation on soil organic matter, soil microbial biomass and its

Broszat et al.

5290 aem.asm.org Applied and Environmental Microbiology

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

activities in central Mexico. Biol. Fertil. Soils 31:414 – 421. http://dx.doi.org/10.1007/s003749900188.

54. Saber M. 1986. Prolonged effect of land disposal of human wastes on soilconditions. Water Sci. Technol. 18:371–374.

55. Mañas P, Castro E, de Las Heras J. 2009. Irrigation with treated waste-water: effects on soil, lettuce (Lactuca sativa L.) crop and dynamics ofmicroorganisms. J. Environ. Sci. Health 44:1261–1273. http://dx.doi.org/10.1080/10934520903140033.

56. Kiziloglu FM, Turan M, Sahin U, Angin I, Anapali O, Okuroglu M.2007. Effects of wastewater irrigation on soil and cabbageplant (Brassicaolereacea var. capitate cv. Yavola-1) chemical properties. J. Plant Nutr. SoilSci. 170:166 –172. http://dx.doi.org/10.1002/jpln.200621971.

57. Jueschke E, Marschner B, Tarchitzky J, Chen Y. 2008. Effects of treatedwastewater irrigation on the dissolved and soil organic carbon in Israelisoils. Water Sci. Technol. 57:727–733. http://dx.doi.org/10.2166/wst.2008.173.

58. Siebe C. 1994. Akkumulation, Mobilität und Verfügbarkeit von Schwer-metallen in langjährig mit städtischen Abwässern bewässerten Böden inZentralmexiko. Hohenheimer Bodenkundliche Hefte 17. Universität Ho-henheim, Stuttgart, Germany.

59. Filip Z, Kanazawa S, Berthelin J. 1999. Characterization of effects of along-term wastewater irrigation on soil quality by microbiological andbiochemical parameters. J. Plant Nutr. Soil Sci. 162:409 – 413. http://dx.doi.org/10.1002/(SICI)1522-2624(199908)162:4�409::AID-JPLN409�3.0.CO;2-#.

60. Filip Z, Kanazawa S, Berthelin J. 2000. Distribution of microorganisms,biomass ATP, and enzyme activities in organic and mineral particles of along-term wastewater irrigated soil. J. Plant Nutr. Soil Sci. 163:143–150.http://dx.doi.org/10.1002/(SICI)1522-2624(200004)163:2�143::AID-JPLN143�3.0.CO;2-T.

61. Hidri Y, Bouziri L, Maron P, Anane M, Jedidi N, Hassan A, Ranjard L.2010. Soil DNA evidence for altered microbial diversity after long-termapplication of municipal wastewater. Agron. Sustain. Dev. 30:423– 431.http://dx.doi.org/10.1051/agro/2009038.

62. Morales SE, Cosart TF, Johnson JV, Holben WE. 2009. Extensive phy-logenetic analysis of a soil bacterial community illustrates extreme taxonevenness and the effects of amplicon length, degree of coverage, and DNAfractionation on classification and ecological parameters. Appl. Environ.Microbiol. 75:668 – 675. http://dx.doi.org/10.1128/AEM.01757-08.

63. Schloss PD, Handelsman J. 2005. Introducing DOTUR, a computerprogram for defining operational taxonomic units and estimating speciesrichness. Appl. Environ. Microbiol. 71:1501–1506. http://dx.doi.org/10.1128/AEM.71.3.1501-1506.2005.

64. Janssen PH. 2006. Identifying the dominant soil bacterial taxa in librariesof 16S rRNA and 16S rRNA genes. Appl. Environ. Microbiol. 72:1719 –1728. http://dx.doi.org/10.1128/AEM.72.3.1719-1728.2006.

65. Fierer N, Leff JW, Adams BJ, Nielsen UN, Bates ST, Lauber CL, OwensS, Gilbert JA, Wall DH, Caporaso JG. 2012. Cross-biome metagenomicanalyses of soil microbial communities and their functional attributes.Proc. Natl. Acad. Sci. U. S. A. 109:21390 –21395. http://dx.doi.org/10.1073/pnas.1215210110.

66. Nacke H, Fischer C, Thürmer A, Meinicke P, Daniel R. 2014. Land usetype significantly affects microbial gene transcription in soil. Microb. Ecol.67:919 –930. http://dx.doi.org/10.1007/s00248-014-0377-6.

67. Boucher HW, Talbot GH, Bradley JS, Edwards JE, Gilbert D, Rice LB,Scheld M, Spellberg B, Bartlett J. 2009. Bad bugs, no drugs: no ESKAPE!An update from the Infectious Diseases Society of America. Clin. Infect.Dis. 48:1–12. http://dx.doi.org/10.1086/595011.

68. Rice LB. 2008. Federal funding for the study of antimicrobial resistance innosocomial pathogens: no ESKAPE. J. Infect. Dis. 197:1079 –1081. http://dx.doi.org/10.1086/533452.

69. Sanchez MB, Hernandez A, Martinez JL. 2009. Stenotrophomonas malto-philia drug resistance. Future Microbiol. 4:655– 660. http://dx.doi.org/10.2217/fmb.09.45.

