vol 6012011

P O L S K I E T O W A R Z Y S T W O M I K R O B I O L O G Ó WP O L I S H S O C I E T Y O F M I C R O B I O L O G I S T S

Polish Journal of Microbiology

2011

I am pleased to inform you that Polish Journal of Microbiology has been selectedfor coverage in Thomson Scientific products and customers information services.Beginning with No 1, Vol. 57, 2008 information on the contents of the PJM isincluded in: Science Citation Index Expanded (ISI) and Journal Citation Reports(JCR)/Science Edition.

Stanis³awa Tylewska-WierzbanowskaEditor in Chief

CONTENTS

MINIREWIEV

New antibacterial therapeutics and strategiesKUREK A., GRUDNIAK A.M., KRACZKIEWICZ-DOWJAT A., WOLSKA K.I. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3

ORIGINAL PAPERS

Clonning, expression and identification by immunohistochemistry of humanized single-chain variable fragment antibodyagainst Hepatitis C virus core proteinLUN Y.-Z., CHENG J., ZHONG Y.-W., YU Z.-G., WANG Q., WANG F., FENG J. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13

The occurrence and comparative phenotypic characteristics of Staphylococcus spp. from healthy and diseased, householdand shelter dogs, based on routine biochemical diagnostic methodsKASPROWICZ A., BIA£ECKA A., BIA£ECKA J., GODZISZ I., BARABASZ W., JAWORSKA O., MA£ACHOWA N.,MIÊDZOBRODZKI J. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19

Comparison of different PCR methods for detection of Brucella spp. in human blood samplesAL-AJLAN H.H., IBRAHIM A.S.S., AL-SALAMAH A.A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27

Antibiofilm activity of selected plant essential oils and their major componentsBUDZYÑSKA A., WIÊCKOWSKA-SZAKIEL M., SADOWSKA B., KALEMBA D., RÓ¯ALSKA B. . . . . . . . . . . . . . . . . . . . . 35

Competitiveness of Rhizobium leguminosarum bv. trifolii strains in mixed inoculation of clover (Trifolium pratense)WIELBO J., MAREK-KOZACZUK M., KIDAJ D., SKORUPSKA A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43

Selection and adaptation of Saccharomyces cerevisae to increased ethanol tolerance and productionFIEDUREK J., SKOWRONEK M., GROMADA A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51

Cytotoxicity of the Aspergillus fungi isolated from hospital environmentGNIADEK A., MACURA A.B., GÓRKIEWICZ M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59

Production and partial charcterization of high molecular weight extracellular "-amylase from Thermoactinomyces vulgarisisolated from Egyptian soilABOU DOBARA M.I., EL-SAYED A.K., EL-FALLAL A.A., OMAR N.F. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65

Halomonas sp. nov., an EPA-producing mesophilic marine isolate from the Indian OceanSALUNKHE D., TIWARI N., WALUJKAR S., BHADEKAR R. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73

SHORT COMMUNICATIONS

Yersinia species in the dunnock (Prunella modularis) in sub-alpine habitats of the western CarpathiansKISKOVÁ J., HREHOVÁ Z., JANIGA M., LUKÁÒ M., HAAS M., JURÈOVIÈOVÁ M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79

First report of Serratia plymuthica causing onion bulb rot in PolandKOWALSKA B., SMOLIÑSKA U., OSKIERA M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85

INSTRUCTIONS TO AUTHORS AND FULL TEXT ARTICLES (IN PDF FORM) AVAILABLE AT:www.microbiology.pl/pjm

Polish Journal of Microbiologyformerly Acta Microbiologica Polonica

2011, Vol. 60, No 1

Polish Journal of Microbiology2011, Vol. 60, No 1, 3�12

MINIREVIEW

Introduction

The growing antibiotic resistance of pathogenicbacterial species is a serious problem for public health.It can be assumed, that although the bulk of traditionalantibiotics can still manage drug-resistant bacteria,many commonly used antibiotics are no longer effec-tive (Levy, 1998; Wright, 2010). This situation isaggravated by a decline in the development of newantibiotics, so recently few substances have appearedin the market (Donadio et al., 2010; Högberg et al.,2010). In view of above, the growing interest in thestudies aimed at developing new antibacterial thera-peutics and strategies is very important not only frommedical point of view but also for agriculture and ani-mal breeding (Myles, 2003). The list of such therapeu-tics is long with stress on the use of bacteriophages asantibacterial agents (Chibani-Chennoufi et al., 2004;Górski et al., 2009). Many papers cover this problemso it will not be the subject of our publication. Thepresent article describes the antibacterial potency andapplication of plant-derived compounds, nanoparticlesand also the very promising photodynamic therapy.

Plant-derived compounds

Plant-derived compounds of therapeutic value aremostly the secondary plant metabolites (Cowan, 1999).Antibacterial phytochemicals are divided in several

categories, this article describe two of them � terpe-nes and phenolics including polyphenols. As a matterof fact, these compounds cannot be considered a newgroup of antimicrobials because people have appliedplants and plant extract for medical purposes for cen-turies (Rios and Recio, 2005).

Terpenes. Terpenes, also referred to as isoprenoids,are based on an isoprene structure with general chemi-cal formula C10H16 and are biosynthesized from thesame basic units, isopentenyl diphosphate, IPP, and itsisomer dimethylallyl diphophate, DMAPP (Fig. 1A).Their derivatives containing additional elements, usu-ally oxygen, are called terpenoids. These compoundshave a lot of biological functions and are applied aspharmaceuticals, fragrances, colorants. Terpenes con-stitute a very diverse group of compounds isolated notonly from higher plants but also from microorganisms(Sacchettini and Poulter, 1997). Successful approachesin engineering Escherichia coli towards biosynthesisof functional isoprenoids were recently described(Harada and Misawa, 2009).

Of special interest are two pentacyclic triterpenoidsoleanolic acid (OA) and ursolic acid (UA) and theirderivatives containing sugar moieties � glucosidesand glucuronides. The chemical formulas of OA/UAare presented in Figure 1B. The antibacterial activityof these compounds was recently reviewed (Wolskaet al., 2010a). The data described in many papersare contrasting and indicate either a strong or weak

New Antibacterial Therapeutics and Strategies

ANNA KUREK, ANNA M. GRUDNIAK, ANNA KRACZKIEWICZ-DOWJATand KRYSTYNA I. WOLSKA*

Department of Bacterial Genetics, Institute of Microbiology, Faculty of BiologyUniversity of Warsaw, Warsaw, Poland

Received 13 January 2011, accepted January 2011

A b s t r a c t

Studies on new antibacterial therapeutics and strategies are currently being conducted in many microbiological, pharmaceutical andbiochemical laboratories. The antibacterial activity of plant-derived compounds as well as silver and gold nanoparticles is the subject ofthis minireview. The application of photodynamic therapy is also discussed.

K e y w o r d s: nanoparticles, new antimicrobials, phototherapy, plant compounds

* Corresponding author: K.I. Wolska, Department of Bacterial Genetics, Institute of Microbiology, University of Warsaw,Miecznikowa 1, 02-096 Warsaw, Poland; phone: (+48) 22 55-41-302; fax: (+48) 22 55 41 402; e-mail: [email protected]

4 Kurek A. et al. 1

antibacterial effect of OA and UA which likely resultsfrom the method of compound purification and thebacterial strain used. A relatively small number ofstudies has been performed to investigate the basisof OA/UA antibacterial activity. It has been shownthat both acids affected peptidoglycan metabolism inListeria monocytogenes (Kurek et al., 2010), oleanolicacid cyclodextrins inhibited insoluble glucan synthesisby Streptococcus mutans (Kozai et al., 1999) andoleane-type triterpenoid, glycyrrhizin acted as a potentE. coli heat-labile enterotoxin inhibitor (Chen et al.,2009). In turn Ren and coworkers (2005) usingmicroaaray techniques demonstrated that UA causeddifferential gene expression in E. coli and inhibitedbiofilm formation in several bacterial species. RecentlyGe and coworkers (2010) proved the synergistic inter-actions of OA in combination with isoniazid, rifampicinor ethanbutol against Mycobacterium tuberculosis.The third pentacyclic triterpenoid with similar chemi-cal structure � betulic acid (BA) is inactive againsta large number of Gram-positive and Gram-negativebacteria. This result illustrates the strong structure-function influence of the antibacterial potential ofterpenes (Fontanay et al., 2008; Wansi et al., 2010).

Other terpenes or terpenoids, such as monoterpenesand sesquiterpenes and their derivatives, also displayantimicrobial activity (Ahmed et al., 1993; Amaral et al.,1998; Habtermariam et al., 1993). Many publicationsdescribe the antibacterial potential of diterpenoids. Itwas demonstrated that six diterpenoids isolated fromthe bark of Podocarpus nagi, of which the most abun-dant compound was totarol, exhibited potent bacteri-cidal activity against Gram-positive bacteria: Propiono-bacterium acnes, S. mutans and Staphylococcus aureus(Kubo et al., 1992). Naturally occurring diterpenoidswith a dehydroabietane skeleton are highly bioactive(Savluchinske-Feio et al., 2006) e.g. isopimaric acid

extracted from immature cones of Pinus nigra inhib-ited the growth of multidrug-resistant and methicillin-resistant Staphylococcus aureus � MRSA (Smith et al.,2005). Antibacterial activity of diterpenoids isolatedfrom hairy roots of Salvia sclarea L was also studied.The results showed that abietane diterpenoids: salvi-sipone, aethopinone, 1-oxoaethopinone and ferrugiolwere bacteriostatic as well as bacteriocidal for cul-tures of S. aureus and S. epidermidis but not for theGram-negative species, E. coli and Pseudomonasaeruginosa (Ku�ma et al., 2007). Salvipisione andaethiopinone expressed staphylococcal anti-biofilmactivity, the reduction in the number of live biofilmcells and changes of biofilm morphology were observed.Both diterpenoids showed synergy with severalclasses of antibiotics, in case of $-lactams this phe-nomenon was due to the probable alternation of cellsurface hydrophobicity and cell envelopes permeabil-ity (Walencka et al., 2007). It was also demonstratedthat diterpenes inhibited the growth of M. tuberculosis(Copp and Pearce, 2007) and recently the Chinesegroup showed that diterpenes isolated from the genusScutellaria possessed the substantial antimicrobialand antiviral activities (Shang et al., 2010).

Phenolics and polyphenols. Phenolics and poly-phenols constitute a very large group of chemicalcompounds. Simple phenols consist of a single sub-stituted phenolic ring, flavones and their derivatives� flavanoids and flavanols are phenolic structurescontaining one carbonyl group, while quinonescontain two carbonyl groups. Tannins are polymericphenolic substances and coumarins are phenoliccompounds made of fused benzene and pyrone rings(Cowan, 1999). The chemical formulas of exemplaryphenolic compounds are shown in Figure 2.

The simple phenol, caffeic acid isolated fromperennial thorny shrub, Paliurus spina-christi was

Fig. 1. Chemical formula of IPP and DMAPP (A) and OA and UA (B)

5New antibacterial therapeutics and strategies1

effective against Gram-positive bacterial species(Brantner et al., 1996). p-guanidinethyl and its simpleparent phenols were active against S. aureus; thesimple phenolic species showed lower activity thattheir calixarene analogues (Mourer et al., 2009).Other groups demonstrated that more highly oxidizedphenols were also more active probably due to theirability to oxidize of sulfhydryl groups in proteins (Ursand Dunleavy, 1975; Mason and Wasserman, 1987).

Flavones and their derivatives, flavonoids and fla-vonols, due to their extremely large amount of bio-logical properties, including the antibacterial activity,are placed among the most attractive plant derivativesenriching the current therapy options (Cazarolli et al.,2008). These compounds can form complexes with cellwall and also disrupt bacterial envelopes (Tsuchiyaet al., 1996; Nakayama et al., 2000). Of special inter-est are catechins, the subgroup of flavonoids presentin the oolong green teas which beneficial effect onhuman health is well known (Cabrera et al., 2006).These compounds are active against food-borne patho-genic bacteria and therefore exert the beneficial effectin gastrointestinal diseases (Friedman, 2007; Drydenet al., 2006; Koo and Cho, 2004). It was shown thatcatechins inhibited in vitro the growth of several bac-terial species such as Vibrio cholerae, S. mutans andShigella spp. (Borris, 1996; Sakanaka et al., 1992;Vijaya et al., 1995). Inactivation of specific bacterialenzymes, V. cholerae toxin and glucosyltransferases inS. mutans, was also reported (Borris, 1996; Nakaharaet al., 1993). Chrysin, another flavonoid abundant inpropolis, also displays substantial antimicrobial activ-ity, preferentially against Gram-positive species, e.g.Streptococcus sobrinus, Enterococcus faecalis andMicrococcus luteus (Uzel et al., 2005). Its activityagainst certain oral pathogens, such as Peptostrepto-coccus anaerobius, Peptostreptococcus micros andLactobacillus acidophilus creates the possibility ofpropolis application in the treatment of oral cavitydiseases (Koru et al., 2007). Recently novel C(7)modified chrysin was synthesized. This modificationwas deliberately designed in order to enhance the anti-

bacterial effect. The biological assays indicated that thiscompound is a potent inhibitor of beta-ketoacyl-acylcarrier protein synthetase (FabH) in E. coli (SureshBabu et al., 2006; Li et al., 2009).

A number of papers are concerned with the anti-bacterial activity of quinones. This activity is basedon their high chemical reactivity inactivating thechemical compounds, mainly proteins. Surface-exposed bacterial adhesins, cell wall polypeptides andmembrane bound enzymes are their probable targets(Cowan, 1999; Koyama, 2006). Because the redox-potential of these compounds was so essential to theiractivity, electrochemical techniques along with bio-chemical and medical knowledge were successfullycombined to design and develop therapeuticallyefficient derivatives (Hillard et al., 2008). It should bealso mentioned that quinones are strong poisons forbacterial type II topoisomerases � gyrase and TopoIV(Pommier et al., 2010). Potent antibacterial activity isattributed to the anthraquinones. It was demonstratedthat anthraquinone isolated from Cassia italica is bac-teriostatic for Bacillus antracis, Corynebacteriumpseudodiphtericum and P. aeruginosa (Kazumi et al.,1994), in turn hypericin and hyperforin isolated fromHypericium perforatum (St. John�s wort) were activeagainst Gram-positive species � S. aureus, S. epider-midis, E. faecalis and Bacillus subtilis (Males et al.,2006; Saddiqe et al., 2010). Recently it was shownthat the antibacterial activity of anthraquinone deriva-tives from Heterophyllaea postulata against S. aureusinvolved an increase in the level of superoxide anionand singlet molecular oxygen (Comini et al., 2010).The antimycobacterial activity of quinones was alsodescribed (Copp and Pearce, 2007).

Tannins are divided in two groups � hydrolysable(derivatives of gallic acid) and condensed, also calledproanthocyanidins (derived from flavonoid mono-mers). Among the various health beneficial activitiesof tannins their antimicrobial activity is often referredto. These compounds are characterized by strong anti-peroxidation properties which may be responsible forthe inactivation of microbial adhesions, enzymes and

Fig. 2. Chemical formulas of exemplary phenolic compounds with antibacterial activity. Catechin (A), Antraquinone (B), Tannin (C)

6 Kurek A. et al. 1

cell envelope transport proteins (Okuda, 2005). Theantioxidation activity of tannins is based on their abil-ity to scavenge free radicals, to chelate metals and toinhibit of prooxidative enzymes and lipid peroxidation(Koleckar et al., 2008). It was well documented thattannins inhibited the growth of aquatic and foodbornebacteria, so they can be used in food processing toincrease the storage time of certain foods (Chung et al.,1998). Tannins, especially proanthocyanins, inhibit thegrowth of uropathogenic E. coli (Cimolai and Cimolai,2007), S. mutans (de la Iglesia et al., 2010) as wellas ruminal bacteria. For the latter it was documentedthat condensed tannin (sainfoin) inhibited the growthand protease activity of Butyrivibrio fibrisolvens A38and Streptococcus bovis. The morphological changesof these species implicated the cell wall as a target oftannin toxicity (Jones et al., 1994). In turn, both hydro-lysable tannins and proanthocyanidines suppressed theoxacillin-resistance of MRSA (Hatano et al., 2005).

The number of publications dealing with anti-microbial activity of yet another group of phenolics,cummarins, is scarce and generally it can be concludedthat this property has not been evaluated systemati-cally (Borges et al., 2005; Cechinel Filho et al., 2009).

Silver and gold nanoparticles

Nanoparticles (NPs) are defined as the clusters ofatoms of size ranged from 1 to 100 nm. Their networkforms are called nanowires. NPs are characterized bya very large surface area to volume ratio (Rai et al.,2009). Copper, zinc, magnesium but especially silverand gold NPs display antibacterial activity and areused for various healthcare, hygiene and personal carepurposes and also in water-treatment (Edwards-Jones,2009; Gurunathan et al., 2009). The conventionalmethods of NPs preparation involves the use of highlytoxic chemical agents, however more friendly tech-niques have also been developed (Baker et al., 2005;Wangoo et al., 2008). Recently the biological systemsfor nanoparticles synthesis were elaborated, the pro-cess is known as �green synthesis�. Sharma and co-workers (2009) described the production of silvernanoparticles (AgNPs) by plant extract containingproteins able to reduce Ag cations. Bacteria and fungican also be explored for AgNPs production. Theirbiosynthesis was achieved through reduction of Ag+

ions by Klebsiella pneumoniae (Shahverdi et al.,2007), E. coli (Gurunathan et al., 2009) and Bacilluslicheniformis (Vaidyanathan et al., 2010). Ingle et al.(2008) and Gade et al. (2008) reported the use offungi, respectively Fusarium accuminatum and Asper-gillus niger, for the production of AgNPs. In turn Heet al. (2008) described the synthesis of gold nanowiresusing an extract of Rhodopseudomonas capsulata. It

should be noted that recently microbial synthesis ofselenium, tellurium platinum, thitania, uranitnie andother nanoparticles by bacteria, actinomycetes, fungi,yeasts and viruses was also reported (Narayanan andSakthivel, 2010).

Silver in ionic form has been known for centuriesto cure venereal diseases, bone and perianal abscesses,eye diseases and burns. It was proved that Ag+ wasactive against various bacterial species e.g. E. coli,S. aureus, Klebsiella sp. and Pseudomonas sp. (Raiet al., 2009; Chopra, 2007). AgNPs have an advan-tage over ionic silver because they show reduced toxi-city and 1.4�1.9 times higher antibacterial potential(Ingle et al., 2008). Reports pointing to silver toxicity,including arygria and the deposition of silver in liverare rather scarce (Tomi et al., 2004; Landsdown, 2006).

The antibacterial effect of AgNPs depends on theirsize. Smaller-sized particles show stronger antibacte-rial activity due to their higher surface area to volumeratio (Morones et al., 2005). It was also proved thatthe truncated triangular AgNPs displayed strongerbacteriocidal action against E. coli compared withspherical and rod-shaped nanoparticles, suggestingshape-dependent interaction at least with Gram-nega-tive bacteria (Pal et al., 2007). Different shapes ofsilver and gold nanoparticles are shown in Figure 3.Several studies demonstrated that bacterial mem-branes constituted the main target of AgNPs antibac-terial activity, nanoparticles caused their disruptionprobably due to the production of reactive oxygenspecies (ROS), including free radicals. Production ofROS is one of the primary mechanisms of nanoparticletoxicity; it may result in oxidative stress, inflamma-tion, and consequent damage not only of membranesbut also of DNA and proteins (Singh et al. 2008). Themodel of bacterium � nanoparticle interactions pre-sented by Neal (2008) is based on contact-mediatedmembrane lipid peroxidation by arising reactive oxy-gen species. Contact was facilitated by electrostaticforces between nanoparticles and negatively chargedcell envelopes. Scanning and transmission electron

Fig. 3. Different types of silver and gold nanoparticles


microscopy images confirmed the formation of pitsin the E. coli cell wall and the accumulation of silverin bacterial membranes which increases permeabilityand therefore results in cell death (Sondi and Salopek-Sondi, 2007). AgNPs may target the bacterial mem-brane, leading to a dissipation of the proton motiveforce as shown by proteomic data and biochemicalstudies. Short exposure of E. coli cells to AgNPsresulted in alterations in the expression of severalenvelope proteins (OmpA, OmpC, OmpF, OppA,MetQ) and heat shock proteins, (IbpA, IbpB and 30Sribosomal subunit) (Lok et al., 2006).

AgNPs interaction with membrane sulfur-contain-ing proteins was also proven (Rai et al., 2009). Mem-brane disruption allowed the passage of AgNPs intocytoplasm causing subsequent damage of DNA andother phosphorus containing compounds and impair-ing the respiratory chain and cell division. The anti-bacterial activity of AgNPs is enhanced by theirdecomposition and the release of Ag ions within bac-terial cell (Feng et al., 2000; Morones et al., 2005).

The antibacterial activity of AgNPs was wellproven basing on in vitro experiments. Activity againstMRSA (Panacek et al., 2006), E. coli (Sondi andSalopek-Sondi, 2007; Morones et al., 2005; Pal et al.,2007; Yoon et al., 2007), P. aeruginosa (Moroneset al., 2005), Vibrio cholera (Morones et al., 2005)and B. subtilis (Yoon et al., 2007) was reported. Kimand coworkers (2007) demonstrated that E. coli wasinhibited at low concentration of AgNPs whereas thegrowth-inhibitory effect of S. aureus was mild. Theefficient antibacterial activity of AgNPs impregnatedwith bacterial cellulose against E. coli and S. aureushas also been demonstrated (Castellano et al., 2007).Sucrose and soluble and waxy corn starch can alsoserve as stabilizers (Valodkar et al., 2010). Synergisticantimicrobial activity of AgNPs with penicillin G,amoxicillin, erythromycin, clindamycin and vanco-mycin against S. aureus and E. coli was observed(Shahverdi et al., 2007). It was also shown thatAgNPs prevent the formation of bacterial biofilms, e.g.biofilms formed by P. aeruginosa and S. epidermidiswere inhibited in more than 95% (Kalishwaralal et al.,2010). This property made these nanoparticles espe-cially useful in controlling biofilms within the oralcavity (Allaker, 2010). Biofilm formation was inhib-ited due to the ability of AgNPs to prevent the initialstep in biofilm development i.e. microbial adhesionto various surfaces (Monteiro et al., 2009).

AgNPs are characterized by so many medical andtechnological applications that they are considered asnew antibacterial agents revolutionizing appliedmedicine. They are used in wounds and ulcers heal-ing, usually in the form of dressings and creams(Cortivo et al., 2010; Jun et al., 2007). They are alsoutilized to coat medical devices such as catheters, den-

tures or surgical masks (Li et al., 2006). Silver, togetherwith copper, is commonly used to inhibit bacterial andfungal growth in chicken farms and in post harvestedcleaning of oysters (Singh et al., 2008). AgNPs andother nanoparticles can be used in water filtration anddisinfection (Li et al., 2008; Jain and Pradeep, 2005)as well in the production of textiles, both non-toxicand possessing antimicrobial properties (Dastjerdi andMontazer, 2010) and in the production of antimicro-bial nanopaints (Kumar et al., 2008).

Gold nanoparticles (AuNPs) also can be used asantimicrobial agents. In this case the majority ofpapers describes their application as a tool to deliverother antimicrobials or as a factor enhancing photo-dynamic destruction of bacteria (Pissuwan et al., 2009).AuNPs were very suitable for delivering drugs, includ-ing antibiotics; AuNPs conjugates with vancomycinproved to be 50-fold more active that the free anti-biotic against Enterococcus faecium and E. faecalis(Gu, 2003). The AuNPs-ciprofloxacin and amino-glycosidic antibiotics conjugates were also described(Tom et al., 2004; Grace and Pandian, 2007). The roleof AuNPs was to facilitate the attachment of conju-gated antibiotic to bacterium and therefore penetratingof cell wall. However it should be stressed that thereis no consensus concerning the efficacy of AuNPs-antibiotic conjugates compared with the same dosageof free antibiotic, e.g. Rosemary et al. (2006) foundthat AuNPs enhanced the efficacy of ciprofloxacinagainst E. coli what was not observed for gentamycin(Burygin et al., 2009).

AuNPs were also used as stabilizers for variousantimicrobial photosensitizers. Four-fold increase ofS. aureus elimination was observed when toluidineblue O-AuNPs conjugates and methylene blue-AuNPsconjugates were used in photodynamic therapy com-pared to dyes alone (Gil-Tomás et al., 2007; Perniet al., 2009). AuNPs enhanced the absorption of lightdue to their plasmon resonance (Pitsillides et al., 2003)which could cause local hyperthermic effect leadingto the efficient destruction of E. coli irradiated withX-rays (Simon-Deckers et al., 2009), P. aeruginosaexposed to near-infrared laser (Norman et al., 2008)or S. aureus irradiated with strong laser light (Zharovet al., 2006).

AuNPs are very useful for detection and diagnosisof bacteria even in complex media like blood(Kaittanis et al., 2010), this being mainly based on thedetection of bacterial DNA by change of color(Elghanian et al., 1997). They have been used for fast,accurate and sensitive detection of Staphylococcus sp.(Storhoff et al., 2004) and M. tuberculosis (Baptistaet al., 2006; Veigas et al., 2010). AuNPs were alsoapplied to improve the sensitivity of bacterial detectionmethods based on flow cytometry and fluorescence(Zaharov et al., 2007; Wang et al., 2009).

8 Kurek A. et al. 1

Natural and synthetic dyes andphotodynamic therapy

The antimicrobial effect of natural and syntheticdyes has been known for many decades. Already inthe beginning of the last century proflavine, acrifla-vine, crystal violet and brilliant green were usedagainst bacterial infections, mainly to cure infectedwounds (Wainwright, 2008; Wainwright, 2010). Pre-operative use of iodine still remains a common prac-tice. Gentian (crystal) violet was shown to be veryefficient in the eradication of MRSA from skin lesions(Saji et al., 1995). Recently it was shown that thetiazol dye, thioflavin T, exerted a strong inhibitoryeffect on S. aureus, the effect on E. coli was less pro-nounced (Lakato�, 2010). The list of dyes with anti-bacterial properties included also pigments synthe-sized by microorganisms (Wolska et al., 2010b). Thepigment produced by P. aeruginosa � pyocyanin,due to its unique redox properties, actively elimina-ted many bacterial species, especially Gram-positiveaerobes (Baron and Rove, 1981). In turn violacein ex-tracted from Chromobacterium violaceum displayeda potent antileishamanial activity (Leon et al., 2001).

Many dyes can serve as photosensitizers, some-times called photomicrobial agents, and are applied inphotodynamic antimicrobial therapy (PACT). Photo-sensitizers can be activated by visible light to generatecytotoxic radicals, superoxide radicals and singletoxygen ½ O2 which are the reactive oxygen species(ROS). ROS are highly toxic to various type of cells,including bacteria, causing the damage of the outermembrane, cell wall, ribosomes and nucleic acids andthus impairing many cellular functions (for review seeWainwright, 2010; Ryskova et al., 2010). Photosensi-tizers are usually dyes such as methylene blue (Gadet al., 2004), porphyrins (Hamblin et al., 2005), crystalviolet (Saji et al., 1995), iodocyanine green (Unnoet al., 2008) and erytrosine (Wood et al., 2006).Thelatter is of special interest because it can be used forthe therapy of oral plaque biofilms (Wood et al., 2006).Positively charged (cationic) photosensitizers such asmethylene blue and crystal violet act as broad-spec-trum antimicrobials, while the negatively charged (an-ionic) compounds lack efficacy against Gram-nega-tive species (Demidova et al., 2005). This is becauseanionic photosensitizers are not able to penetrate thelipopolysaccharide outer membrane of Gram-negativebacteria. In practice photosensitizers are usually acti-vated by red light and the preferable source of light islow-power lasers (Ryskova et al., 2010). The stabili-zation of various photosensitizers by AuNPs was de-scribed in the previous chapter. Beside dyes, alsofullerenes which are stable chemical molecules com-posed of 60 carbon atoms arranged in a soccer ball-

shaped structure are proved to be the efficient photo-sensitizers (Krokosz, 2007).

Photodynamic therapy is used mainly in the treat-ment of local infections. Its efficacy was proved inhealing cutaneous infections e.g. poor-healing woundscaused by Mycobacterium marinum (Rallis andKoumantaki-Mathioudaki, 2007) and oral microbialrelated diseases such as periodontitis (Liu et al.,2009). It was clinically studied for leishmaniasis (Daiet al., 2009). It should be stressed that photodynamictherapy can be applied in the eradication of antibiotic-resistant pathogens e.g. MRSA (Griffiths et al., 1997),VRE (Soncin et al., 2002) and P. aeruginosa (Minnocket al., 1996) which are life-threat danger in hospitals.Recently it was shown that two water soluble photo-sensitizers: methylene blue and neutral red enclosedin liposomes gave a stronger antibacterial effect thantheir free forms (Nisnevitch et al., 2010). It shouldbe also noted that photodynamic therapy was appliedand found to be efficient in treating lung, stomach andskin tumors (Maisch et al., 2005).

Conclusions

The huge and constantly growing amount of pa-pers describing new antibacterial therapeutics reflectsan urgent need to find efficient antimicrobials whichcan be an alternative to antibiotics. Plants and theirextracts have been used even in ancient times formedical purposes. Recently, studies are focused onthe activity of purified compounds. Trials aimed atresolving the mechanism of their action are also per-formed. The majority of studies are held in vitro butthe results of preclinical and clinical trial have alsobeen reported. As it was shown that many plant com-pounds exert a cytotoxic effect (Zhang et al., 2007)efforts have been made to synthesize derivatives withless toxicity and better water solubility (e.g. Farinaet al., 1998; Liu, 2005), which can enhance the possi-bility of their therapeutic application. Studies on theantibacterial activity of silver and gold nanoparticlesare more advanced and also comprise their synergismwith commonly used antibiotics and the applica-tion of AuNPs in stabilizing photosensitizers used inphotodynamic therapy, which is a very proficient newantibacterial strategy.

Considering the enormous scientific effort put inelaborating new antibacterial compounds and strate-gies, alternative possibilities to cope with bacterialdiseases can emerge in the near future.

AcknowledgmentThis study was partially supported by Ministry of Science and

Higher Education grant NN302 027937.


Literature

Ahmed A.A., A.A. Mahmoud, H.J. Williams, A.I. Scott,J.H. Reinbenspiesand and T.J. Mabry. 1993. New sesquiter-pene "-methylene lactones from the Egyptian plant Jasoniacandicans. J. Nat. Prod. 56: 1276�1280.Allaker R.P. 2010. The use of nanoparticles to control oralbiofilm formation. J. Dent. Res. 89: 1175�1186.Amaral J.A., A. Ekins S.R. Richards and R. Knowles. 1998.Effect of selected monoterpenes on methane oxidation, denitrifi-cation, and aerobic metabolism by bacteria in pure culture. Appl.Environ. Microbiol. 64: 520�525.Baker C., A. Pradhan, L. Pakstis, D.J. Pochan and S.I. Shah.2005. Synthesis and antibacterial properties of silver nanoparticles.J. Nanosci. Nanotechnol. 5: 244�249.Baptista P.V., M. Koziol-Montewka, J. Paluch-Oles, G. Doriaand R. Franco. 2006. Gold-nanoparticle-probe-based assay forrapid and direct detection of Mycobacterium tuberculosis DNA inclinical samples. Clin. Chem. 52: 1433�1434.Baron S. and J.J. Rove. 1981. Antibiotic action of pyocyanin.Antimicrob. Agents Chemother. 20: 814�830.Borges F., F. Roleira, N. Mihazes, L. Santana and E. Uriarte.2005. Simple coumarins and analogues in medical chemistry:occurrence, synthesis and biological activity. Curr. Med. Chem.12: 887�916.Borris R.P. 1996. Natural products research: perspectives from amajor pharmaceutical company. J. Ethnopharmacol. 51: 29�38.Brantner A., �. Male�, S. Pepelnjak and A. Antoliæ. 1996.Antimicrobial activity of Paliurus spina-christi Mill. (Christ�sthorn). J. Ethnopharmacol. 52: 119�122.Burygin G.L., B.N. Khlebtstov, A.N. Shantrokha, L.A.Dykman, V.A. Bogatyrev and N.G. Khlebtsov. 2009. On theenhanced antibacterial activity of antibiotics mixed with goldnanoparticles. Nanoscale Res. Lett. 4: 794�801.Cabrera C., R. Artacho and R. Giménez. 2006. Beneficial effectof green tea � a review. J. Am. Coll. Nutr. 25: 79�99.Castellano J.J., S.M. Shafii, F. Ko, G. Donate, T.E. Wright,R.J. Mannari, W.G. Payne, D.J. Smith, M.C. Robson. 2007.Comparative evaluation of silver-containing antimicrobial dress-ings and drugs. Int. Wound J. 4: 114�122.Cazarolli L.H., L. Zanatta, E.H. Alberton, M.S. Figueiredo,P. Folador, R.G. Damazio, M.G. Pizzolatti and F.R. Silva.2008. Flavonoids: prospective drug candidates. Mini Rev. Med.Chem. 8: 1429�1440.Cechinel Filho V., C. Meyre-Silva and R. Neiro. 2009. Chemicaland pharmacological aspects of the genus Calophyllum. Chem.Biodivers. 6: 313�327.Chen J.-C., T.-H. Ho, Y.-S. Chang, S.-L. Wu, C.-C. Li andC.-Y. Hsiang. 2009. Identification of Escherichia coli enterotoxininhibitors from traditional medical herbs in silico, in vitro andin vivo analyses. J. Ethnopharmacol. 121: 372�378.Chibani-Chennoufi S., J. Sidoti, A. Bruttin, E. Kutter,S. Sarker and H. Brussow. 2004. In vitro and in vivo bacterio-lytic activities of Escherichia coli phages: implications for phagetherapy. Antimicrob. Agents Chemother. 48: 2558�2569.Chopra I. 2007. The increasing use of silver-based products asantimicrobial agents: a useful development or a case for concern?J. Antimicrobial. Chem. 59: 587�590.Chung K.T., T.Y. Wong, C.I. Wei, Y.W. Huang and Y. Lin.1998. Tannins and human health: a review. Crit. Rev. Food Sci.Nutr. 38: 421�464.Cimolai N. and T. Cimolai. 2007. The cranberry and urinarytract. Eur. J. Clin. Microbiol. Infect. Dis. 26: 767�776.Comini L.R., S.C. Núòez Montoya, P.L. Páez, G.A. Argüello,I. Albesa and J.L. Cabrera. 2010. Antibacterial activity of anthra-

quinone derivatives from Heterophyllaea postulate (Rubiaceae).J. Photochem. Photobiol. B.Copp B.R. and A.N. Pearce. 2007. Natural product growth inhibi-tors of Mycobacterium tuberculosis. Nat. Prod. Rep. 24: 278�297.Cortivo R., V. Vindigni, L. Iacobellis, G. Abatangelo, P. Pintonand B. Zavan. 2010. Nanoscale particle therapies for wounds andulcers. Nanomedicine 5: 641�656.Cowan M.M. 1999. Plant product as antimicrobial agents. Clin.Microbiol. Rev. 12: 564�582.Dai T., Y.-Y. Huang and M.R. Hamblin. 2009. Photodynamictherapy for localized infections � state of art. Photodiag. Photodyn.Ther. 6: 170�188.Dastjerdi R. and M. Montazer. 2010. A review on the applica-tion of inorganic nano-structured materials in the modificationof textiles: focus on anti-microbial properties. Colloids Surf.B. Interfaces. 79: 5�18.de la Iglesia R., F.I. Milagro, J. Campión, N. Boqué andJ.A. Martinez. 2010. Healthy properties of proanthocyanidins.Biofactors 36: 159�168.Demidova T.N. and M.R. Hamblin. 2005. Effect of cell-photo-sensitizer binding and cell density on microbial photoinactivation.Antimicrob. Agents Chemother. 49: 2329�2335.Donadio S., S. Maffiolo, P. Monciardini, M. Sosio andD. Jabes. 2010. Antibiotic discovery in the twenty-first century:current trends and future perspectives. J. Antibiot. (Tokyo) 63:423�430.Dryden G.W., M. Song and C. McClain. 2006. Polyphenols andgastrointestinal diseases. Curr. Opin. Gastroenterol. 22: 165�170.Edwards-Jones V. 2009. The benefits of silver in hygiene, per-sonal care and healthcare. Lett Appl. Microbiol. 49: 147�152.Elghanian R., J.J. Storhoff, R.C. Mucic, R.L. Letsinger andC.A. Mirkin. 1997. Selective colorimetric detection of polynucle-otides based on the distance-dependent optical properties of goldnanoparticles. Science 277: 1078�1081.Farina C., M. Pinza and G. Pifferi. 1998. Synthesis and anti-ulcer activity of new derivatives of glycyrrhetic, oleanolic andursolic acids. Pharmacology 53: 22�32.Feng Q.J., J. Wu, G.Q. Chen, F.Z. Cui, T.N. Kim and J.Q. Kim.2000. A mechanistic study of the antibacterial effect of silver ionson Escherichia coli and Staphyloccocus aureus. J. Biomed. Matter52: 662�668.Fontanay S., M. Grare, J. Mayer, C. Finance and R.E. Duval.2008. Ursolic, oleanolic and betulic acids: Antibacterial spectraand selectivity indexes. J Ethnopharmacol. 120: 272�276.Friedman M. 2007. Overwiew of antibacterial, antitoxin, antiviraland antifungal activities of tea flavonoids and teas. Mol. Nutr.Food Res. 51: 116�134.Gad F., T. Zahra, T. Hasan and M.R. Hamblin. 2004. Effect ofgrowth phase and extracellular slime on photodynamic inactiva-tion of Gram-positive pathogenic bacteria. Antimicrob. AgentsChemother. 48: 2173�2178.Gade A.K., P. Bonde, A.P. Ingle, P.D. Marcato, N. Duran andM.K. Rai. 2008. Explotation of Aspergillus niger for synthesis ofsilver nanoparticles. J. Biol. Mater. Bioener. 2: 1�5.Ge F., F. Zeng, S. Liu, N. Guo, H. Ye, Y. Song, J. Fan, X. Wu,X. Wang, X. Deng, Q. Jin and L. Yu. 2010. In vitro synergisticinteractions of oleanolic acid in combination with isoniazid,rifampicin or ethambutol against Mycobacterium tuberculosis.J. Med. Microbiol. 59: 567�72.Gil-Thomás J., S. Tubby, I.P. Parkin, N. Narband, L. Dekker,S.P. Nair, M. Wilson and C. Street. 2007. Lethal photosensitisa-tion of Staphylococcus aureus using toluidine blue O-tiopronin-gold nanoparticle conjugate. J. Mat. Chem. 17: 3739�3746.Górski A., A. Miêdzybrodzki, J. Borysowski, B. Weber-D¹browska, M. £obocka, W. Fortuna, S. Letkiewicz, M. Zimecki

10 Kurek A. et al. 1

and G. Filby. 2009. Bacteriophage therapy for the treatment ofinfections. Curr. Opin. Investig. Drugs 10: 766�774.Grace N.A. and K. Pandian. 2007. Antibacterial efficacy ofaminoglycosidic antibiotics protected gold nanoparticles � A briefstudy. Colloids Surf. A Physicochem. Eng. Asp. 297: 63�70.Griffiths M.A., B.W. Wren and M. Wilson. 1997. Killing ofmethicillin-resistant Staphylococcus aureus in vitro using alu-minium disulphonated phthalocyanine, a light-activated antimicro-bial agent. J. Antimicrob. Chemother. 40: 873�876.Gu H., P.L. Ho, E. Tong, L. Wang, B. Xu. 2003. Presentation ofvancomycin on nanoparticles to enhance antimicrobial activities.Nano Lett. 3: 1261�1263.Gurunathan S., K. Kaliswaralal, R. Vaidyanathan, D. Venka-taraman, S.R. Pandian, J. Hariharan and S.H. Eom. 2009.Biosynthesis, purification and characterization of silver nano-particles using Escherichia coli. Colloids Surf. B. Interfaces 74:328�335.Habtermariam S., A.I. Gray and P.G. Waterman. 1993. A newantibacterial sesquiterpene from Premna oligotricha. J. Nat. Prod.56: 140�143.Hamblin M.R., J. Viveiros, C.H. Yang, A. Ahmadi, R.A. Ganzand M.J. Tolkoff. 2005. Helicobacter pylori accumulates photo-active porphyrins and is killed by visible light. Antimicrob. AgentsChemother. 49: 2822�2827.Harada H. and N. Misawa. 2009. Novel approaches and achieve-ments in biosynthesis of functional isoprenoids in Escherichiacoli. Appl. Microbiol. Biotechnol. 84: 1021�1031.Hatano T., M. Kusuda, K. Inada, T.O. Ogawa, S. Shiota,T. Tsuchiya and T. Yoshida. 2005. Effects of tannins and relatedpolyphenols on methicillin-resistant Staphylococcus aureus. Phyto-chemistry 66: 2047�2055.He S., Y. Zhang, Z. Guo and N. Gu. 2008 . Biological synthesisof gold nanowires using extact of Rhodopseudomonas capsulata.Biotech. Prog. 24: 476�480.Hillard E.A., F.C. de Abreu, D.C. Ferreira, G. Jaouen,M.O. Goulart, C. Amatore. 2008. Electrochemical parameters andtechniques in drug development, with an emphasis on quinones andrelated compounds. Chem Commun. (Camb.) 21: 2612�2628.Högberg L. D., A. Heddini and O. Cars. 2010. The global needfor effective antibiotics: challenges and recent advances. TrendsPharmacol. Sci. 31: 509�515.Ingle A., A. Gade, S. Pierrat, C. Sonnichsen and M. Rai. 2008.Mycosynthesis of silver nanoparticles using the fungus Fusariumacuminatum and its activity against some human pathogenic bac-teria. Curr. Nantechnol. 4: 141�144.Jain P. and T. Pradeep. 2005. Potential of silver nanoparticle-coated polyurethane foam as an antibacterial water filter. Bio-technol. Bioeng. 90: 59�63.Jones G.A., T.A. McAllister, A.D. Muir and K.J. Cheng. 1994.Effects of sainfoin (Onobrychis viciifolia Scop.) condensedtannins on growth and proteolysis by four strains of ruminal bac-teria. Appl. Environ. Microbiol. 60: 1374�1378.Jun J., D. Yuan-Yuan, W. Shao-feng, W. Zhong-yi. 2007.Preparation and characterization of antibacterial silver-contain-ing nanofibers for wound dressing applications. J. US-China Med.Sci. 4: 52�54.Kaittanis C., S. Santra and J.M. Perez. 2010. Emerging nano-technology based strategies for the identification of microbialpathogenesis. Adv. Drug Deliv. Rev. 62: 408�423.Kalishwaralal K., S. BarathManiKanth, S.R. Pandian,V. Deepak and S. Gurunathan. 2010. Silver nanoparticles impedethe biofilm formation by Pseudomonas aeruginosa and Staphylo-coccus epidermidis. Colloids Sur. B Biointerfaces 79: 340�344.Kazumi M.H., A. Malik, S. Hammed, N. Akhtar and S. NoorAli. 1994. An anthraquinone derivative from Cassia italica. Phyto-chemistry 36: 761�763.

Kim J.S., E. Kuk, K.N. Yu, J.H. Kim, S.J. Park, H.J. Lee,S.H. Kim,. Y.K. Park, C.Y. Hwang, Y.K. Kim, Y.S. Lee,D.H. Jeong and M.H. Cho. 2007. Antimicrobial effect of silvernanoparticles. Nanomedicine 3: 95�101.Koleckar V., K. Kubikova, Z. Rehakova, K. Kuca, D. Jun,L. Jahodar and L. Opletal. 2008. Condensed and hydrolysabletannins as antioxidants influencing the health. Mini Rev. Med.Chem. 8: 436�447.Koo M.W. and C.H. Cho. 2004. Pharmacological effect of greentea on the gastrointestinal system. Eur. J. Pharmacol. 500: 177�185.Koru O., F. Toksoy, C.H. Acikel, Y.M. Tunca, M. Baysallar,A. Uskudar Guculu, E. Akca, A. Ozkok Tuylu, K. Sorkun,M. Tanyuksel and B. Salih. 2007. In vitro antimicrobial activityof propolis samples from different geographical origins againstcertain oral pathogens. Anaerobe 13: 140�145.Koyama J. 2006. Anti-infective quinone derivatives of recentpatents. Recent Pat. Antiinfect. Drug Discov. 1: 113�125.Kozai K., J. Suzuki, M. Okada and N. Nagasaka. 1999. Effect ofoleanolic acid-cyclodextrin inclusion compounds on dental carriesby in vitro experiment in rat-carries model. Microbios 97: 179�188.Krokosz A. 2007. Fullerenes in biology (in Polish). Post.Biochem. 53: 91�96.Kubo I., H. Muroi and M. Himejima. 1992. Antibacterial acti-vity of totarol and its potentiation. J. Nat. Prod. 55: 1436�1440.Kumar A., P. K. Vemula, P. M. Ajayan and G. John. 2008.Silver nanoparticle-embeded antimicrobial paints based on vege-table oil. Nat. Mater. 7: 236�241.Kurek A., A.M. Grudniak, M. Szwed, A. Klicka, £. Samlukand K.I. Wolska. 2010. Oleanolic acid and ursolic acid affectpeptidoglycan metabolism in Listeria monocytogenes. Anton,Leuven. 97: 1143�1146.Ku�ma £., M. Ró¿alski, E. Walencka, B. Ró¿alska andH. Wysokiñska. 2007. Antimicrobial activity of diterpenoidsfrom hairy roots of Salvia sclarea L.: salvipisone as a potentialanti-biofilm agent active against antibiotic resistant Staphylo-cocci. Phytomedicine 14: 31�35.Lakato� B., B. Kaliòková, D. Hudecová. and L. Vareèka. 2010.New effect and applications of thioflavins. Centr. Eur. J. Biol. 5:143�150.Landsdown A.B. 2006. Silver in health care: antibacterial effectand safety in use. Curr. Probl. Dermatol. 33: 17�34.Leon L.L., C.C. Miranda, A.O. De Souza and N. Durán. 2001.Antleishmanial activity of the violacein extracted from Chromo-bacterium violaceum. J. Antimicrob. Chemother. 48: 449�450.Levy S.B. 1998. The challenge of antibiotics resistance. Sci. Am.278: 46�53.Li Y., P. Leung, Q.W. Song and E. Newton. 2006. Antimicro-bial effect of surgical masks coated with nanoparticles. J. Hosp.Infect. 62: 58�63.Li Q., S. Mahendra, D.Y. Lyon, L. Brunet, M.V. Liga, D. Liand P.J. Alvarez. 2008. Antimicrobial nanomaterials for waterdisinfection and microbial control: potential applications and im-plications. Water Res. 42: 4591�4602.Li H.Q., L. Shi, Q. S. Li, P.G. Liu, Y. Luo, J. Zhao andH.L. Zhu. 2009. Synthesis of C(7) modified chrysin derivativesdesigning to inhibit beta-ketoacyl-acyl carrier protein synthetaseIII (FabH) as antibiotics. Bioorg. Med. Chem. 17: 6264�6269.Liu P.F., W.H. Zhu and C.M. Huang. 2009. Vaccines and photo-dynamic therapies for oral microbial-related diseases. Curr. Drug.Metab. 10: 90�94.Liu J. 2005. Oleanolic and ursolic acids: Research perspectives.J. Ethnopharmacol. 100: 92�94.Lok Ch-M., Ch-M. Ho, R. Chen, Q-Y. He, W-Y. Yu, H. Sun,Kwong-Hang, P. Tam, J-F. Chiu and Ch-M. Chi-Ming Che.2006. Proteomic analysis of the mode of antimicrobial action ofsilver nanoparticles. J. Prot. Res. 5: 916�924.


Maisch T., C. Bosi, R.M. Szeimies, N. Lehn and C. Abels.2005. Photodynamic effect of novel XF porfyrin derivatives onprokaryotic and eukaryotic cells. Antimicrob. Agents Chemother.49: 1542�1552.Males Z., A.H. Branter, K. Soviæ, K.H. Pilepiæ and M. Plazibat.2006. Comparative phytochemical and antimicrobial investiga-tions of Hypericium perforatum L. subsp. perforatum andH. perforatum subsp. angustifolium (DC.) Gaudin. Acta Pharm.56: 359�367.Mason T.L. and B.P. Wasserman. 1987. Inactivation of red beetbeta-glucan synthetase by native and oxidized phenolic compounds.Phytochemistry 26: 2197�2202.Minnock A., D.I. Vernon, J. Schofield., J. Griffith., J. HowardParish and S.B. Brown. 1996. Photoinactivation of bacteria. Useof cationic water-soluble zinc phthalocyanine to photoinactivateboth Gram-negative and Gram-positive bacteria. J. Photochem.Photobiol. B. Biol. 32: 159�64.Monteiro D.R., L.P. Gorup, A.S. Takamiya, A.C. Ruvollo-Filho, E.R. de Camargo and D. Barros Barbosa. 2009. Thegrowing importance of materials that prevent microbial adhesion:antimicrobial effect of medical devices containing silver. Int.J. Antimicrob. Agents 34: 103�110.Morones J.R., J.L. Elechigerra, A. Camacho and J.T. Ramirez.2005. The bacterial effect of silver nanoparticles. Nanotechnology16: 2346�2353.Mourer M., H.M. Dibama, S. Fontanay, M. Grare, R.E. Duval,C. Finance and J.B. Regnouf-de-Vains. 2009. p-Guanidinoethylcalixarene and parent phenol derivatives exhibiting antibacterialactivities. Synthesis and biological evaluation. Bioorg. Med. Chem.17: 5496�5509.Myles D.C. 2003. Novel biologically active natural and unnaturalproducts. Curr. Opin. Biotechnol. 14: 627�633.Nakayama T., T. Hashimoto, K. Kajiyaand S. Kumazawa.2000. Affinity of polyphenols for lipid bilayers. Biofactors 13:147�151.Nakahara K., S. Kawabata, H. Ono, K. Ogura, T. Tanaka,T. Ooshima and S. Hamada. 1993. Inhibitory effect of oolongtea polyphenols on glucosyltransfrases of mutant streptococci.Appl. Environ. Microbiol. 59: 968�973.Narayanan K.B. and N. Sakthivel. 2010. Biological synthesisof metal nanoparticles by microbes. Adv. Colloid Sci. 156: 1�13.Neal A.I. 2008. What can be inferred from bacterium � nano-particle interactions about the potential consequences of en-vironmental exposure to nanoparticles? Exotoxicobiology 7:362�371.Nisnevitch M., F. Nakonechny and Y. Nitzan. 2010. Photo-dynamic antimicrobial chemotherapy by liposome-encapsulatedwater-soluble photosensitizers. Bioorg. Chim. 36: 396�402.Norman R.S., J.W. Stowe, A. Gole, C.J. Murphy and T.L. Sabo-Altwood. 2008. Targeted photothermal lysis of pathogenic bac-teria, Pseudomonas aeruginosa, with gold nanorods. Nano. Lett.8: 302�306.Okuda T. 2005. Systematics and health effects of chemically dis-tinct tannins in medical plants. Phytochemistry 66: 2012�2031.Pal S., Y.K. Tak and J.M. Song. 2007. Does the antibacterialactivity of silver nanoparticles depend on the shape of thenanoparticle? A study of the Gram-negative bacterium Escherichiacoli. Appl. Environ. Microbiol. 27: 1712�1720.Panacek A., L. Kvitek, R. Prucek, M. Kolar, R. Vecerovaand N. Pizurova. 2006. Silver colloid nanoparticles: synthesis,characterization and their antibacterial activity. J. Phys. Chem.110: 16248�16243.Perni S., C. Piccirillo, J. Pratten, P. Prokopovich, W. Chrza-nowski, P. Parkin and M. Wilson. 2009. The antimicrobial pro-perties of light-activated polymers containing methylene blue andgold nanoparticles. Biomaterials 30: 89�93.

Pissuwan D., C.H. Cortie, S.M. Valenzuela and M.B. Cortie.2009. Functionalised gold nanoparticles for controlling patho-genic bacteria. Trends Biotechnol. 28: 207�213.Pitsillides C.M., E.K. Joe, X Wei, R.R. Anderson and C.P. Lin.2003. Selective cell targeting with light-absorbing microparticleswith nanoparticles. Biophys. J. 84: 4023�4032.Pommier Y., E. Leo, H. Zhang and C. Marchand. 2010. DNAtopoisomerases and their poisoning by anticancer and antibacterialdrugs. Chem. Biol. 28: 421�433.Rai M., A. Yadav and A Gade. 2009. Silver nanoparticles asa new generation of antimicrobials. Biotech. Adv. 27: 76�83.Rallis E. and E. Koumantaki-Mathioudaki. 2007. Treatmentof Mycobacterium marinum cutaneous infections. Expert Opin.Pharmacother. 8: 2965�2978.Ren D., R. Zuo, A.F. Gonzalez Barrios, L.A. Bedzyk,G.R. Eldridge, M.E. Pasmore and T.K. Wood. 2005. Differen-tial gene expression for investigation of Escherichia coli biofilminhibition by plant extract ursolic acid. Appl. Environ. Microbiol.71: 4022�4034.Rios J.L. and M.C. Recio. 2005. Medical plants and antimicro-bial activity. J. Ethnopharmacol. 100: 80�84.Rosemary M.J., I. MacLaren and T. Pradeep. 2006. Investiga-tions of the antibacterial properties of ciprofloxacin SiO

2. Langmuir

22: 10125�10129.Ryskova L., V. Buchta and R. Slezak. 2010. Photodynamic anti-microbial therapy. Centr. Eur. J. Biol. 5: 400�406.Sacchettini J.C. and C.D. Poulter. 1997. Creating isoprenoiddiversity. Science 277: 1788�1789.Saddiqe Z., I. Naeem and A. Maimoona. 2010. A review of theantibacterial activity of Hypericum perforatum L. J. Ethnophar-macol. 131: 511�521.Saji M., S. Taguchi, K. Uchiyama, E. Osomo, N. Hayama andH. Ohkumi. 1995. Efficacy of gentian-violet in the eradicationof methicillin-resistant Staphylococcus aureus from skin lesions.J. Hosp. Infect. 31: 225�228.Sakanaka S., N. Shimura, M. Aizawa, M. Kim and T. Yamamoto.1992. Preventive effect of green tea polyphenols against dental car-ies in conventional rats. Biosci. Biotechnol. Biochem. 56: 592�594.Savluchinske-Feio S., M.J. Curto, B. Gigante and J.C. Roseiro.2006. Antimicrobial activity of resin acid derivatives. Appl. Micro-biol. Biotech. 72: 430�436.Shahverdi A.R., A. Fakhimi, H.R. Shahverdi and S.M. Minaian.2007. Synthesis and effect of silver nanoparticles on the antibacte-rial activity of different antibiotics against Staphylococcus aureusand Escherichia coli. Nanomedicine 3: 168�171.Shang X., X. He, M. Li, R. Zhang, P. Fan, Q. Zhang andZ. Jia. 2010. The genus Scutellaria an ethnopharmacological andphytochemical review. J. Ethnopharmacol. 128: 279�313.Sharma V.K., R.A. Yngard and Y. Lin. 2009. Silver nano-particles: green synthesis and their antimicrobial activities. Adv.Colloid Interface Sci. 145: 83�96.Simon-Deckers A., S. Loo, M. Mayne-L�hermite, N. Herlin-Boime, N. Menguy, C. Reynaud, B. Gouget and M. Carriere.2009. Size-, composition-, and shape-dependent toxicologicalimpact of metal oxide nanoparticles and carbon nanotubes towardsbacteria. Environ. Sci. Technol. 43: 8423�8429.Singh M., S. Singh, S. Prasada and I.S. Gambhir. 2008. Nano-technology in medicine and antibacterial effect of silver nano-particles. Digest J. Nanomat. Biostruct. 3: 115�122.Smith E., E. Williamson, M. Zloh and S. Gibbons. 2005.Isopimaric acid from Pinus nigra shows activity against multidrug-resistant and EMRSA strains of Staphylococcus aureus. Phytother.Res. 19: 538�542.Soncin M., C. Fabris, A. Busetti, D. Dei, D. Nistri andG. Roncucci. 2002. Approaches to selectivity in the Zn (II)-phthalocyanide-photosensitized inactivation of wild-type and

12 Kurek A. et al. 1

antibiotic-resistant Staphylococcus aureus. Photochem. Photobiol.Sci. 1: 815�819.Sondi J. and B. Salopek-Sondi. 2004. Silver nanoparticles asantimicrobial agent: a case study on E. coli as a model for Gram-negative bacteria. J. Colloid Interface 275: 177�182.Storhoff J.J., A.D. Lucas, V. Garimella, Y.P. Bao and U.R.Müller. 2004. Homogenous detection of unamplified genomicDNA sequences based on colorimetric scatter of gold nano-particles probes. Nat. Biotechnol. 22: 883�887.Suresh Babu K., T. Hari Babu, P.V. Srinvas, K. Hara Kishore,U.S. Murthy and J.M. Rao. 2006. Synthesis and biologicalevaluation of novel C(7) modified chrysin analogues as antibac-terial agents. Bioorg. Med. Chem. Lett. 16: 221�224.Tom R.T., V. Suryanarayanan, P.G. Reddy, S. Baskaran andT. Pradeep. 2004. Ciprofloxacin-protected gold nanoprticles.Langmuir 20: 1909�1914.Tomi N.S., B. Kranke and W. Aberer. 2004. A silver man. Lan-cet 363: 532Tsuchiya H., M. Sato, M. Miyazaki, S. Fuijwara, S. Tanigaki,M. Ohyama, T. Tanaka, and M. Iinuma. 1996 Comparativestudy on the antibacterial activity of photochemical flavanonesagainst meticillin-resistant Staphylococcus aureus. J. Ethnophar-macol. 50: 27�34.Unno N., M. Suzuki, N. Yamamoto, K. Inuzuka, D. Sagara andM. Nishiyama. 2008. Indocyanine green fluorescence angio-graphy for intraoperative assessment of blond flow: a feasibilitystudy. Eur. J. Vasc. Endovasc. Surg. 35: 205�207.Urs N.V.R.R. and J.M. Dunleavy. 1975. Enhancement of thebactericidal activity of peroxidase system by phenolic compounds(Xanthomonas phaseoli var. sojensis, soybeans). Phytopathology65: 686�690.Uzel A., K. Sorkun, O. Onçag, D. Cogülu, O. Gençay andB. Salih. 2005. Chemical composition and antimicrobial activitiesof four different Anatolian propolis samples. Microbiol. Res. 160:189�195.Vaidyanathan R., S. Gopalram, K. Kalishwaralal, V. Deepak,S.R. Pandian and S. Gurunathan. 2010. Enhanced silvernanoparticle synthesis by optimization of nitrate reductase activity.Colooids Sur. B Biointerfaces 75: 335�341.Valodkar M., A. Bhadoria, J. Pohnerkar, M. Mohan andS. Thakore. 2010. Morphology and antibacterial activity of carbo-hydrate-stabilized silver nanoparticles. Carbohydr. Res. 345:1767�1773.Veigas B., D. Machado, J. Perdigao, I. Portugal, I. Couto,M. Viveiros and P.V. Baptista. 2010. Au-nanoprobes for detec-tion of SNPs associated with antibiotic resistance in Mycobacte-rium tuberculosis. Nanotechnology 21: 415101.

Vijaya K., S. Ananthan and R. Nalini. 1995. Antibacterial effectof teaflavin, polyphenon 60 (Camellia sinensis) and Euphorbiahirta on Shigella spp. � a cell culture study. J. Ethnopharmacol.49: 115�118.Wainwright M. 2008. Dyes in the development of drugs andpharmaceuticals. Dyes Pigments 76: 582�589.Wainwright M. 2010. �Safe� photoantimicrobials for skin andsoft-tissue infections. Int. J. Antimicrob. Agents 36: 14�18.Walencka E., S. Ró¿alska, S. Wysokiñska, M. Ró¿alski,L. Ku�ma and B. Ró¿alska. 2007. Salvipisone and aethiopinonefrom Salvia sclarea hairy roots modulate staphylococcal anti-biotics resistance and express anti-biofilm activity. Planta Med.73: 545�551.Wang X., L.H. Liu, O. Ramström and M. Yan. 2009. Engineer-ing nanomaterial surfaces for biomedical applications. Exp. Biol.Med. 234: 1128�1139.Wangoo N., K.K. Bhasin, R. Boro and C.R. Suri. 2008. Facilesynthesis and functionalization of water-soluble gold nanoparticlesfor bioprobe. Anal. Chim. Acta 610: 142�148.Wansi J.D., D.D. Chiozem, A.T. Tcho, F.A. Toze, K.P. Devkota,B.L. Ndjakou, J. Wandji and N. Sewland. 2010. Antimicrobialand antioxidant effects of phenolic constituents from Klainedoxagaboniensis. Pharm. Biol. 48: 1124�1129.Wolska K.I., A.M. Grudniak, B. Fiecek, A. Kraczkiewicz-Dowjat and A. Kurek. 2010 a. Antibacterial activity of oleanolicand ursolic acids and their derivatives. Centr. Eur. J. Biol. 5:543�553.Wolska K.I., A.M. Grudniak, A. Kraczkiewicz-Dowjat andA. Kurek. 2010 b. Various functions of selected bacterial pig-ments (in Polish). Post. Mikrobiol. 40: 105�114.Wood S., D. Metcalf, D. Devine and R. Robinson. 2006. Erythro-sine is a potential photosensitizer for the photodynamic therapyof oral plaque biofilms. J. Antimicrob. Chemother. 57: 680�684.Wright G.D. 2010. Antibiotic resistance in the environment:a link to the clinic? Curr. Opin. Microbiol. 13: 589�594.Yoon K-Y, J.H. Byeon, J.-H. Park and J. Hwang. 2007. Sus-ceptibility constants of Escherichia coli and Bacillus subtilis tosilver and copper nanoparticles. Sci. Tot. Environm. 373: 572�575.Zharov V.P., E.I. Galanzha and W. Tuchin. 2007. Photothermalflow cytometry in vitro for detection and imaging of individualmoving cells. Cytometry A 71: 191�206.Zharov V.P., K.E. Mercer, E.N. Galitovskaya and M.S. Smeltzer.2006. Photothermal nanotherapeutics for selective killing of bac-teria targeted with gold nanoparticles. Biophys. J. 90: 619�627.Zhang Y., F. Bao, J. Hu, S. Liang, Y. Zhang, G. Du, C. Zhangand Y. Chen. 2007. Antibacterial ligands and triterpenoids fromRostellularia procumbens. Planta Med. 73: 1596�1599.


ORIGINAL PAPER

* Corresponding author: Yong-Zhi Lun; e-mail: [email protected]

Introduction

Hepatitis C virus (HCV) was first described in1989 as the putative viral agent of non-A non-B hepa-titis. An estimated 170 million people are infectedwith HCV worldwide (Armstrong, 2003; Stoll-Kelleret al., 2009). HCV is a member of the Flaviviridaefamily and has been recognized as the major caus-ative agent of chronic liver disease, including chronicactive hepatitis, cirrhosis and hepatocellular carci-noma (Di Bisceglie, 2000). It has recently been sug-gested that HCV core protein suppresses the antiviralcytotoxic T-lymphocyte response by interacting withthe C1q complement receptor, thereby playing a keyrole in the induction and maintenance of chronic HCVinfection and liver damage (Kittlesen et al., 2000;Large et al., 1999). The presence of serum HCV coreprotein is associated with active HCV viremia, and itsdetection is now used for clinical evaluations(Dickson et al., 1999; Tanaka et al., 2000). In addi-tion, HCV core protein is highly conserved among the

various HCV genotypes (Houghton et al., 1991) andelicits a rapid Antibody response after the onset ofthe disease. Thus, antibody responses to HCV coreprotein may be considered to confer protection againstHCV infection regardless of viral subtypes. Themonoclonal antibodies (McAb) of HCV core proteincould passively conduce to prevent HCV infection.However, the production periodicity of McAb madeby hybridoma technique is relatively long. In addition,clinical testing has shown that murine monoclonalantibodies may evoke human anti-mouse antibodyresponse. Phage display technology offers a means ofcloning human anti-HCV antibodies coding gene ofa defined specificity that may have potential thera-peutic use (Canaan-Haden et al., 1995). We nowutilize a semi-synthetic human single-chain Fv anti-body library and solid-phase bound hepatitis C viruscore protein to screen out the phage display antibodythat recognizes the HCV core protein (Zhong et al.,2001), using HCV core protein as the immobilizedantigen and proceeding immunohistochemistry.

Cloning, Expression and Identification by Immunohistochemistryof Humanized Single-Chain Variable Fragment Antibody

against Hepatitis C Virus Core Protein

YONG-ZHI LUN1, 2, *, JUN CHENG2, YAN-WEI ZHONG2, ZENG-GUO YU1, QI WANG2,FANG WANG and JIE FENG1

1 Liaoning Provincial University Key Laboratory of Biophysics, Medical CollegeDalian University, Dalian 116622, China

2 Institute of Infectious Diseases, Beijing Ditan Hospital, Beijing 100015, China

Received 29 April 2010, revised 17 December 2010, accepted 14 January 2011

A b s t r a c t

Expression of single-chain variable fragment (scFv) antibodies on the surface of bacteriophage is widely used to prepare antibodies withpre-defined specificities. A phage antibody library containing the gene for scFv antibody against Hepatitis C virus core protein was pannedwith core protein immobilized on microtiter plate wells. After five rounds of panning 60 phage clones specific to core protein wereobtained and one selected clone was sequenced. It was found that the specifically detected antigen consists of 774bp and is capable ofencoding 257 amino acids in the patients but not in healthy persons.

K e y w o r d s: Hepatitis C virus; core protein; phage display; single-chain variable fragment antibody

Abbreviations: HRP, horseradish peroxidase; HCV, Hepatitis C virus; HCV core protein scFv antibody, scFv antibody against HCVcore protein; MAb, monoclonal antibody; scFv, single-chain variable fragment.

14 Lun Y.-Z. et al. 1

Experimental

Materials and Methods

Materials. A recombinant HCV core protein fromVirostat (USA) was employed. A human scFv antibodyphage library in which the genes encoding VL andVH were amplified by PCR with degenerate primersand connected with a glycine linker [(Gly4Ser)3], waspurchased from Novagen (USA). M13K07 phage wasemployed as helper (Pharmacia).

Phagemids rescue. To rescue phagemids from thelibrary, 5 ml of 2×TY broth containing 100 mg/mlampicillin and 1% glucose (2×TY-AMP-GLU) wasinoculated with 10 µl of Escherichia coli TG1 takenfrom the library stock and grown for 3 hrs at 37°C.The bacteria were spun down, resuspended in 50 mlof 2×TY broth containing 100 mg/ml ampicillin(2×TY-AMP), and shaken until A600 reached 0.5.The bacteria were inoculated with M13K07 phage(1×1010 PFU) and incubated for 30 mins at 37°C with-out shaking. After pelleting the cells were resuspendedin 200 ml of 2×TY broth containing 100 mg/ml ampi-cillin and 25 mg/ml kanamycin (2×TY-AMP-KAN),and shaken for 12 hrs at 37°C. Phage particles werepurified and concentrated using polyethylene glycoland resuspended in 2 ml of distilled water.

Screening of HCV core protein scFv antibodyclones. Delta surface plates (Nalge Nunclon Inter-national, Denmark) were coated with 1 ml of HCVcore protein (80 µg/ml) per well in a coating buffer(50 mmol/l carbonate/bicarbonate pH 9.6) overnightat 4°C. After washing with Tris-borate-saline (TBS),the plates were incubated in 2% BSA in PBS for 2 hrsat 37°C (blocking). The washing was repeated and thepurified phage in 2% BSA (1 ml) was added. Theplates were rotated gently for 10 mins, left undis-turbed for 90 mins at 37°C, and washed 20 times withPBS with 0.1% Tween 20 and 20 times with PBS. Thebound phage particles were eluted from the plateswith 1 ml of 100 mmol/l triethylamine per plate. Thephage-containing elutate was immediately neutralizedwith 0.5 ml of 1.0 mol/l Tris-HCl pH 7.4 and stored at4°C. The phage was used to infect 10 ml of log-phaseE. coli TG1 plated on TYE-AMP-GLU plates andgrown overnight at 37°C. The colonies were pickedup into 2 ml of TYE-AMP-GLU per colony with 30%(v/v) glycerol and stored at �20°C. The panning (am-plification-adsorption-elution) was repeated 5 times,and 30 phage clones were picked up randomly fromwell-isolated colonies on the top-agar plates. Eachclone was grown in 400 µl of 2×TY-AMP-GLU at37°C overnight. Aliquots (20 µl) of each clone weretransferred to 400 µl of 2×TY-AMP and further cultu-red until A600 reached 0.5. After adding a helper phage

the cultures were incubated at 30°C overnight. To col-lect samples for ELISA the supernatants after centrifu-gation at 12,000 r.p.m. for 1 min at 4°C were saved.

Identification of phage clones. Wells of 96-well-plates were coated overnight with 8 µg HCV coreprotein in 100 µl of coating buffer per well. Afterblocking for 2 hrs at 37°C 50 µl aliquots of culturesupernatants and 50 µl of 2% BSA were added perwell for 1 hr at 37°C. After washing with 0.05%Tween 20 in PBS a 1/5000 dilution of horseradish per-oxidase (HRP)-labeled anti-M13 secondary antibodywas added for 1 hr at 37°C. The plates were washedwith 0.05% Tween 20-PBS and a tetramethylbenzidinesolution was added for 10 mins at 37°C. The reactionwas stopped with H2SO4 and A450 was read.

ELISA. Wells of 96-well-plates were coated over-night with 8 µg HCV core protein per well in the coat-ing buffer. After blocking 100 µl aliquots of diluted(1:50) culture supernatants were added per well for1 hr at 37°C. The plates were washed and loaded withthe secondary antibody as described above. M13K07phage served as negative control.

DNA sequencing. Plasmid DNA was preparedfrom the culture of a selected positive clone usingWizard Plus Minipreps DNA Purification System(Promega) and sequenced in an ABI3700 automatedDNA sequencer (Perkin Elmer).

Expression of soluble HCV core protein scFvantibody in E. coli. To express the scFv antibodyin soluble E-tagged form the selected clone wassubcloned into the pCANTAB5E expression vector.Restriction digestion and subsequent 1% agarose gelelectrophoresis confirmed the identity of the recom-binant pCANTAB5E-scFv vector. Competent E. coliXL1-Blue was transformed with pCANTAB5E-scFvand induced with IPTG for 20 hrs. The culture wascentrifuged at 10,000 r.p.m. and the supernatant wassubjected to SDS-PAGE and Western blot analysis.

Western blot analysis. The culture supernatantwas diluted 1:1 with 2×SDS loading buffer, heatedat 100oC for 10 mins, briefly centrifuged again, and20 µl of the supernatant was used for SDS-PAGE.After the run the gel was blotted onto a PVDF mem-brane (Millipore). The blot was blocked with 5%non-fat dry milk for 2 hrs, incubated with an anti-E-tag MAb for 1.5 hr and with a secondary HRP-goatanti-mouse IgG antibody for another 1 hr, and stainedwith DAB and hydrogen peroxide.

Immunohistochemistry. Paraffin-embedded livertissue slices from patients with positive anti-HCVantibodies and HCV-RNA. were examined. After de-activating endogenous hyperoxidase the slices weresubmersed in a methanol solution (should be defined)with 0.5% hydrogen peroxide at room temperature for50 mins, washed with PBS 3 times, and kept in 5%

15ScFv antibody against HCV core protein1

BSA overnight at 4°C. Then the slices were incubatedwith the scFv antibody diluted 1:100 for 1 hr at 37°Cand overnight at 4°C. A sheep HRP-anti-M13 anti-body diluted 1:200 was dropped on tissue prepara-tions and left to react for 40 min at 37°C. The prepa-rations were washed 3 times with PBS, a few drops ofa DAB solution (9 mg DAB, 13.5 ml 0.01 M Tris-HCl(pH7.6), 1.5 ml 0.3 % CoCl2, and 15 ml 30% hydrogenperoxide) were added. After 10 min at room tempera-ture the preparations were washed with PBS 3 timesand 1% haematin was used to stain the cell nucleus.After a standard dehydratation procedure the prepara-tions were observed under microscope. Negative con-trols consisted of PBS instead of the scFv antibodyand liver tissue preparations from healthy persons.

Results

Identification of HCV core protein scFv-positiveclones. After five rounds of panning (amplification-absorption-elution) 60 clones were picked up andtested for HCV core protein scFv antibody by ELISA.

Twenty of these were found positive. Six of theseshowed a low cross-reaction with BSA (Fig. 1). Onepositive clone with the highest reaction with HCV coreprotein and the lowest reaction one with BSA was cho-sen for a confirmatory test with restriction digestion.The digestion with NcoI and NotI and subsequent gelelectrophoresis proved the presence of a 774 bp insertcorresponding to the scFv antibody gene (Fig. 2).

Fig. 2. Restriction map of plasmid DNA carrying HCV coreprotein scFv gene prepared from a single positive clone

by NcoI/NotI digestion.a, b: DNA fragment with HCV core protein scFv gene;

M: DNA Marker DL2000 (Takara Co., Japan)

Fig. 1. Identification of positive clones. The binding activitiesof the phage antibodies from six clones infected by bound phage

particles to coated 8 µg HCV core protein and 20 µg bovineserum albumin.

a-f: positive clones� culture supernatant with scFv antibody againstHCV core protein; g: helper M13K07 instead of phage antibodies, used

as negative.

Fig. 3. Western blot analysis of the supernate protein derivedfrom induced and non-induced E. coli XL1-Blue transformed

by expression vector.Supernate protein from non-induced E. coli XL1-Blue transformed withpCANTAB5E-HCV core protein-scFv (lane a) and supernate proteinfrom induced E. coli XL1-Blue transformed with pCANTAB5E-HCV

core protein-scFv (lane b).

H chain GFTFSSY- AISGSGGST- TRTKRF EVQLVESGGGLV- WVRQAPGKGL- RFTISRDNSKNTL- WGQGALVTVSRAMS YYADSVKG RPGGSLRLSCAAS EWVS YLQMNSLRAEDT

-AVYYCAR

L chain CQGDSL- GKNNRPS NSPDSSG- SELTQDPAVS- WYQQKPGQAP- GIPDRFSGSSSGN- FGGGTKLTVLGRSYYAS NHVV VALGQTVRIT VLVIY TASLTITGAQAED-

EADYYC

Table IThe complementarity-determining regions (CDRs) and framework regions (FRs) of deduced amino acids sequence

of ScFv against HCV core protein

CDR1 CDR2 CDR3 FR1 FR2 FR3 FR4


Sequencing of HCV core protein ScFv gene. Thenucleotide sequence of the selected clone was deter-mined and submitted to GenBank (Acc. No AF271150).The corresponding amino acid sequence was deducedand complementarity-determining regions and frame-work regions were located according to the Kabatdatabase (Table I).

Expression of HCV core protein scFv in E. coli.The HCV core protein scFv antibody was expressedin E. coli and confirmed by Western blot analysis(Fig. 3). A negative control consisting of E. coli in-fected with empty vector did not show any specificprotein. These results indicated that the soluble formof human HCV core protein scFv antibody was suc-cessfully expressed in this system.

Immunostaining of HCV core protein of livertissue sections. Immunostaining of sections of livertissues from and 17 patients with chronic hepatitis Cand healthy persons gave positive results in the for-mer but not latter group (Fig. 4). HCV core pro-tein was mainly located in the cytomembrane of thehepatocytes.

Discussion

The mature HCV protein is located in the cyto-plasm of infected cells, in close vicinity to the peri-nuclear membranes and the endoplasmic reticulum,where it polymerizes in the presence of genomic RNAto form viral capsids (Reed and Rice, 2000). TheHCV core protein is highly antigenic, induces spe-cific cellular and humoral responses, and probablyplays a pivotal role in the pathogenesis of HCV infec-tion (Lai and Ware, 2000; Nelson et al., 1997). Theavailability of an anti-HCV core protein humanizedscFv antibody allowed the development of an ELISAto detect HCV core antigen in peripheral blood ofpatients with HCV (Aoyagi et al., 1999). The majorneutralizing epitope of HCV core protein lies withinthe first 45 aa of the protein, the major antigenicsegment of core recognized both by murine andhuman antibodies. Noticeable, the recognized epitope(29�37: QIVGGVYLL) has an unusual preponderanceof hydrophobic residues, some of which are buried ina small hydrophobic core in the nuclear magneticresonance structure of the peptide in solution, suggest-ing that the antibody may induce a structural rearrange-ment upon recognition (Menez et al., 2003).

Phage libraries are a powerful tool for the selectionof antibodies of important and useful specificities,particularly for humanized scFv antibodies (Markset al., 1991; Hoogenboom et al., 1998; Lamarre andTalbot, 1997; Rondon and Marasco, 1997). It hasmany advantages. First, it is the only method to getspecific antibody by passing the immunization step.It can mimic the maturation process of human anti-body in vivo, so that it is possible to obtain a highaffinity antibody from this selection. Second, a scFvantibody consisting of antigen-binding domains ofheavy and light chain regions of immunoglobin con-nected by a flexible peptide linker is a small-size mol-ecule compared with the full-length antibody. If anantibody library of human origin is used, the selectedantibody is most suitable to human administration andis potentially applicable to clinical diagnosis andtreatment of both infectious disease and cancer.Finally, as it contains no Fc fragment, its backgroundin immunohistological study is very low. In contrast,a MAb against the recombinant HCV core proteinprepared from hybridomas is of murine origin andhence immunogenic if used systemically in humans(Songsivilai et al., 1996). In order to overcome thedisadvantages of an intact MAb applied in vivo andto offer an antibody with a stable genetic source,soluble scFv antibodies are currently generated byadvanced recombinant phage antibody technique,which may provide novel targeting vehicle for diag-nosis and treatment of diseases.

Fig. 4. Immunostaining of HCV core protein of differentsections from liver tissues of healthy persons and patients with

chronic hepatitis C, self-made anti-HCV core protein singlechain antibodies used as primary antibody.

A: Immunohistochemistry of HCV core protein of liver tissue fromhealth person; B: Immunohistochemistry of HCV core protein of livertissue from patients with chronic hepatitis C, core protein was detected

in the cytoplasm of some liver cells (arrowhead pointing).

A

B

17ScFv antibody against HCV core protein1

In this study, we succeeded in cloning the HCVcore protein scFv gene by means of the phage displaylibrary technique. The cloned gene was sequencedand expressed in E. coli. These results illustrate thefeasibility of using the antibody-engineering techno-logy that may prove useful in the future for diagnos-tics and therapy of hepatitis C infection.

Literature

Aoyagi K., C. Ohue and K. Iida. 1999. Development of a simpleand highly sensitive enzyme immunoassay for hepatitis C viruscore antigen. J. Clin. Microbiol. 37: 1802�1808.Armstrong G.L. 2003. Commentary: modeling the epidemio-logy of hepatitis C and its complications. Int. J. Epidemiol. 32:725�726.Canaan-Haden L., M. Ayala and M.E. Fernandez-de-Cossio.1995. Purification and application of a single-chain Fv antibodyfragment specific to hepatitis B virus surface antigen. Biotechniques19: 606�612.Di Bisceglie A.M. 2000. Natural history of hepatitis C: its impacton clinical management. Hepatology 31: 1014�1018.Dickson R.C., M. Mizokami and E. Orito. 1999. Quantificationof serum HCV core antigen by a fluorescent enzyme immuno-assay in liver transplant recipients with recurrent hepatitis C:clinical and virologic implications. Transplantation. 68: 1512.Hoogenboom H.R., A.P. de Bruine and S.E. Hufton. 1998.Anti-body phage display technology and its applications. Immuno-technology 4: 1�20.Houghton M., A. Weiner and J. Han. 1991. Molecular biologyof the hepatitis C virus: implications for diagnosis, development,and control of viral disease. Hepatology 14: 381.Kittlesen D.J., K.A. Chianese-Bullock and Z.Q. Yao. 2000.Interaction between complement receptor gC1qR and hepatitis Cvirus core protein inhibits T-lymphocyte proliferation. J. Clin.Investig. 106: 1239�1249.

Hagedorn C.H. and C.M. Rice. 2000. The hepatitis C viruses.Springer-Verlag KG Berlin, Germany.Lamarre A. and P.J. Talbot. 1997. Characterization of phage-displayed recombinant anti-idiotypic antibody fragments againstcoronavirus neutralizing monoclonal antibodies. Viral. Immunol.10: 175�182.Large M.K., D.J. Kittlesen and Y.S. Hahn. 1999. Suppressionof host immune response by the core protein of hepatitis C virus:possible implications for hepatitis C virus persistence. J. Immunol.162: 931�938.Marks J.D., H.R. Hoogenboom and T.P. Bonnert. 1991. By-immunization human antibodies from V-gene libraries displayedon phage. J. Mol. Biol. 222: 581�597.Menez R., M. Bossus and B.H. Muller. 2003. Crystal structureof a hydrophobic immunodominant antigenic site on hepatitis Cvirus core protein complexed to monoclonal antibody 19D9D6.J. Immunol. 170: 1917�1924.Nelson D.R., C.G. Marousis and G.L. Davis. 1997. The role ofhepatitis C virus-specific cytotoxic lymphocytes in chronic hepa-titis C. J. Immunol. 158: 1473�1481.Reed K.E. and C.M. Rice. 2000. Overview of hepatitis C virusgenome stucture, polyprotein processing, and protein properties.Curr. Top. Microbiol. Immunol. 242: 55�84.Rondon U. and W.A. Marasco. 1997. Intracellular antibodies(intrabodies) for gene therapy of infectious disease. Annu. Rev.Microbiol. 51: 257�283.Songsivilai S., T. Dharakul and R. Kunkitti. 1996. Molecularcloning and expression of hepatitis C virus core protein and pro-duction of monoclonal antibodies to the recombinant protein.Asian Pac J Allergy Immunol. 14: 31�41.Stoll-Keller F., H. Barth and S. Fafi-Kremer. 2009. Deve-lopment of hepatitis C virus vaccines: challenges and progress.Expert Rev. Vaccines 8: 333�345.Tanaka E., C. Ohue and K. Aoyagi. 2000. Evaluation of a newenzyme immunoassay for hepatitis C virus (HCV) ore antigenwith clinical sensitivity approximating that of genomic amplifi-cation of HCV RNA. Hepatology 32: 388.Zhong Y., J. Cheng and S. Shi. 2001. Screening and character-ization of human phage antibody to hepatitis C core antigen (inChinese). Zhonghua Gan Zang Bing Za Zhi 9: 217�219.