70. Denton M, Kerr KG. 1998. Microbiological and clinical aspects of infec-

tion associated with Stenotrophomonas maltophilia. Clin. Microbiol. Rev.11:57– 80.

71. Brooke JS. 2012. Stenotrophomonas maltophilia: an emerging global op-portunistic pathogen. Clin. Microbiol. Rev. 25:2– 41. http://dx.doi.org/10.1128/CMR.00019-11.

72. Zhang L, Li XZ, Poole K. 2000. Multiple antibiotic resistance inStenotrophomonas maltophilia: involvement of a multidrug efflux system.Antimicrob. Agents Chemother. 44:287–293. http://dx.doi.org/10.1128/AAC.44.2.287-293.2000.

73. Yashiro E, Spear RN, McManus PS. 2011. Culture-dependent and cul-ture-independent assessment of bacteria in the apple phyllosphere. J.Appl. Microbiol. 110:1284 –1296. http://dx.doi.org/10.1111/j.1365-2672.2011.04975.x.

74. Krishnamurthi S, Chakrabarti T. 2013. Diversity of bacteria and archaeafrom a landfill in Chandigarh, India as revealed by culture-dependent andculture-independent molecular approaches. Syst. Appl. Microbiol. 36:56 –68. http://dx.doi.org/10.1016/j.syapm.2012.08.009.

75. Furlong MA, Singleton DR, Coleman DC, Whitman WB. 2002. Molec-ular and culture-based analyses of prokaryotic communities from an ag-ricultural soil and the burrows and casts of the earthworm Lumbricusrubellus. Appl. Environ. Microbiol. 68:1265–1279. http://dx.doi.org/10.1128/AEM.68.3.1265-1279.2002.

76. McKillip JL. 2000. Prevalence and expression of enterotoxins in Bacilluscereus and other Bacillus spp., a literature review. Antonie Van Leeuwen-hoek 77:393–399. http://dx.doi.org/10.1023/A:1002706906154.

77. Nicholson WL, Law JF. 1999. Method for purification of bacterial en-dospores from soils: UV resistance of natural Sonoran desert soil popula-tions of Bacillus spp. with reference to B. subtilis strain 168. J. Microbiol.Methods 35:13–21. http://dx.doi.org/10.1016/S0167-7012(98)00097-9.

78. Benardini JN, Sawyer J, Venkateswaran K, Nicholson WL. 2003. SporeUV and acceleration resistance of endolithic Bacillus pumilus and Bacillussubtilis isolates obtained from Sonoran desert basalt: implications forlithopanspermia. Astrobiology 3:709 –717. http://dx.doi.org/10.1089/153110703322736033.

79. Hooper DC. 1999. Mechanisms of fluoroquinolone resistance. Drug Re-sist. Updat. 2:38 –55. http://dx.doi.org/10.1054/drup.1998.0068.

80. Hoa PTP, Managaki S, Nakada N, Takada H, Shimizu A, Anh DH, VietPH, Suzuki S. 2011. Antibiotic contamination and occurrence of antibi-otic-resistant bacteria in aquatic environments of northern Vietnam. Sci.Total Environ. 409:2894 –2901. http://dx.doi.org/10.1016/j.scitotenv.2011.04.030.

81. Phuong Hoa PT, Nonaka L, Hung Viet P, Suzuki S. 2008. Detection ofthe sul1, sul2, and sul3 genes in sulfonamide-resistant bacteria from waste-water and shrimp ponds of north Vietnam. Sci. Total Environ. 405:377–384. http://dx.doi.org/10.1016/j.scitotenv.2008.06.023.

82. Luna VA, King DS, Gulledge J, Cannons AC, Amuso PT, Cattani J.2007. Susceptibility of Bacillus anthracis, Bacillus cereus, Bacillus mycoides,Bacillus pseudomycoides and Bacillus thuringiensis to 24 antimicrobials us-ing Sensititre automated microbroth dilution and Etest agar gradient dif-fusion methods. J. Antimicrob. Chemother. 60:555–567. http://dx.doi.org/10.1093/jac/dkm213.

83. Ding GC, Radl V, Schloter-Hai B, Jechalke S, Heuer H, Smalla K,Schloter M. 2014. Dynamics of soil bacterial communities in response torepeated application of manure containing sulfadiazine. PLoS One9:e92958. http://dx.doi.org/10.1371/journal.pone.0092958.

84. Alonso A. 2004. Overexpression of the multidrug efflux pump SmeDEFimpairs Stenotrophomonas maltophilia physiology. J. Antimicrob. Che-mother. 53:432– 434. http://dx.doi.org/10.1093/jac/dkh074.

85. Livermore DM. 2001. Of Pseudomonas, porins, pumps and carbapenems.J. Antimicrob. Chemother. 47:247–250. http://dx.doi.org/10.1093/jac/47.3.247.

86. German Institute for Standardization. 2007. DIN 58940-3:2007-10.Medical microbiology—susceptibility testing of microbial pathogens toantimicrobial agents. Part 3: agar diffusion test. German Institute for Stan-dardization, Berlin, Germany.

Gammaproteobacteria in Wastewater-Irrigated Soils

September 2014 Volume 80 Number 17 aem.asm.org 5291

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from