ORIGINAL PAPER

* Corresponding author: J. Miêdzobrodzki, Dept. of Microbiol., Faculty of Biochem., Biophys. and Biotechnol., JagiellonianUniversity, Gronostajowa Str. 7, 30-387 Kraków, Poland; phone: +48-12-664-6371; fax: +48-12-664-6902;e-mail: [email protected]

Introduction

Staphylococcus species are considered to be oneof the most widespread bacteria found in nature. Bac-teria that constitute this genus, colonize a number ofdomestic animals, including dogs and cats. Usuallythey belong to the normal skin flora of these animalscommonly present on skin and mucosal membranes(Stepanovic et al., 2001; Hauschild and Wojcik, 2007).In 1976 Hajek described a new staphylococcal coagu-lase-positive species Staphylococcus intermediuswhich colonized predominantly the skin and themucosal membrane of the nasal vestibule in dogs(Hajek, 1976). Later studies revealed that S. inter-medius was the most frequent species isolated from

healthy dogs. It comprised 40.3% of all isolated strainsand was identified as a resident of the physiologicalbacterial flora of healthy dogs (Cox et al., 1988; Król,1998). Devriese and DePelsmaecker proved in theirresearch that S. intermedius strains were predominantlyisolated from nostrils and the rectum region of healthydogs (Devriese and DePelsmaecker, 1987). These twoecological niches were proposed to be the source forcolonization of other areas in healthy dogs by S. inter-medius strains (Nagase et al., 2002). Usually occurringin healthy individuals, under favorable conditionsS. intermedius can cause a variety of infections in dogsand cats (Biberstein et al., 1984, Kim et al., 2005).

Dermatitis or inflammation of the skin is caused bythe diverseness of allergens, irritation and infectious

The Occurrence and Comparative Phenotypic Characteristicsof Staphylococcus spp. from Healthy and Diseased, Household and Shelter Dogs,

Based on Routine Biochemical Diagnostic Methods

ANDRZEJ KASPROWICZ1, ANNA BIA£ECKA1, JOANNA BIA£ECKA1, IZABELA GODZISZ2,WIES£AW BARABASZ2, OLGA JAWORSKA3, NATALIA MA£ACHOWA4, 5 and JACEK MIÊDZOBRODZKI4*

1 Centre for Microbiological Research and Autovaccines Ltd., Kraków, Poland2 Department of Microbiology, Agricultural University of Kraków, Kraków, Poland

3 Rescue Animal Shelter, Kraków Society for Animal Care, and �Alvet� Veterinary Clinic, Kraków, Poland4 Department of Microbiology, Faculty of Biochemistry, Biophysics and Biotechnology

Jagiellonian University, Kraków, Poland5 Laboratory of Human Bacterial Pathogenesis, National Institute of Health, Hamilton, MT, USA

Received 9 September 2010, revised 30 November 2010, accepted 6 December 2010

A b s t r a c t

To determine the staphylococcal colonization pattern in healthy and diseased dogs, living in two particular environments, a number ofmicrobiological samples were taken. Overall, twenty dogs, either healthy or with infected skin lesions, were examined. In each casebacterial swabs were collected from the nasal mucosa, ear, perineum, lumbo-sacralis triangle, and from the infection sites if such werepresent. A total number of 104 isolates representing different staphylococcal species were isolated and identified using routine biochemi-cal methods applied in diagnostic laboratories. Among 17 isolated staphylococcal species, Staphylococcus intermedius was the mostcommon species isolated from both healthy or diseased dogs living either in animal shelter or household environments. The pattern ofStaphylococcus sp. colonization differs considerably for animals living in the two tested habitats. In particular, S. aureus MRSA andMSSA isolates were detected only in infected skin lesion samples from animals that dwelled in the animal shelter. As could be expected,S. intermedius was found to be a predominant causative agent in canine skin infections. In our study, we demonstrated that S. intermediusin its carrier-state, inhabits mainly the mucosal membrane of the nasal vestibule. It was also found in the samples taken from the skin, thelumbo-sacralis triangle and perineum, but was rarely isolated from the ears.

K e y w o r d s: Staphylococcus spp. from dogs, diagnostic, phenotyping, biochemical methods

20 Kasprowicz A. et al. 1

factors, or systematic diseases (Hendricks et al., 2002;Kizerwetter-�wida et al., 2009). Pyoderma is a typeof dermatitis. It occurs fairly often among dogs. Inpyoderma, either flesh or deep skin infections can beobserved. Commonly in both cases, S. intermedius isthe main causative agent. Infective skin lesions usuallyshow up in warm, moist and wrinkled skin regions,where there appear to be propitious conditions forbacterial colonization and progression of pyoderma(Allaker et al., 1993; Guardabassi et al., 2004).

Notwithstanding the growing responsibility andmicrobiological awareness among dog owners and theincreasing interest for the S. intermedius species amongthe veterinary society, this species still has not beenadequately studied. Bearing this in mind, knowledgeof the bacterial flora composition of the dogs skinwould be extremely useful in the epidemiologicalstudy of a variety of a skin infections that occur in dogs.

The main goal of this project was to determine thesimilarity, disparity and potential relationship betweenthe different colonization patterns of the staphylo-coccal species characteristic for healthy and diseaseddogs, living either in a rescue shelter or households.

Commonly the diagnostics of bacterial strains iso-lated from dogs are based on phenotypic methods andthese type of methods were considered in this study(Miêdzobrodzki et al., 2008). Although based onthe fact that some staphylococcal species (S. inter-medius and S. pseudintermedius) can be distinguishedalmost only by genetic methods, the further intro-duction of genetic based techniques in routine veteri-nary diagnostics is essential (Bannoehr et al., 2009;Devriese et al., 2009).

Experimental


Bacterial strain isolation. Bacterial samples iso-lated from 20 healthy and diseased dogs were exam-ined. The examined group of dogs was heterogeneous.It consisted of 20 mongrels, both male and female thatweighed from 5 to 45 kg. Among the 20 dogs, 12 hadskin lesions and the remaining 8 had none. The dogsliving in an animal shelter had been staying there fora few weeks up to 3 years. A similar time range wasfor the dogs living in household environments. Five outof 7 sheltered dogs, and 7 out of 13 household dogsdemonstrated skin lesions. In the 8 remaining dogs,no skin lesions were observed, as shown in Figure 1.

Samples were taken from skin lesions found insick dogs as well as from healthy dogs without skinchanges. The samples were collected by a veterinarian.The material used for research was derived from skinlesions caused by flea allergy dermatitis. These lesions

were caused by hypersensitivity, and may have hadpus complications. The lesions were not only alwaysexuding with pus or serum-pus, but also painful andstrongly pruritic. However, there were no immuno-logical changes, understood as autoaggression, suchas lupus or pemphigus. There were no spontaneousbacterial infections either.

Swabs were taken from each dog from both theleft and right ear, the nasal vestibule, and perineum, aswell as from the back, and in the case of the diseaseddogs, also from the infection site (Fig. 2). All the iso-lated samples/strains were described in the followingmanner: (i) classification of the etiological agent caus-ing from skin infections; (ii) characteristic of the iso-lated bacterial strain by standard phenotypic methods;

Fig. 1. Characeistics of all examined dogs

Fig. 2. Different reservoir sites for staphylococcal strains in dogs

21Staphylococcus spp. isolated from dogs1

(iii) correlation between a particular isolation site anda staphylococcal species. Microbiological samplesisolated from dogs were inoculated onto Columbiablood (supplemented with 5% sheep blood), Baird-Parker and Candida ID agar within 2 hours of isola-tion. After an incubation period of 48 h at 35°C,all colonies were screened and staphylococcal-likecolonies were isolated and plated on tryptic soy agarfor 24 h at 35°C. Pure isolates were then used forfuture experiments. A total number of 104 isolateswas received from 20 examined dogs.

Microscopic analysis. To confirm the purity iden-tification of all the 104 isolates to Gram-positive cocci,Gram staining was performed (Beveridge, 2001).

Biochemical identification. Throughout the bio-chemical analysis, two reference strains S. aureusATCC25933 and S. epidermidis ATCC 12228 weretested alongside the canine isolates. All isolates wereevaluated for catalase activity and furazolidone resis-tance. Bacterial identification was performed bya coagulase tube test (Biomed, Poland). Detection ofthe clumping factor with rabbit plasma was performedby PASTOREXTM STAPH-PLUS test (BIO-RAD).In order to confirm identification of staphylococcalspecies, ID32 STAPH (BioMerieux, Poland) analysiswas done (Sasaki et al., 2007a; Weese et al., 2009).

Results

A total of 104 staphylococcal strains were isolatedfrom healthy and diseased dogs living in either ani-mal shelter or households. All strains demonstratedtypical colony growth on blood and Baird-Parkerselective agar. Coagulase-positive staphylococci pro-duced black, shiny, convex colonies with entire mar-gins and clear zones with or without an opaque zonearound the colonies.

Phenotypic characteristics of isolated strains.The free coagulase tube test revealed a positive reac-tion in 61 strains (59%), whereas no coagulation wasobserved in the remaining 43 (41%) strains. Althoughthe production of the clumping factor was detected in44 (42%) strains, 57 (55%) did not produce this factor,and for 3 (3%) strains the results were uncertain. ThePASTOREXTM STAPH-PLUS test showed that only39 among all strains (37.5%) have the ability toautoagglutinate. In terms of the ID32 STAPH method,104 strains were identifiable, Table I. S. intermedius(46 strains) and S. aureus (11 strains) were the onlytwo coagulase-positive staphylococcal species isolatedamong all the tested canine strains. The remainingstrains belong to the coagulase-negative group.

Domicile and Staphylococcus sp. variety. Table Ipresents the rate of occurrence of different staphylo-coccal species in swabs taken from the skin, ears, and

mucosal membrane of the nasal vestibule, from dogsliving in the animal shelter or households. A total of17 different species belonging to the Staphylococcusgenus were found. Animals living in the shelter carried11 different species, whereas 12 species were isolatedfrom dogs living in household conditions. Regardlessof living environments, S. intermedius isolates werethe most common. It accounts for 40% and 47.4% ofall isolated strains, respectively for the animal shelterand household environment. Based on the obtainedresults the difference between staphylococcal profilesand the various environments that they colonize wasnoticeable. Dogs from the animal shelter were carriersfor such staphylococcal species, like S. gallinarum,S. saprophyticus, and S. simulans that were not isolatedfrom any animal living in the household environment.On the other hand, such species as S. warneri, S. ho-minis, and S. chromogenes, were isolated only fromdogs living in the households. A fact worth noticingwas that 11 S. aureus strains (MSSA and MRSA) wereisolated only from samples obtained from the shelter.

Manifestation of particular staphylococcal speciesin samples isolated from the nasal vestibule are shownin Table II. In the group of 11 isolated species themost frequent, despite of habitat, was S. intermedius.Nevertheless, S. intermedius was detected more oftenin samples taken from dogs kept in households thanin the animal shelter, 55.5% and 31.6% respectively.

S. intermedius 18 (40.0 %) 28 (47.4%)

S. aureus (MSSA) 3 (6.7%) 0

S. aureus (MRSA) 8 (17.8%) 0S. warneri 0 4 (6.8%)

S. gallinarum 2 (4.4%) 0

S. hominis 0 3 (5.1%)S. chromogenes 0 5 (8.5%)

S. epidermidis 0 1 (1.7%)

S. haemolyticus 1 (2.2%) 8 (13.5%)S. lentus 3 (6.7%) 1 (1.7%)

S. saprophyticus 1 (2.2%) 0

S. equorum 3 (6.7%) 1 (1.7%)S. xylosus 1 (2.2%) 5 (8.5%)

S. cohni 1 (2.2%) 1 (1.7%)

S. schleiferi 0 1 (1.7%)S. simulans 3 (6.7%) 0

S. lugdunensis 0 1 (1.7%)

S. sciuri 1 (2.2%) 0Total number ofstaphylococcal species

11 12

Table I Distribution of 104 strains of the Staphylococcus species

in all examined dogs

Staphylococcus spp.

Living environment of examined dogstotal number of bacterial strains (%)

7 sheltered dogs-45strains

13 household-59strains


S. aureus strains were isolated mainly from the mucosalmembrane of the nasal vestibule of dogs living in theshelter in the range of 31.6%. Adjacent to coagulase-positive species, coagulase-negative staphylococcalspecies were also present in the biological material.While, S. equorum, S. sciuri or S. cohni were foundonly in dogs from the shelter, S. lugdunensis, S. chro-mogenes, S. xylosus or S. warneri were presented inthe samples taken from the animals living at home.This should be treated as a trend because the numberof examined dogs was relatively low.

S. intermedius was also the most prevalent speciesamong isolates from the perineum region, Table III.Furthermore, it was the only staphylococcal species

shared among household and shelter dogs. The fol-lowing species were detected in swabs taken from theperineum region of the sheltered animals: S. aureus,S. saprophyticus, S. gallinarum, S. equorum, S. simu-lans, and S. lentus. Subsequently, domestic dogs car-ried S. hominis, S. warnerii, S. chromogenes, S. haemo-lyticus, and S. epidermidis in the material from thesame isolation region.

From the lumbo-sacralis triangle region shown inFigure 2, 9 species of Staphylococcus were distin-guished, Table IV. In comparison to the samples takenfrom shelter animals, the dogs living at home werecharacterized by a broad range of staphylococcal spe-cies, 2 and 8 species respectively. As mentionedabove only two species were isolated from the lumbo-sacralis triangle samples from sheltered dogs: S. inter-medius (75%) and S. aureus (25%).

The above data demonstrated that S. intermedius incarrier-state, predominantly colonized nares of testeddogs. Over 50% of all animals, regardless of theirliving environment, sick or healthy carried strains ofthis species in the nasal vestibule. The next preferredregion was the lumbo-sacralis triangle and perineum.S. intermedius, however was isolated more often fromthe sheltered dogs (75%) then from animals living inhouseholds (16.7%), Table IV. In both healthy anddiseased dogs, the patterns of colonization were simi-lar, as it is shown in Figure 3A and Figure 3B.

The etiological factor for skin lesions of canineorigin. The rate of occurrence of different staphylo-coccal species, isolated from 12 dogs with infectionsites are listed in Figure 4. The most common speciesfound in 7 out of 12 examined animals (58.3%) wasS. intermedius. In 5 out of 7 dogs living in householdsit was the only staphylococcal species isolated fromthe skin lesion. Moreover, 7 additional Staphylococ-cus spp. were isolated, including: methicillin-resistant

S. intermedius 4 (33.3%) 4 (33.3%)S. aureus 2 (16.7%) 0

S. gallinarum 2 (16.7%) 0

S. saprophyticus 1 (8.3%) 0S. equorum 1 (8.3%) 0

S. simulans 1 (8.3%) 0

S. lentus 1 (8.3%) 0S. hominis 0 2 (16.7%)

S. warneri 0 2 (16.7%)

S. chromogenes 0 1 (8.3%)S. haemolyticus 0 2 (16.7%)

S. epidermidis 0 1 (8.3%)

Total number ofstaphylococcal species

7 6

Table IIIStaphylococcal strain distribution in the perineum region

Staphylococcus spp.




S. intermedius 6 (31.6%) 10 (55.5%)S. aureus 6 (31.6%) 0

S. lentus 2 (10.5%) 1 (5.6%)

S. equorum 2 (10.5%) 0S. haemolyticus 1 (5.3%) 2 (11.1%)

S. sciuri 1 (5.3%) 0

S. cohni 1 (5.3%) 0S. lugdunensis 0 1 (5.6%)

S. chromogenes 0 1 (5.6%)

S. xylosus 0 1 (5.6%)S. warneri 0 2 (11.1%)


7 7

Table II Staphylococcal strain distribution in the nasal mucosa

Staphylococcus spp.




S. intermedius 6 (75.0%) 2 (16.7%)

S. aureus 2 (25.0%) 0S. xylosus 0 3 (25.0%)

S. haemolyticus 0 2 (16.7%)

S. cohni 0 1 (8.3%)S. schleiferi 0 1 (8.3%)

S. hominis 0 1 (8.3%)

S. equorum 0 1 (8.3%)S. chromogenes 0 1 (8.3%)


2 8

Table IVStaphylococcal strain distribution in the lumbo-sacralis

triangle region

Staphylococcus spp.





S. aureus (MRSA), S. haemolyticus, S. chromogenes,S. simulans, S. equorum, S. xylosus, and S. cohni whichappeared to be single cases. Staphylococcal speciesdistribution in diseased dogs was also analyzed basedon habitat, Figure 4. Among the 8 species mentioned

earlier, 6 originated from animals living in the shelterand three from dogs living at home. Evidently, S. inter-medius was the dominant species in each habitat, nev-ertheless it was isolated more repeatedly from animalsliving in households (71.4% of all animals). A greatervariety of staphylococcal species were found in skinlesion samples taken from animals living in the shelter,where S. intermedius occurred in 40% of these animals.Among these species S. aureus (MRSA), S. simulans,S. equorum, S. xylosus, and S. cohni were identified. Inskin infections of dogs living in household conditions,beside S. intermedius strains, only S. haemolyticus,S. chromogenes were found in skin infections.

Discussion

Normal animal skin is colonized by numerous bac-terial species, which contribute to the physiologicalskin flora. Staphylococcus species are not out num-bered among this flora. The most typical staphylococ-cal species isolated from canine skins are S. interme-dius, S. xylosus, S. sciuri, S. capitis, S. chromogenesand S. lentus, by Nagase et al. (Nagase et al., 2002).At the same time other studies show a slightly differentprofile of isolated strains from dog skin at carrier-state: S. intermedius, S. aureus, S. simulans, S. heamo-lyticus, and S. saprophyticus (Hauschild and Wójcik,2007). So far not many studies have been done to de-termine the staphylococcal colonization pattern basedon a specific part of the body or living habitat condi-tions of the animals from which swabs were taken.

In the recent study we took an effort to characterizethe contribution of the different staphylococcal spe-cies in the colonization of dogs living in two differentenvironments: the animal shelter and households. Ourdata confirm the general trend that S. intermediusstrains are isolated at a higher rate from dogs thatinhabit households, whereas S. aureus is isolated fromdogs living at the shelter. These differences could beexplained by distinctness in animal exposition to other

Body site

Fig. 3B. Distribuion of S. intermedius in the carrier-stateat different body sites in healthy and diseased dogs

Fig. 3A. Distribuion of S. intermedius in the carrier-stateat different body sites in sheltered and household dogs

Body site

Fig. 4. Distribution of Staphylococcus species found in infected skin lisions of 12 examined dogs


animals and people (Talan et al., 1989; Król, 1998).S. aureus strains isolated during our research, seemto be an excellent example. The animals from theshelter living in small closed areas and are in constantcontact with other animals and moreover with thepersonnel, who are one of the main carriers ofS. aureus (Kloos and Musselwhite, 1975). Humansare colonized by MSSA or MRSA by a carriage rateof 20�40% (Shopsin et al., 2000). These numbersgrow even higher in the case of elderly persons orhospital personnel, where they can reach up to 90%(Szewczyk, 2005). Throughout our study, S. aureusstrains were isolated only from dogs living in theanimal shelter and comprise 24.5% of all strains iso-lated in these animals. Among this group we isolatedboth MSSA and MRSA strains.

On the other hand our data confirm, that S. interme-dius is present in carrier-state in dogs. Isolates of thisspecies were the most common, regardless of habitatand dog health conditions. The most favorable placefor bacterial colonization was the mucosal membraneof nostrils. It was a reservoir for nearly 55% of allS. intermedius isolates, followed by the lumbo-sacralistriangle region (almost 30%).

Dermatitis is the most common type of infectiousdisease found in dogs (Ackerman, 1994). Dermatoseshave a variety of etiological factors, where some ofthem are caused by particular bacterial strains. 90%of pyoderma in dogs is caused by S. intermediusstrains infection (Craig, 2003), while S. aureus is oneof the causative agents in skin lesions of non-pyodermal origin (Biberstein et al., 1984). Our datashow that S. intermedius species seem to be the onlyspecies presented in microbiological samples frominfected skin lesions of dogs living in both animalshelter and household environments. It was isolatedfrom almost 60% of all diseased animals. Five out ofseven of these dogs had only S. intermedius strainspresented in the infected skin lesion. In the remainingtwo cases, S. intermedius strains were accompaniedby other coagulase-negative strains.

The achieved data enriches our knowledge of thecolonization of dogs by not only staphylococcal coagu-lase-postive strains like S. aureus or S. intermediusbut also by coagulase-negative strains. The presentedresults are also important for understanding the epi-demiology of infectious animal diseases, in whichbacteria from the staphylococcal genus play a crucialrole. In the last few years, a new Staphylococcus spe-cies � S. pseudintermedius was separated from thegroup previously considered to be S. intermedius spe-cies (Devriese et al., 2005; W³adyka et al., 2008).S. pseudintermedius can be easily misclassified asS. intermedius by routine biochemical methods used instandard diagnostics. Furthermore, it seems that all theisolates classified in our and other projects by routine

biochemical identification tests seem to be S. pseudin-termedius. Therefore, the final microbiological iden-tification must require the use of genetic methods(Sasaki et al., 2007a; Bannoehr et al., 2009).

The number of dogs used in the project was twentywhich was not very high. However they were used toshow whether the similarity in lesions is because ofsame etiological factors in diseased dogs (twelve) andto recognize the staphylococcus species in healthydogs at carrier state (eight). The staphylococcal spe-cies isolated from healthy and diseased dogs werecompared to understand the colonization althoughdisease was not studied. The main question was, do thecarriage or the life conditions (house/shelter) effectthe occurrence of disease?

The less number of dogs taken in the project re-sulted from trouble in selection of animals. There wereoften abrasions or wounds present on the skin. Onlythe dogs with skin lesions were taken for the project.The idea was that the similarity in skin lesions iscaused by staphylococci, the carriage in same areaand the localization of dogs in environment. Thus thework was to be done with high precision. Dogs weretaken from one acute shelter hostel and the skin lesionswere clinically evaluated. All the samples were takenby same veterinary doctor.

Analysis shown in the paper is an introduction onthe general elaboration of carriage phenomenon in dogsliving under different environments (house/shelter)and of isolated strains from skin lesions in part of dogsin the population. Thus showing the relation betweendiseased to healthy dogs and house to shelter conditions.

A total of one hundred four bacterial strains wereisolated from twenty dogs. Higher species heteroge-neity was observed among bacteria in dogs from shel-ter and that this difference did not affect pathology,which is mainly caused by S. intermedius, indepen-dent of the living environment of dogs. So the etio-logical factor can be easily observed among the testeddogs and the number of dogs used were enough togive the phenomenon. Authors were interested nei-ther in the numbers of dogs nor in possessed isolates,but in observation of differences in colonization andetiological factors according to dogs� life environment.

In conclusion, we described the isolation of variousstaphylococcal strains which were constituents of thenormal biocenosis of the skin of dogs. We also reportedstaphylococci as etiological factors of wound infec-tions in household or rescue shelter dogs, healthy ordiseased. Our observations enriched by recent reportsby other authors expand the knowledge to be moreprecise which brings focus to ecological phenomenaand epidemiological pathways. A carriage pheno-menon and transient colonization by such strains indogs and/or their owners facilitate the transmission ofstaphylococci between humans and domestic animals


(Simoons-Smit et al., 2000; Nagase et al., 2002) witha particular share of staphylococci from poultry(Wieliczko et al., 2002). As it is reported the genomicsimilarity of strains isolated in veterinary pathologyis particularly specific (Cuteri et al., 2004, Jakubczaket al., 2007). The dissemination of methicillin-resis-tant S. pseudintermedius in various animals and theconfirmed presence of their resistance genes placesthem as potentially serious pathogens (Ruscher et al.,2009). They have to be precisely analysed by a num-ber of validated and recommended methods (Cuteriet al., 2004; Ma³achowa et al., 2005). Recently ela-borated molecular methods should be introduced torestriction analysis of the chromosomal DNA with thefinal aim of increasing the effectiveness in discrimi-nating closely related strains (Krawczyk et al., 2007;Black et al., 2009). A need of such an investigationis additionally enhanced by single reports on humancolonization by S. intermedius (Talan et al., 1989;Mahoudeau et al., 1997; Kikuchi et al., 2004) as wellas recently reported infections caused by S. pseudin-termedius (Van Hoovels et al., 2006; Sasaki et al.,2007b). Thus the elaboration of new procedures anddiagnostic schemes for both veterinary and humanbacteriology are an emerging challenge.

AcknowledgementsThe authors thank Miss Ma³gorzata Wójcik from the Jagiello-

nian University for helping prepare this manuscript.

Literature

Ackerman L. 1994. Guide to Skin and Haircoat Problems inDogs. Alpine Publications, Loveland CO, pp. 7�19.Allaker R.P., N. Garrett, L. Kent, W.C. Noble and D.H. Lloyd.1993. Characterization of Staphylococcus intermedius isolatesfrom canine pyoderma and from healthy carriers by SDS-Page ofexoproteins, immunoblotting and restriction endonuclease digestanalysis. J. Med. Microbiol. 39: 429�433.Bannoehr J, Franco A, Iurescia M, Battisti A, Fitzgerald JR.2009. Molecular diagnostic identification of Staphylococcuspseudintermedius. J. Clin. Microbiol. 47: 469�71.Beveridge T.J. 2001. Use of the gram stain in microbiology.Biotech. Histochem. 76: 111�118.Biberstein E.L., S.S. Jang and D.C. Hirsh. 1984. Species distri-bution of coagulase-positive staphylococci in animals. J. Clin.Microbiol. 19: 610�615.Black C.C., S.M. Solyman, L.C. Eberlein, D.A. Bemis,A.M. Woron and S.A. Kania. 2009. Identification of predomi-nant multilocus type, pulsed-field gel electrophoresis cluster, andnovel staphylococcal chromosomal cassette in clinical isolates ofmecA-containing, methicillin-resistant Staphylococcus pseudin-termedius. Vet. Microbiol. 139: 333�338.Cox H.U., J.D. Hoskins, S.S. Newman, C.S. Foi, G.H. Turnwaldand A.F. Roy. 1988. Temporal study of staphylococcal specieson healthy dogs. Am. J. Vet. Res. 49: 747�751.Craig M. 2003. Diagnosis and Management of Pyoderma in theDog. In Practice 25: 418�425.

Cuteri V., M.L. Marenzoni, R. Mazzolla, N. Tosti, L. Merletti,S. Arcioni and C. Valente. 2004. Staphylococcus aureus: studyof genomic similirity of strains isolated in veterinary pathologyusing amplified fragment length polymorphism (AFLP). Comp.Immunol. Microbiol. Infect. Dis. 27: 247�253.Devriese L.A. and K. DePelsmaecker. 1987. The anal region asa main carrier site of Staphylococcus intermedius and Streptococ-cus canis in dogs. Vet. Rec. 121: 302�303.Devriese L.A., K. Hermans, M. Baele and F. Haesebrouck.2009. Staphylococcus pseudintermedius versus Staphylococcusintermedius. Vet. Microbiol. 133: 206�207.Devriese L.A., M. Vancanney, M. Baele, M. Vaneechoutte,E. De Graef, C. Snauwaert, I. Cleenwerck, P. Dawyndt,J. Swings, A. Decostere and F. Haesebrouck. 2005. Staphylo-coccus pseudintermedius sp. Nov., a coagulase-positive speciesfrom animals. Int. J. Syst. Evol. Microbiol. 55: 1569�1573.Guardabassi L., M.E. Loeber and A. Jacobson. 2004. Trans-mission of multiple antimicrobial-resistant Staphylococcus inter-medius between dogs affected by deep pyoderma and their owners.Vet. Microbiol. 98: 23�27.Hajek V. 1976. Staphylococcus intermedius, a new species iso-lated from animals. Int. J. Syst. Bacteriol. 26: 401�408.Hauschild T. and A. Wójcik. 2007. Species distribution andproperties of staphylococci from canine dermatitis. Res. Vet. Sci.82: 1�6.Hendricks A., H.J. Schuberth, K. Schueler and D. Lloyd. 2002.Frequency of superantigen-producing Staphylococcus intermediusisolates from canine pyoderma and proliferation-inducing potentialof superantigens in dogs. Res. Vet. Sci. 73: 273�7.Jakubczak A., P. Szweda, K. £ukaszewska and J. Kur. 2007.Molecular typing of Staphylococcus aureus isolated from cowswith mastitis in the east of Poland on the basis of polymorphism ofgenes coding protein A and coagulase. Pol. J. Vet. Sci.10: 199�205.Kikuchi K., T. Karasawa, C. Piao, I. Itoda, H. Hidai,H. Yamaura, K. Totsuka, T. Morikawa and M.Takayama.2004. Molecular confirmation of transmission route of Staphylo-coccus intermedius in mastoid cavity infection from dog saliva.J. Infect. Chemother. 10: 46�48.Kim T.J., Y.R. Na and J.I. Lee. 2005. Investigation into the basisof chloramphenicol and tetracycline resistance in Staphylococcusintermedius isolates from cases of pyoderma in dogs. J. Vet. Med.B. Infect. Dis. Vet. Public. Health 52: 119�124.Kizerwetter-�wida M., D. Chrobak, M. Rzewuska and M.Binek. 2009. Antibiotic resistance patterns and occurence ofmecA gene in Staphylococcus intermedius strains of canine origin.Pol. J. Vet. Sci. 12: 9�13.Kloos W.E. and M.S. Musselwhite. 1975. Distribution and persis-tence of Staphylococcus and Micrococcus species and other aero-bic bacteria on human skin. Appl. Environ. Microbiol. 30: 381�395.Krawczyk B., J. Leibner, W. Barañska-Rybak, A. Samet,R. Nowicki and J. Kur. 2007. ADSRRS-fingerprinting and PCRMP techniques for studies of intraspecies genetic relatedness inStaphylococcus aureus. J. Microbiol. Meth. 71: 114�122.Król J. 1998. Characterization of staphylococci isolated fromhealthy and infected dogs (in Polish). Zeszyty Naukowe AkademiiRolniczej, Wroc³aw, Weterynaria LVIII, 344: 17�47.Mahoudeau I., X. Delabranche, G. Prevost, H. Monteil andY. Piemont. 1997. Frequency of isolation of Staphylococcus inter-medius from humans. J. Clin. Microbiol. 35: 2153�2154.Ma³achowa N., A. Sabat, M. Gniadkowski, J. Krzysztoñ-Russjan, J. Empel, J. Miêdzobrodzki, K. Kosowska-Shick,P.C. Appelbaum and W. Hryniewicz. 2005. Comparison of mul-tiple-locus variable-number tandem-repeat analysis with pulsed-field gel electrophoresis, spa typing, and multilocus sequence


typing for clonal characterization of Staphylococcus aureus iso-lates. J. Clin. Microbiol. 43: 3095�3100.Miêdzobrodzki J., N. Ma³achowa, T. Markiewski, A. Bia³eckaand A. Kasprowicz. 2008. Differentiation of Staphylococcusaureus isolates based on phenotypical characters (in Polish).Postêpy Hig. Med. Do�w. 62: 322�327.Nagase N., A. Sasaki, K. Yamashita, A. Shimizu, Y. Wakita,S. Kitai and J. Kawano. 2002. Isolation and species distributionof staphylococci from animal and human skin. J. Vet. Med. Sci.64: 245�250.Ruscher C., A. Lubke-Becker, C.G. Wleklinski, A. Soba,L.H. Wieler and B. Walther. 2009. Prevalence of methicillin-resistant Staphylococcus pseudintermedius isolated from clinicalsamples of companion animals and equidaes. Vet. Microbiol. 136:197�201.Sasaki T., K. Kikuchi, Y. Tanaka, N. Takahashi, S. Kamata andK. Hiramatsu. 2007a. Reclassification of phenotypically iden-tified Staphylococcus intermedius strains. J. Clin. Microbiol. 45:2770�2778.Sasaki T., K. Kikuchi, Y. Tanaka, N. Takahashi, S. Kamataand K. Hiramatsu. 2007b. Methicillin-resistant Staphylococcuspseudintermedius in a veterinary teaching hospital. J. Clin.Microbiol. 45: 1118�1125.Shopsin B., B. Mathema, J. Martinez, E. Ha, M.L. Campo,A. Fierman, K. Krasinski, J. Kornblum, P. Acabes, M. Wad-dington, M. Riehman and B.N. Kreiswirth. 2000. Prevalenceof methicillin-resistant and methicillin-susceptible Staphylococcusaureus in the community. J. Infect. Dis. 182: 359�362.

Simoons-Smit A.M., P.H.M. Savelkoul, J. Stoof, T.M. Starinkand C.M.J. Vandenbroucke-Grauls. 2000. Transmission ofStaphylococcus aureus between humans and domestic animals ina houshold. Eur. J. Clin. Microbiol. Infect. Dis. 19: 150�152.Stepanovic S., V. Dimitrijevic, D. Vukovic, I. Dakic, B. Savicand M. Svabic-Vlahovic. 2001. Staphylococcus sciuri as a partof skin, nasal and oral flora in healthy dogs. Vet. Microbiol. 82:177�185.Szewczyk E.M. 2005. Bacteriological diagnostics (in Polish).Wydawnictwo Naukowe PWN, Warszawa, pp 20�23.Talan D.A., D. Staatz, A. Staatz and G..D. Overturf. 1989. Fre-quency of Staphylococcus intermedius as human nasopharyngealflora. J. Clin. Microbiol. 27: 2393�2399.Van Hoovels L., A. Vankeerberghen, A. Boel, K. Van Vaeren-bergh and H. De Beenhouwer. 2006. First case of Staphylococcuspseudintermedius infection in a human. J. Clin. Microbiol. 44:4609�4612.Weese J.S., R. Poma, F. James, G. Buenviaje, R. Foster andD. Slavic. 2009. Staphylococcus pseudintermedius necrotizingfascilitis in a dog. Can. Vet. J. 50: 655�656.Wieliczko A., J. Król, T. Piasecki, M. Mazurkiewicz andZ. Staroniewicz. 2002. Occurence and characteristics of staphylo-cocci isolated from poultry (in Polish). Med. Weter. 58: 348�352.W³adyka B., M. Bi�ta, A.J. Sabat, E. Bonar, S. Grzeszczuk,W. Hryniewicz and A. Dubin. 2008. A novel member of thethermolysin family, cloning and biochemical characterization ofmetalloprotease from Staphylococcus pseudintermedius. ActaBiochim. Pol. 55: 525�536.


ORIGINAL PAPER

* Corresponding author: A.S.S. Ibrahim, Department of Botany and Microbiology, Faculty of Science, King Saud University,P.O. 2454, Riyadh 11451, Saudi Arabia; phone: +96 6597359415; e-mail: [email protected]

Introduction

Brucellosis is a major zoonotic disease that causesa serious health and economic problem worldwide(Elfaki et al., 2005). In spite of the growing numberof countries declared Brucella-free, the disease remainsone of the main zoonotic infections throughout manyparts of the world with major economical and publichealth implications. About 500,000 new cases occurannually worldwide, with predominance in the MiddleEast, Mediterranean countries, South America andCentral Asia (Godfroid, 2002; Sauret and Villissova,2002). The causative organisms of brucellosis areGram-negative facultative intracellular pathogens thatmay affect a range of different mammals includingman, cattle, sheep, goats, swine, rodents and marinemammals and in most host species, the disease prima-rily affects the reproductive system with concomitantloss in productivity of animals affected (Cutler et al.,

2005). In man, infection is associated with proteanmanifestations and characteristically recurrent febrileepisodes that led to the description of this disease asundulant fever (Abdoel et al., 2008). Currently, thediagnosis of brucellosis is based on microbiologicaland serological laboratory tests. However the diag-nostic value of serological tests is unsatisfactory inthe early stages of the disease due to low sensitivity,serological cross-reactions, and the inability to distin-guish between active and inactive infection due toantibody persistence after therapy (Diaz and Moriyo,1989; Navarro et al., 2002). Furthermore in patientswith persistent or relapsing brucellosis, dependance onblood culture analysis is usually impeded by the lowyield of microorganisms as a result of dormancy ofbrucellae in the mononuclear phagocytic cells (Elfakiet al., 2005). Blood cultures (which represent the �goldstandard� of laboratory diagnosis) are among the mostimportant tests used for the diagnosis of infectious

Comparison of Different PCR Methods for Detection of Brucella spp.in Human Blood Samples

HISHAM H. AL-AJLAN, ABDELNASSER S.S. IBRAHIM* and ALI A. AL-SALAMAH

Medical Unit, Department of Botany and Microbiology, Faculty of ScienceKing Saud University, P.O. 2454, Riyadh 11451, Saudi Arabia

Received 2 July 2010, revised 15 December 2010, accepted 18 December 2010

A b s t r a c t

For detection of Brucella species by PCR four DNA extraction methods and four targets were compared using pure culture of Brucellamelitensis and the best conditions were applied in clinical samples. It was found that the MagNA Pure LC method was the most efficientand sensitive method showing a positive PCR reaction with DNA extracted from as low as 25 and 100 CFU suspended in one ml blood andone ml water, respectively. Detection of Brucella spp. by conventional PCR was investigated using four different targets. The resultsindicated that The B4-B5 amplification method was the most sensitive one as it could amplify DNA extracted from as a low as 25 and100 CFU/ml suspended in one ml water and blood, respectively. Furthermore real-time PCR was able to detect Brucella using DNAextracted from as low as 50 CFU/ml blood and 15 CFU/ml water, respectively. The best and optimum detection conditions were applied tothe clinical samples. Evaluation of conventional PCR assays on blood specimens confirmed 72% of the results obtained by conventionalblood culture methods with a specificity of 95%, while serum samples had a sensitivity of 54% and specificity of 100%. Real-time PCRwas generally found to be more sensitive and specific for detecting Brucella spp. in blood and serum samples compared to conventionalPCR. The real-time PCR done on blood specimens confirmed 77.5% of the results obtained by conventional blood culture methods withspecificity of 100%, while 60% of serum samples were found to be positive with specificity of 100%. These results suggest that serum andblood analysis by conventional and real time PCR is a convenient and safe method for rapid and accurate diagnosis of brucellosis.

K e y w o r d s: Brucella spp., brucellosis, detection, PCR methods for detection

28 Al-Ajlan H.H. et al. 1

diseases including brucellosis. However, contamina-tion with skin type flora like coagulase negativestaphylococcus could over grow the slow growingorganisms like Brucella in addition to a serious threatto laboratory personnel (Yagupsky, 1999; 2004).Therefore, other diagnostic methods are needed toovercome such limitations of conventional approachesfor the diagnosis of brucellosis. DNA-based methodssuch as gene probes and polymerase chain reaction(PCR) are attractive means for the confirmation ofbrucellosis. Because of the prevalence of brucellosisin Saudi Arabia, a precise diagnostic method shouldbe established for the control of brucellae in thispopulation. Different target genes, primer pairs, PCRtechniques and extraction procedures have been pre-viously investigated for Brucella detection, however,most of these assays have used Brucella DNA of purecultures and only a few of these primers have beenused in clinical animal, and human samples (Zervaet al., 2001; Abdoel et al., 2008; Bogdanovich et al.,2008; Hiniæ et al., 2008) and there is no enoughreport about comparison of these assays. Thereforethe aims of the current work were to compare differentDNA extraction method for DNA purification fromBrucella cells, compare different targets and PCRmethods for detection of Brucella and apply it to clini-cal human samples

Experimental

Material and Methods

Clinical samples and bacterial strains. A totalof 200 clinical blood specimens were collected fromthe Armed Forces Hospitals (Riyadh, Saudi Arabia)including 160 blood samples obtained from patientswith clinically proven or suspected systemic brucel-losis infection and 40 control samples from healthysubjects without any clinical evidence or history ofbrucellosis. The diagnosis of brucellosis was confirmedby isolation and identification of Brucella spp. fromblood culture. Blood (8 to 10 ml) was inoculated intoBACTEC Plus aerobic/F blood culture bottle (enrichedsoybean-casein digest broth) and incubated for 28 daysor until the bottles were positive. All blood cultureswere evaluated in the BACTEC 9600 blood culturesystem (Becton Dickinson Diagnostic Instrument Sys-tems), which detect microbial growth by continuousmonitoring. One ml aliquots from bottles shown to con-tain Gram-negative coccobacilli bacteria were removedand stored at �80°C until use. All isolated strains wereidentified in the lab. The reference strain used in thisstudy was Brucella melitensis 16 M, which was obta-ined from the Central Veterinary laboratory (Weybridge,UK). It was propagated on chocolate agar (Oxoid) me-

dium and incubated at 37°C in a humidified atmo-sphere supplemented with 5% CO2. Brain heart infu-sion broth (Oxoid) with 20% glycerol (Sigma) wasused for the storage of bacterial strains at �80°C.

Preparation of bacterial cells suspensions.Freshly cultured Brucella melitensis was killed by theaddition of 70% methanol in sterile saline (0.9%NaCl) and recovered by centrifugation at 5000 rpmfor 5 min, washed twice with 5 ml of sterile distilledwater then recovered by centrifugation at 5000 rpmfor 5 min. The cells were serially diluted with steriledistilled water and adjusted to a 0.5 McFarland stan-dard (which is approximately 1.5×108 CFU/ml). Dif-ferent cell dilutions were prepared and suspended ineither sterile distilled water or whole blood collectedin EDTA Vacutainer from healthy individual with noevidence or history of brucellosis infection, to givea final cell count in the range of 25 to 105 CFU/ml.The inoculated whole blood samples and cells sus-pended in water were subsequently used for DNAextraction. Sterile water inoculated blood samplesserved as a negative control.

Bacterial DNA extraction methods. Four differ-ent DNA extraction kits were used to extract thegenomic DNA of Brucella melitensis according tothe manufacturer instructions including QIAmp kit(Qiagen), GenomicPrep DNA Isolation Kit (AmershamBiosciences), Automated Nucleic Acid Purificationsystem (MagNA Pure LC Systems), in addition to 10%Chelex-100 resin suspension (Bio-Rad Laboratories)where 0.2 ml cell suspension was mixed with 0.1 ml ofa 10% Chelex-100 resin suspension (Bio-Rad Labo-ratories), and the mixture was boiled for 10 min. Aftercentrifugation at 10000 rpm for 5 min, about 0.1 mlof supernatant was removed and used for PCR.

Detection of Brucella melitensis by conventionalPCR. The sensitivity of conventional PCR was inves-tigated for detection of Brucella melitensis using a modi-fication of previously reported methods (Navarro et al.,2002; Baddour and Alkhalifa, 2008) using four diffe-rent primers pairs (TIB MOLBIOL, Berlin, Germany),specific to four different targets in Brucella spp.(Table I). The PCR reaction contained (25 µl): reac-tion buffer (50 mM KCl, 1.5 mM MgCl2, 10 mM TrisHCl, pH 9.0), 200 µM of each of dATP, dCTP, dGTP,and dTTP and 2.5 U of puReTaq DNA polymerase(Amersham-Pharmacia). For optimization of PCR con-ditions different concentrations of primers (5�25 pmol)and MgCl2 (1.5�4 mM), amplification at differenttemperature settings and cycling programs were used(Table I). Following PCR reaction, 10 µl of the reac-tion mixture was mixed with 2 µl of loading bufferReddyRun (ABgene) and was run in 2 % agarose gelelectrophoresed in Tris-borate-EDTA buffer (TBE) at120 V for about 50 min and the amplified DNA bandswere visualized in ethidium bromide staining and

29Detection of Brucella spp. by different PCR methods1

photographed under UV light. 100 bp Superladder(ABgene) was used as DNA Marker. Sterile waterinstead of DNA was used as a negative control.

Detection of Brucella melitensis by Real-timePCR. Detection of Brucella using Real-time PCR wasinvestigated using modified of previously reportedmethod (Redkar et al., 2001). The reaction mixture forthe real time contained 2 µl of 10x LightCycler-FastStartDNA master hybridization probes (Roche Diagnos-tics), 2.4 µl MgCl2 (final concentration of 4 mM),4 µl Reagent mix (Brucella-specific primers andhybridization probes), and 6.6 µl nucleases free waterand 5 µl of the tested DNA. Thermocycling conditionswere as follows: one cycle of initial denaturation at95°C for 10 min, followed by 55 amplification cycles(temperature transition rate of 20°C/s), each includ-ing denaturation (95°C for 10 s), annealing (55°C for8 s), and extension (72°C for 15 s). Fluorescence wasmeasured continuously during the slow temperaturerise to monitor the dissociation of the LightCycler Red640-labeled sensor probe at the F2 channel. Water wasused instead of DNA as a negative control.

Results

Sensitivity of the DNA extraction methods. Fourdifferent DNA extraction methods were evaluated forwhole DNA purification from Brucella melitensis.Serial dilution of Brucella melitensis cells were sus-pended in either sterile water or whole blood to givea final cells count of 25 to 25000 CFU/ml. DNA wasextracted and the purified DNA was used as a tem-plate for PCR reaction. The sensitivity and efficacywas measured as the minimum number of CFUrequired to produce DNA showing a positive PCR.The results for the approximate sensitivity of eachmethod are shown in Tables II and III. It was foundthat the MagNA Pure LC method was the most effi-cient and sensitive method as it showed positivePCR reaction with DNA extracted from as low as25 and 100 CFU suspended in one ml blood and

MagNA Pure LC + + + + + + � �QIAmp silica column + + + + � � � �GenomicPrep Blood + + + + + � � �Chelex resin � � � � � � � �

Table IISensitivities of different DNA extraction methods.

Serial dilution of the Brucella melitensis cells was preparedin one ml blood. Total DNA was extracted using different

methods and the purified DNA was used as template in PCR

DNA extraction Count of Brucella cells (CFU/ml blood)

25000 6000 800 400 200 100 50 25

+: Positive PCR, �: Negative PC

Methods

PC

R ta

rget

gene

enc

odin

g a

31 k

Da

Bru

cell

a ab

ortu

sIS

6501

sequ

ence

16S

rR

NA

of B

. abo

rtus

gene

enc

odin

g an

out

er m

embr

ane

prot

ein

anti

gen

(om

p-2)

Pro

duct

siz

e (b

p)22

360

090

519

3

Pri

mer

seq

uenc

eF

-5-T

GG

CT

CG

GT

TG

CC

AA

TAT

CA

A-3

F-5

-GG

TT

GT

TAA

AG

GA

GA

AC

AG

C-3

F-5

-TC

GA

GC

GC

CC

GC

AA

GG

GG

-3F-

5-G

CG

CT

CA

GG

CT

GC

CG

AC

GC

AA

-3R

-5-C

GC

GC

TT

GC

CT

TT

C A

GG

TC

TG

-3R

-5-G

AC

GA

TAG

CG

TT

TC

AA

CT

TG

-3R

-5-A

AC

CA

TAG

TG

TC

TC

CA

CTA

A-3

R-5

-AC

CA

GC

CA

TT

GC

GG

TC

GG

TA-3

PC

R c

ondi

tion

s:M

gCl 2 c

onc.

(m

M)

1.5,

2.5

, 41.

51.

53

Taq

poly

mer

ase

(IU

)2.

52.

52.

52.

5

Ann

eali

ng te

mp

6056

5460

Ext

ensi

on ti

me

(s)

6045

9060

Tabl

e I

Mai

n ch

arac

teri

stic

s of

PC

R m

etho

ds u

sed

in th

e st

udy

Cha

ract

eris

tic

B4-

B5

ISP

1-IS

P2

F4-

R2

JPF

-JP

R


one ml water respectively, followed by GenomicPrepBlood method and QIAmp silica column purificationmethod respectively (Table II and III). However noneof the extracted DNA using Chelex resin was ableto give positive PCR reaction. Based on these resultsthe MagNA Pure LC method was selected for furtheranalysis.

Detection of Brucella by conventional and realtime PCR. Detection of Brucella melitensis by con-ventional PCR was investigated using four differenttargets. The results presented in Table IV and V andFigure 1 indicated that the B4-B5 amplificationmethod was the most sensitive as it could amplifyDNA extracted from as low as 25 and 100 CFU/mlsuspended in one ml water and blood, respectively,followed by ISP1-ISP2 and F4-R2, respectively.

However, none of the bacterial DNA from wholeblood or water gave a positive PCR using the JPR-JPF method. Based on these results the B4-B5 methodwas used in analysis of the clinical samples. The sen-sitivity of the real-time PCR was determined usingBrucella specific probes. The reaction was carried outusing DNA extracted from serial dilution of bacterialcells suspended in blood and water. Real-time PCRwas able to detect Brucella using DNA extracted fromas low as 50 and 15 CFU suspended in one ml bloodand water respectively (Fig. 2).

Clinical samples. During the study period, 200clinical blood specimens (160 patients and 40 con-trols) were tested for brucellosis by blood culture, op-timum conventional PCR and real-time PCR. Amongthe 160 clinical samples tested, 89 specimens were

Fig. 1. Sensitivity of PCR using different targets for detection of Brucella sp.Using B4-B5 and DNA extracted from and DNA extracted from serial dilutions of cells suspended in Blood (A) and water (B).

Using ISP1-ISP2 and DNA extracted from serial dilutions cells suspended in blood (C) and water (D). Using F4-R2 and DNA extractedfrom cells suspended blood (E) and water (F). Lane 1: 100 bp Marker, 2: Negative control, 3: 25,000 CFU/ml, 4:6,000 CFU/ml,

5: 800 CFU/ml, 6: 400: CFU/ml, 7: 200 CFU/ml, 8: 100 CFU/ml, 9: 50 CFU/ml and 10: 25 CFU/ml


blood culture positive for Brucella and 71 were nega-tive but 9 of them were positive for other bacteria (sixcoagulase negative staphylococci, one Staphylococ-cus aureus, one Klebsiella spp. and one Acinatobacterspp). One of the blood culture positive for coagulase

negative staphylococcus (detection after 33 h) waspositive for Brucella by conventional PCR and lightcycler PCR in blood, negative in serum and negativeby blood culture. DNA was extracted from the89 blood samples (which were found to be positive forBrucella by blood culture) and detection was carried

Fig. 2. Detection of Brucella by real time PCRFluorescence is plotted against number of PCR cycles to monitor amplification of different cells counts Brucella suspended in blood (A)

and water (B) 1: 800 CFU/ml, 2: 200 CFU/ml, 3:100 CFU/ml, 4: 50 CFU/ml, 5�25 CFU/ml, 6:15 CFU/ml, 7&8: Negative control

MagNA Pure LC + + + + + + + +

QIAmp silica column + + + + + + � �

GenomicPrep Blood + + + + + + + �Chelex + + + � � � � �

Table III Sensitivities of different DNA extraction methods.

Serial dilution of the Brucella melitensis cells was preparedin one ml water. Total DNA was extracted using differentmethods and the purified DNA was used as template in PCR

Methods

DNA extraction Count of Brucella cells (CFU/ml water)

25000 6000 800 400 200 100 50 25


B4-B5 + + + + + + � �

ISP1-ISP2 + + + + + � � �

F4-R2 + + + � � � � �JPF-JPR � � � � � � � �

Table IV Sensitivities of four PCR methods for detection of Brucella

suspended in blood determined by amplifying the DNAextracted from different cells dilutions

MethodsCount of Brucella cells (CFU/ml blood)

25000 6000 800 400 200 100 50 25



out using optimum conditions of conventional PCRand real-time PCR. The results of conventional PCRshowed that 64 out of 89 blood samples and 2 ofthe 40 control samples (5%) were positive. In addi-tion, 48 of the 89 serum samples were positive andnone of the control samples were positive. The sensi-tivities of PCR detection in blood, serum and bloodculture were 72, 54 and 100%, respectively, andthe specificities were 95, 100, 100% respectively(Table VI). The results of detection of Brucella spp.using real-time PCR are shown in Table VII. It wasfound that 69 out of 89 blood samples were positiveand 54 of the 89 serum samples (60%) were positiveand none of the control samples were positive. Thesensitivities for blood, serum and blood culture were77.5, 60 and 100% with specificities of 100, 100,100%, respectively.

Discussion

An accurate diagnosis of brucellosis is very im-portant for treatment, control and eradication of bru-cellae and due to the prevalence of brucellosis inSaudi Arabia, an efficient and sensitive diagnostic

method should be established for the control of bru-cellae in this population (Elfaki et al., 2005). PCRoffers an alternative choice over the conventionallyavailable methods for an accurate diagnosis of bru-cellosis. However, sufficient nucleic with removal ofinhibitory substances is essential for optimal detectionof the microbial pathogens by PCR. The aim of thisstudy was to optimize the DNA extraction and PCRconditions for detection of Brucella spp. and applythe optimum conditions in the clinical samples andcompare it with blood culture approach. Thereforefour different DNA extraction methods were evaluatedto purify total DNA from Brucella melitensis. Althoughblood is known to possess substances inhibitory toPCR, the DNA purification methods used in this study(except chelex resin method) were successful in elimi-nating these inhibitors, the most sensitive and efficientone being the MagNA Pure LC method showing posi-tive PCR reaction with DNA extracted from as low as25 and 100 CFU suspended in one ml blood and oneml water respectively. The detection of bacterial DNAin blood specimens by PCR usually requires sensitiveDNA amplifying method with sensitive primers andoptimized PCR conditions because of the presence ofhuman DNA and inhibitors in blood (Bricker, 2002;Bogdanovich et al., 2004). With the aim of findingthe most efficient and sensitive methods for detectionof Brucella DNA in blood specimens, four DNAamplifying methods were evaluated using four prim-ers pairs including B4-B5, ISP1-ISP2, F4-R2 andJPF-JPR. The results indicated that the detection limitvaried between 25 to 800 CFU/ml, depending on theamplifying method (except JPF-JPR method). TheB4-B5 amplification method was the most sensitiveone as it could amplify DNA extracted from as a lowas 25 and 100 CFU/ml suspended in one ml water andblood respectively, followed by ISP1-ISP2 and F4-R2,respectively. This result is consistent with that pre-viously reported by Elfeki et al. (2005) where PCRusing primers B4-B5 was the most sensitive one fordetection of Brucella spp. However in another studyby Navarro et al. (2002) for comparison of three PCRmethods for detection of Brucella, F4/R2 was themost sensitive primers. Furthermore the sensitivity ofthe real-time PCR was determined using Brucella spe-cific probes. The reaction was carried out using DNAextracted from serial dilution of bacterial cells sus-pended in blood and water. Real-time PCR was evenmore sensitive than conventional PCR as it was ableto detect Brucella spp. using DNA extracted from aslow as 50 CFU /ml blood 15 CFU/ml water.

The best DNA extraction method was used to ex-tract DNA from the clinical samples and optimumconventional PCR conditions, RT-PCR and bloodculture were compared for detection of Brucella spp.in the clinical blood samples. It was found that 72%

Blood culture 89 (89) 0 (40) 100% 100%

Blood 69 (89) 0 (40) 77.5% 100%

Serum 54 (89) 0 (40) 60 % 100%

Table VIIDetection of Brucella spp. in blood and serum samples

by real-time PCR in comparison to blood culture method

Specimen Positive False pos. Sensitivity Specificity

Blood Culture 89 (89) 0 (40) 100% 100%

Blood 64 (89) 2 (40) 72% 95%

Serum 48 (89) 0 (40) 54% 100%

Table VI Detection of Brucella in blood and serum samples

by conventional PCR in comparison to blood culture method

Specimen Positive False pos. Sensitivity Specificity

B4-B5 + + + + + + + +ISP1-ISP2 + + + + + + � �

F4-R2 + + + + + � � �

JPF-JPR � � � � � � � �

Table VSensitivities of four PCR methods for detection of Brucellasuspended in water specimens determined by amplifying the

DNA extracted from the dilution series

MethodsCount of Brucella cells (CFU/ml water)

25000 6000 800 400 200 100 50 25



and 54% of the positive blood culture was detectedby PCR with specificity of 95% and 54% in blood andserum, respectively. The use of PCR for the detectionof Brucella DNA in blood samples of certain groups ofpatients with brucellosis has been previously studiedwith sensitivity in the range of 50% to 100% (Mattaret al., 1996; Navarro et al., 1999; Zerva et al., 2001).Several systems of real-time PCR have been devel-oped. They are user-friendly, rapid, and free of con-tamination. Moreover, these PCRs overcome the con-ventional PCR by allowing quantification of thetargeted copies in the specimen (Newby et al., 2003;Probert et al., 2004). Evaluation of the real-time PCRfor detection of Brucella spp. in the clinical bloodsamples showed excellent specificity and good sensi-tivity. The real-time PCR confirmed 77.5% of theresults obtained with the blood culture assays withspecificity of 100%. In this study it appears that thereal-time PCR has greater sensitivity and specificitythan conventional PCR.

Conclusions. In conclusion comparison of bloodculture, conventional PCR conditions and RT-PCRfor detection for detection of Brucella spp. in the clini-cal blood samples indicated that PCR amplificationtechnology is promising method for the detection ofBrucella in clinical samples with high sensitivity andspecificity close to that reported by conventionalblood culture. Although the PCR detection of Bru-cella spp. using peripheral blood is not without diffi-culties, it presents considerable advantages. Comparedto standard bacteriological methods, the PCR assaysare safer and more rapid to perform. Therefore, theseassays may be important diagnostic tools to detectBrucella spp.

AcknowledgmentThis work was financially supported by Deanship of Scien-

tific Research, King Saud University. The authors are gratefullyacknowledged for this support

Literature

Abdoel T., I.T. Dias, R. Cardoso and H.L. Smit. 2008. Simpleand rapid field tests for brucellosis in livestock. Vet. Microbiol.130: 312�319.Baddour M.M. and D.H. Alkhalifa. 2008. Evaluation of threepolymerase chain reaction techniques for detection of BrucellaDNA in peripheral human blood. Can. J. Microbiol. 54: 352�357.

Bogdanovich T., M. Skurnik, P.S. Lubeck, P. Ahrens andJ. Hoorfar. 2004. Validated 5� nuclease PCR assay for rapididentification of the genus Brucella. J. Clin. Microbiol. 42:2261�2263.Bricker B.J. 2002. PCR as a diagnostic tool for brucellosis. Vet.Microbiol. 90: 435�446.Cutler S.J., A.M. Whatmore and N.J. Commander. 2005. Bru-cellosis � new aspects of an old disease. J. Appl. Microbiol. 98:1270�128.1Diaz R. and I. Moriyo. 1989. Laboratory techniques in the diag-nosis of human brucellosis. In: Brucellosis: Clinical and Labora-tory Aspects (Young, E.J. and Corbel, M.J., Eds.), pp. 73�83. CRCPress, Boca Raton, FL.Elfaki M.G., T. Uz-Zamana, A.A. Al-Hokailb and S.M.Nakeeba. 2005. Detection of brucella DNA in sera from patientswith brucellosis by polymerase chain reaction. Diagnos. Microbiol.and Infect. Dis. 53: 1�7.Godfroid J. 2002. Brucellosis in Wildlife. Rev. Sci. Tech. Int.Epiz. 21: 277�286.Hiniæ V., I. Brodard, A. Thomann, �. Cvetniæ, P.V. Makaya,J. Frey and C. Abril. 2008. Novel identification and differen-tiation of Brucella melitensis, B. abortus, B. suis, B. ovis, B. canis,and B. neotomae suitable for both conventional and real-time PCRsystems. J. Microbiol. Methods. 75: 375�378.Mattar G.M., I.A. Khneisser and A.M. Abdelnoor. 1996. Rapidlaboratory confirmation of human brucellosis by PCR analysis ofa target sequence on the 31-Kilodalton Brucella antigen DNA.J. Clin. Microbiol. 34: 477�478.Navarro E., J. Escribano, J.A. Fernandez and J. Solera.2002. Comparison of three different PCR methods for detectionof Brucella spp. in human blood samples. FEMS Immun. Med.Microbiol. 34: 147�151.Navarro E., J.A. Fernandez and J. Solera. 1999. PCR assay fordiagnosis of human brucellosis. J. Clin. Microbiol. 37: 1654�1655.Newby D.T., T.L. Hadfield and F.F Roberto. 2003. Real-timePCR detection of Brucella abortus: a comparative study of SYBRGreen I, 5�-exonuclase, and hybridization probe assays. Appl.Environ. Microbiol. 69: 4753�4759.Probert W.S., K.N. Schrader, N.Y. Khuong, S.L. Bystrom andM.H. Graves. 2004. Real time multiplex PCR assay for detectionof Brucella spp., B. abortus, and B. melitensis. J. Clin. Microbiol.42: 1290�1293.Redkar R., S. Rose, B. Bricker and V. Del Vecchio. 2001. Real-time detection of Brucella abortus, Brucella melitensis and Bru-cella suis. Mol. Cell. Prob. 15: 43 52Sauret J.M. and N. Villissova. 2002. Human brucellosis. J. Am.Board. Pract. 15: 401�406.Yagupsky P. 1999. Detection of Brucella in blood cultures. J. Clin.Microbiol. 37: 3437�3342Yugupsky P. 2004. Use of the BACTEC MYCO/F LYTIC me-dium for detection of Brucella melitensis bacteremia. J. Clin.Microbiol. 42: 2207�2208.Zerva L., K. Bourantas, S. Mitka, A. Kansouzidou andN.J. Legakis. 2001. Serum is the preferred clinical specimen fordiagnosis of human brucellosis by PCR. J. Clin. Microbiol. 39:1661�1664.


ORIGINAL PAPER

* Corresponding author: B. Ró¿alska, Department of Immunology and Infectious Biology, Institute of Microbiology, Biotechno-logy and Immunology, University of £ód�; Banacha 12/16, 90-237 £ód�, Poland; e-mail: [email protected]

Introduction

A frequent complication while using artificial de-vices in medical practice (BAI, biomaterial-associatedinfections) are infections dependent on microbial ad-hesion and biofilm formation. They should be con-sidered a serious health problem requiring a rapidsolution. Very often BAI are a consequence of directbiomaterial contamination during implantation butthey can also be caused by haematogenous spread ofbacteria from an infection site anywhere within thehuman body. A similar medical problem is posed bywound-associated chronic infections, which are alsooften characterized as having a biofilm nature. Thebiofilm mode of growth results in an increased bac-terial resistance against classical antimicrobial treat-ment and host immune factors (Bryers, 2008; Jameset al., 2008; Dai et al., 2010; Hoiby et al., 2010).

Thus, the search for alternative therapies is a necessityand using, for example, natural plant/animal productsand/or their combinations with antibiotics or syntheticcounterparts seems to be one of the promising solu-tions (Dürig et al., 2010).

Higher plants evolved through developing mecha-nisms for avoiding the effects of microbial attack basedon the production of protective substances, usuallytheir secondary metabolites. Compounds with strongbacteriostatic or bactericidal activity belong mostly tophytoalexins and, within this group, essential oils arethe most important members (Gibbons, 2008). Essen-tial oils are complex mixtures of chemical substances,at least one of which shows antimicrobial activity.They consist mainly of monoterpenes, sesquiterpenes,diterpenes and other aromatic or aliphatic compounds(Kalemba and Kunicka, 2003; Bakkali et al., 2008;Reichling et al., 2009). Essential oils of several plants

Antibiofilm Activity of Selected Plant Essential Oilsand their Major Components

ALEKSANDRA BUDZYÑSKA1, MARZENA WIÊCKOWSKA-SZAKIEL1, BEATA SADOWSKA1,DANUTA KALEMBA2 and BARBARA RÓ¯ALSKA1*

1 Institute of Microbiology, Biotechnology and Immunology, University of £ód�, Poland2 Institute of General Food Chemistry, Technical University of £ód�, Poland

Received 14 October 2010, accepted 15 December 2010

A b s t r a c t

The aim of the study was to examine the antibiofilm activity of selected essential oils (EO): Lavandula angustifolia (LEO), Melaleucaalternifolia (TTO), Melissa officinalis (MEO) and some of their major constituents: linalool, linalyl acetate, "-terpineol, terpinen-4-ol.Biofilms were formed by Staphylococcus aureus ATCC 29213 and Escherichia coli NCTC 8196 on the surface of medical biomaterials(urinary catheter, infusion tube and surgical mesh). TTC reduction assay was used for the evaluation of mature biofilm eradication fromthese surfaces. Moreover, time-dependent eradication of biofilms preformed in polystyrene 96-well culture microplates was examined andexpressed as minimal biofilm eradication concentration (evaluated by MTT reduction assay). TTO, "-terpineol and terpinen-4-ol as wellas MEO, showed stronger anti-biofilm activity than LEO and linalool or linalyl acetate. Among the biomaterials tested, surgical mesh wasthe surface most prone to persistent colonization since biofilms formed on it, both by S. aureus and E. coli, were difficult to destroy. Thekilling rate studies of S. aureus biofilm treated with TTO, LEO, MEO and some of their constituents revealed that partial (50%) destructionof 24-h-old biofilms (MBEC

50) was achieved by the concentration 4�8×MIC after 1 h, whereas 2�4×MIC was enough to obtain 90%

reduction in biomass metabolic activity (MBEC90

) after just 4 h of treatment. A similar dose-dependent effect was observed for E. colibiofilm which, however, was more susceptible to the action of phytochemicals than the biofilms of S. aureus. It is noteworthy that anevident decrease in biofilm cells metabolic activity does not always lead to their total destruction and eradication.

K e y w o r d s: biofilm eradication, biomaterial-associated infections, essential oils

36 Budzyñska A. et al. 1

are widely used in ethnomedicine for their antimicro-bial and anti-inflammatory properties but their anti-biofilm activity has not been so far studied extensively(Carson et al., 2006; Fabian et al., 2006; Cavanaghand Wilkinson, 2002; Karpanen et al., 2008; Warnkeet al., 2006; Chao et al., 2008; Gursoy et al., 2009;Hossainzadegan and Delfan, 2009).

Essential oils derived from Melaleuca alternifolia,Lavandula angustifolia, Melissa officinalis and theirmajor constituents were selected for the present study.Tea tree oil (TTO) is an essential oil from the leavesof the Australian M. alternifolia tree, a member of thebotanical family Myrtaceae. The oil from the leavesis used medicinally, being effective against bacterial,viral and fungal organisms as well as having immuno-stimulatory activity. It is also known that it can allevi-ate inflammation and may help wound healing (Carsonet al., 2006). Essential oils distilled from members ofthe genus Lavandula have been applied both cosmeti-cally and therapeutically for centuries with the mostcommonly used species being L. angustifolia, L. lati-folia, L. stoechas and L. intermedia. The claims madefor lavender oil include its antibacterial, antifungal,smooth muscle relaxing, sedative, antidepressive prop-erties (Cavanagh and Wilkinson, 2002; Roller et al.,2009). Melissa is commonly used in Europe as a tea,liquid extract, and topical preparation. Melissa essen-tial oil (lemon balm) is also a common antibacterialand antifungal agent (Mimica-Dukic et al., 2004).

The attention of our study was focused on the pos-sibility of using essential oils in the fight againstbiofilms of two members of the �alert� pathogensgroup. These were Gram-positive staphylococci, Sta-phylococcus aureus and Gram-negative enteric bacte-ria � Escherichia coli, since the epidemiological dataon the incidence of infection with their participationsound serious. Moreover, these strains were chosenbecause the known differences in the cell wall struc-tures between Gram-positive and Gram-negative bac-teria imply the extent of their susceptibility to variousantimicrobial agents (Gibbons, 2008; Fabian et al.,2006; Chao et al., 2008).

Experimental


Biomaterials, bacteria, phytochemicals. Thefollowing biomaterials/culture surfaces were used:short term urine drainage catheter of Nelaton type(Bicakcilar, Turkey), infusion tube (Polfa Lublin,Poland) (both 0.5 cm in length); surgical mesh sup-port for muscle/fascia (Tricomed, £ód�, Poland)(0.5×0.5 cm); 96-well polystyrene tissue culture micro-plates (Nunc, Denmark). Eradication of Staphylococ-

cus aureus ATCC 29213 and Escherichia coli NCTC8196 biofilms by essential oils (EO) and some of theirmain components was evaluated. There were oils ofMelaleuca alternifolia (tea tree oil, TTO), Lavandulaangustifolia (lavender essential oil, LEO), Melissaofficinalis (Melissa essential oil, MEO or lemon balm)and "-terpineol, terpinen-4-ol, linalool, linalyl acetate.All essential oils were purchased from Pollena Aroma,Poland and the isolated compounds of EO were pur-chased from SAFC, USA, via Sigma, USA.

Evaluation of bacterial susceptibility to essentialoils and their major constituents. MIC (minimalinhibitory concentration) of phytochemicals was de-termined by the standard CLSI (Clinical LaboratoryStandards Institute) microdilution method, with minormodifications (Budzyñska et al., 2009). Essential oils/components were initially diluted in 96% ethanol(1:1 v/v), and later in Mueller-Hinton Broth (MHB,Sigma) with 0.5% Tween 20 (Sigma). The tested con-centrations of phytochemicals (range 6.75�0.024%)were deposited in triplicate, in a volume of 100 µlin the wells of flat-bottomed polystyrene 96-wellmicroplates (Nunc, Denmark). Then, 100 µl of bacte-rial suspension with a density of 106/ml in MHB/0.5%Tween 20 was added to each well. The positive controlwas a suspension of bacteria in 200 µl of MHB/0.5%Tween 20, and a negative control was the mediumwithout bacteria. After 24 h incubation at 37°C, theabsorbance at A600 (Victor 2, Wallac, Finland) wasdetermined. The concentration at which the A600 of thewells did not exceed the value of absorbance of thecontrol medium was accepted as the MIC. The lowestconcentration of essential oils/components, bactericidalto ≥99.9% of the original inoculum (MBC, minimalbactericidal concentration) was determined from brothdilution MIC tests, by subculturing 100 µl (from thewells of MIC, 2×MIC, 4×MIC, 8×MIC) to the brothmedium without any antimicrobial agents. No visiblegrowth after subsequent 24 h incubation means MBCon condition that the concentration is not higher thanthe 4-fold value of MIC. Antimicrobial substances� oxacillin and ofloxacin (Sigma, USA) were accep-ted as a reference.

Surface colonization and biofilm eradication.Fragments of biomaterials (three pieces of each type)were incubated with bacterial suspension in tryptic soybroth (TSB) supplemented with glucose (TSB/0.25%Glc) for 24 h at 37°C. Colonized surfaces, after theirwashing with phosphate-buffered saline (PBS), weretransferred to the wells of a 96-well tissue culturemicroplate containing dilutions of essential oils/com-ponents and were incubated for the next 24 h at 37°C.Then, biomaterial fragments were rinsed with PBSand transferred to a new 96-well microplate contain-ing TSB with 1% TTC (2,3,5-triphenyltetrazoliumchloride) for 24 h incubation at 37°C, as previously

37Antibiofilm activity of plant essential oils1

described (Ró¿alska et al., 1998). TTC is a redoxindicator used to differentiate between metabolicallyactive and inactive cells; the colorless compound isenzymatically reduced to red TPF (1,3,5-triphenylfor-mazan) in living cells due to the activity of variousdehydrogenases. The presence/reduction of biofilmbiomass was evaluated by comparing the color inten-sity of biofilm deposit on biomaterials treated and un-treated with phytochemicals, according to arbitrarilyfixed scale (4+, 3+, 2+, 1+, �). The experiments wereperformed twice to confirm reproducibility of the results.

The results of the semi-quantitative method werecompared with those of a standard biomass quantifica-tion method by CFU determination. The fragments ofcolonized biomaterials treated with phytochemicals,which were scored by TTC assay as (+) and (�), wereremoved from the wells and rinsed in PBS. Then, theywere placed in 1 ml of sterile broth medium and theremaining bacterial deposit was removed by ultra-sonic disruption for 5 min. One hundred µl of thesonicate was spread onto two agar plates for overnightincubation and CFU counting.

Time-dependent biofilm eradication. Time-de-pendent inhibitory concentration of phytochemicalsfor biofilms preformed in a polystyrene 96-well cul-ture microplate, used at concentrations from MIC to8×MIC was determined. Mature (24-h old) biofilmsof S. aureus ATCC 29213 and E. coli NCTC 8196were exposed to the action of essential oils/compo-nents for 1, 4, 6 and 24 h co-incubation at 37°C. Theessential oils/components concentrations causing50% or at least 90% reduction in biomass metabolicactivity (MBEC50 and MBEC90) at each time pointwere determined using MTT-reduction assay, as de-scribed earlier (Walencka et al., 2005; 2007). MBEC50means that A550 of the sample dropped below the halfvalue of the positive control (A550 = 1.5) and MBEC90means that A550 of the sample was close to the value ofthe negative control (A550 = 0.2). To avoid interferencebetween the phytochemical�s red-ox potency and MTT,before its application, the fluid above the biofilm wasaspirated and removed. In this assay, pale-yellow MTT(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide) is reduced to purple formazan by living,respiratory active cells. A solubilizer was added todissolve the formed formazan product into a coloredsolution whose absorbance was quantified (550 nm(Victor 2, Wallac, Finland). The experiments wereperformed in duplicate to confirm reproducibility of theresults. Mean A550 ± S.D. values were presented.

Evaluation of viability of bacterial cells treatedwith essential oils. The potential effect of essentialoil on bacterial cell membranes was assessed usingEO-mediated SYTO 9 and propidium iodide uptake(LIVE/DEAD BacLight Bacterial Viability kit, Mole-cular Probes, Invitrogen, Poland). Cell suspensions of

S. aureus ATCC 29213 and E. coli NCTC 8196 inPBS (1.0×106 CFU/ml) were incubated with 4×MIC,2×MIC or MIC) of EO at 37°C for 4 h, with shaking.After the incubation, the bacteria were washed with5 ml sterile PBS and stained using the LIVE/DEADkit, according to the manufacturer�s recommenda-tions. The cells with LIVE/DEAD and no EO servedas negative controls. After the incubation all thesamples were washed and resuspended in PBS, anda drop of each suspension was examined with a con-focal scanning laser microscope for green/red fluo-rescence to visualize SYTO 9 and propidium iodide,respectively. Six areas of each of the triplicate sampleswere photographed with an integrated Hamamatsu digi-tal camera (C4742�95; Nikon UK).

Results

The minimal inhibitory concentration (MIC) ofselected essential oils and their major constituents wasdetermined using the broth microdilution method anddefined as the lowest concentration able to inhibitvisible microbial growth. The essential oil of Melaleucaalternifolia (TTO), "-terpineol and terpinen-4-ol, aswell as the essential oil of Melissa officinalis (MEO),showed stronger antibacterial activity than the essen-tial oil of Lavandula angustifolia (LEO) and its majorcomponents, such as linalool and linalyl acetate. TheirMICs values against Staphylococcus aureus and Esche-richia coli are presented in Table I. The experimentsperformed to check whether the tested phytochemi-cals are bactericidal showed that MBC values did notexceed the obligatory 4 x MIC, since more than99% of the bacterial inoculum was killed even byMIC or 2×MIC. One exception was the S. aureusculture which was killed by 8×MIC of linalool � oneof the components from the lavender and melissaessential oils. The data on this set of experiments arepresented in Table I.

The answer to the question whether TTO, LEO,MEO are bacteriostatic or bactericidal was also provi-ded by the experiments for EO-mediated SYTO 9/PIuptake, evaluated by fluorescent confocal microscopy.As assessed by the emission of green/red fluorescence,non-treated S. aureus or E. coli cells, showed onlygreen fluorescence (live with undamaged cell wall),except for very few red cells. However, EO-treatedcells exhibited increased uptake of propidium iodide(leaking cell wall and membrane), proportional to theincrease in the compound concentration. All bacterialcells from planktonic cultures treated with EO at theconcentration of 2�4 MIC, exhibited red fluorescence(data not shown).

In the further experiments, essential oils/compoundswere shown to possess the bactericidal activity against


mature S. aureus and E. coli biofilms formed earlieron the surface of polystyrene culture microplate wells.The time-dependent inhibitory concentration of phyto-chemicals for biofilms preformed in the polystyrene96-well culture microplate was determined by MTTreduction assay. All biocides were used for this pur-

pose at MIC up to 8×MIC. There was only a smalldifference between planktonic and biofilm biocidalconcentrations, usually not exceeding 2�4-fold highervalues. Killing rate studies of S. aureus biofilm eradi-cation by TTO and its constituents revealed that par-tial (50%) destruction of 24-h-old biofilms (MBEC50)

Fig. 1. Time- and concentration-dependent effect of essential oils on biofilm viability, determined by MTT-reduction assay.A1, A2, A3 (S. aureus), B1, B2, B3 (E. coli) biofilms exposed to tea tree oil (A1, B1), lavender oil (A2, B2), or lemon balm (A3, B3).

A550 mean ± S.D.


was achieved by the concentration of 4�8×MIC justafter 1 h, whereas 2×MIC was enough to obtain TTOMBEC90 after 4 h of treatment. Effective MBEC90 ofLEO and its constituents was as high as 4�8×MIC.The time-dependent activity of MEO was comparableto TTO. With few exceptions, the tested phytochemi-cals reduced the metabolic activity of bacterial cellsin biofilms after 24 h exposure at concentrations closeto MICs. A similar dose- and time-dependent effectwas observed for E. coli biofilm, however, surprisingly,it was more susceptible to the action of phytochemicalsthan the S. aureus biofilms, similarly to what was ob-served for planktonic cultures. (Table I, Fig. 1).

Among the medical biomaterials tested, surgicalmesh was the surface most prone to persistent coloni-zation, since biofilms formed on it by both bacterialstrains were more difficult to eradicate by the testedcompounds. Modified Richard�s method was usedto detect the presence or eradication of biofilm, asdescribed earlier (Ró¿alska et al., 1998). The obtainedvisual results scored by TTC assay as (+) and (�),were compared with the data from the standard biom-ass quantification method by bacterial dislodgementand CFU determination. Only TTO and terpinen-4-olused at MIC � 2×MIC caused visible biofilm eradi-cation (TTC reduction) from the surface of urologicalcatheter and infusion tube, evaluated later as greaterthan 90% decrease in the number of live bacteria(CFU). However, the use of higher concentrations(4�8×MIC) of these and other compounds (MEO,

LEO, "-terpineol, linalool, linalyl acetate) was neces-sary to achieve such an effect on the surface of surgicalmesh. In all cases it was proved that indeed TTC score(�) means that the lack of metabolically active cells isequal to the lack of viable bacteria, since the CFUcounting method used for the measurement of biofilmsurvival showed its total eradication (data not shown).

Our study leads to the conclusion that essential oilsand some of their major constituents are able to effi-ciently reduce biofilms of both S. aureus and E. coli onbiomaterial surfaces. However, a satisfactory effect isstrongly dependent on the surface structure and pro-perties. The example of TTO antibiofilm activity ispresented in Fig. 2.

TTO S. aureus 0.39 0.78 0.78 0.78

E. coli 0.19 0.19 0.19 0.19"-terpineol S. aureus 0.19 0.78 0.38 0.38

E. coli 0.097 0.097 0.19 0.19

Terpinen-4-ol S. aureus 0.19 0.78 0.19 0.19E. coli 0.048 0.19 0.097 0.048

LEO S. aureus 0.78 1.56* 1.56 1.56

E. coli 0.19 0.19 0.19 0.19Linalool S. aureus 0.19 1.56 0.78 0.78

E. coli 0.097 0.39 0.78 0.19

Linalyl acet. S. aureus 0.19 0.78 >1.56 0.19E. coli 0.19 0.19 >1.56 0.19

MEO S. aureus 0.097 0.19 >0.78 0.38

E. coli 0.048 0.097 0.19 0.19

Table IBacteriostatic and bactericidal activity of essential oils/consituents against planktonic

and biofilm cultures of Staphylococcus aureus and Escherichia coli

Essentialoil/component

BacteriaMIC (planktonic),

% v/vMBC (planktonic)

% v/vMBEC

90 (4 hours),

% v/vMBEC

90 (24 hours),

% v/v

TTO � Tea Tree oil (Melaleuca alternifolia); LEO � lavender oil (Lavandula angustifolia)MEO � Lemon balm oil (Melissa officinalis); MIC � minimal inhibitory concentrationMBC � minimal bactericidal concentration, value not exceded 4×MIC;* � exception linalool which is not bactericidal for S. aureus, MBC = 8× MICMBEC90 � minimal biofilm eradication concentration causing ≥90% reduction of biomassmetabolic activity, measured after 4 or 24 h of compounds application on the biofilm culture

Fig. 2. Image of infusion tube colonized by S. aureus biofilm:A, B � treated for 24 h with TTO, respectively at MIC or ½ MIC.C(+) � not treated positive control, C(�) � not colonized negative control.TTC-reduction assay � scored according to an arbitrarily fixed scale as

described in Material and Methods.


Discussion

In the present study, the in vitro strong effects ofMelaleuca alternifolia (TTO), Lavandula angustifolia(LEO), Melissa officinalis (MEO) essential oils andsome of their main constituents ("-terpineol, terpinen-4-ol, linalool, linalyl acetate) on the biofilms of Gram-positive S. aureus and Gram-negative E. coli wereshown. Remarkably, the in vitro activity of the oilsagainst the biofilm of both strains tested was equal toor only slightly lower than that against bacterialplanktonic culture (Table I). This is worth emphasizingbecause the biofilm resistance to classical chemothera-peutics is typically 100�1000 times higher (Bryers,2008, Hoiby et al., 2010). It is a promising observationsince plant-derived compounds have gained a generalinterest in the search to identify alternatives for thecontrol of infections, especially those connected withthe use of artificial medical devices. Research on thistopic is focused on natural or synthetic substances,which have potent broad-spectrum microbicidal andantibiofilm activities and pose a low risk for the de-velopment of resistance. It is accepted that there aretwo main reasons why essential oils do not createresistant strains of bacteria: they are complex andcomprise numerous compounds in variable propor-tions depending on the plant chemotype. Hence, evenif bacteria did figure out an oil�s effective compo-nents, they would have to start all over with the nextset (Bakkali et al., 2008; Reichling et al., 2009).

In the present study we demonstrated that essen-tial oils, not only of M. alternifolia well known inthis respect from other studies (Brady et al., 2006;Kwieciñski et al., 2009; Karpanen et al., 2008), butalso of M. officinalis and L. angustifolia have anti-biofilm potency. According to our knowledge, this isthe first report concerning such activity of MEO andLEO. Both S. aureus and E. coli biofilms were eradi-cated efficiently by MEO. However, this effect wasmore time-dependent than the activity of TTO andLEO. The antibacterial, antifungal and antioxidantproperties of M. officinalis essential oil, but not anti-biofilm activity, have been earlier described. The mainconstituents of MEO are citrals (geranial + neral,39.9%), citronellal (13.7%), limonene (2.2%), geraniol(3.4%), $-caryophyllene (4.6%), $-caryophyllene oxide(1.7%), and germacrene D (2.4%) (Mimica-Dukicet al., 2004). Our further research will be devoted toexamining the activity of individual components.However, it is also possible that they can be moreactive when they are in their natural proportions inthe native oil. The main chemical components of lav-ender oil � the second active in our experiments area-pinene, limonene, 1,8-cineole, cis-ocimene, trans-ocimene, 3-octanone, camphor, linalool, linalyl acetate,caryophyllene, terpinen-4-ol and lavendulyl acetate

(Roller et al., 2009; Cavanagh and Wilkinson, 2002).Three of these components linalool, linalyl acetate,terpinen-4-ol were tested for antibiofilm activity sincethey are also major constituents of active TTO. Amongthem, terpinen-4-ol seems to have the most potent acti-vity, causing more than 90% reduction in biofilmmetabolic activity (MBEC90) after just 4 h of exposure.

Our results on TTO antibiofilm activity are slightlydifferent from those published by Brady et al. (2006).The authors showed that biofilms formed by MSSAand MRSA isolates were completely eradicated fol-lowing an exposure to 5% TTO for 1 h. In our study,S. aureus biofilm was also eradicated in such a shorttime but only by 66%. However, the concentration ofTTO used was much lower � 3.1% (8×MIC). On theother hand, total eradication of S. aureus biofilm wasachieved not earlier than after 4 h but the concentrationof TTO needed for that was only 0.78% (2×MIC).Similarly to our results, TTO activity against S. aureusbiofilms was reported by Kwieciñski et al. (2009).

Usually plant-derived compounds show consider-able activity against Gram-positive bacteria but notagainst Gram-negative species or yeast, which haveevolved significant permeability barriers (Bakkaliet al., 2008; Gibbons, 2008; Reichling et al., 2009;Amalradjou et al., 2010). Thus, it is worth empha-sizing that in our experiments the Gram-negativebacteria were very susceptible to damage by all theessential oils used. For example, the potent and veryfast antibiofilm activity of TTO was noticed forE. coli which was eradicated within 1 h exposureto concentration 0.78%.

It is noteworthy that the evident decrease in bio-film cells metabolic activity measured by MTT-reduc-tion assay (biofilms in microplate wells), is not equalto their total destruction and eradication from the sur-face of the real medical biomaterials. We, like someother authors, have defined a drug concentration re-sulting in ≥90 biomass reduction measured by MTTstaining as the MBEC (minimal biofilm eradicationconcentration). This method indeed has shown excel-lent applicability as it is able to detect dose-dependentand time-dependent differences in the effect of anti-microbials. But, contrary to other investigators, wehave not found a strong correlation between the amountof biofilm mass exposed to essential oils, quantifiedwith TTC staining on medical biomaterials and themetabolic activity quantified with MTT in the wellsof microplate. A great advantage of the TTC reduc-tion method is the fact that the metabolic reduction ofcolorless TTC into red-colored formazan by bacteriaadhering to the surface of a synthetic implant occursregardless of the type, shape or color of the biomate-rial. However, this method is only semi-quantitativeand requires confirmation using a more objectiveevaluation method, which was done in our study. This


suggests that research on given compound�s antibiofilmactivity should be conducted using simultaneously atleast two independent methods. It is well known thatthe growth conditions and the type of surface mayaffect the architecture of a biofilm which can influ-ence the cells sensitivity to antimicrobial agents(Bryers, 2008; Flemming et al., 2009; Hoiby et al.,2010). However, our results encourage the explora-tion of the other essential oils and their constituentsshowing the most potent antibiofilm activity sincethe oils used in this study have superior antimicrobialactivity in S. aureus and E. coli biofilms, comparedwith conventional antibiotics.

Literature

Amalaradjou M.A.R., A. Narayanan, S.A. Baskaran andK. Venkitanarayanan. 2010. Antibiofilm effect of trans-cinnamal-dehyde on uropathogenic Escherichia coli. J. Urology. 184:358�363.Bakkali F., S. Averbeck, D. Averbeck and M. Idaomar. 2008.Biological efects of essential oils � A review. Food Chem. Toxicol.46: 446�475.Brady A., R. Loughlin, D. Gilpin, P. Paddy Kearney andM. Tunney. 2006. In vitro activity of tea-tree oil against clinicalskin isolates of meticillin-resistant and -sensitive Staphylococcusaureus and coagulase-negative staphylococci growing planktoni-cally and as biofilms. J. Med. Microbiol. 55: 1375�1380.Bryers J.D. 2008. Medical biofilms. Biotechnol. Bioeng. 100: 1�17.Budzyñska A., M. Wiêckowska-Szakiel, D. Kalemba, B. Sadow-ska and B. Ró¿alska. 2009. The optimization of methods utilizedfor testing the antibacterial activity of essential oils (in Polish).Med. Do�w. Mikrobiol. 61: 281�281.Carson C.F., K.A. Hammer and T.V. Riley. 2006. Melaleucaalternifolia (Tea Tree) oil: a review of antimicrobial and othermedicinal properties. Clin. Microbiol. Rev. 19: 50�62.Cavanagh H.M.A. and J.M. Wilkinson. 2002. Biological acti-vities of lavender essential oil. Phytotherapy Res. 16: 301�308.Chao S., G. Young, C. Oberg and K. Nakaoka. 2008. Inhibitionof methicillin-resistant Staphylococus aureus (MRSA) by essentialoils. Flavour and Fragrance J. 23: 444�449.Dai T., Y-Y. Huang, K.S. Sharma, T.J. Hashmi, B.D. Kurupand R.M. Hamblin. 2010. Topical antimicrobials for burn woundinfections. Recent Patents on Anti-Infective Drug Discovery 5:124�151.Dürig A., I. Kouskoumvekaki, R.M. Vejborg and P. Klemm.2010. Chemoinformatics-assisted development of new antibiofilmcompounds. Appl. Microbiol. Biotechnol. 87: 309�317.Fabian D., M. Sabol, K. Domaracka and D. Bujnakova. 2006.Essential oils � their antimicrobial activity against Escherichiacoli and effect on intestinal cell viability. Toxicology in vitro 20:1435�1445.

Flemming K., C. Klingenberg, J.P. Cavanagh, M. Sletteng,W. Stensen, J.S. Svendsen and T. Flægstad. 2009. High in vitroantimicrobial activity of synthetic antimicrobial peptidomimeticsagainst staphylococcal biofilms. J. Antimicrob. Chemother. 63:136�145.Gibbons S. 2008. Phytochemicals for bacterial resistance � strengths,weaknesses and opportunities. Planta Med. 74: 594�602.Gursoy U.K., M. Gursoy, O.V. Gursoy, L. Cakmakci,E. Kononen and V-J. Uitt. 2009. Antibiofilm properties ofSatureja hortensis L. essential oil against periodontal pathogens.Anaerobe, 15: 164�167.Hoiby N., T. Bjarnsholt, M. Givskov, S. Molin and O. Ciofu.2010. Antibiotic resistance of bacterial biofilm. Int. J. Antimicrob.Agents 35: 322�332.Hossainzadegan H. and Delfan B. 2009. Evaluation of antibiofilmactivity of dentol. Acta Med. Iranica. 47: 35�40.James G.A., E. Swogger, R. Wolcott, E. Pulcini, P. Secor,J. Sestrich, J.W. Costerton and P.S. Stewart. 2008. Biofilms inchronic wounds. Wound Repair Regen. 16: 37�44.Kalemba D. and A. Kunicka. 2003. Antibacterial and antifungalproperties of essential oils. Curr. Med. Chem. 10: 813�29.Karpanen T.J., T. Worthington, E.R. Hendry, B.R. Conwayand P.A. Lambert. 2008. Antimicrobial efficacy of chlorhexidinedigluconate alone and in combination with eucalyptus oil, tea treeoil and thymol against planktonic and biofilm cultures of Staphylo-coccus epidermidis. J. Antimicrob. Chemother. 62, 1031�1036.Kwieciñski J., S. Eick and K. Wójcik. 2009. Effects of tea tree(Melaleuca alternifolia) oil on Staphylococcus aureus in biofilmsand stationary growth phase. Int. J. Antimicrob. 33: 343�347.Mimica-Dukic N., B. Bozin, M. Sokovic, and N. Simin. 2004.Antimicrobial and antioxidant activities of Melissa officinalis L.(Lamiaceae) essential oil. J. Agric. Food Chem. 52: 2485�2489.Reichling J., P. Schnitzler, U. Suschke and R. Saller. 2009.Essential oils of aromatic plants with antibacterial, antifungal,antiviral, and cytotoxic properties � an overview. Forsch Komple-mentmed. 16: 79�90.Roller S., N. Ernest and J. Buckle. 2009. The antimicrobial acti-vity of high-necrodane and other lavender oils on methicillin-sen-sitive and -resistant Staphylococcus aureus (MSSA and MRSA).J. Altern. Complement Med. 15: 275�279.Ró¿alska B., B. Sadowska, M. Wiêckowska and W. Rudnicka.1998. Detection of biomaterial-associated bacterial biofilm (inPolish). Med. Do�w. Mikrobiol. 50: 115�122.Walencka E., B. Sadowska, S. Ró¿alska, W. Hryniewicz andB. Ró¿alska. 2005. Lysostaphin as a potential therapeutic agentfor staphylococcal biofilm eradication. Pol. J. Microbiol. 54:191�200.Walencka E., S. Ró¿alska, H. Wysokiñska, M. Ró¿alski,£. Ku�ma and B. Ró¿alska. 2007. Salvipisone and aethiopinonefrom Salvia sclarea hairy roots modulate staphylococcal antibioticresistance and express antibiofilm activity. Planta Med. 73: 545�551.Warnke P.H., E. Sherry, P.A.J. Russo, Y. Acil, J. Wiltfang,S. Sivananthan, M. Sprengel, J.C. Roldan, S. Schubert,J.P. Bredee and others. 2006. Antibacterial essential oils in malo-dorous cancer patients: Clinical observations in 30 patients. Phyto-medicine 13: 463�467.


ORIGINAL PAPER

* Corresponding author: J. Wielbo, Department of Genetics and Microbiology, Maria Curie-Sk³odowska University,Akademicka 19 st., 20-033 Lublin, Poland; e-mail: [email protected]

Introduction

Biological nitrogen fixation (BNF) is a process inwhich atmospheric dinitrogen is reduced to formsavailable to plants and is provided by free-living bacte-ria or bacteria symbiotically associated with legumi-nous plants, commonly known as rhizobia. Rhizobiabelong to different taxonomic families of "-proteobac-teria such as Rhizobiaceae, Phylobacteriaceae andBradyrhizobiaceae, and to $-proteobacteria such asthe recently described Burkholderia spp. (reviewedby Perret et al., 2000; Masson-Boivin et al., 2009).Significance of rhizobial symbioses in agriculturestems from providing an extra source of nitrogen forplant growth, supplementing low nitrogen level in thesoil and replacing nitrogenous fertilizer (Peopleset al., 1995; Ramos et al., 2001).

Rhizobium leguminosarum bv. trifolii (Rlt) inducesand colonizes nodules elicited on roots of clover(Trifolium spp.). The symbiosis between rhizobia andlegumes is a multi-step process including the exchangeof molecular signals between the microsymbiont and

its host (reviewed by, Perret et al., 2000; Spaink,2000; Jones et al., 2007). Initially, flavonoids releasedby plants attract bacteria to the roots and induce syn-thesis of bacterial Nod factors that are lipochitooligo-saccharide signals that trigger several plant responses,such as root hair curling and differentiation of plantmeristems leading to the formation of root nodules.Nodules are colonized by rhizobia via tubular struc-tures known as infection threads in which rhizobia mul-tiply. After releasing from infection threads bacteriasurrounded by peribacteroid membranes colonize nod-ule tissue forming symbiosomes in which bacteria areconverted into bacteroids. Bacteroids localized in thesymbiotic zone of mature nodules reduce atmosphericdinitrogen into forms, which are easily assimilated byplants (Vasse et al., 1990; Timmers et al., 2000).

Competition for nodulation is a quantitative pheno-type, which determines the ability of Rhizobium strainsto dominate in the nodules of a given legume host incompetition with other strains present in the root rhizo-sphere (Dowling and Broughton, 1986). Soil popula-tions of Rhizobium usually consist of numerous strains,

Competitiveness of Rhizobium leguminosarum bv. trifolii Strainsin Mixed Inoculation of Clover (Trifolium pratense)

JERZY WIELBO*, MONIKA MAREK-KOZACZUK, DOMINIKA KIDAJand ANNA SKORUPSKA

Department of Genetics and Microbiology, Maria Curie-Sk³odowska UniversityLublin, Poland

Received 10 April 2010, revised 10 January 2011, accepted 14 January 2011

A b s t r a c t

Rhizobium leguminosarum bv. trifolii (Rlt) establishes beneficial root nodule symbiosis with clover. Twenty Rlt strains differentiallymarked with antibiotic-resistance markers were investigated in terms of their competitiveness and plant growth promotion in mixedinoculation of clover in laboratory experiments. The results showed that the studied strains essentially differed in competition ability.These differences seem not to be dependent on bacterial multiplication in the vicinity of roots, but rather on complex physiological traitsthat affect competitiveness. The most remarkable result of this study is that almost half of the total number of the sampled nodules wascolonized by more than one strain. The data suggest that multi-strain model of nodule colonization is common in Rhizobium-legumesymbiosis and reflects the diversity of rhizobial population living in the rhizosphere

K e y w o r d s: clover growth promotion, competitiveness, mixed inoculation, rhizobia

44 Wielbo J. et al. 1

which compete with each other during the phase ofvegetative growth in the soil, as well as during severalstages of plant colonization and nodule formation(Wilson et al., 1998; Stuurman et al., 2000; Duoduet al., 2009). Rhizobial strains are genetically and meta-bolically diverse, reveal significant differentiation incompetitive fitness to infect and occupy nodule of thehost plant and differ in the symbiotic activities (Maierand Triplett, 1996; Wielbo et al., 2007; Depret andLaguerre, 2008). To investigate the competition be-tween rhizobial strains, numerous molecular markerswere developed and employed. Spontaneous or ac-quired antibiotic resistance markers are commonlyused due to feasibility of detection and a broad differ-entiation allowing simultaneous identification a num-ber of strains (Sharma et al., 1991; Cresswell et al.,1994; Sessitsch et al., 1998; Wilson et al., 1998;Stuurman et al., 2000).

In this work, we investigated the competition abil-ity of 20 Rlt strains originating from clover root nod-ules under laboratory conditions. The results showedthat in most cases simultaneous inoculation of plantswith a mixture of rhizobial strains carrying differentantibiotic resistance markers resulted in nodule colo-nization by more than one strain. The commonly ob-served nodule colonization by multiple strains thatdiffer in respect to the efficiency of plant growthpromotion may have significant impact on overallsymbiosis in the soil.

Experimental


Rhizobium leguminosarum bv. trifolii strains.20 Rlt strains used in this study were obtained fromnodules of clover (Trifolium pratense) cultivated inarable sandy loam soil in the region of Lublin, Poland.Rifampicin, streptomycin and trimethoprim-resistantspontaneous mutants were obtained as follow: fromovernight cultures of Rlt isolates grown in liquidTY medium (Sambrook et al., 1989) with constantshaking, about 5×109 cfu/ml of the given culture wasplated on TY agar medium supplemented withrifampicin, streptomycin or trimethoprim (40 µg/ml,200 µg/ml, 200 µg/ml, respectively). Single coloniesresistant to appropriate antibiotic were isolated. Nali-dixic acid for selection of naturally resistant strainswas used in the concentration of 150 µg/ml. Tetra-cycline resistant Rlt strains were obtained by intro-ducing pJBA21Tc plasmid via triparental conjugation(Wielbo and Skorupska, 2001). Each of 20 strains wasresistant to one of the following antibiotics: rifam-picin, streptomycin, tetracycline, trimethoprim andnalidixic acid (Table I).

Plant tests. Red clover seeds (Trifolium pratenseL. cv. Dajana) were surface-sterilized, germinated onTY agar medium, and then transferred onto agar slantswith nitrogen-free Fåhraeus medium (Vincent, 1970).Clover seedlings were inoculated with 200 µl singlestrain suspension in water, which was scratched fromTY agar medium plate, or with 200 µl mixture of fourstrains differently tagged with antibiotic-resistancemarker (1:1:1:1 v/v). In both cases the bacterial sus-pensions contained about 1.0×109 cfu/ml. Plants weregrown in a greenhouse under natural light supple-mented with artificial light (14 h day/10 h night, at24/19°C). After 5 weeks, clover plants were harvestedand nodules were counted. The efficiency of symbioticnitrogen fixation was estimated by weighing freshmass of shoots and roots. For each experimental group20 plants were used and two independent experimentswere conducted.

Estimation of rhizobial competitiveness. Ten clo-ver plants were randomly chosen from each experi-mental group inoculated with a mixture of four strainsand wet masses of shoots and roots were estimated.Root nodules were surface-sterilized and the contentof individual nodules was plated on TY agar medium.Colonies derived from individual nodules were usedfor preparation of water suspension an OD550 of 0.05(~5×107 cfu/ml). 20 µl of each suspension was spot-ted on a set of TY agar medium plates containing oneof four antibiotics, depending on antibiotic resistancemarkers carried by strains in a particular mixture.Bacteria were grown for three days at 28°C. Detect-able growth on only one plate from a set was inter-preted as the presence of pure culture in the nodule,whereas the growth on more than one plate from a setwas interpreted as mixed colonization of nodule.

Rhizobial growth assay. 5 ml Fåhraeus mediumsupplemented with appropriate amount of TY me-dium was inoculated with 50 µl of overnight cultureof Rlt strains growing in TY medium, and incubatedfor 2 days at 28°C. Bacterial growth was measuredby monitoring OD550. For all tested strains the experi-ment was conducted in triplicate.

K416 TmR K417 RfR K38 RfR K29 TcR K313 TcR

K411 RfR K108 TmR K413 NalR K87 StrR K312 StrR

K36 StrR KO17 TcR KO18 TcR K322 NalR K415 RfR

KO27 TcR K71 StrR K91 StrR K810 RfR K107 TmR

Table I Relevant characteristics of Rhizobium leguminosarum bv.

trifolii strains used in this study

Group I Group II Group III Group IV Group V

The spontaneous mutants were isolated in the case of RfR � rifampicinresistance, StrR � streptomycin resistance and TmR � trimethoprimresistance. TcR � tetracycline resistant strains were obtained by intro-ducing pJBA21Tc plasmid. NalR � natural nalidixic acid resistance.

45Competitiveness of Rhizobium leguminisarum strains1

Results

To study nodulation competitiveness, twenty Rltstrains were divided into five groups (I�V). Strainswere assigned to groups randomly, and four strainsbelonging to the same group differed from each otherwith respect to the antibiotic resistance markers theywere carrying (Table I). Clover seedlings were inocu-lated with individual strains or with a mixture of fourstrains belonging to a given group. After 5 weeks,samples of nodules were taken and rhizobia were re-covered from nodules by selection on TY mediumsupplemented with an appropriate antibiotic. In thecase of groups II, III and V, all four strains used forclover inoculation were recovered from the nodules,whereas in the case of groups I and IV, three of fourstrains used for inoculation were found in the samplednodules. For Rlt strains assigned to a given groupthe �relative competition ratio� (RCR) was calculatedas follow: (a) the number of nodules occupied by the

least frequently found strain was normalized to 1;(b) RCR for the three other strains were calculated bydividing the number of nodules colonized by a par-ticular strain by the number of nodules occupied bythe least frequent strain; (c) if a strain was absentin all tested nodules, the RCR was 0 (Fig. 1A, B, C,D, E). As regards their high �relative competitionvalue�, K411 (group I), K417, K71 (group II), K38,K413 (group III), K87 (group IV) and K415 (groupV) strains can be considered competitive. On the otherhand, KO27 and K810 strains were not recoveredfrom the sampled nodules and they were considereduncompetitive.

Based on the antibiotic resistance selection of Rltstrains recovered from clover nodules, it has beenfound that nodules occupied by only one strain com-prised at average 56 ± 7% (Fig. 2 A, B, C, D, E). Theothers nodules were occupied by two or three strainsthat were distinguished by different antibiotic markers.Two-strain nodule occupancy ranged from 28% to

Fig. 2. Distribution of nodules infected by one, two or three strains in particular groups of R. leguminosarum bv. trifolii strains.

Fig. 1. Competition ability of R. legumino-sarum bv. trifolii strains in the mixed inocu-lation of clover measured as relative compe-tition ratio (RCR) (see Results). RCR equal 1� number of nodules colonized by strainmost rarely found in the sampled nodules of

a given group (I�V).


40%, and three-strain nodule occupancy from 3% to16% of nodules, depending on the group of strains(I�V) used for clover inoculation (Fig. 2 A, B, C,D, E). Nodules simultaneously colonized by all fourstrains were not detected. The obtained results showedthat nodule colonization by more than one strain wasprevalent, at least in competition experiments con-ducted under laboratory conditions.

Rlt strains used in competition experiments werecharacterized with regard to the symbiotic propertiessuch as nodulation ability and plant growth promo-tion (Table II). The tested strains varied both in thenumber of nodules elicited and in the impact on freshmass of clovers. In the case of some strains the differ-ences in nodule number and shoot and root mass werestatistically significant. It is worth noting that plants

inoculated with a mixture of four strains showed in-termediary values of symbiotic parameters, which canreflect averaged effects of individual strains on sym-biosis. In almost all cases, fresh mass of total plantper nodule was lower in the mixed inoculation incomparison to the same parameter in clover inocula-tion by individual strains (Table II).

The differences observed in the nodule coloniza-tion ability of Rlt strains might result from somephysiological differences between the strains, forinstance, in the growth rate. In the competition expe-riment, the mixtures of strains used as inocula wereprepared by mixing equal volumes of four bacterialwater suspensions with the same OD550, which shouldminimize the effect of possible differences in the ini-tial cell density. In addition, growth of rhizobia was

Group I of Rlt strains

K 416 5.4 ± 1.5 a 26.3 ± 3.5 a 22.7 ± 1.3 a 9.0

K 411 6.8 ± 0.7 a 31.3 ± 9.4 a 29.7 ± 10.2 a 8.9K 36 4.3 ± 1.0 a 36.8 ± 2.1 a 18.5 ± 3.6 a 12.8

KO27 6.6 ± 2.3 a 28.6 ± 6.6 a 32.3 ± 5.3 a 9.2

Mixed inoculation (I) 7.4 ± 2.2 a 36.2 ± 8.3 a 23.7 ± 7.4 a 8.1Group II of Rlt strains

K 417 7.0 ± 0.7 b 45.8 ± 9.3 ab 25.6 ± 11.6 a 10.2

K 108 5.4 ± 0.7 ab 50.9 ± 8.5 b 26.5 ± 10.0 a 14.3KO17 3.6 ± 0.4 a 33.4 ± 1.9 a 12.6 ± 4.2 a 12.7

K 71 3.7 ± 0.6 a 34.2 ± 8.6 a 13.7 ± 3.8 a 13.0

Mixed inoculation (II) 4.7 ± 1.9 ab 30.5 ± 10.0 a 10.5 ± 6.3 a 8.8Group III of Rlt strains

K 38 5.2 ± 2.0 a 36.6 ± 4.1 a 16.0 ± 0.9 a 10.1

K 413 8.6 ± 2.1 a 44.3 ± 2.5 a 39.4 ± 7.0 b 9.8KO18 10.2 ± 0.9 a 68.5 ± 7.3 b 43.3 ± 7.1 b 11.0

K 91 5.8 ± 2.7 a 56.6 ± 3.0 c 40.0 ± 12.5 b 16.6

Mixed inoculation (III) 9.0 ± 2.8 a 33.9 ± 3.4 a 24.9 ± 6.3 ab 6.5Group IV of Rlt strains

K 29 3.6 ± 1.2 a 31.2 ± 7.0 a 12.1 ± 2.0 a 12.2

K 87 2.8 ± 0.7 a 24.6 ± 9.4 a 12.4 ± 4.1 a 13.4K 322 4.2 ± 1.8 a 34.6 ± 9.2 a 18.8 ± 8.2 ab 12.7

K 810 6.8 ±1.6 b 29.5 ± 4.5 a 21.8 ± 5.5 b 7.5

Mixed inoculation (IV) 3.3 ± 0.9 a 25.2 ± 7.1 a 10.4 ± 2.5 a 10.9Group V of Rlt strains

K 313 3.8 ± 1.5 a 44.1 ± 12.9 a 23.7 ± 10.5 ab 17.7

K 312 3.4 ± 1.0 a 35.0 ± 7.0 a 13.3 ± 2.1 a 14.4K 415 6.2 ± 1.2 ab 41.3 ± 0.9 a 22.8 ± 5.0 b 10.4

K 107 5.1 ± 1.6 ab 55.3 ± 10.4 a 27.4 ± 8.1 b 16.4

Mixed inoculation (V) 6.8 ± 0.4 b 44.7 ± 7.0 a 25.7 ± 6.1 b 10.3Average values

Inoculation by individual strains 6.2 ± 2.3 a 34.1 ± 7.2 a 19.0 ± 7.9 a 12.1 ± 2.8 a

Inoculation by a mixture of strains 5.4 ± 1.9 a 39.4 ± 11.4 a 23 ± 9.6 a 8.9 ± 1.8 b

Table II Symbiotic activity of R. leguminosarum bv. trifolii strains

Rlt strain number No of nodules/plantFresh mass

of shoots/plant (mg)Fresh mass

of roots/plant (mg)Fresh mass

of plant/nodule (mg)

Values are the mean ± standard deviation of 20 clover plants in experiment. Means within the same column and followed by the same letterare not significantly different (P>0.05).


assayed in the medium composed of nitrogen-freeFåhraeus medium used in plant tests supplementedwith 1%, 2%, 5%, 10% or 20% TY medium. It wasassumed that addition of some amount of TY to theplant medium allows for the growth of bacteria whilesimultaneously resembling the plant growth medium.Rhizobia were grown in these media for 2 days andOD550 was measured. The results showed that Rltstrains used in the competition experiments growweakly and only in Fåhraeus medium supplementedwith 10% or 20% of TY, reaching OD550 values from0.13 to 0.2 (data not shown). Differences in growth ofstrains on Fåhraeus medium supplemented with 10%TY, as well as on medium supplemented with 20%TY were observed, however, the analysis of varianceindicated that these differences were statistically in-significant (data not shown). In conclusion, the pos-sible differences in the initial growth of Rlt strainson plant medium at the time of inoculation could notessentially affect their competitiveness.

Discussion

Local population of R. leguminosarum specific fora given legume host is composed of numerous strainscharacterized by great variability in genetic and meta-bolic traits (Lakzian et al., 2002; Wielbo et al., 2010).Rhizobial competitiveness is a complex process depen-dent on genetic and overall metabolic status of bacteria(Wielbo et al., 2007), susceptibility to plant molecularsignals (Mabood et al., 2008; Maj et al., 2010), mo-tility of bacteria (Mellor et al., 1987), production of/resistance to bacteriocins (Wilson et al., 1998) or evendistribution of bacteria in the soil (Lopez-Garciaet al., 2002). Several studies indicate that both thelegume hosts and microsymbionts affect the outcomeof rhizobial competition (Kiers et al., 2006; Depretand Laguerre, 2008; Rangin et al., 2008).

All these and other variables characterizing indi-vidual strains influence their overall competition abili-ties. As a result, appreciable variability in rhizobialcompetitiveness is observed, both in highly controlledexperiments under laboratory conditions, and in ex-periments carried out in the soil (Maier and Triplett,1996; Svenning et al., 2001; Wielbo et al., 2007;Duodu et al., 2009; Sachs et al., 2009).

The strains compete with each other on the levelof root adsorption, root hair infection, growth insidethe infection threads, nodule tissue colonization andsurvival after release into the soil, where they consti-tute part of population capable of symbiotic interac-tions (Duodu et al., 2005; Silva et al., 2007; Ranginet al., 2008; Sachs et al., 2009). Less competitiverhizobia comprising another part of the populationmay be eliminated from nodule infection (Streeter,

1994). Finally, nonsymbiotic rhizobia constitute thefraction that lost the nodulation genes but is still ableto colonize root surfaces and can play an importantrole in competition (Sachs et al., 2009).

In several studies, the competition between rhizo-bia was commonly investigated in a two-strain com-petition assay under controlled conditions. In thisassay both strains were tagged with different markerssuch as antibiotic resistance genes (Bromfield, 1984),lux (Cresswell et al., 1994) or gfp reporter genes(Stuurman et al., 2000) and occupancy of both strainswas easily determined in the nodule. The drawbackof this method is the extreme simplification of themodel, which does not reflect native conditions. Thesecond most frequently used method for rhizobialcompetition analysis was to use a single marked strainvs. the entire unmarked soil population composed ofnumerous strains. Major drawback of this approach islack of any information about the unmarked strainspossibly present in the nodules. Recently, the com-petitiveness of unmarked rhizobial strains was stud-ied by molecular identification of particular genotypesoccupying the nodules (Svenning et al., 2001).

In the present work, the two methods have beencombined, and clover plants were inoculated by fourdifferently marked strains. It allowed determining thedifferences in competitive ability of the individualstrains, and the predominance of nodules occupied bymore than one strain, in the case of a mixed inocula-tion. It is worth noting that infection by several strainsnegatively affected plant growth promotion whencompared to single-strain infection.

Past studies showed mixed colonization of infec-tion threads and nodules (Bromfield, 1984) in a two-strain competition assay (Stuurman et al., 2000; Gage,2004). Expanding the competition test to clover in-oculation by four strains, we demonstrated the possi-bility of single clover nodule colonization by threedifferent strains. The percent of nodules colonizedby three strains was relatively low and ranged from 3to 16% of the sampled nodules. Nodules colonizedby four strains were not found. It is possible that thenumber of the sampled nodules should have beengreater to allow detection of nodules occupied byall four strains. On the other hand, the limited spaceavailable in the infection threads and/or in youngnodules might restrict the growth of rhizobia, andthis might also explain why four strain nodule colo-nization was not observed. The most important find-ing from the presented study is that almost half ofthe total number of the sampled nodules was colo-nized by more than one strain. It suggests that multi-strain model of nodule colonization is predominantalso in the soil environment, and reflects the com-plexity and diversity of rhizobial population in therhizosphere.


The comparison of symbiotic efficiencies of clo-ver inoculation by individual strains vs. a mixture ofstrains was not conclusive. Whereas, significant dif-ferences between the averaged data of shoots androots masses in single strain inoculation and in themixed inoculation have not been found, significantdifference in ratios of fresh mass of the entire plantto nodule number was evident when these two typesof inoculations were compared (Table II). A possibleexplanation for this result might be that the concen-tration of several Nod factors produced by particularstrains in the mixed inoculation is substantiallygreater than in a single strain inoculation. Nod factorsstimulate nodule organogenesis (Perret et al., 2000;Spaink, 2000) and that nodule number increase wasnot accompanied by increased plant growth probablydue to the relatively short timeframe of the experi-ment. This observation is consistent with our previousstudies, in which treatment of clover seeds with Nodfactors under controlled conditions enhanced thegrowth of clover only when a Nod factor was appliedin appropriate concentration (Maj et al., 2009).

In summary, our data revealed that R. legumino-sarum strains investigated in the experimental compe-tition model were greatly differentiated with respectto competitiveness for nodule occupancy. In the mixedinoculation of clover plants, nodule coinfection bytwo or three strains was commonly observed. Theprevalence of nodule coinfection by native soil popu-lation is yet to be determined.

AcknowledgementsThe research reported in this paper was funded in part by

a grants of Ministry of Sciences and Higher Education of Polandnr N N304 026734 and N N301 028734.

Literature

Bromfield E.S.P. 1984. Variation in preference for Rhizobiummeliloti within and between Medicago sativa cultivars grown insoil. Appl. Environ. Microbiol. 48: 1231�1236.Cresswell A., L. Skot and A.R. Cookson. 1994. The construc-tion, detection and use of bioluminescent Rhizobium legumino-sarum biovar trifolii strains. J. Appl. Bacteriol. 77: 656�665.Depret G. and G. Laguerre. 2008. Plant phenology and geneticvariability in root and nodule development strongly influencegenetic structuring of Rhizobium leguminosarum biovar viciaepopulations nodulating pea. New Phytol. 179: 224�235.Dowling D.N. and W.J. Broughton. 1986. Competition for nodu-lation of legumes. Annu. Rev. Microbiol. 40: 131�157.Duodu S., C. Brophy, J. Connolly and M.M. Svenning. 2009.Competitiveness of native Rhizobium leguminosarum bv. trifoliistrain for nodule occupancy is manifested during infection. PlantSoil 318: 117�126.Duodu S., T.V. Bhuvaneswari, J. Gudmundsson and M.M.Svenning. 2005. Symbiotic and saprophytic survival of three un-marked Rhizobium leguminosarum biovar trifolii strains intro-duced into the field. Environ. Microbiol. 7: 1049�1058.

Gage D.J. 2004. Infection and invasion of roots by symbioticnitrogen-fixing rhizobia during nodulation of temperate legumes.Microbiol. Mol. Biol. Rev. 68: 280�300.Jones K.M., H. Kobayashi, B.W. Davies, M.E. Taga andG.C. Walker. 2007. How symbionts invade plants: the Sinorhizo-bium-Medicago model. Nature 5: 619�633.Kiers E.T., R.A. Rousseau and R.F.Denison. 2006. Measuredsanctions: legume hosts detect quantitative variation in rhizobiumcooperation and punish accordingly. Evol. Ecol. Res. 8: 1077�1086.Lakzian A., P. Murphy, A. Turner, J.L. Beynon and K.E. Giller.2002. Rhizobium leguminosarum bv. viciae populations in soilswith increasing heavy metal contamination: abundance, plasmidprofiles, diversity and metal tolerance. Soil Biol. Biochem. 34:519�529.Lopez-Garcia S.L., T.E.E. Vazquez, G. Favelukes andA.L. Lodeiro. 2002. Rhizobial position as a main determinant inthe problem of competition for nodulation in soybean. Environ.Microbiol. 4: 216�224.Mabood F., W.J. Jung and D.L. Smith. 2008. Signal in theunderground: microbial signaling and plant productivity. In:Nautiyal C.S., P.E. Dion and V.L. Chopra (eds.). Molecularmechanisms of plant and microbe coexistence. Springer-Verlag,Berlin, Heidelberg.Maier R.J. and E.W. Triplett. 1996. Toward more productive,efficient, and competitive nitrogen-fixing symbiotic bacteria. Crit.Rev. Plant Sci. 15: 191�234.Maj D., J. Wielbo, M. Marek-Kozaczuk and A. Skorupska.2009. Pretreatment of clover seeds with Nod factors improvesgrowth and nodulation of Trifolium pratense. J. Chem. Ecol.35: 479�487.Maj D., J. Wielbo, M. Marek-Kozaczuk and A. Skorupska.2010. Response to flavonoids as a factor influencing competiti-veness and symbiotic activity of Rhizobium leguminosarum.Microbiol. Res. 165: 50�60.Masson-Boivin C., E. Giraud, X. Perret and J. Batut. 2009.Establishing nitrogen-fixing symbiosis with legumes: how manyrhizobium recipes? Trends Microbiol. 17: 458�466.Mellor H.Y., A.R. Glenn and M.J. Dilworth. 1987. Symbioticand competitive properties of motility mutants of Rhizobiumtrifolii TA1. Arch. Microbiol. 148: 34�39.Peoples M.B, J.K. Ladha and D.F. Herridge. 1995. Enhancinglegume N

2 fixation through plant and soil management. Plant Soil

174: 83�101.Perret, X., C. Staehelin and W.J. Broughton. 2000. Molecularbasis of symbiotic promiscuity. Microbiol. Mol. Biol. Rev. 64:180�201.Ramos M.G., M.A. Villatoro, S. Urquiaga, B.J. Alves andR.M. Boddey. 2001. Quantification of the contribution of bio-logical nitrogen fixation. J. Biotechnol. 91: 105�115.Rangin, C., B. Brunel, J.-C. Cleyet-Marel and G. Bena. 2008.Effects of Medicago truncatula Genetic Diversity, RhizobialCompetition, and Strain Effectiveness on the Diversity of a NaturalSinorhizobium Species Community. Appl. Environ. Microbiol. 74:5653�5661.Sachs J.L., S.W. Kembel, A.H. Lau and E.L. Simms. 2009.In situ phylogenic and diversity of wild Bradyrhizobium commu-nities. Appl. Environ. Microbiol. 75: 4727�4735.Sambrook, J., E.F. Fritsch and T. Maniatis. 1989. MolecularCloning: a Laboratory Manual. 2nd ed. Cold Spring Harbor, NY:Cold Spring Harbor Laboratory.Sessitsch A., G. Hardarson, W.M. de Vos and K.J. Wilson.1998. Use of marker genes for competition studies of Rhizobium.Plant Soil 204: 35�45.Sharma P.K., R.C. Anand and K. Lakshminarayana. 1991.Construction of Tn5 tagged mutants of Rhizobium spp. (Cicer)for ecological studies. Soil Biol. Biochem. 23: 881�885.


Silva C., F.L. Kan and E. Martínez-Romero. 2007. Populationgenetic structure of Sinorhizobium meliloti and S. medicae iso-lated from nodules of Medicago spp. in Mexico. FEMS Microbiol.Ecol. 60: 477�489.Spaink H.P. 2000. Root nodulation and infection factors pro-duced by rhizobial bacteria. Annu. Rev. Microbiol. 54: 25�288.Streeter J.G. 1994. Failure of inoculant rhizobia to overcome thedominance of indigenous strains for nodule formation. Can. J.Microbiol. 40: 513�522.Stuurman N., C. Pacios Bras, H.R.M. Schlaman, A.H.M.Wijfjes, G. Bloemberg and H.P. Spaink. 2000. Use of greenfluorescent protein color variants expressed on stable broad-host-range vectors to visualize rhizobia interacting with plants. Mol.Plant-Microbe Interact. 13: 1163�11699.Svenning M.M., J. Gudmundsson, I.L. Fagerli and P.Leinonen. 2001. Competition for nodule occupancy between in-troduced strains of Rhizobium leguminosarum bv. trifolii and itsinfluence on plant production. Ann. Bot. 88: 781�787.Timmers A.C., E. Soupène, M.C. Auriac, F. de Billy, J. Vasse,P. Boistard and G. Truchet. 2000. Saprophytic intracellularrhizobia in alfalfa nodules. Mol. Plant-Microbe Interact. 13:1204�1213.

Vasse J., F. de Billy, S. Camut and G. Truchet. 1990. Correla-tion between ultrastructural differentiation of bacteroids and ni-trogen fixation in alfalfa nodules. J. Bacteriol. 172: 4295�4306.Vincent J.M. 1970. A manual for the practical study of root nod-ule bacteria. International biological program handbook no.15.Blackwell Scientific Publications Ltd, Oxford, UK.Wielbo J. and A. Skorupska. 2001. Construction of improvedvectors and cassettes containing gusA and antibiotic resistancegenes for studies of transcriptional activity and bacterial localiza-tion. J. Microbiol. Methods 45: 197�205.Wielbo J., M. Marek-Kozaczuk, A. Kubik-Komar and A.Skorupska. 2007. Increased metabolic potential of Rhizobiumspp. is associated with bacterial competitiveness. Can. J.Microbiol. 53: 957�967.Wielbo J., Marek-Kozaczuk M., Mazur A., Kubik-Komar A.and A. Skorupska. 2010. Genetic and metabolic divergencewithin a Rhizobium leguminosarum bv. trifolii population recov-ered from clover nodules. Appl. Environ. Microbiol. 76: 4593�4600.Wilson R.A., B.A. Handley and J.E. Beringer. 1998. Bacterio-cin production and resistance in a field population of Rhizobiumleguminosarum bv. viciae. Soil Biol. Biochem. 30: 413�417.


ORIGINAL PAPER

* Corresponding author: J. Fiedurek, Department of Industrial Microbiology, Maria Curie-Sk³odowska University, Akademicka 19,20-033 Lublin, Poland; phone: +48 81 537 59 33; fax: +48 81 537 59 60; e-mail: [email protected]

Introduction

Bio-ethanol production by yeast is a growingindustry due to energy and environmental demands(Schubert, 2006). Saccharomyces cerevisiae andrelated yeast species have been extensively used infermentation, wine-making, sake-making and brewingprocesses. Successful performance of alcoholic fer-mentations, however depends on the ability of the yeaststrains used to cope with a number of stress factorsoccurring during the process (Van Uden, 1985; Viegaset al., 1989; Hirasawa et al., 2007), including osmoticpressure imposed by the initial high sugar concentra-tion and stress induced by fermentation end-productsor sub-products such as ethanol or acetate. Amongthese, the stress induced by increasing amounts ofethanol, accumulating to toxic concentrations duringethanol fermentation, is the major factor responsiblefor reduced ethanol production yields and, ultimately,for stuck fermentations (Gibson et al., 2007). Thus,yeast strains that can endure stress imposed by highethanol concentrations are highly desirable. Through-out the years many efforts have been made to cha-racterize the mechanisms underlying ethanol stress

tolerance, aiming to increase ethanol productivity(Van Uden, 1985; You et al., 2003; Alper et al., 2006;Hirasawa et al., 2007). To overcome fermentationproblems, sophisticated refinements of fermentationprocesses, involving extractive fermentation (Joneset al., 1993; Da Silva et al., 1999), cell immobiliza-tion (de Vasconcelos et al., 2004; Verbelen et al.,2006), and recycling or retention by membranes(Nishiwaki and Dunn, 1998; Wang and Lin, 2010),were employed with a view to obtaining a large quan-tity of fermenting biomass as well as removing theinhibitory ethanol product. Successful engineering ofyeast transcription machinery for this purpose wasalso reported (Alper et al., 2006).

The present study was conducted to select thebest ethanol-producing yeast strains from our collec-tion, to improve yeast fermentation performanceby adaptation, and to optimize the conditions foralcohol production from sucrose. There are, to ourknowledge, only a few studies that describe thecreation of ethanol-tolerant S. cerevisiae mutantsusing adaptation and ethanol stress as the selectionpressure (Brown et al., 1982; Remize et al., 1999;Stanley et al., 2010).

Selection and Adaptation of Saccharomyces cerevisaeto Increased Ethanol Tolerance and Production

JAN FIEDUREK*, MARCIN SKOWRONEK and ANNA GROMADA

Department of Industrial Microbiology, Maria Curie-Sk³odowska University, Lublin, Poland

Received 2 August 2010, revised 12 January 2011, accepted 20 January 2011

A b s t r a c t

A total of 24 yeast strains were tested for their capacity to produce ethanol, and of these, 8 were characterized by the best ethanol yields(73.11�81.78%). The most active mutant Saccharomyces cerevisiae ER-A, resistant to ethanol stress, was characterized by high resistanceto acidic (pH 1.0 and 2.0), oxidative (1 and 2% of H

2O

2), and high temperature (45 and 52°C) stresses. During cultivation under all stress

conditions, the mutants showed a considerably increased viability ranging widely from about 1.04 to 3.94-fold in comparison with theparent strain S. cerevisiae ER. At an initial sucrose concentration of 150 g/l in basal medium A containing yeast extract and mineral salts,at 30°C and within 72 h, the most active strain, S. cerevisiae ER-A, reached an ethanol concentration of 80 g/l, ethanol productivity of1.1 g/l/h, and an ethanol yield (% of theoretical) of 99.13. Those values were significantly higher in comparison with parent strain (ethanolconcentration 71 g/l and productivity of 0,99 g/l/h). The present study seems to confirm the high effectiveness of selection of ethanol-resistant yeast strains by adaptation to high ethanol concentrations, for increased ethanol production.

K e y w o r d s: adaptation to high ethanol concentration, ethanol tolerance, fermentation, yeast

52 Fiedurek J. et al. 1

Experimental


Microorganisms and media. The strains of theyeast listed in Table I were maintained at 4°C on maltagar slants. For inoculum preparation selected strainswere cultivated on a growth medium A containingglucose, 2%; bactopepton, 2% and yeast extract, 1%.Fermentations were performed using a basal mediumA containing: sucrose, 15.0%; yeast extract, 1.0%;(NH4)2SO4, 0.3% and KH2PO4, 0.1%.

Adaptation for increased ethanol production.Enrichments for increased ethanol production werecarried out according to the method of Dinh et al.,(2008) with some modifications. The cultivation ofthe S. cerevisiae ER strain was carried out in maltmedium containing ethanol and then the culture wastransferred to a fresh medium containing the sameethanol concentration. Adapted cultures were grownin culture tubes (18 by 150 mm) containing 10 ml of

that medium and were incubated at 30°C withoutagitation. After that, the culture was transferred toa medium containing a higher ethanol concentration,followed by repetitive cultivations. The initial ethanolconcentration was set at 5.0% (w/v) and it was changedgradually from 6.0 to 15.0%. New derivatives ofS. cerevisiae were isolated from the adapted culturesafter 10 months of serial transfers into media with highconcentrations of ethanol. At the end of this period,two clones were selected for further study; theseclones were designated as strain ER-A and ER-M.

The adaptation of the yeast was evaluated by mea-suring the optical density of the culture at OD600.Viability in ethanol was determined by maintainingyeast cells of S. cerevisiae ER in malt medium supple-mented with 5�15% ethanol for 48 h at 30°C, platingthem on malt agar plate, and subsequently countingthe number of colonies formed. Control cultures weremaintained in the same medium without ethanol.

Inoculum preparation. For the preparation ofinoculum, yeast strains were transferred from agar

Candida shaetaceae ATCC 22�994 8.67 6.61 0.70 0.40 8.67 1.86

Candida utilis CCY 29�38�18 8.70 7.13 2.00 0.70 24.78 3.25Kluyveromyces fragilis IPF 8.07 10.00 5.00 3.00 61.96 13.94

Kluyveromyces marxianus CCY 50�2�1 4.38 4.69 3.10 4.30 38.41 19.981Saccharomyces bayanus S-21 4.25 1.89 6.60 7.60 81.78 35.321Saccharomyces owiformis 3.78 5.34 6.00 7.00 74.35 32.532Saccharomyces carlsbergensis FD 4.31 4.48 6.48 6.49 80.30 30.163Saccharomyces cerevisiae Anker 2.58 6.03 5.80 8.10 71.87 37.64Saccharomyces cerevisiae A364A 1.83 2.08 3.80 2.80 47.09 13.01

Saccharomyces cerevisiae DBY 747 6.81 6.64 6.40 6.80 79.30 31.604Saccharomyces cerevisiae ER 3.78 3.08 6.60 9.75 81.78 45.314Saccharomyces cerevisiae GM 5.20 9.04 5.80 6.00 71.87 27.883Saccharomyces cerevisiae Hammer 3.22 6.75 5.80 9.20 71.87 42.751Saccharomyces cerevisiae JA 8.41 5.34 5.90 7.20 73.11 33.462Saccharomyces cerevisiae PG 4.06 5.09 6.00 6.80 74.35 31.601Saccharomyces cerevisiae J 5.81 4.84 1.10 2.40 13.63 11.151Saccharomyces elipsoideus Sz.o. 3.81 4.29 6.48 5.64 80.30 26.21Saccharomyces fragilis II 11 4.71 4.90 5.00 2.20 61.96 10.22

Saccharomyces fragilis 11�54 9.07 7.72 3.80 6.20 47.09 28.81

Saccharomyces fragilis S-24 9.84 5.91 3.10 3.20 38.41 14.87Saccharomyces fragilis S-25 6.88 8.05 5.10 6.20 63.20 28.811Saccharomyces mellis 1 3.71 3.78 0.70 0.80 8.67 3.72

Saccharomyces muciparus CCM 21�25�1 8.54 7.72 4.10 3.00 50.80 13.941Saccharomyces rouxii 7.53 8.71 0.60 0.20 7.43 0.93

Table I Screening yeast strains for efficient ethanol production

Sucrose concentration (%)

15 40Strain

Catalase activity(U)

Ethanol(% w/v)a

Ethanol yield(% of theoretical)

The strains were incubated in 50 ml conical flasks, each containing 20 ml of basal medium A containing 15%or 40% of sucrose during 72 h.a Values are averages of 3 replicate determinations with standard deviations of < ± 5%1 Wine yeasts; 2 Brewing yeasts; 3 Baker�s yeast; 4 Distillery yeast

1515 4040

53S. cerevisae adaptation for increased ethanol levels1

slants into 50-ml Erlenmeyer flasks containing 10 mlof sterile liquid growth medium A, which were cul-tured at 30°C on a rotary shaker (Shaker Orbit TheLAB-LINE Instruments Inc, Melrose Park, Illinois,USA) at 150 rpm for 24 h.

Ethanol fermentations. Fermentations with theselected strain were conducted in 300-ml Erlenmeyerflasks containing 100 ml of basal medium A (pH 5.5).The flasks were inoculated with 10% v/v seed culture.Fermentations were carried out for 72 h at 30°C (if notindicated otherwise) in a shaker at 90 rpm. Ethanolevaporation was prevented by rubber stoppers, withfermentative tubes filled with 50% H2SO4. The fermen-tation parameters were corrected by ethanol, sucroseand biomass withdrawn during sampling. Overall bio-mass as well as ethanol yields and sucrose consump-tion were calculated from end-of-batch data, wherethe peak ethanol concentration was recorded. Othermethodological details are given in tables and figures.

Assays. Biomass was estimated from optical den-sity at 600 nm. Dry mass was calculated by referringto a standard curve of cell mass versus absorbance(Hughest et al., 1984). Ethanol was quantified usingthe Gonchar et al. (2001) method in own modificationusing o-dianisidine instead of 3,3,5,5,-tetramethylben-zidine (TMB) as chromogen.

Extracellular catalase activity was measured spec-trophotometrically by observing the decrease in lightabsorption at 525 nm during decomposition of H2O2by the enzyme (Fiedurek and Gromada, 1997). Oneunit (U) of catalase activity was defined as the amountof enzyme catalysing the decomposition of 1 µmolhydrogen peroxide per min at 30°C. Fermentationswere performed in 2 replicate cultures, and analyseswere carried out in duplicate. The data given here arethe averages of the measurements.

Measurement of respiration. Cell suspensions,prepared as described above, were used to measurethe rate of yeast respiration at various medium pH,either in the absence or in the presence of ethanol.Other methodological details are given in the tablesand figures. Oxygen concentration in the culture me-dium was measured by a polarographic dissolvedoxygen sensor (Ingold, CH Industrie Nord, Urdorf,Switzerland). The readings were expressed as per-centage of the initial level of saturation (100%).

Results

Production of ethanol during fermentation is lim-ited by the inability of yeast to grow at high ethanollevels, which is why a great deal of effort has beendevoted to creating yeast strains that would toleratehigh ethanol levels, and be able to continue the fer-mentation to produce higher concentrations of alcohol.

The development of such strains would have themajor advantage of saving the energy involved in dis-tilling and refining ethanol.

A total of 24 yeast strains were tested for their capac-ity to produce ethanol, and of these, 8 were character-ized by the best ethanol yields (73.11�81.78%). Etha-nol production, catalase activity, and ethanol yieldwere monitored on synthetic medium A. The effectsof increasing sucrose concentration from 15 to 40%on ethanol yield, catalase activity and biomass of theyeast strains were examined. Along with the increasein sucrose concentration from 15 to 40%, a decreasein biomass and ethanol yield was observed. On theother hand, the increase enhanced extracellular cata-lase production, probably as an effect of stress condi-tions. Among the 24 strains, 13 (54.2%) were charac-terized by high catalase activity when grown ona medium with a high sucrose concentration (40%)(Table I). The increase in sucrose concentration in themedium (from 15 to 40%) caused a significant (1.02to 3-fold) reduction in biomass production.

For further selection an industrial strain of Sac-charomyces cerevisiae ER characterized by high etha-nol tolerance, higher cell viability especially during�very high gravity� fermentation, and working undera wide range of temperatures (35�40°C) was used.This strain was used for preparation of inocula foradaptation with high concentrations of ethanol (5 to15%) in order to select ethanol-tolerant yeast. Newderivatives of S. cerevisiae were isolated from adaptedcultures after 10 months of serial transfers. Duringthis period about 120 subsequent transfers were per-formed. At the end of this period, a two clones wereselected from enrichment for further study; thoseclones, designated as strain S. cerevisiae: ER-A andER-M, were able to grown at 15% of ethanol inthe medium (data not shown). When subjected toa stepwise increase in ethanol concentration withrepetitive cultivations, the yeast cells S. cerevisiaeER-A adapted to the high ethanol concentrationshowed better biomass accumulation in the mediumcontaining the same ethanol concentration, in com-parison to the cells of the parent strain (Table II). Thisstrain was used for further study.

The most active mutant, S. cerevisiae ER-A, resis-tant to ethanol stress, was characterized by high resis-tance to acidic (pH 1.0 and 2.0), oxidative (1 and 2%of H2O2) and high temperature (45 and 52oC) stresses.The viability of mutants during cultivation under allthe mentioned stress conditions increased about 1.04to 3,94-fold in comparison with the parent strainS. cerevisiae ER. It is worth noting, that mutant ofS. cerevisiae ER-A resistant to ethanol stress, generallyshowed a better adaptation to higher ethanol concen-tration, as expressed by the increased (about 4-fold)viability at 20% of ethanol in comparison to its 10%


concentration (Table III). A similar trend was also ob-served for oxidative (1 and 2% of H2O2) and high tem-perature (45 and 52°C) stress, when higher numbers ofcells survived in more drastic stress conditions.

Measurements of oxygen consumption at 30°Cand pH 4.5 showed that ethanol inhibited the respira-tion rate of yeast. In the absence of added ethanol, theoxygen concentration decreased gradually over thefirst 15 min to the level of about 6%. When the experi-ment was repeated in the presence of 5% (w/v) etha-nol, the respiration rate of the yeast cells was markedlyinhibited, and the oxygen concentration fell more

slowly, reaching 10.7% after 20 min. The higher con-centration (10%) of ethanol significantly reducedoxygen consumption; in these conditions, more thanhalf of the initial dissolved oxygen content remained

Low pH (2.0) 81.99 93.70 1.14

Low pH (1.0) 3.85 7.14 1.85

Oxidative stress (1% H2O

2) 80.90 100.0 1.24

Oxidative stress (2% H2O

2) 72.0 96.50 1.34

High temperature (45oC) 47.59 69.85 1.46

High temperature (52oC) 26.34 43.17 1.64Ethanol (10%) 89.25 90.37 1.04

Ethanol (15%) 61.02 77.93 1.28

Ethanol (20%) 10.00 39.40 3.94

Table IIIEffect of abiotic stresses on surviving cells

of Saccharomyces cerevisiae ER

Stress conditionsSurviving cells (%)a Relative

to the wild-type (-fold)Parent ER-A

The strains were incubated in 50 ml conical flasks, each containing20 ml of basal medium during 24 h of stress conditions. Low pH mediawere obtained by adding 0.1 M HC1. a Values are averages of 4 replicate determinations with standard devia-tions of < ± 4%

Saccharomyces cerevisiae ER (parent)

Control (none) 2.33 3.04

11 1.10 1.6712 0.58 1.11

13 0.41 0.63

1415 0.19 0.22

Saccharomyces cerevisiae ER-A

Control (none) 2.42 2.74 1.04 0.9011 1.35 1.67 1.23 1.00

12 0.65 1.24 1.12 1.12

13 0.53 0.87 1.29 1.3814 0.44 0.77 1.42 1.64

15 0.30 0.36 1.58 1.64

Table IIEffect of ethanol concentration on biomass production

Ethanol (% w/v)

Dry matter(g/l)a after

24 h 48 h

Relative to the parent-type (-fold)

The strains were incubated in 50 ml conical flasks, each containing20 ml of basal medium A with ethanol (11�15%) during 24�48 h.a Values are averages of 6 replicate determinations with standard devia-tions of < ± 6%

48 h 24 h

Saccharomyces cerevisiae ER (parent)

Control (none) 39.13 73.90 2.335 21.74 39.13 1.73

10 4.35 4.35 1.36

11 0 4.30 1.1012 0 0 0.58

13 0 0 0.39

14 0 0 0.2815 0 0 0.19

Saccharomyces cerevisiae ER-A

Control (none) 43.48 100.00 2.465 30.43 52.17 2.25

10 5.43 13.44 1.50

11 4.43 13.00 1.3512 0 4.35 0.70

13 0 0 0.53

14 0 0 0.4415 0 0 0.34

Table IVEffect of externally added ethanol at concentration 0�15%

on CO2 and biomass production by parent and adapted strain

of Saccharomyces cerevisiae MR-A

Ethanol(% w/v)

Relative metabolic rate (%)a, b

Mixing(90 rpm)

Mixing(180 rpm)

Dry matter(g/l)b

a Relative metabolic rate (%) was calculated by counting the number ofbubbles of CO2 released from fermentative tubes during 60 min. Maxi-mal amount of bubbles formed during culture of the adapted strain ER-A was defined as 100%. The strains were incubated in 50 ml conicalflasks, each containing 20 ml of basal medium A with ethanol (5�15%)during 24 h

b Values are averages of 6 replicate determinations with standard devia-tions of < ± 5%

Saccharomyces cerevisiae ER (parent)a

Basal medium A 6.30 78.06 5.38

Modified basal medium Awith (NH

4)

2SO

4 � 1,0% 7.10 87.98 6.75

Saccharomyces cerevisiae ER-A a

Basal medium A 7.20 89.22 5.04

Modified basal medium Awith (NH

4)

2SO

4 � 1,0%

8.00 99.13 6.23

Table VEffect of (NH

4)

2SO

4 concentration on ethanol production

MediumEthanol(% w/v)

Ethanol yield(% of

theoretical)

Drymatter(g/l)

Fermentation conditions: inoculation: 2× 107 cells/ml, time fermenta-tion 72 h at 30°C in shaker 90 rpm. The strain was incubated in 50 mlconical flasks, each containing 20 ml of basal medium A containing 0.3and 1.0% of with (NH4)2SO4.a Values are averages of 6 replicate determinations with standard devia-tions of < ± 5%


in the medium after 20 min from the beginning of theexperiment (Fig. 1a). The adapted cells of S. cerevisiaeER-A consumed more oxygen than the parent strainin media with all the tested ethanol concentrations(Fig. 1b). After 20 min of respiration, the levels ofoxygen concentration in media with 5% and 10%ethanol were lower by 10.7% and 13.2%, respectively,as compared with values for the parent strain.

The effect of 5�15% ethanol externally added tobasal medium A on CO2 production by the parent andthe adapted strain of S. cerevisiae ER-A was exam-

ined. In comparison with the parent strain, the meta-bolic activity of adapted cells of S. cerevisiae ER-Ashowed higher resistance to inhibition by ethanolwhen the cells were grown with 5 and 10% (w/v)ethanol. The higher concentration (11%) of ethanolcompletely inhibited metabolic activity of the parentstrain when culture was carried out in a shaker at90 rpm, and adapted cells showed insignificant activityin these conditions. Under a higher mixing rate (180rpm), at 11% of ethanol, adapted cells of S. cerevisiaeER-A were characterized by an about 3-fold higher

Fig. 1. Effect of ethanol concentration in the medium on the oxygen consumption of Saccharomyces cerevisiae ER strain (a)and Saccharomyces cerevisiae ER-A strain (b).

The values shown represent the mean of three experiments. Error bars represent standard deviations.

a)

b)


metabolic activity than the parent strain. A further in-crease in ethanol concentration in basal medium A to12% completely inhibited metabolic activity of theparent strain, and the adapted strain showed verysmall this activity in these conditions (Table IV).

Table V compares ethanol production by the pa-rental and the mutant strain of S. cerevisiae ER-A inbasal and modified medium A. The highest ethanolyields for the two strains were obtained on modifiedmedium A, containing 15% of sucrose, 1% of yeastextract, 1% of (NH4)2SO4 and 1% of KH2PO4, usinga very simple fermentation system (shake flask). Con-siderably better results were achieved for mutantS. cerevisiae ER-A, which was characterized by anethanol yield of 99.13% and an ethanol concentrationof 8.0%; the respective values for the parental strainwere 87.98 % and 7.1%.

Discussion

Tolerance to high ethanol and sucrose concentra-tions is an important property of industrial micro-organisms. The accumulation of ethanol during culti-vation causes stress to yeast cells, leading to a decreasein cell growth and production of target products. Thus,understanding the process of adaptation of yeast tohigh ethanol concentrations is important as it maylead to the construction of yeast strains able to growwell at high ethanol concentrations. Such ethanol-tol-erant yeasts are highly desirable for the productionof useful compounds. Improving ethanol tolerance inyeast should, therefore, reduce the impact of ethanoltoxicity on fermentation performance (Dinh et al.,2008; Stanley et al., 2010).

Stanley et al. (2010) obtained ethanol-tolerant yeastmutants by subjecting mutagenised and non-muta-genised populations of S. cerevisiae W303-1A to adap-tive evolution using ethanol stress as a selection pres-sure. Mutants CM1 (chemically mutagenised) and SM1(spontaneous) had increased acclimation and growthrates when cultivated in sub-lethal ethanol concentra-tions, and their survivability in lethal ethanol concen-trations was considerably improved compared withthe parent strain. Those authors suggested that theincreased ethanol tolerance of the mutants was dueto their elevated glycerol production rates and thepotential of these to increase the ratio of oxidisedand reduced forms of nicotinamide adenine dinucle-otide (NAD+/NADH) in an ethanol-compromisedcell, stimulating glycolytic activity.

The viability of the adapted S. cerevisiae ER-Awas always higher than for the parental strain, for allthe stress conditions used (Table III). For example,the viable population (expressed as a percentage ofthe initial population) of the ER- culture after 24 h in

20% (w/v) ethanol was 39.40%, respectively, com-pared with 10.0% for the parent. Similar viabilitycharacterized SM1 and CM1 cultures obtained byStanley et al. (2010) under lethal ethanol stress con-ditions (12% (w/v) ethanol, after 12 h) � 52% and44%, respectively, compared with 5% for the parent.

Some researchers have analyzed phenomena asso-ciated with adaptation of yeast cells to high ethanolconcentrations. Lloyd et al. (1993) found that yeastpreviously grown in the presence of 5% ethanol couldgrow in the medium containing 10% ethanol, whereasyeast inoculated directly into a medium containing10% ethanol failed to grow. Ismail and Ali (1971)reported that no increase in the tolerance of yeast toa high ethanol concentration was observed after tensuccessive transfers to an environment containinga high ethanol concentration. Therefore, it is expectedthat exposing yeast cells to a stepwise increase in thelevel of ethanol stress should be effective for obtain-ing ethanol-tolerant yeast strains.

The results presented above confirmed that anadapted strain resistant to ethanol stress generallyshowed better adaptation to other stress conditions,as expressed by the increased survival of the mutantof S. cerevisiae ER-A during cultivation under acidic(pH 1.0 and 2.0), oxidative (1 and 2% of H2O2), andhigh temperature (45 and 52°C) stresses. It is worthnoting that in the more drastic stress conditions, theethanol-tolerant mutant was characterized by a highersurvival rate. This is in accordance with data presentedby Ogawa et al. (2000), who showed that several geneswere highly expressed only in the ethanol-tolerant mu-tant but not in the parent strain. The ethanol-tolerantmutant also exhibited resistance to other stressesincluding heat, high osmolarity, and oxidative stressin addition to ethanol tolerance. These results indicatethat the mutant exhibits multiple stress tolerances dueto elevated expression of stress-responsive genes,resulting in accumulation of high amounts of stressprotective substances such as catalase, glycerol, andtrehalose (Ogawa et al., 2000). The ability of onestress condition to provide protection against otherstresses is referred to as cross-protection. Several stud-ies have shown that adaptation to acid stress confersresistance to a wide range of stress conditions includ-ing heat, salt, crystal violet, and polymyxin B (Leeet al., 1995; Bearson et al., 1997). However, adapta-tion to other stresses does not typically induce signi-ficant acid tolerance. This implies that acid exposuremay be treated by microorganisms as a more generalstress indicator, whereas salt and H2O2 may be morespecific stress signals.

A number of specific selection schemes have beenelaborated to improve the biosynthetic capacity ofproduction strains. Thus the acid tolerance of Leuco-nostoc oenos was examined in cells surviving at pH


2.6, which is lower than the acid limit of growth (aboutpH 3.0). The acid-resistant mutant L. oenos, wasfound to be able to grow in acidic media and charac-terized by a high H +�ATPase activity at low pH. Suchstrains may be an important part of the technology ofmodern commercial wine production (Drici-Cachonet al., 1996). Accumulation of a large amounts ofmetabolic end-products during the fermentation period,especially in case of industrial amino acid fermenta-tion, builds up a high osmotic strength which affectsboth growth and production. Enhanced l-treonine pro-duction by salt tolerant mutants of E. coli was achieved(Drici-Cachon et al., 1996). Some mutants have beendescribed in E. coli which are more resistant to celllysis in the presence of ethanol (Fried and Novick1973; Ingram et al., 1980). In this respect, our resultsobtained in ethanol production can be compared withdata provided by Ortiz-Zamora et al. (2008), who iso-lated and selected yeast strains from alcoholic fermen-tations of natural sources. These strains were exposedseveral times to high concentrations of glucose andethanol in order to select ethanol- and glucose-tolerant yeast; 10 were obtained that adapted best tothese conditions. Some of these strains demonstratedthe highest adaptation to both ethanol (5�7% w/v) andglucose (20% w/v). The maximum yield obtained was0.46 g/g (90% theoretical yield) in a 20-L bioreactorwith cane molasses.

Araque et al. (2008) selected thermotolerant yeaststrains Saccharomyces cerevisiae for bioethanol pro-duction, which were able to grow and ferment glucosein the temperature range 35�45°C. All the strainsgrew (in agar plates) at 35 and 40°C, only two strainsgrew at 42°C, and no strain grew at 45°C. Glucose-to-ethanol conversion yield was between 50% and80% of the theoretical value. The ethanol yields bySSF using the selected strain were higher than thoseobtained using the control yeast.

The selected strain, S. cerevisiae ER-A, showed anability to grow and ferment sucrose at ethanol concen-trations in the medium of 15 and 12% (w/v), res-pectively (Tables II and IV). Its resistance to ethanol,externally added to the medium, was significantlyhigher than for the parent strain. An increase in therate of mixing from 90 to 180 rpm correlated witha simultaneous increase in the relative fermentationrate (%) both for the parent and the adapted strain,probably as an effect of a higher mass transfer. Theeffect of ethanol on yeast growth and fermentation hasbeen studied by Brown et al. (1981).These authorsshowed complex kinetics which resulted from bothan inhibition of the growth rate itself and also a reduc-tion in cell viability. The growth and viability effectshad different inhibition constants. Contrary to ourdata, ethanol was less inhibitory toward fermentationthan toward growth in sake yeast.

Some data suggest that an improvement in ethanoltolerance leads to an increase in both ethanol produc-tion rate and the total amount of ethanol produced(Jiménez and Benítez, 1988). The adapted S. cerevisiaeER-A reached an ethanol concentration of 80 g/l, anethanol productivity of 1.1 g/l/h, and an ethanol yield(% of theoretical) 99.13. Those values were signifi-cantly higher in comparison with the parent strain(ethanol concentration of 72.9 g/l and productivity of1,01 g/l/h).

The studies presented above seem to confirm thehigh effectiveness of selection of resistant yeaststrains by adaptation to high ethanol concentrationsfor increased ethanol production. Additionally, betteradaptation of these mutants to abiotic stresses canaffect yeast growth and ethanol productivity. Theadvantage gained in direct screening is to reduce ina very specific way the number of cultures isolatedfrom the plates, which would normally require testingof productivity via shake flask cultures. This is a signi-ficant contribution to make screening of ethanol-pro-ducing yeast more efficient. The ethanol tolerant strainwas stable in the subsequent subcultures in the absenceof stress during 6 months. It can be concluded fromthe present results that the adapted strain S. cerevisiaeER-A showed, at this stage of our studies, a moderatefermentation activity, which gave reasonable ethanolyields from sucrose. Further improvements to the iso-lated yeast strain and the growth conditions are neces-sary to utilize the strain for larger-scale fermentation.

AcknowledgementsThe authors wish to thank Prof. Józef Kur (Department of

Microbiology Chemical Faculty, Gdañsk University of Techno-logy, Poland) for supplying yeast strain Saccharomyces cerevisiaeER (Ethanol Red).

This work was financially supported by Research ProgramBW/BiNoZ/UMCS.

Literature

Alper H., J. Moxley, E. Nevoigt, G.R. Fink and G. Ste-phanopoulos. 2006. Engineering yeast transcription machineryfor improved ethanol tolerance and production. Science 314:1565�1568.Araque E., C. Parra, M. Rodríguez, J. Freer and J. Baeza.2008. Selection of thermotolerant yeast strains Saccharomycescerevisiae for bioethanol production. Enzyme Microb. Technol.43: 120�123.Bearson S., B. Bearson and J.W. Foster. 1997. Acid stress re-sponses in enterobacteria. FEMS Microbiol. Lett. 147: 173�180.Brown S.W., S.G. Oliver, D.E.F. Harrison and R.C. Righelato.1981. Ethanol inhibition of yeast growth and fermentation: Differ-ences in the magnitude and complexity of the effect. J. Appl.Microbiol. Biotechnol. 11: 153�155.Brown S.W. and S.G. Oliver. 1982. Isolation of ethanol-tolerantmutants of yeast by continuous selection. Eur. J. Appl. Microbiol.Biotechnol. 16: 119�122.


Da Silva F.L.H., M.I. Rodrigues and F. Maugeri. 1999. Dynamicmodeling simulation and optimization of an extractive continuousalcoholic fermentation process. J. Chem. Technol. Biotechnol.74: 176�182.Dinh T.N., K. Nagahisa, T. Hirasawa, C. Furusawa andH. Shimizu. 2008. Adaptation of Saccharomyces cerevisiae cellsto high ethanol concentration and changes in fatty acid composi-tion of membrane and cell size. PLoS ONE 3(7):e2623. doi:10.1371/journal.pone.0002623.Drici-Cachon Z., J. Guzzo, J.F. Cavin and C. Divies. 1996.Acid tolerance in Leuconostoc oenos. Isolation and characteriza-tion of an acid-resistant mutant. Appl. Microbiol. Biotechnol. 44:785�789.Fried V.A. and A. Novick. 1973. Organic solvents as probes forthe structure and function of the membrane: effects of ethanol onthe wild and ethanol resistant mutant of Escherichia coli K-12.J. Bacteriol. 114: 239�248.Gibson B.R., S.J. Lawrence, J.P. Leclaire, C.D. Powell andK.A. Smart. 2007. Yeast responses to stresses associated withindustrial brewery handling. FEMS Microbiol. Rev. 31: 535�69.Gonchar M.V., M.M. Maidan, H.M. Pavlishko and A. Sibirny.2001. A new oxidase-peroxidase kit for ethanol assays in alco-holic beverages. Food Technol. Biotechnol. 39: 37�42.Fiedurek J. and A. Gromada. 1997. Selection of biochemicalmutants of Aspergillus niger with enhanced catalase production.Appl. Microb. Biotechnol. 47: 313�316.Hirasawa T., K. Yoshikawa, Y. Nakakura, K. Nagahisa,C. Furusawa, Y. Katakura, H. Shimizu and S. Shioya. 2007.Identification of target genes conferring ethanol stress toleranceto Saccharomyces cerevisiae based on DNA microarray dataanalysis. J. Biotechnol. 131: 34�44.Hughest D.B., N.J. Tudroszen and C.J. Moye. 1984. The effectof temperature on the kinetics of ethanol production by a thermo-tolerant strain of Kluyveromyces marxianus. Biotechnol. Lett. 6:1�6.Ingram L.O., N.S. Vreeland and L.C. Eaton. 1980. Alcohol tole-rance in Escherichia coli: a proposed common mechanism forchanges induced by ethanol. Pharmacol. Biochem. Behav. 13:191�195.Ismail A.A. and M.M. Ali. 1971. Selection of high ethanol-yield-ing Saccharomyces I. Ethanol tolerance and the effect of training inSaccharomycess cerevisiae Hansen. Folia Microbiol. 16: 346�369.Jiménez J. and T. Benítez. 1988. Selection of ethanol-tolerantyeast hybrids in pH-regulated continuous culture. Appl. Environ.Microbiol. 54: 917�922.Jones T.D., J.M. Havard and A.J. Daugulis. 1993. Ethanol pro-duction from lactose by extractive fermentation. Biotechnol. Lett.15: 871�876.

Lee I.S., J. Lin, H.K. Hall, B. Bearson and J.W. Foster. 1995.The stationary-phase sigma factor sS (RpoS) is required for a sus-tained acid tolerance response in virulent Salmonella typhimurium.Mol. Microbiol. 17: 155�167.Lloyd D., S. Morrell, H.N. Carlsen, H. Degn, P.E. James andC.C. Rowlands. 1993. Effects of growth with ethanol on fermen-tation and membrane fluidity of Saccharomyces cerevisiae. Yeast9: 825�833.Nishiwaki A. and I.J. Dunn. 1998. Analysis of a two-stage fer-mentor with recycle for continuous ethanol production. Chem.Eng. Commun. 168: 207�227.Ogawa Y., A. Nitta, H. Uchiyama, I. Takesh, H. Shimoi andK. Ito. 2000. Tolerance mechanism of the ethanol-tolerant mutantof sake yeast. J. Biosc. Bioeng. 90: 313�320.Ortiz-Zamora O., R. Cortés-García, M. Ramírez-Lepe,J. Gómez-Rodríguez and M.G. Aguilar-Uscanga. 2008. Isola-tion and selection of ethanol-resistant and osmotolerant yeastsfrom regional agricultural sources in Mexico. J. Food. Process.Engin. 32: 775�786.Remize F., J.L. Roustan, J.M. Sablayrolles, P. Barre P andS. Dequin. 1999. Glycerol overproduction by engineered Saccha-romyces cerevisiae wine yeast strains leads to substantial changesin by-product formation and to a stimulation of fermentation ratein stationary phase. Appl. Environ. Microbiol. 65: 143�149.Schubert C. 2006. Can biofuels finally take center stage? Nat.Biotechnol. 24: 777�784.Stanley D., S. Fraser, P.J. Chambers, P. Rogers andG.A. Stanley. 2010. Generation and characterisation of stableethanol-tolerant mutants of Saccharomyces cerevisiae. J. Ind.Microbiol. Biotechnol. 37: 139�149.Van Uden N. 1985. Ethanol toxicity and ethanol tolerance inyeasts. Ann. Rep. Ferm. Process. 8: 11�58.de Vasconcelos J.N., C.E. Lopes and F.P. de Franca. 2004. Con-tinuous ethanol production using yeast immobilized on sugar-canestalks. Braz. J. Chem. Eng. 21: 357�365.Verbelen P.J., D.P. De Schutter, F. Delvaux, K.J. Verstrepenand F.R. Delvaux. 2006. Immobilized yeast cell systems for con-tinuous fermentation applications. Biotechnol. Lett. 28: 1515�1525.Viegas C.A., M.F. Rosa, I. Sa-Correia and J.M. Novais. 1989.Inhibition of yeast growth by octanoic and decanoic acids pro-duced during ethanolic fermentation. Appl. Environ. Microbiol.55: 21�28.Wang F.S. and H.T. Lin. 2010. Fuzzy optimization of continuousfermentations with cell recycling for ethanol production. Ind. Eng.Chem. Res. 49: 2306�2311.You K.M., C.L. Rosenfield and D.C. Knipple. 2003. Ethanoltolerance in the yeast Saccharomyces cerevisiae is dependent oncellular oleic acid content. Appl. Environ. Microbiol. 69: 1499�503.


ORIGINAL PAPER

* Corresponding author: A. Gniadek, PhD, Department of Medical and Environmental Nursing, Faculty of Health Sciences,Jagiellonian University Medical College, 12 Micha³owskiego str., 31-126 Kraków, Poland; phone: (+48 12) 6336259; fax: (+48 12) 429482;e-mail: [email protected]

Introduction

There is evidence that a number of Aspergillusfungi present in hospital environment produce toxins(Burr, 2001; Ben-Ami et al., 2009; Klich et al., 2009).Their secondary metabolites such as ochratoxin A,aflatoxins, trichotecins or sterigmatocystine are toxicfor various cellular structures and interfere with keyprocesses like RNA and DNA synthesis (Ciegler andBennet, 1980). Depending on fungal species and/orstrain, mycotoxins differ in their specificity and influ-ence on target cells, cellular structures and processesin them (Steyn, 1995; Pitt, 2000). It should be alsokept in mind that not all moulds produce mycotoxins,and their production depends on culture medium, lifecycle and environmental conditions (Pitt et al., 2000;Kelman et al., 2004). To assess the ability of a givenstrain to produce mycotoxins, the presence of othermoulds in the environment should be taken intoaccount as well as their influence on mycotoxin pro-duction intensity. It has been documented that thefungi incubated in monocultures in laboratory setting

lose their mycotoxin production potential (Fischerand Dott, 2003; Jarvis and Miller, 2005). The abilityof fungi to produce mycotoxins is hard to evaluatebecause there is a no possibility to analyze the myco-toxins produced in the tissues of living organisms.The relationship between disease (or predispositionto it) and the level of exposure (detection of patho-genic spores) as well as symptoms and signs charac-teristic of experimental lesions produced by myco-toxins may contribute to establishing the noxiousnessof fungi to human health. The objective of the studywas evaluation of the cytotoxicity of Aspergillus fungiisolated from hospital environment.

Experimental


The materials comprised mould strains belongingto the Aspergillus genus, isolated from the environment,mainly from indoor air in hospital rooms at a numberof hospitals in Kraków in the years 2007�2008.

Cytotoxicity of Aspergillus Fungi Isolated from Hospital Environment

AGNIESZKA GNIADEK1, ANNA B. MACURA2 and MACIEJ GÓRKIEWICZ3

1 Department of Medical and Environmental Nursing, Faculty of Health SciencesJagiellonian University Medical College, Kraków, Poland

2 Department of Mycology, Chair of Microbiology, Jagiellonian University Medical College, Kraków, Poland3 Department of Epidemiology and Population Research, Jagiellonian University Medical College, Kraków, Poland

Received 18 May 2010, revised 10 January 2011, accepted 14 January 2011

A b s t r a c t

The majority of mycotoxins produced by Aspergillus fungi are immunosuppressive agents, and their cytotoxicity may impair defensemechanisms in humans. The objective of the study was evaluation of the cytotoxicity of fungi isolated from an environment whereinpatients with impaired immunity were present. The materials comprised 57 fungal strains: Aspergillus fumigatus, Aspergillus niger.Aspergillus ochraceus, Aspergillus flavus, Aspergillus versicolor and Aspergillus ustus isolated from hospital rooms in Cracow. Thecytotoxicity of all the strains was evaluated using the MTT test (3-(4,5-dimethylthiazol-2-yl) 2,5 diphenyltetrazolium bromide). To emphasizethe differences in cytotoxicity among the particular strains, variance analysis (ANOVA) and Tukey�s difference test were used. Out of57 Aspergillus strains tested, 48 (84%) turned out to be cytotoxic. The cytyotoxicity was high (+++) in 21 strains, mainly in A. fumigatus.The least cytotoxic were A. niger fungi, this being statistically significant (p<0,05). To protect a patient from the adverse effects ofmycotoxins, not only his or her immunity status should be evaluated but also the presence of fungi in hospital environment and theircytotoxicity should be monitored (possible exposure).

K e y w o r d s: Aspergillus sp., cytotoxicity, environment

60 Gniadek A. et al. 1

Primarily, the mycological flora was evaluated in hos-pital ward environment (neonatal intensive care unit,medical intensive therapy unit, the wards of chemo-therapy and radiotherapy). The fungi were sampledusing a MAS 100 device (Merck) from the indoor airin various hospital rooms. The species of particularstrains were detected on the basis of thorough macro-scopic and microspocic analysis. Out of all of thefungi isolated, 57 Aspergillus strains were randomlychosen for further examination. The chosen strainsbelonged to six species: A. fumigatus (21 strains),A. niger (14 strains), A. ochraceus (13 strains), A. fla-vus (5 strains), A. versicolor (3 strains) and A. ustus(a single strain). The fungi were divided into groups:each group comprised different species. The cytotoxi-city test MTT (3-(4,5-dimethylthiazol-2-yl) 2,5 diphe-nyltetrazolium bromide) was performed separately foreach strain. To evaluate the total cytotoxicity of thefungi, swine kidney cells (SK) were used because theyare sensitive to most mycotoxins. The test is based onthe reduction of yellow MTT tetrazolium salt to violetformazan, insoluble in water. The reduction occurs inthe presence of intact SK, not damaged by mycotoxins.The intensity of reaction is proportional to the amountof metabolically active SK. When the SK are infectedwith moulds producing mycotoxins, their mitochon-dria fail to reduce tetrazolium salt into formazan.Therefore, when the SK are damaged by mycotoxins,the reaction is less intensive or does not occur, whichcan be measured photometrically as more or lessintensive change of colour. Thus, the reduction or theabsence of the reaction gives evidence of cytotoxicityof the fungal strain tested. (Hanelt et al., 1994).

The analysis comprised the evaluation of a testsample (Petri dish with the mould on Czapek medium)and a control sample (Petri dish with Czapek medium).The SK were grown in medium containing antibiotics(penicillin and streptomycin, Sigma Aldrich) and calffetal serum (Sigma Aldrich) in the Hera Cell incuba-tor with carbon dioxide, manufactured by Heraeus(5% CO2, 37°C, 98% humidity). The number of SKwas 2.2×105. The ranges of testing concentrationswere prepared in ratio 1:2 and amounted from 31.251to 0.061 cm2/ml. The value was expressed in terms ofcm2/ml, where the area of the Petri dish from whichthe moulds were extracted together with the medium,was measured in square centimetres.

The quantitative evaluation of cytotoxicity was per-formed using a microslide spectrophotometer (ElisaDigiscan reader, Asys Hitech GmbH, Austria) and theprogramme MikroWin 2000 (Mikrotek LaborsystemeGmbH, Germany). The readings were made at thewave-length of 510 nm. All of the absorption valuesbelow 50% of the threshold activity were consideredas toxic. So, the borderline toxic concentration wasevaluated on the basis of the dilution i.e. the mean

inhibitory concentration IC50 was equal to the small-est sample (in cm2/ml) which was toxic to the SK.The cytotoxicity was considered as low (+) when thevalues were within the range of 31.251>15.625>7.813[cm2/ml], intermediate (++) for the values >3.906>1.953>0.977 [cm2/ml], and high (+++) for >0.488>0.244>0.122>0.061. The lack of cytotoxicity wasreported when the absorption value exceeded 31.251[cm2/ml] (Gareis, 1994).

The cytotoxicity was tested in the Department ofPhysiology and Toxicology, Institute of ExperimentalBiology at the Casimirus the Great University inBydgoszcz, Poland.

To evaluate differences among the particular groupsof fungi, the fungi were divided into four groups. Thefirst group � I (21 strains) comprised fungi belongingto the A. fumigatus species, the second group � II(14 strains) A. niger, the third group � III (13 strains)A. ochraceus, and the fourth group � IV (9 strains)comprised the remaining strains (A. flavus, A. verisco-lor and A. ustus). Descriptive statistics were used, andthe mean values and standard deviations were calcu-lated. To show the differences of cytotoxicity of thespecies tested ANOVA test was used. As the meantoxicities were different in particular groups, theTuckey�s post hoc test was used to find out betweenwhich groups the differences were significant. Thevalue of p<0,05 was assumed as the borderline ofsignificance (Armitage, 1971).

Results

The amounts of fungi and fungal species variedfrom one room to another. The mean numbers of fungiin the particular wards varied from 5 to 2370 c.f.u.× m�3.The fungi were most abundant in the neonatal inten-sive care unit: the mean number of colonies on a singlePetri dish reflected 530 c.f.u.×m�3 in the indoor air.The lowest number of fungi was detected in thechemotherapy ward: 29 c.f.u.m�3 (Table I). The domi-nating genera were Penicillium, Cladosporium andAspergillus. The highest percentage of Aspergilluswas isolated in the neonatal intensive care unit: 38%.The moulds were the most abundant in this environ-ment. The lowest percentage of Aspergillus wasdetected in air-conditioned intensive therapy ward:22%. The total number of Aspergillus strains isolatedwas too high to evaluate cytotoxicity in all of them.The strains chosen to cytotoxicity test originated fromthree hospital wards because it was assumed that strainsfrom the same ward might be similar genotypically.

Out of the 57 Aspergillus strains tested, 48 (84%)turned out to be cytotoxic. They belonged to thefollowing species: A. fumigatus 19/21, A. niger 8/14,A. ochraceus 12/13, A. flavus 5/5, A. versicolor 3/3,

61Cytotoxicity of Aspergillus sp.1

and a single strain A. ustus. Only nine strains werenot cytotoxic (16%). The absorption value >31.251[cm2/ml] (lack of cytotoxicity) was most frequentlyfound in A. niger (six strains). Twenty one strains testedrevealed high cytotoxicity (+++), most often A. fumi-gatus (11 strains), and A. ochraceus (7 strains). Inter-mediate cytotoxicity was found in seventeen strains,mainly A. fumigatus. Ten strains revealed low cyto-toxicity, mainly A. niger and A. ochraceus (Table II).The ANOVA test revealed differences of the patho-

genicity within the particular fungal species (p = 0,03;p<0,05). The least cytotoxic was the Aspergillusniger species: its mean value 32.71 and SD 27.97were the highest among the fungi tested. The Tuckey�spost hoc test, performed following ANOVA, revealedthat the cytotoxicity of A. niger is significantly lowerthan those of A. fumigatus and A. ochraceus (p<0,05).The cytotoxicity of the other Aspergillus fungi(group IV) did not differ significantly from the threespecies mentioned above, which may be a result oftoo small number of fungi in the samples. Moreover,the confidence interval was calculated for each of thespecies tested; these are presented in Fig. 1.

Discussion

Moulds can grow mainly in the environment inwhich humidity exceeds 45%, the temperature iswithin the range of 5°C�35°C (optimum 18°�27°C).and water activity above 0.8. Such environment isconducive to the production of secondary metabolites� mycotoxins. Penicillium and Aspergillus are domina-ting mould species in the rooms where water activityis around 0.85 (Jarviss, 2003). The Aspergillus genusis the most pathogenic to living organisms, however,it globally produces less mycotoxins than Stachybotryseven though the former dominates in the environment.This may not be true in all the Aspergillus species,because sterigmatocystein produced by A. versicolormay contribute to 1% of its biomass when water acti-vity is equal to one (Fog Nielsen, 2003). We managedto isolate only three A. versicolor strains and to evalu-ate their cytotoxicity, which was intermediate in allcases. Such a small number of isolates resulted fromthe fact that this fungal species is rarely isolated in-door and is present mainly in colder regions such asmountains or polar areas. The species most frequentlyisolated from indoor air are A. fumigatus and A. niger.Just these two species were most often isolated in ourstudy and examined for cytotoxicity.

It is reported in many papers that A. fumigatusis the most pathogenic Aspergillus species (Bennett,

Radiotherapy 130 5 360 39,5 17,5 32% 9% 31% 28% 16 12

Chemotherapy 130 5 130 29 20 29% 8% 29% 34% 20 16

Neonatal ICU 30 50 2370 530 260 38% 18% 32% 12% 12 12

Intensive therapy 48 5 170 40 30 22% 17% 38% 23% 9 8

Table IResults of cytotoxicity tests

WardNumber

ofsamples

Numbers of fungal colonies c.f.u.×m�3 Percentage of fungi Numberof Aspergillus

strains examinedfor cytotoxicity

Number ofstrains withdocumentedcytotoxicityMinimum Maximum Mean Median A C P I

ICU � intensive care unit, A � Aspergillus sp., C � Cladosporium sp., P � Penicillium sp., I� other fungal

1 Aspergillus fumigatus 21 (37%) 2 1 7 11

2 Aspergillus niger 14 (25%) 6 3 3 2

3 Aspergillus ochraceus 13 (23%) 1 3 2 7

4 Aspergillus flavus 5 (8%) 0 2 2 1

5 Aspergillus veriscolor 3 (5%) 0 0 3 0

6 Aspergillus ustus 1 (2%) 0 1 0 0

Total 57 (100%) 9 10 17 21

Table IIDistribution of fungal species in relation to their cytotoxicity

No Species N (%)Cytotoxicity

None + ++ +++

N� Total number of fungi; (+) � low cytotoxicity;(++) � intermediate cytotoxicity; (+++) � high cytotoxicity

Fig. 1. Intervals of confidence 95% CI and mean valueof Aspergillus cytotoxicity estimated as difference between

reference level equal to 50 and measured value of IC 50 cm2/ml.Legend: the squares at the middle represent the mean value

of the estimated cytotoxicity, and the vertical lines represent the sizeof the confidence interval of the estimated cytotoxicity.


2009; Krishnan et al., 2009; Albrecht et al., 2010).This finding was confirmed by Kamei et al. (2002)who analyzed the virulence of A. fumigatus, A. flavus,A. niger and A. terreus and their influence on murinemacrophages. The macrophages treated with 1% A. fu-migatus filtrate were seriously damaged, up to necro-biosis while the damage caused by similar filtrates ofA. niger was lighter and that caused by A. flavus andA. terreus was almost undetectable. Those data areconsistent with our findings because A. fumigatus wasthe most frequently highly cytotoxic (+++) as com-pared with other species, and only two strains out od21 were not toxic to SK. On the other hand, only eightout of fourteen A. niger strains were cytotoxic, buttheir toxicity was the lowest as compared with otherspecies. All of the A. flavus strains were cytotoxic inour study. Only five strains were tested, perhaps toofew to come to a conclusion.

The MTT test focused on in vitro influence offungi on living cells is performed with swine, sheepor lamb cell cultures. Stec et al. (2007) investigated theinfluence of mycotoxins such as aflatoxin B, ochra-toxin, patuline, citrinine and zelarenon on various cellcultures. They found out that SK fibroblasts weremost sensitive to mycotoxins, however, the intensityof the yellow tetrazolium salt reduction to formazandepended on the kind of toxin. It appears that thechoice of SK in our study was appropriate, and itcould be expected that the majority of strains isolatedin our study might by pathogenic to living organisms.In further trials carried out by Stec et al. (2007) cellcultures responded in different ways to treatment withvarious mycotoxins. Therefore, it appears essential todetermine the kind of mycotoxins produced by highlymycotoxic fungi. It is not always possible. In our pre-vious study (Gniadek and Macura, 2003) performedin 2001 with 21 A. flavus strains isolated from theenvironment at social welfare homes were examinedfor aflatoxins B1, B2, G1 and G2 using high performanceliquid chromatography � HPLC. Aflatoxins were notdetected in any of the strains tested. The strains werenot tested using MTT, however we were not sure thatthey were not pathogenic. The isolated A. flavus strainscould produce the so called �masked mycotoxins�, e.g.aflatrem, aspergillic acid, cyclopiaze acid, kojic acid,maltoryzin, paspalicin or highly toxic sterigmatocys-tine. It should be kept in mind that fungi are able toproduce mycotoxins in presence of other fungi (toxicmetabolites are released only in a cross-reaction withtoxins secreted by other fungi). (Fischer et al., 2000).Such a conclusion may be confirmed by the findingsof Murtoniemi et al. (2005), who examined the influ-ence of cytotoxicity of various fungi (Stachybotryschartarum, Streptomyces californicus, A. veriscolorand Penicillium spinulosum) isolated from wet plasterbars on murine macrophages. They have shown that

some microcultures, after prolonged growth on wetcardboard sheets, were mutually stimulated or causeda synergic growth of cytotoxic fungi (especiallyS. chartarum and A. versicolor), but they did notcause inflammatory reaction in the cells tested.

Variable environmental conditions may stimulatefungi to produce mycotoxins, e.g. gliotoxin producedby A. fumigatus (Ben-Ami et al., 2009; Kwon-Chungand Sugui, 2009). This substance inhibits T-cell activ-ity, stimulates macrophage apoptosis and is includedinto pathogenesis of severe allergic rhinitis, bronchialasthma and allergic alveolitis in form of farmer�s lung,baker�s lung as well as allergic broncho-pulmonaryalveolitis (ABPA). The study carried out by Watanabeet al. (2004) gives evidence that a good access to oxy-gen stimulated A. fumigatus to produce toxic gliotoxinsand increased the general cytotoxicity of the fungi.The conditions in the rooms in our study were condu-cive to fungal growth: the mean temperature was 24°C,and humidity around 40%.

The indoor environment is an active ecosystemthat changes in the course of time and as a result ofchanging temperature and humidity, and in the pres-ence of other microorganisms. The toxin productionby moulds is influenced by those factors and dependsalso on the fungal culture age, the stage of sporula-tion and the access to nutrients (Kelman et al., 2004).The examination of the environment of a patient diag-nosed with a mycotoxin infection is most often per-formed after the initial phase of the disease and maynot reflect the exposure to harmful substances presentin the course of the disease (Gniadek et al., 2005;Hardin et al., 2003). On the basis of the measurementsof environmental factors which appeared after the in-fection, the real exposure at the onset of the diseasemay be only estimated. Therefore, it is a reasonableprophylactic measure to monitor mycological clean-ness of the environment where immunocompromisedpatients are present and to evaluate the cytotoxicityof the fungi known as pathogenic.

Conclusions. 1. The majority of the fungi Asper-gillus in the environment of the rooms tested werecytotoxic and most often (p<0,05) were non- A. niger.2. To protect patients from harmful influence of myco-toxins, the immunity status of the patients should beevaluated and the presence of fungi in the environ-ment should be monitored, including their cytotoxicitytesting (possible exposure).

Literature

Albrecht D., R. Guthke, A.A. Brakhage and O. Kniemeyer.2010. Integrative analysis of the heat shock response in Aspergil-lus fumigatus. BMC Genomics. 15: 11�32.

63Cytotoxicity of Aspergillus sp.1

Armitage P. 1971. Statistical Methods in Medical Research.Blackwell Scientific Publications. Oxford. p. 189�207Ben-Ami R., R.E. Lewis, K. Leventakos and D.P. Kontoyiannis.2009. Aspergillus fumigatus inhibits angiogenesis through theproduction of gliotoxin and other secondary metabolites. Blood.114: 5393�5399.Bennett J.W. 2009. Aspergillus: a primer for the novice. Med.Mycol. 47 (Suppl. 1): S5�12.Burr M.L. 2001. Health effects of indoor moldes. Rev. Environ.Health. 16: 97�103.Ciegler A. and J.W. Bennet. 1980. Mycotoxins and mycotoxi-cosis. Bioscience 30: 512�513.Fischer G. and W. Dott. 2003. Relevance of airborne fungi andtheir secondary metabolites for environmental, occupational andindoor hygiene. Arch. Microbiol. 179: 75�82.Fischer G., T. Müller, R. Schwalbe, R. Ostrowski andW. Dott. 2000. Species-specific profiles of mycotoxins pro-duced in cultures and associated with conidia of airbornefungi derived from biowaste. Int. J. Hyg. Environ. Health. 203:105�116.Fog Nielsen K. 2003. Mycotoxin production by indoor molds.Fungal Genet Biol. 39: 103�117.Gareis M. 1994. Cytotoxicity testing of samples originating fromproblem buildings. [In:] Fungi and Bacteria in Indoor Air Environ-ments: Health Effects, Detection and Remediation. E. Johanning(ed.), Eastern New York Occupational Health Program, SaratogaSprings, New York, USA, Proceedings. 139�144.Gniadek A. and Macura A.B. 2003. The presence of fungi inthe environment of social welfare homes and the mycotoxinsthreat (in Polish). Ann. Univ. Maria Sklodowska. Sect. D. Med.58 (Suppl 13): 416�421.Gniadek A., A.B. Macura, E. Oksiejczuk, E. Krajewska-Ku³ak and C. £ukaszuk. 2005. Fungi in the air of selected socialwelfare homes in the Ma³opolskie and Podlaskie provinces � a com-parative study. Int. Biodeterior. Biodegrad. 55: 85�91.Hanelt M., M. Gareis and B. Kollarczik. 1994. Cytotoxicity ofmycotoxins evaluated by the MTT-cell culture assay. Mycopatho-logia 128: 167�174.

Hardin B.D., B.J. Kelman and A. Saxon. 2003. Adverse humanhealth effects associated with molds in the indoor environment.J. Occup. Environ. Med. 45: 470�478.Jarvis B.B. 2003. Analysis for mycotoxins: the chemist�s perspec-tive. Arch. Environ. Health. 58: 479�483.Jarvis B.B. and J.D. Miller. 2005. Mycotoxins as harmful in-door air contaminants. Appl. Microbiol. Biotechnol. 66: 367�372.Kamei K., A. Watanabe, K. Nishimura and M. Miyaji. 2002.Cytotoxicity of Aspergillus fumigatus Culture Filtrate AgainstMacrophages. Nippon Ishinkin Gakkai Zasshi. 43: 37�41.Kelman B.J., C.A. Robbins, L.J. Swenson and B.D. Hardin.2004. Risk from inhaled mycotoxins in indoor office and residen-tial environments. Int. J. Toxicol. 23: 3�10.Klich M.A., S. Tang and D.W. Denning. 2009. Aflatoxin andochratoxin production by Aspergillus species under ex vivo condi-tions. Mycopathologia 168: 185�191.Krishnan S., E.K. Manavathu and P.H. Chandrasekar. 2009.Aspergillus flavus: an emerging non-fumigatus Aspergillus speciesof significance. Mycoses. 52: 206�222.Kwon-Chung K.J. and J.A. Sugui. 2009. What do we knowabout the role of gliotoxin in the pathobiology of Aspergillusfumigatus? Med. Mycol. 47 (Suppl. 1): S97�103.Murtoniemi T., P. Penttinen, A. Nevalainen and M.R. Hirvonen.2005. Effects of microbial cocultivation on inflammatory and cyto-toxic potential of spores. Inhal. Toxicol. 17: 681�693.Pitt J.I. 2000. Toxigenic fungi: which are important? Med. Mycol.38 (Suppl. 1): 17�22.Pitt J.I., J.C. Basilico, M.L. Abarca and C. López. 2000. Myco-toxins and toxigenic fungi. Med. Mycol. 38 (Suppl. 1): 41�46.Stec J., M. Szczotka and J. Ku�mak. 2007. Cytotoxicity of feed-borne mycotoxins to animal cell lines in vitro using MTT assay.Bull. Vet. Inst. Pulawy 51: 679�684.Steyn P.S. 1995. Mycotoxins, general view, chemistry and struc-ture. Toxicology Letters 82/83: 843�851.Watanabe A., K. Kamei, T. Sekine, H. Higurashi, E. Ochiai,Y. Hashimoto and K. Nishimura. 2004. Cytotoxic substancesfrom Aspergillus fumigatus in oxygenated or poorly oxygenatedenvironment. Mycopathologia 158: 1�7.


ORIGINAL PAPER

* Corresponding author: N.F. Omar, Botany Department, Faculty of Science, Mansoura University (Damietta Branch), NewDamietta, Egypt. P.O. Box 34517; e-mail: [email protected]

Introduction

Enzymes produced by thermophilic bacteria havebeen highlighted for their potential as biocatalysts inbiotechnology. The importance of this was referredto the general relationship between enzyme thermo-stability and the thermophilicity of the host bacterium(Herbert, 1992).

The "-amylase (EC 3.2.1.1) is a well-known endo-amylase that hydrolyzes starch by randomly cleavinginternal a- 1,4 � glucosidic linkages. The spectrum of"-amylase applications has widely used in manyfields, such as starch saccharification, textile, food,brewing, distilling industries, medical and analyticalchemistries (Pandey et al., 2000). Despite this, interestin new and improved "-amylase is growing vastly.Therefore, the search for thermostable Ca2+ indepen-dent "-amylase (Tonkova, 2006) is continuous. Enzy-mes of the thermophilic actinomycetes Thermoactino-myces species, especially their "-amylase (Ito et al.,2007), have attracted much interest because of theiractivity at high temperature. The advantages for usingthermostable "-amylases in industrial processes include

the decreased risk of contamination, the increased dif-fusion rate and the decreased cost of external cooling.In addition, the stability of biocatalysts is often a limi-ting factor in the selection of enzymes for industrialapplications due to the elevated temperature or extremepH of many biotechnological processes.

The aim of the investigations was to determine theoptimum conditions for production of highly activeand industrial stable "-amylase by an Egyptian isolateof the thermophilic actinomycete Thermoactinomycesvulgaris and to investigate the enzyme properties.

Experimental


T. vulgaris strain. T. vulgaris strain was isolatedfrom fertile soil samples collected from Egypt at50°C and identified according to Bergey�s Manualof Systematic Bacteriology (Lacey and Cross, 1989).The culture was maintained on Czapek-yeast-casein(CYC) agar slants.

Production and Partial Characterization of High Molecular Weight Extracellular"-amylase from Thermoactinomyces vulgaris Isolated from Egyptian Soil

M.I. ABOU DOBARA, A.K. EL-SAYED, A.A. EL-FALLAL and N.F. OMAR*

Botany Department, Faculty of Science, Mansoura University (Damietta Branch), Egypt

Received 14 July 2010, revised 15 January 2011, accepted 20 January 2011

A b s t r a c t

Optimizing production of "-amylase production by Thermoactinomyces vulgaris isolated from Egyptian soil was studied. The optimumincubation period, temperature and initial pH of medium for organism growth and enzyme yield were around 24 h, 55°C and 7.0,respectively. Maximum "-amylase activity was observed in a medium containing starch as carbon source. The other tested carbohydrates(cellulose, glucose, galactose, xylose, arabinose, lactose and maltose) inhibited the enzyme production. Adding tryptone as a nitrogensource exhibited a maximum activity of "-amylase. Bactopeptone and yeast extract gave also high activity comparing to the other nitrogensources (NH

4Cl, NH

4NO

3, NaNO

3, KNO

3, CH

3CO

2NH

4). Electrophoresis profile of the produced two "-amylase isozymes indicated

that the same pattern at about 135�145 kDa under different conditions. The optimum pH and temperature of the enzyme activity were 8.0and 60°C, respectively and enzyme was stable at 50°C over 6 hours. The enzyme was significantly inhibited by the addition of metal ions(Na+, Co2+ and Ca2+) whereas Cl� seemed to act as activator. The enzyme was not affected by 0.1 mM EDTA while higher concentration(10 mM EDTA) totally inactivated the enzyme.

K e y w o r d s: Thermoactinomyces vulgaris, high molecular weight "-amylase

66 Abou Dobara M.I. et al. 1

Production of "-amylase. The organism wasgrown in conical flasks containing starch-nitrate me-dium (Waksman, 1959) as a basal medium with pHadjusted to 7.5. The medium (20 ml taken in 250 mlErlenmeyer flasks) was inoculated with 1 ml of sporesuspension of pure colonies of the organism and in-cubated at 50°C with shaking (150 rpm) for 72 hours.

The initial pH of the medium (4.0�10.0), tempera-ture of incubation (30�60°C), and incubation period(12�96 h) were tested for "-amylase production. Dif-ferent carbon sources (1%) and nitrogen sources(equimolecular nitrogen amounts equivalent to thenitrogen content of the basal medium) were used foroptimization of nutritional factors. The various testedcarbon sources were: starch, cellulose, glucose, galac-tose, xylose, arabinose, lactose and maltose. The nitro-gen sources were included NH4Cl, NH4NO3, NaNO3,KNO3, ammonium acetate, bactopeptone, yeast extractand tryptone were tested.

On the compilation of the previous experiments,the cell-free enzyme supernatant was obtained by cen-trifugation at 8000×g for 20 min. Experiments werecarried out in triplicate and the results were treatedstatistically and standard errors are shown.

"-Amylase assay. The amylase assay was based onthe reduction in blue colour intensity resulting fromstarch hydrolysis (Palanivelu, 2001). The reactionmixture consisted of 0.4 ml of diluted enzyme, 0.5 mlof 0.1% soluble starch and 1 ml of phosphate buffer(0.1 M, pH 7) was incubated at 50°C for 10 minutes.The reaction was stopped by adding 0.5 ml of 0.1 NHCl and the colour was developed by adding 0.5 mlof (2% KI in 0.2% I2) solution. The optical density(OD) of the blue colour solution was determined usinga Unico 7200 SERIES spectrophotometer at 690 nm.One unit of enzyme activity is defined as the quantityof enzyme that caused 20% reduction of blue colourintensity of starch iodine solution at reaction incuba-tion temperature in 1 min per ml.

Intracellular protein content of T. vulgaris. Theharvested mycelia of T. vulgaris strain were used fordetermination of intracellular protein. Washed pelletswere dissolved in 20 ml of NaOH (1 M), and boiledfor 20 minutes. Dilution of clarified solution was usedto determine the intracellular protein concentrationusing Bradford method (1976). Bovine serum albuminwas used as standard.

Physicochemical properties of "-amylase. Enzy-me activity at various temperatures and pH was stud-ied by incubating reaction mixtures at different tem-peratures (30�80°C) and Tris-HCl buffer (pH 4.0�9.0).Enzyme stability at various temperatures was also stud-ied by pre-incubating cell-free supernatants for differ-ent time (1�6 h) at various temperatures (50°C�80°C).The effect of metal salts (NaCl, CoCl2 and CaCl2)and EDTA on activity was determined by adding of

different concentrations of each salt to the standardassay. Activities were expressed as a percentage ofthe maximal activity.

Ammonium sulphate precipitation of the en-zyme. The supernatant of culture was brought to 70%ammonium sulphate saturation in an ice bath. The pre-cipitated protein was collected by centrifugation at3000×g at 4°C and dissolved in 1�2 pellet volumesof phosphate buffer (0.1 M, pH 7.0). The enzymesolution was dialyzed overnight at 4°C against the samebuffer then concentrated over sucrose bed. The finalenzyme solution was taken for polyacrylamide gel elec-trophoresis (PAGE).

Electrophoresis and molecular weight determi-nation. Nondenaturing PAGE was carried out byomitting SDS from the method of Laemmli (1970)with 10% polyacrylamide. The reference pre-stainedprotein marker (Molecular weights 10 to 170 kDa,SM 0671, Fermentas) was used. Amylase activity ofproteins was detected according to Garcia-Gonzalezet al., (1991) by incubating the gels at 50°C for 20 minin 0.2 M phosphate buffer (pH 7.0) containing 2% starchand then immersing in staining solution (KI 13 g/l andI2 6 g/l). The gel was destained with distilled water.The stain was stable for only a few minutes.

Statistical analysis. Data were statistically ana-lyzed for variance and the least significant difference(LSD at 0.01 level) using one-way analysis of vari-ance (ANOVA). A software system SPSS version 15was used.

Results

The production of "-amylase by T. vulgaris in-creased significantly during the growth of the organ-ism, with the maximum production after 24 hours(1.03 ± 0.09 U/ml). After 36 hours the activity wasreduced rapidly by 72.8% (Fig. 1). Although there was

Fig. 1. Effect of incubation period on growth and "-amylaseproduction by T. vulgaris grown in starch-nitrate medium

containing 1.0 % starch.

67Extracellular "-amylase from Thermoactinomyces vulgaris1

a significant increase in the production after 72 hours,the "-amylase profile; on active PAGE didn�t differfrom that at 24 hours (Fig. 2) as they produce two"-amylase isozymes with approximate molecularweight 135�145 kDa.

The optimum temperatures for the production of"-amylase were in the range 45°C to 55°C with nonsignificant difference in this range. Below 45°C, theorganism could grow weakly but no activity could bedetected (Fig. 3).

Maximum production occurred in the pH range of6.0 to 7.0 (3.5 U/ml), increasing the pH above 7.0induced a significant decrease in the yield. At pH 10.0

and below pH 6, the production of the enzyme wascompletely inhibited (Fig. 4).

T. vulgaris was able to grow well using differentcarbon sources (1% w/v), namely, starch, cellulose,glucose, galactose, xylose, arabinose, lactose and mal-tose. However, the used carbon sources other thanstarch induced an extremely significant decrease inthe enzyme yield (Table I). Although different carbonsources affected the quantity of the enzyme production,it didn�t affect its isozymal pattern as they producedthe same two "-amylase isozymes of approximatemolecular weight 135�145 kDa (data not shown).

Tryptone, bactopeptone, yeast extract and NH4Clcaused a highly significant increasing in enzyme pro-duction comparing with KNO3 of the basal medium(Table II). The highest production of "-amylase(93.81 ± 0.20 U/ml) was recorded with tryptone andthe lowest (1.86±0.16) was recorded with NaNO3.The different used nitrogen sources (NH4Cl, NH4NO3,NaNO3, KNO3, ammonium acetate, bactopeptone, yeast

Fig. 2. Active-PAGE of "-amylase profile of T. vulgarisgrown in starch-nitrate medium containing 1.0 % starch

after 24 hours (A), and 72 hours (B).Arrows indicate the position of the two "-amylase isozymes

of approximate size between 135�145 kDa.

Fig. 3. Effect of temperature on growth and "-amylase productionby T. vulgaris grown in starch-nitrate medium containing

1.0% starch.

Fig. 4. Effect of pH on growth and "-amylase productionby T. vulgaris grown in starch-nitrate medium containing

1.0 % starch( ) denotes the final pH.

Starch 3.43 ± 0.02 1.06 ± 0.04

Glucose 0.04 ± 0.02 0.78 ± 0.02Galactose 0.02 ± 0.01 0.86 ± 0.08

Xylose 0.10 ± 0.06 0.76 ± 0.02

Arabinose 0.07 ± 0.02 0.76 ± 0.01Lactose 0.11 ± 0.02 0.63 ± 0.02

Maltose 0.36 ± 0.05 0.71 ± 0.04

Cellulose 0.05 ± 0.03 0.52 ± 0.01

Table IEffect of carbon sources on growth and "-amylase

production by T. vulgaris grown in starch-nitrate mediumcontaining different carbon sources instead of starch

Carbon sources(1.0%) (w/v)

Amylase(U/ml)

Intracellular protein(mg/ml)

± standard error


extract and tryptone) didn�t have any effect on theenzyme electrophoretic profile. The "-amylase profilehad the same previous pattern of two "-amylaseisozymes at about 135�145 kDa (data not shown).

Physicochemical properties of "-amylase. The"-amylase activity couldn�t be detected at pH 4.0 butit increased significantly with the increase of the pHuntil it reaches its optimum point at pH 8.0 (Fig. 5).The optimum activity occurred at temperature rangebetween 50°C and 60°C, with an optimum point of60°C (Fig. 5). The minimum level of the activity(54.4 ± 2.3 U/ml) was occurred at 80°C.

The enzyme was stable at 50°C retaining about80% of its activity over 6 hours incubation period,but at higher temperature the activity of the enzymedeclined (Fig. 6). At 60°C and 70°C, the enzyme hasa half-life of about one hour. However, at 80°C itretained more than 20% of its activity up to 4 hours.At 90°C the enzyme lost its activity rapidly.

The enzyme was significantly influenced by thedifferent metal salts including NaCl, CoCl2 and CaCl2(Fig. 7). CoCl2 induced significant inhibition of theenzyme activity. An amount of 1 mM of NaCl andCaCl2 caused extremely significant decrease in enzyme

Ammonium acetate 6.71 1.06 ± 0.15 6.46 ± 0.11

Tryptone 6.75 1.10 ± 0.12 93.81 ± 0.20

Yeast extract 6.87 0.72 ± 0.03 45.29 ± 0.08

Bactopeptone 6.64 0.93 ± 0.07 63.05 ± 0.63

NH4Cl 6.46 0.66 ± 0.06 21.56 ± 3.64

NH4NO

36.40 0.95 ± 0.03 6.34 ± 0.17

NaNO3

6.81 0.80 ± 0.01 1.86 ± 0.16

KNO3

6.73 0.53 ± 0.02 3.54 ± 0.01

Table IIEffect of nitrogen sources on growth and "-amylase

production by T. vulgaris grown in starch-nitrate mediumcontaining different nitrogen sources instead of KNO

3

Nitrogen sources Final PHIntracellular

protein (mg/ml)Amylase(U /ml)

± standard error

Fig. 5. Effect of temperature and pH on "-amylase activity.The enzyme activities are represented relative to the maximal value.

Fig. 7. Effect of various metal salts concentrationson "-amylase activity.

The enzyme activities are represented relative to the control activity.

0.001 99.62 ± 4.46

0.01 104.36 ± 1.700.1 108.85 ± 0.10

0.5 53.59 ± 0.52

1 18.81 ± 5.785 1.12 ± 0.70

10 0.00 ± 0

Table IIIEffect of various EDTA concentrations on "-amylase

activity. The enzyme activities are represented relative tothe control activity

Concentration of EDTA (mM) Amylase relative activity (%)

± standard error

Fig. 6. Effect of temperature on the stability of "-amylase.The enzyme activities are represented relative to the maximal value.


activity by about 80% and 70% respectively. How-ever, increasing of their concentration up to 10 mMof NaCl and CaCl2 resulted in retaining 60.8% and63.4% of its activity respectively. The enzyme acti-vity was not affected by 0.001, 0.01 and 0.1 mMEDTA but it was totally inactivated by 10 mM EDTA(Table III). On the other hand, 0.5 mM EDTA wasfound to decrease the activity to 53.6% comparingwith the control (96.6 Uml�1).

Discussion

"-Amylases have been isolated from diversifiedsources including plants, animals, and microbes, wherethey play a dominant role in carbohydrate metabolism.In spite of the wide distribution of "-amylase, micro-bial sources are used for the industrial production. Thisis due to their advantages such as cost effectiveness,consistency, less time and space required for produc-tion, and ease of process modification and optimiza-tion (Lonsane and Ramesh, 1990). Growth expressedas intracellular protein and "-amylase production bythe thermophilic actinomycete Thermoactinomycesvulgaris reached maximum values after 24 hrs, afterwhich, the activity was reduced rapidly by 72.8%.This might be corresponding to the rapid autolysis ofThermoactinomyces species (Lacey, 1971). However,it increased significantly at 60 and 72 hours. After72 hrs, the production decreased gradually and reachedits minimum recorded level at 96 hours. As theisozymal pattern was the same at 24 hrs and 72 hrs,the observed peaking and troughing of the productioncan be attributed to differential inhibition by productsof substrate hydrolysis rather than the isozymes downor over expression. In support, studies on both gluco-amylase and "-amylase indicate that inhibition doesnot occur below a critical concentration of product(Wang et al., 2006). These results indicated that theproduction of extracellular "-amylase by T. vulgariswas growth associated and this is in agreement withother investigators (Kuo and Hartman, 1966; Shimizuet al., 1978; Murthy et al., 2009; Asoodeh et al., 2010).

The influence of temperature on amylase produc-tion is related to the growth of the organism. Thepresent results revealed an optimum yield of "-amy-lase at 45°C to 55°C. In spite of the relative goodgrowth of the organism at 40°C, "-amylase activitycouldn�t be detected. This referred to the action ofprotease; that is rapidly inactivated at higher tem-perature (Behnke et al., 1982), which suppresses theamylolytic activity.

The pH change of the growth medium not onlyaffected the growth and "-amylase secretion of T. vul-garis but also influence the enzyme stability in themedium. Therefore, the difference of the final pH of

the medium from pH 10.0 to pH 6.0 could explain thecomplete inhibition of the enzyme activity at pH 10.0in contrast to the optimum production at pH 6.0 inspite of the same ability of the organism to grow.

The results confirms the inducibility nature of the"-amylase when different carbon sources were usedand compared. In support, starch is known to induceamylase production in different bacterial strains (Aiyer,2004; Ryan et al., 2006; Asoodeh et al., 2010). The"-amylase production is also appeared to be subjectedto catabolite repression by maltose and glucose, likemost other inducible enzymes that are affected bysubstrate hydrolytic products (Bhella and Altosaar,1985; Morkeberg et al., 1995). Other carbon sourceshave been found to be strongly repressive althoughthey supported good growth.

Among nitrogen sources, organic nitrogen sourceshave been preferred for the production of "-amylase,with ammonium acetate as an exception. It was re-corded that organic nitrogen sources supported maxi-mum "-amylase production by various bacteria andfungi due to their high nutritional amino acids andvitamins content (Gupta et al., 2003). The role ofamino acids and vitamins in enhancing the "-amylaseproduction in different microorganisms have beenreported to be highly variable (Gupta et al., 2003).Tryptone was the best nitrogen source that increasedthe productivity of "-amylase by 26.5 fold comparingto KNO3. Ammonium chloride induced a significantincrease in the enzyme yield that is higher than thatof the ammonium acetate. Similar effect of ammo-nium chloride was obtained for B. subtilis DM-03(Das et al., 2004). Although the different nitrogensources had a variable effect on "-amylase activity,they did not produce different isozymal profile. Thisindicate that they have no effect on the isozymal"-amylase over expression.

Most raw starch degrading enzymes had optimumpH in the acidic to neutral range (Pandey et al., 2000;Sun et al., 2010). In the present work, "-amylase fromT. vulgaris showed a pH activity profile with a flattop which retaining more than 75% of the enzymeactivity in the pH range 5.0�9.0, despite it was com-pletely inhibited at pH 4.0. This pH profile couldbe attributed to the limitation of the enzyme catalysisby protonation of the nucleophile at low pH and bydeprotonation of the hydrogen donor at high pH values(Nielsen et al., 2001). At reaction temperature of 60°C,the enzyme expresses maximum activity whereas itshowed less than 50% of its activity at 30°C. Thisreduced activity might be attributed to the reducedmolecular flexibility of the thermophilic protein undermesophilic conditions. Although the enzyme showedonly 4% of its activity at 80°C, it showed more than20% of its activity at 50°C after being kept at 80°Cfor 4 hrs indicating inhibition of the enzyme catalysis


at 80°C rather than inactivation of the enzyme. In gen-eral, "-amylase from T. vulgaris, in the present work,is fairly stable at 50°C over 6 hrs and with a half-lifeof about one hour at both 60°C and 70°C.

It is proposed that "-amylases belong to a newclass of metallo-enzymes characterized by a prostheticgroup, i.e., an alkaline-earth metal rather than a tran-sition element, and which plays primarily a structuralrole (Prakash and Jaiswal, 2010). At different concen-tration of CoCl2, a significant inhibition in the enzymeactivity was recorded. The Co2+ effect was explainedby Leveque et al., (2000) to be a result of competitionbetween the exogenous cations and the protein-asso-ciated cation. In spite of the important role of bothcalcium and sodium ions to retain the structure andfunction of "-amylases (Prakash and Jaiswal, 2010),"-amylase in the present study was strongly inhibitedby both 1 mM CaCl2 and NaCl. Similar inhibitoryeffect of CaCl2 was reported to amylase of Aspergillusoryzae EI 212 (Kundu et al., 1973). Calcium inde-pendent "-amylase is suitable for the manufacture offructose syrup, where Ca2+ is an inhibitor of glucoseisomerase (Tonkova, 2006).

Increasing the concentration of CaCl2 and NaClwas found to retain the enzyme activity, assuming thatCl� ion has a stabilizing role. Chloride ions have beenfound mainly in the active site of mammalian "-amy-lases, which have been shown to enhance the cata-lytic efficiency of the enzyme (Prakash and Jaiswal,2010). In accordance with retaining the enzymeactivity at high concentration of CaCl2 and NaCl, theenzyme yield when using ammonium chloride wasfound to be 3.3 fold of that using other sources ofammonium i.e., NH4NO3 and ammonium acetate.Regarding to the effect of EDTA, the enzyme retainedalmost 100% activity when 0.1 mM EDTA was addedto the reaction mixture. But 0.5 mM EDTA inhibitedthe enzyme activity retaining only 53% of its activity.The inhibitory effect of EDTA was also documentedby many studies (Gupta et al., 2003). Although themolecular weights of microbial "-amylases are usuallyrange between 50 to 60 kDa (Vihinen and Mantsala,1989), the present result revealed a highly molecularweight of two "-amylase isozymes (135�145 kDa).In support, Thermoactinomyces vulgaris R-47 wasreported to produce two "-amylases, TVAI and TVAIIwith molecular weights of 71 kDa and 67.5 kDarespectively (Ohtaki et al., 2003). However, molecularweight of some "-amylases was found to rise owingto carbohydrate moieties (Gupta et al., 2003). In con-clusion, the present results indicated a new activehighly molecular weight, thermostable and calciumindependent "-amylase of T. vulgaris which could beof importance for the starch-processing industries.Further work is in progress to purify the "-amylase ofT vulgaris and characterize the purified enzyme.

Literature

Aiyer P.V.D. 2004. Effect of C: N ratio on alpha amylase productionby Bacillus licheniformis SPT 27. African J. Bacteriol. 3: 519�522.Asoodeh A., J. Chamanic and M. Lagzian. 2010. A novel ther-mostable, acidophilic "-amylase from a new thermophilic �Bacil-lus sp. Ferdowsicous� isolated from Ferdows hot mineral springin Iran: Purification and biochemical characterization Int. J. Biol.Macromol. doi:10.1016/j.ijbiomac.2010.01.013Behnke U., H. Ruttloff and R. Kleine. 1982. Preparation andcharacterization of proteases from Thermoactinomyces vulgaris.V. Investigations on autolysis and thermostability of the purifiedprotease. Z. Allg. Mikrobiol. 22: 511�519.Bhella R.S. and I. Altosaar. 1985. Purification and some proper-ties of the extracellular "-amylase from Aspergillus awamori. Can.J. Microbiol. 31: 149.Bradford M.M. 1976. A rapid and sensitive method for thequantitation of microgram quantities of protein utilizing the prin-ciple of protein dye binding. Anal. Biochem. 72: 248�254.Das K., R. Doley and A.K. Mukherjee. 2004. Purification andbiochemical characterization of thermostable, alkaliphilic, extracel-lular "-amylase from B. subtilis DM-03, a strain isolated from thetraditional food of India. Biotechnol. Appl. Biochem. 40: 291�298.Garcia-Gonzalez M.D., J.F. Martin, T. Vigal and P. Liras.1991. Characterization, expression in Streptomyces lividans, andprocessing of the amylase of Streptomyces griseus IMRU 3570:Two different amylases are derived from the same gene by anintracellular processing mechanism. J. Bacteriol. 173: 2451�2458.Gupta R., G. Paresh, H. Mohapatra, V.K. Goswami andB. Chauhan. 2003 Microbial "-amylases: a biotechnological per-spective. Process Biochem. 38: 1599�1616.Herbert R. A. 1992. Molecular biology and biotechnology ofextremophiles. Herbert R.A. and T.J. Sharp (eds). Blackie, Glasgowand London, pp. 1�43.Ito K., S. Ito, k. Ishino, A. Shimizu-Ibuka and H. Sakai. 2007.Val326 of Thermoactinomyces vulgaris R-47 amylase II modu-lates the preference for alpha-(1,4)- and alpha-(1,6)-glycosidiclinkages. Biochimica et Biophysica Acta 1774: 443�449.Kundu A.K., S. Das and T.K. Gupta. 1973. Influence of cultureand nutritional conditions on the production of amylase by thesubmerged culture of Aspergillus oryzae. J. Ferment. Technol.51:142�150.Kuo M.J. and P.A. Hartman. 1966. Isolation of amylolyticstrains of Thermoactinomyces vulgaris and production of thermo-philic actinomycete amylases. J. Bacteriol. 92:723�726.Lacey J. 1971. Thermoactinomyces sacchari sp. nov., a thermophilicactinomycete causing bagassosis. J. Gen. Microbiol. 66: 327�338.Lacey J. and T. Cross. 1989. Genus Thermoactinomyces Tsiklin-sky 1899, 501AL. pp. 2574�2585. In: Williams S.T., M.E. Sharpeand J.G. Holt (eds). Bergey�s Manual of Systematic Bacteriology,vol. 4. Baltimore, Williams & Wilkins.Laemmli U.K. 1970. Cleavage of structural proteins during theassembly of the head of bacteriophage T4. Nature 227: 680�685.Leveque E., S. Janecek, B. Haye and A. Belarbi. 2000. Ther-mophilic archaeal amylolytic enzymes. Enzyme Microbiol.Technol. 26: 3�14.Lonsane B.K. and M.V. Ramesh (eds). 1990. Production of bac-terial thermostable "-amylase by solid state fermentation: a poten-tial tool for achieving economy in enzyme production and starchhydrolysis. pp. 1�56. In: Advances in applied microbiology,vol. 35. San Diego: California Academic Press.Morkeberg R., M. Carlsen and J. Neilsen. 1995. Induction andrepression of "-amylase production in batch and continuous cul-tures of Aspergillus oryzae. Microbiology. 141: 2449�2454.Murthy P.S., M.M. Naidu and P. Srinivas. 2009. Production of"-amylase under solid-state fermentation utilizing coffee waste.J. Chem. Technol. Biotechnol. 84: 1246�1249.


Nielsen J., T. Borchert and G. Vriend. 2001. The determinantsof "-Amylase pH-activity profiles. Protein Engineering 14:505�512.Ohtaki A., A. Iguchi, M. Mizuno, T. Tonozuka, Y. Sakano andS. Kamitori. 2003. Mutual conversion of substrate specificitiesof Thermoactinomyces vulgaris R-47 "-amylases TVAI andTVAII by site-directed mutagenesis. Carbohydrate Research 338:1553�1558.Palanivelu P. 2001. Analytical Biochemistry and separationTechniques. Kalamani Printers, Madurai, India.Pandey A., P. Nigam, C.R. Soccol, V.Y. Soccol, D. Singh andR. Mohan. 2000. Advances in microbial amylases. Biotechnol.Appl. Biochem. 31: 135�152.Prakash O. and N. Jaiswal. 2010. "-amylase: An ideal repre-sentative of thermostable enzymes. Appl. Biochem. Biotechnol.DOI 10.1007/s12010-009-8735-4Ryan S.M., G.F. Fitzerald and D. Sinderen. 2006. Screeningand identification of starch-, amylopectin-, and pullulan-degrad-ing activities in Bifidobacterial strains. Appl. and Environmen.Microbiol. 72: 5289�5296.

Shimizu M., M. Kanno, M. Tamura and M. Suckane. 1978.Purification and some properties of a novel "-amylase producedby a strain of Thermoactinomyces vulgaris. Agric. Biol. Chem.42: 1681�1688.Sun H., P. Zhao, X. Ge, Y. Xia, Z. Hao, J. Liu and M. Peng.2010. Recent advances in microbial raw starch degrading enzymes.Appl. Biochem. Biotechnol. 160: 988�1003.Tonkova A. 2006. Microbial starch converting enzymes of the"-Amylase family. In: Ray R.C. and wards O.P. (eds.), pp. 421�472,Microbial Biotechnology in Horticulture, Science Publishers,Enfield, New Hampshire, USA.Vihinen M. and P. Mantsala. 1989. Microbial amylolytic en-zymes. Crit. Rev. Biochem. Mol. Biol. 24: 329�418.Waksman S.A. 1959. Strain specificity and production of anti-biotic substances. X. characterization and classification of specieswithin the Streptmyces griseus Group. Proc. Natl. Acad. Sci. USA45: 1043�1047.Wang J.P., A.W. Zeng, Z. Liu and X.G. Yuan. 2006. Kineticsof glucoamylase hydrolysis of corn starch. J. Chem. Techn. andBiotechn. 81: 727�729.


ORIGINAL PAPER

* Corresponding author: R. Bhadekar, phone: 020-24365713; fax: 91-20-24379013; e-mail: [email protected]

Introduction

Long chain polyunsaturated fatty acids (LC-PUFAs)are essential components of membrane lipids of variousorganisms (Berge and Barnathan, 2005). They are welldocumented for their beneficial physiological effectsin human health including i) lowering of plasma cho-lesterol and triglycerols ii) prevention of certain car-diovascular diseases (atherosclerosis and thrombosis)and iii) reducing the risk of breast, colon and pancre-atic cancer (Robert et al., 2009). Alpha-linoleic acid(ALA), ecosapenthaenoic acid (EPA) and docosahe-xaenoic acid (DHA) are the major LC-PUFAs of ge-neral nutritional importance, suggested by numerousnutritional bodies (Simopoulos et al., 1999). Althoughthe recommended ratio of dietary omega-6 and omega-3fatty acids is 5:1 (Sargent, 1997), it has shifted heavilytowards omega-6 acids in the current western diet andby some estimate, is up to 30-fold too high (Simopoulos,1999). The main reason being an increase in the con-sumption of vegetable oils rich in omega-6 fatty acids.Since omega-6 and omega-3 fatty acids are not inter-convertible in the human body, the ratio of linoleic acid

(LA)/ALA in our diet influences the ratio of omega-6/omega-3 fatty acids LC-PUFAs. To correct this imbal-ance, the needed omega-3 LC-PUFAs, can be obtainedin our diet from external sources such as fish oil.

The current commercial sources of EPA and DHAare restricted to fish and algal-derived oils. Problemsexist with both of these sources. Commercial fishstocks are likely to decline in the future, since thedemand for fish oil in the aquaculture industry alone isestimated to exceed the supply by 2010 due to increasein global population (Meyers and Worm, 2003). Be-sides the concern for the presence of contaminants,such as mercury and polychlorinated biphenyls, insome fish oils, makes it evident that alternative sourcesof LC-PUFAS must be found (Jacobs et al., 2004).Algal-derived oils require a relatively high investmentin technology compared to bacterial fermentation,although bacteria contain a lower proportion of lipid(Nichols et al., 1996). A key advantage of bacte-rial PUFA production is that only a single PUFA isproduced, rather than the complex mixture yieldedfrom fish or algal oils (Russell and Nichols, 1999).Thus bacterial sources of PUFA remove the expense

Halomonas sp. nov., an EPA-Producing Mesophilic Marine Isolatefrom the Indian Ocean

DIPTI SALUNKHE1, NEHA TIWARI1, SANDEEP WALUJKAR2 and RAMA BHADEKAR1*

1 Department of Microbial Biotechnology, Rajiv Gandhi Institute of IT and BiotechnologyBharati Vidyapeeth Deemed University, Katraj, Pune 411 046, Maharashtra, India

2 National Center of Cell Sciences, University of Pune, Ganeshkhind, Pune 411 007, Maharashtra, India

Received 18 May 2010, revised 19 January 2011, accepted 20 January 2011

A b s t r a c t

Marine samples from the Indian Ocean were used to isolate and characterize the organisms with respect to their fatty acid profiles. Sixmesophilic isolates (MBRI 6, MBRI 8, MBRI 9, MBRI 10, MBRI 12 and MBRI 13) were obtained from three different water samples.They were i) Gram-negative, ii) catalase positive, iii) produced acid from glucose and maltose, iv) tolerated 5 to 15% NaCl v) exceptMBRI 9, showed pH tolerance in the range of 5.0 to 9.0 with optimum pH 7.0 to 8.0 v) grew well at 30oC and were able to grow in the rangeof 15 to 45oC. EPA, an essential omega-3 fatty acid, was produced by these isolates in the range of 12 to 60% at 30oC. MBRI 12 was foundto be a potential source as it produced 60% EPA. This isolate was further identified by partial 16S rDNA sequencing and phylogeneticanalysis revealed that the strain belonged to Gammaproteobacteria and was closely related to Halomonas bolviensis (96% sequencesimilarity, 570 bp). Thus a new genus of Halomonas may be included in earlier reported EPA- producing prokaryotic genera affiliated tothe Gammaproteobacteria.

K e y w o r d s: Gammaproteobacteria, Halomonas bolviensis, Alpha-linoleic acid, nutraceuticals, polyunsaturated fatty acid

74 Salunkhe D. et al. 1

of preparative purification in the production of high-purity PUFA oils. In addition to their potential useas �cell factories� bacteria in particular offer the bio-technological opportunity to study the structure andregulation of the genes and enzymes responsible forPUFA production.

Numerous bacterial species of marine origin pro-ducing PUFAs are particularly prevalent in high-pres-sure, low temperature and deep-sea habitats (Yanoet al., 1997). This is an important adaptation for coun-tering the effects of hydrostatic pressure and low tem-perature on fluidity or phase of membrane lipid (Allenand Bartlett, 2002). Halophilic organisms are alsoknown to be good sources of different bioactive com-pounds (Margesin and Schinner, 2001). Recently wehave reported halotolerant organisms from differentfood samples (Jadhav et al., 2010a) as well as fromwall scrapings of historical building in India (Jadhavet al., 2010b). They were novel owing to their abili-ties to fix atmospheric nitrogen and produce industri-ally important enzymes.

Considering the significance of PUFA in humanhealth and limitations in using fish oils, microorgan-isms prove the best suitable alternative. However useof psychrophilic or piezophilic organisms producingEPA, necessitates the need of low temperature andhigh pressure facilities (Gentile et al., 2003). Henceuse of organisms producing these nutraceuticals atroom temperature will be efficient and reasonablypriced. The present work was aimed at isolation ofmarine organisms from the Indian Ocean and charac-terizing them with respect to their fatty acid profiles.Being mesophilic in nature, high PUFA producingisolates could be conveniently used for pilot scale pro-duction and for further scale-up. To our knowledgethis is the first report of a high EPA- producing ma-rine isolate from the Indian Ocean.

Experimental


Sampling. Water samples were collected duringsummer 2008 from different locations in the IndianOcean (Table I). All chemicals were procured fromHimedia and Merck, India. All were of A.R. grade.

Isolation and characterization of microorgan-isms. 10 ml of each individual sample were inocu-lated in 100 ml Marine Salt Medium (MSM) (Compo-sition per litre: 81.0 g NaCl, 10.0 g yeast extract, 9.6 gMgSO4, 7.0 g MgCl2, 5.0 g protease peptone no 3,2.0 g KCl, 1.0 g glucose, 0.36 g CaCl2, 0.06 g NaHCO3and 0.026 g NaBr with pH adjusted to 7.0±0.2) andincubated at 30°C, 120 rpm for 48 hrs. After 48 hrs,0.1 ml of each sample was spread on MSM agar platesand incubated for another 48 hrs. The isolated colo-nies were maintained on MSM agar slants.

The isolates were characterized morphologically,physiologically and biochemically. Acid productionwas studied by using different sugars (glucose, fruc-tose, sucrose, lactose, mannitol and maltose). Theywere also studied qualitatively for their ability tosecrete extracellular enzymes (amylase, catalase, ure-ase, protease, and gelatinase) (Collee et al., 1989).

MSM broth supplemented with various concentra-tions of NaCl (ranging from 1�25%) was used toexamine salt-tolerance of the isolates. The cultureswere incubated at 30°C, 120 rpm for 24 hrs and cellgrowth was determined by measuring the absorbanceat 660 nm. Temperature tolerance was examined byincubating the cultures at temperatures 15°C, 30°Cand 45°C for 24 hrs. Further these isolates werescreened for pH tolerance in MSM broth adjustedto pH 5.0�11.0. The media at different pH were in-oculated with overnight grown inoculum (107 cells/ml).Cell growth was determined by measuring the absor-bance at 660 nm.

Preparation of fatty acid methyl esters (FAMES).10% inoculum of all the isolates was used to inocu-late MSM and incubated at 30°C in an orbital shaker(Remi, India) at 120 rpm. Cells were harvested after24 hrs by centrifugation (Plastocraft, India) at 10,000rpm for 12 mins. Following centrifugation, the super-natant was discarded, the cell pellet resuspended in1.0% NaCl (w/v), and recentrifuged. Each bacterialculture tube was capped and stored at 4°C. Cells werereweighed, to which a fresh solution of the trans-esterification reaction mix (methanolic HCl (0.6 N)4 ml) was added in the tubes (Carrapiso and Garcia,2000). The tubes were capped tightly and the solu-tions were vortexed for 5 s to 10 s and heated in an80°C ± 2°C water bath for 2 hrs. The tubes were thencooled quickly in ice.

6NT/LT/BOT 18°48�52�N 72°46�30�E 13 8.02 30.4 71.61 974.7 3.98 MBRI 9, MBRI 10 and MBRI 12

2NT/LT/BOT 15°33.01�6�N 73°56.58�E 9.5 7.62 31.8 27.05 412.4 4.72 MBRI 8

2ST/LT/BOT 15°33.01�6�N 73°56.58�E 11 7.62 31.8 27.05 412.4 4.72 MBRI 6 and MBRI 13

Table IDifferent sampling locations

Location Latitude LongitudeDepth

(m)pH

Tempera-ture (°C)

SalinityConducti-vity (ms)

D.O.(mg/l)

Isolates

75High EPA producing novel Halomonas sp.1

The resultant FAMES were extracted twice byadding 2 volumes of hexane and then 1 volume ofhexane by centrifugation at 5000 rpm for 15 mins.The upper phase of hexane layer was separated andstored for gas chromatography analysis.

Gas chromatography analysis of bacterial ex-tracts. Analyses of the FAMES were performed witha Chemito GC 1000 equipped with a 50 m×0.25 mminternal diameter cross-linked methyl silicone fused-silica CP � SIL 88 capillary column and flame ioniza-tion detector. Samples were injected at 100°C in the splitmode. After 5 mins the oven was temperature-program-med from 100°C to 198oC at the rate of 1.5°C min�1

and hold for 9 mins. Nitrogen was used as a carriergas, and the injector and detector were maintained at225 and 250°C respectively. Peak areas were quanti-fied using chromatography software (IRIS 32, India).

16S rDNA sequencing. The isolate producinghigh amount of PUFA was used for identification by16S rDNA sequencing. The genomic DNA was iso-lated as described by Ausubel et al. (1987). The PCRassay was performed using Applied Biosystems, model9800 with 1.5 µl of DNA extract in a total volumeof 25 µl. The PCR master mixture contained 2.5 µl of10X PCR reaction buffer (with 1.5 M MgCl2), 2.5 µlof 2 mM dNTPs, 1.25 µl of 10 pm/µl of each oligo-nucleotide primers 27f (5�CCAGAGTTTGATCGTGGCTCAG3�), 1488r(5�CGGTTACCTTGTTACGACTTCACC 3�), 0.24 µl of Taq DNA polymerase and15.76 µl of glass distilled PCR water.

Initially denaturation accomplished at 94°C for3 min. Thirty-five cycles of amplification consisted ofdenaturation at 94°C for 1 min, annealing at 55°C for1 min and extension at 72°C for 1 min. A final exten-sion phase at 72°C for 10 min was performed. ThePCR product was purified by PEG-NaCl method. Thesample was mixed with 0.6 times volume PEG-NaCl[20% PEG (MW 6000), 2.5 M NaCl] and incubatedfor 40 min at 37°C. The precipitate was collected bycentrifugation at 3,800 rpm for 28 min. The pellet waswashed with 70% ethanol, air dried and sequencedusing 96 well sequencing plate as per manufacturer�sinstructions.

The thermocycling for the sequencing reactionswas performed with a 9800 PCR model (AppliedBiosystems). It began with an initial denaturation at94°C for 2 min, followed by 35 cycles of PCR con-sisting of denaturation at 94°C for 10 sec, annealingat 50°C for 10 sec and extension at 68°C for 4 min.

The samples were purified using standard proto-cols described by Applied Biosystems, Foster City,USA. To this, 10 µl of Hi-Di formamide was addedand vortexed briefly. The DNA was denatured byincubating at 95°C for 3 min, kept on ice for 5�10 minand was sequenced in a 3730 DNA analyzer (AppliedBiosystems) following manufacturer�s instructions.

Nucleotide sequence accession number. The par-tial 16S rDNA sequence generated in this study wasdeposited in Gen Bank + EMBL+DDBJ+PDB underthe accession number GU593323. Sequence was com-pared with the compilation of 16S rDNA genes avail-able in the Gen Bank + EMBL+DDBJ+PDB libraryby BLASTN 2.2.17 searching.

Results and Discussion

Isolation and characterization. Total six bacterialisolates were isolated from the three samples of IndianOcean (Table I). The isolates were grown and mainta-ined on MSM. They were named as MBRI 6, MBRI 8,MBRI 9, MBRI 10, MBRI 12 and MBRI 13. All6 MBRI isolates were characterized morphologically,biochemically and physiologically. They i) were Gram-negative ii) produced catalase, iii) produced acid fromglucose and maltose, iv) tolerated 5 to 15% of salt, v)except MBRI 9, showed pH tolerance in the range of5.0�9.0 with optimum pH of 7.0�8.0, vi) grew well at30°C and v) were able to grow in the range of 15 to45°C. MBRI 6, MBRI 8, MBRI 9 and MBRI 10 pro-duced acid from fructose while MBRI 6, MBRI 8 andMBRI 13 used lactose. Only MBRI 11 was able to uti-lize sucrose as carbon source. MBRI 10 and MBRI 12could grow on citrate as carbon source. MBRI 9 tol-erated a wide pH range of 6.0�9.0.

Fatty acid profile. All six isolates were analysedfor their fatty acids profiles (Table II). The results indi-cated that total saturated fatty acids, monounsaturatedfatty acids and polyunsaturated fatty acids were in therange of 21 to 100%, 11 to 30% and 1 to 62% respec-tively. Interestingly, MBRI 10 did not show presenceof unsaturated fatty acids. Linoleic acid was the onlyomega-6 fatty acid detected in MBRI 8, MBRI 9 andMBRI 12. It was detected in the range of 1 to 6%,while omega-3 fatty acids were ALA and EPA (0.5 to16% and 12.0 to 60%, respectively). Arachinoidicacid and docosahexanoic acid were not detected inany of the isolates. Trans-fatty acids were also notdetected in these isolates. So far, EPA has mainly beenreported to occur in eukaryotes and some peizophilicor psychrophilic microorganisms (Freese et al., 2009).Bacteria are known to alter the composition of theirphospholipid fatty acids side-chains in order to main-tain appropriate membrane organization and function(Suutari and Laakso, 1994). At low temperatures orhigh pressures, the content of unsaturated fatty acidsoften increases with a concomitant decline in satu-rated fatty acids (Allen et al., 1999). Polyunsaturatedfatty acids (PUFAs), such as EPA and DHA, areparticularly effective in the adjustment of membranefluidity due to their low melting points (Hazel, 1995).Hence several EPA producing marine organisms isolated


were psychophilic and peizophilic from polar regionsand deep sea, as mentioned earlier. However the recentisolation of mesophilic EPA-producing Shewanellaspecies from a temperate estuary (Skerratt et al., 2002)and from shallow seawater samples (Frolova et al.,2005; Freese et al., 2008) suggested that EPA maynot be restricted to psychrophiles and piezophiles.

Figure 1 shows the comparison of % EPA pro-duced by our isolates with that of microalgae andmesophilic bacterial cultures. Vazhappilly and Chen(1998) have reported upto 34.2% EPA in variousmicroalgae at 25°C. However recovery of EPA fromthese sources is difficult along with poor yields.Freese et al. (2009) have documented up to 1.2% EPAin various organisms at 30°C (Fig. 1). Different sp. ofShewanella were reported to produce EPA up to 6.5%at 28°C (Ivanova et al., 2003; Ivanova et al., 2004;Hirota et al., 2005), probably indicating that tempera-ture sensitive enzymes were involved in biosynthesis.Thus our isolates appear novel owing to their abilityto produce high EPA at 30°C. Also these studies con-tradict the notion that only barophilic or cold-adaptedspecies are able to produce significant levels ofPUFAs such as EPA.

Oleaginous fungi are also known to store largeamounts of lipid, mainly triglycerols, and Mortierella

spp. are noteworthy for the n-3 and n-6 PUFA contentsof their stored lipid. Typically up to 40% of the fungaldry weight may be triacylglycerol in which the acylchains are up to 15% EPA or 55% AA (Singh andWard, 1997). Our results are comparable to theseobservations besides the advantage of rapid cultivationand easy recovery.

Branched chain fatty acids (BCFAs) have re-peatedly been reported to promote cold adaptations(Chattopadhyay and Jagannadham, 2001). Our resultsshowing comparatively low levels (1 to 34%) ofBCFAs in all the isolates except MBRI 10 supportthese observations. However in some other bacteriano clear changes in BCFAs with varying growth tem-perature were observed (Nichols et al., 2002).

Phylogeny. MBRI 12, the highest EPA producingisolate was identified using partial 16S rDNA sequenc-ing. The sequence was deposited in EMBL+Genbankunder accession number GU593323. BLAST analysisof partial 16S rDNA sequence revealed that the strainbelonged to Gammaproteobacteria and was closelyrelated to Halomonas bolviensis (96% sequence simi-larity, 570 bp). All so far known EPA-producingprokaryotes affiliate with only a few genera withintwo bacterial phyla: The Gammaproteobacteria (e.g.genera Shewanella, Moritella, Colwellia, Alteromonas,

C 4:0 0.2 7.7 11.6 21.9 6.8 19.3C 6:0 0.4 2.2 2.7 8.4 2.0 7.3

C 8:0 2.2 4.5 8.3 2.5 N.D. 2.4

C 10:0 0.5 0.7 3.8 5 1.2 N.D.C 11:0 0.7 0.8 1.2 6.1 1.4 1.1

C 12:0 0.8 1.0 N.D. N.D. N.D. 0.8

C 13:0 N.D. N.D. 1.4 N.D. N.D. N.D.C 14:0 18.1 34.3 8.7 14.1 1.7 4.1

C 15:0 N.D. N.D. N.D. N.D. N.D. 1.9

C 16:0 25.1 19.7 22.0 42.1 8.5 8.1C 17:0 N.D. 0.9 0.9 N.D. N.D. 4.8

C 18:0 7.2 11.7 0.8 N.D. N.D. 2.5

Total Saturated Fatty acids 55.3 83.5 61.4 100 21.6 52.3C 16:1 1.6 2.7 25.7 N.D. 12.1 10.7

C 18:1 6.9 0.9 2.7 N.D. 4.7 2.5

C 22:1 0.6 N.D. N.D. N.D. N.D. N.D.C 17:1 2.3 11.7 1.1 N.D. N.D. N.D.

Total Unsaturated Fatty Acids 11.4 15.3 29.5 N.D. 16.8 13.2

C 18:2 n6t N.D. 1.1 5.9 N.D. 1.5 N.D.C 18:2 n6c 4.7 N.D. 0.8 N.D. N.D. N.D.

C 18:3 n6 15.9 N.D. 2.5 N.D. 0.7 N.D.

C 20:5 n3 12.8 N.D. N.D. N.D. 59.5 34.4Total Polyunsaturated Fatty Acids 33.8 1.1 9.2 N.D. 61.7 34.4

Table IIFatty acid profile of MBRI isolates

Fatty acids MBRI 6 MBRI 8 MBRI 9 MBRI 10 MBRI 12 MBRI 13

N.D. � Not detected

77High EPA producing novel Halomonas sp.1

Allen E.E. and D.H. Bartlett. 1999. Monounsaturated but notpolyunsaturated fatty acids are required for growth of the deep-seabacterium Photobacterium profundum SS9 at high pressure andlow temperature. Appl. Environ. Microbiol. 65: 1710�1720.Ausubel F.M., R. Rrent, R.E. Kingston, D.D. Moore,J.G. Seidman, J.A. Smith and K. Struhl. 1987. Current Proto-cols in Molecular Biology. Wiley, New York.Berge J.P. and G. Barnathan. 2005. Fatty acids from lipidsof marine organisms: molecular biodiversity, role as biomarkers,biologically active compounds and economical aspects. Adv.Biochem. Eng. Biotechnol. 96: 49�125.Carrapiso A.I., and C. Garcia. 2000. Development in lipidanalysis: some new extraction techniques and in situ transesteri-fication. Lipids 5(11): 1167�77.Chattopadhyay M.K. and M.V. Jagannadham. 2001. Mainte-nance of membrane fluidity I Antarctic bacteria. Polar. Biol. 24:386�388.Collee J.G., J.P. Duguid, A.G. Fraser and B.P. Marmion. 1989.Practical Medical Microbiology. Churchill Livingstone, MedicalDivision of Longman Group UK Ltd., New York.Freese E., J. Koster and J. Rullkoter. 2008. Origin and compo-sition of organic matter in tidal flat sediments from the GermanWadden Sea. Org. Geochem. 39: 820�829.Freese E., H. Rutters, J. Koster, J. Rullkoter and H. Sass.2009. Gammaproteobacteria as a possible source of ecosapen-tanoic acid in anoxic intertidal sediments. Aqu. Microbiol. 57:444�454Frolova G.M., K.G. Pavel, A.A. Shparteeva, O.I. Nedashkov-skaya, N.m. Gorhkova, E.P. Ivanova, and V.V. Mikhail. 2005.Lipid composition of novel Shewanella species isolated from fareastern seas. Microbiology 74: 664�669.Gentile G., V. Bonasera, C. Amico, L. Giuliano and M.M.Yakimov. 2003. Shewanella sp. GA-22, a psychrophilic hydrocar-bonoclastic antarctic bacterium producing polyunsaturated fattyacids. J. Appl. Microbiol. 95: 1124�1133Hazel J.R. 1995. Thermal adaptation in biological membranes: ishomeoviscous adaptation the explanation? Annu. Rev. Physiol. 57:19�42Hirota K.Y. Nodasaka, Y. Orikasa, H. Okuyama and I. Yumoto.2005. Shewanella pneumatophori sp. nov., an eicosapentaenoicacid producing marine bacterium isolated from the intestines ofPacific mackerel (Pneumatophorus japonicus). Int. J. Syst. Evol.Microbiol. 55: 2355�2359Ivanova E.P., N.M. Gorshkova, J.P. Bowman, A.M. Lysenko,N.V. Zhukova, A.F. Sergeev, V.V. Mikhailov and D.V.N. 2004.Shewanella pacifica sp. nov., a polyunsaturated fatty acid-produc-ing bacterium isolated from sea water. Int. J. Syst. Evol. Microbiol.54: 1083�1087.Ivanova E.P., O.I. Nedashkovskaya, N.V. Zhukova, D.V. Nicolau,R. Christen and V.V. Mikhailov. 2003. Shewanella waksmaniisp. nov., isolated from a sipuncula (Phascolosoma japonicum) Int.J. Syst. Evol. Microbiol. 53: 1471�1477.Jacobs M.N., A. Covaci, A. Gheorghe and P. Schepens. 2004.Time trend investigation of PCBs, OCPs, and PBDEs in n-3 poly-unsaturated fatty acid-rich dietary fish oil & vegetable oil supple-ment; Nutritional relevance for human essential n-3 fatty acidrequirement. J. Agri. Food. Chem. 52: 1780�1788.Jadhav G.G., D.S. Salunkhe, D.P. Nerkar and R.K. Bhadekar.2010a. Isolation and characterization of salt-tolerant nitrogen-fixing microorganisms from food. Eur. J. Biosci. 4: 33�40Jadhav G.G., D.S. Salunkhe, D.P. Nerkar and R.K. Bhadekar.2010b. Novel Staphylococcus sp. isolated from wall scrapings ofa historical building in India. Ann. Microbiol. 60: 197�201.

Fig. 1. Comparison of % EPA produced by MBRI isolates(this work) with other mesophilic marine bacteria and microalgae.1. MBRI 12 ; 2. MBRI 13; 3. Monodus subterraneus UTEX 151,4. Chlorella minutissima UTEX 2341, 5. Phaeodactylum tricornutumUTEX 642 (Vazhappilly and Chen, 1998); 6. MBRI 6 ; 7. Shewanellapneumatophori (Hirota et al., 2005); 8. Shewanella waksmanii (Ivanovaet al., 2003); 9. Shewanella pacifica (Ivanova et al., 2004); 10. Photo-bacterium sp. SAMA2, 11. Vibrio sp. NB73, 12. Shewanella sp. NB72

(Freese et al., 2009).

and Photobacterium) and the Bacteroidetes (e.g Flexi-bacter and Psychroserpens). Therefore, EPA may bea potentially useful marker for these genera in environ-mental microbial communities (Freese et al., 2009).Our results suggest that a new genus of Halomonasmay be added to earlier reported EPA producingprokaryotic genera belonging to Gammaproteobacteria.

Conclusions. 1. The occurrence of high levels ofEPA in MBRI isolates (present work) with MBRI 12being highest producer of EPA which could be com-mercially exploited. 2. This is probably the firstreport of Halomonas sp. producing EPA at 30°C inthe presence of high salt-concentration.

AcknowledgementsThis work is financially supported by the Department of Bio-

technology, New Delhi, Government of India. We are thankfulto Honorable Dr. Shivajirao Kadam, V.C., Bharati VidyapeethDeemed University and Dr. R.M. Kothari, Principal, Rajiv GandhiInstitute of IT and Biotechnology, (BVDU) for providing facilitiesto undertake this work. We are also thankful to Dr. D.P. Nerkarand Ms. V. V. Jadhav for their assistance.

Literature

Allen E.E. and D.H. Bartlett. 2002. Structure and regulationof the omega-3 polyunsaturated fatty acid synthase genes fromthe deep-sea bacterium Photobacterium profundum strain SS9.Microbiology 148: 1903�1913.


Margesin R. and F. Schinner. 2001. Potential of halotolerant andhalophilic microorganisms for biotechnology. Extremophiles 5(2):73�83Meyers R.A. and B. Worm. 2003. Rapid worldwide depletion ofpredatory fish communities. Nature 432: 280�283.Nichols D.S., P. Hart, P.D. Nichols and T.A. McMeekin. 1996.Enrichment of the rotifer Brachinous plicatilis fed an Antarcticbacterium containing polyunsaturated fatty acid. Aquaculture 147:115�125.Nichols D.S., K.A. Presser, J. Olley, T. Ross and T.A. McMeeekin.2002. Variation of branched-chain fatty acids marks the normalphysiological range for growth in Listeria monocytogenes. Appl.Environ. Microbiol. 68: 2809�2813Robert S.S., J. R. Petrie, X. Zhou, M. P. Mansour,S.I. Blackburn, A.G. Green, S.P. Singh and P.D. Nichols. 2009.Isolation and characterization of a )5-fatty acids elongase from themarine microalgae Pavlova salina. Mar. Biotechnol. 11: 410�418.Russell N.J., and D.S. Nichols. 1999. Polyunsaturated fatty acidsin marine bacteria � a dogma rewritten. Microbiology 145: 767�779.Sargent J.R. 1997. Fish oils and human diet. Br. J. Nutr. 78:Suppl. 1, 5�13.

Simopoulos A.P., A. Leaf and N., Jr Salem. 1999. Workshop onthe essentiality of and recommended dietary intakes for omega-6and omega-3 fatty acids. Food. Aust. 51: 332�333.Simopoulos A.P. 1999. Essential fatty acids in health and chronicdisease. Am. J. Clin. Nutr. 70(3): 560S�569S.Singh A. and O.P. Ward. 1997. Microbial production ofdocosahexaenoic acid (DHA, 22:6) Adv. Appl. Microbiol. 45:271�312.Skerratt J.H., J.P. Bowman and P.D. Nicholas. 2002. Shewa-nella olleyana sp. nov., a marine species isolated from a temperateestuary which produces high levels of polyunsaturated fatty acids.Int. J. Syst. Evol. Microbiol. 52: 2101�2106.Suutari M. and S. Laakso. 1994. Microbial fatty-acids and ther-mal adaptation. Crit. Rev. Microbiol. 20: 285�328Vazhappilly R and F. Chen. 1998. Eicosapentaenoic acid anddocosahexaenoic acid production potential of microalgae and theirheterotrophic growth. J. Am. Oil Chem. Soc. 75(3): 393�397Yano Y., A. Nakayama and K. Yoshida. 1997. Distribution ofpolyunsaturated fatty acids in bacteria present in intestines of deep-sea fish and shallow-sea poikilothermic animals. Appl. Environ.Microbiol. 63: 2572�2577.


SHORT COMMUNICATION

* Corresponding author: J. Kisková, Institute of High Mountain Biology, Tatranská Javorina 7, 059 56, Slovakia; phone: (+421)51-449-91-08; e-mail: [email protected]

The genus Yersinia is a highly heterogeneous groupof the family Enterobacteriaceae comprising acknowl-edged pathogens and a variety of strains that are widelydistributed in nature in both aquatic and terrestrialecosystems (Cover and Aber, 1989). Many speciessuch as Yersinia enterocolitica are psychrophilic bacte-ria capable of persisting and growing in cold environ-ments (Kato et al., 1985; Gill and Reichel, 1989).

The wild-living birds, due to their great mobility,may play a significant role as effective spreadersof Yersinia through faecal contamination of pasturesand surface waters (Kaneuchi et al., 1989; Niskanenet al., 2003).

There are only a few studies on bacteria living inwild birds in the extreme environments of the subal-pine and alpine vegetation levels. Janiga et al. (2007)identified the composition of microflora in the diges-tive tract of the alpine accentor (Prunella collaris) asa typical species of alpine environments. Novotnýet al. (2007) specifically discussed the ecology ofYersinia spp. in relation to alpine accentors consider-ing that the genus Yersinia may play an important rolein the ecology of this bird species.

The objective of this study was to continue researchof yersiniosis in lower sub-alpine habitats in the West

Carpathians. The dunnock (Prunella modularis) isa dominate bird species of the dwarf-pine ecosystem(950�1 700 m a.s.l) and as the alpine accentor is themember of the family Prunellidae, therefore it waschosen as experimental host species for this micro-biological study.

From April 2007 to July 2009, 97 free-livingdunnocks were captured with mist nets in the localmountains of the Slovakian part of the WesternCarpathians � The West, High, Low and BelianskeTatras, Great and Small Fatra, Babia hora, and Choè(from 1 000 to 1 750 m a.s.l). Captured birds wereidentified as adults or juveniles (age ≤2 months).Adult birds were sexed by the presence of a cloacalprotuberance in males (Nakamura, 1990). They wereweighed with 0.2 g accuracy using a Pesola springscale and standard morphometric measurements weretaken. Two types of samples were collected from eachbird � pharyngeal and cloacal swabs. Samples weretaken using sterile transport swabs suitable for bothaerobes and anaerobes (DispoLab, Copan Italia,Brescia, Italy).

Isolated bacterial cultures from cloacal and pharyn-geal swabs were enriched in Tryptone-soya broth at26�28°C for 48 hours (Nikolova et al., 2001). Enriched

Yersinia Species in the Dunnock (Prunella modularis) in Sub-alpine Habitatsof the Western Carpathians

JANA KISKOVÁ* , ZUZANA HREHOVÁ, MARIÁN JANIGA, MARTIN LUKÁÒ, MARTINA HAASand MARTINA JURÈOVIÈOVÁ

Institute of High Mountain Biology, University of �ilina, Tatranská Javorina, Slovakia

Received 29 August 2010, revised 5 December 2010, accepted 15 December 2010

A b s t r a c t

The study presents the prevalence of Yersinia species in dunnok Prunella modularis from the sub-alpine zone of the Western Carpathians.Bacteria were detected from cloacal and pharyngeal swabs from 97 specimens using PCR assay. Yersinia enterocolitica showed thehighest prevalence (47.4%) from among the determined Yersinia species. Yersinia species (except Y. frederiksenii) were detected morefrequently in pharyngeal than cloacal samples. The highest prevalence of yersiniosis was detected in April (Yersinia spp. � 80%,Y. enterocolitica � 70%). No statistically differences were observed in the prevalence of Yersinia spp. between males and females andbetween juveniles and adult birds. Bacterial contamination did not affect body weight or tarsus length.

K e y w o r d s: Yersinia spp. Yersinia enterocolitica, Dunnock Prunella modularis

80 Kisková J. et al. 1

cultures were plated on CIN agar presented as highlyselective medium for Yersinia spp. (Schiemann, 1979)and cultivated at 26�28°C for 48 hours (Neubaueret al., 2000; Hussein et al., 2001).

Bacterial DNA was extracted and then Yersiniaspecies were identified among isolated bacterial cul-tures using the PCR method developed by Neubaueret al. (2000). The authors designed primers Y1 andY2 for amplification of the specific region of the 16SrRNA gene of the genus Yersinia. Primers A1 and A2were used to amplify a 430 bp fragment of the ailgene, found exclusively in pathogenic Yersinia spp.strains (Wannet et al., 2001). For the identificationof Yersinia spp. a reference strain (CCM 5671) ofY. enterocolitica subsp. enterocolitica, serovar 0:3,biovar 4 was obtained from the Czech collection ofmicroorganisms, Masaryk University, Brno. The PCRproducts were independently sequenced in both direc-tions on the Genome Lab GeXP Single genetic ana-lyzer (Beckman Coulter Inc.) The obtained sequenceswere subjected to BLAST searches in sequence data-base GenBank for species identification.

Y. pseudotuberculosis was also independentlyexamined in all samples. The AmpliSens Yersiniapseudotuberculosis kit (Russia) was used for the iden-tification.

A P2 statistics (STATISTICA 8.0) was used to testthe hypothesis of independence of frequencies ofselected factors (prevalence, sex, age and season)which may influence the occurrence of bacteria. Mor-phometric data were compared by one-way ANOVA.

From 97 examined birds, a total of 47.4% indi-viduals were Yersinia positive (28.9% of pharyngealand 27.8% of cloacal samples). Seven Yersinia specieswere detected by comparison of PCR-product�s to thenucleotide sequences in BLAST (GenBank, Table I).Y. enterocolitica showed the highest total incidence(34.0%) of the genus Yersinia, therefore it is consid-ered in this study as separate species. The higherprevalence of Y. enterocolitica tended to be in cloacal(20.6%) than in pharyngeal (16.5%) samples. Also otherYersinia species (except Y. fredericksenii) were detectedmore frequently in pharyngeal than cloacal swabs.The differences were not statistically significant.

A seasonal variation in the distribution of Yersiniaspp. was observed. The highest prevalence of Yersiniaspecies was detected in April (80%). Even, the con-tamination of Y. enterocolitica reached a statisticallysignificant value compared to other months (P≤0.05),in which the prevalence of bacteria decreased signifi-cantly (Table II).

Comparison of the total prevalence of Yersiniaspp. between males and females did not show signifi-cant differences but in females was nearly 10% higherthan in males. A much lower frequency of infectionin juveniles than in adult individuals was found butthe difference didn�t reach the statistical significancevalue (P≥0.05, Table II).

Table III shows the potential relation betweenthe occurrence of Yersinia spp., resp. Y. enterocoliticaand morphological features of the adult birds.Measurements of body weight and tarsus length were

Yersinia spp. 46 (47.4) 28 (28.9) 27 (27.8)Y. enterocolitica 8081 33 (34.0) 20 (20.6) 16 (16.5)

FE 80735KM 1PO/Y/1-3ARCTIC-P11

Y. kristensenii ATCC 33638 10 (10.3) 10 (10.3) 6 (6.2)N1SF35Y 160

Y. molareti H279-36/86 2 (2.1) 2 (2.1) 1 (1)Y. intermedia H9-36/83 2 (2.1) 2 (2.1) 0 (0)

253Y. aleksici 991 2 (2.1) 2 (2.1) 0 (0)

Y 388

Y. bercovieri H632-36/85 2 (2.1) 2 (2.1) 1 (1.0)Y. frederiksenii WS 52/02 2 (2.1) 0 (0) 2 (2.1)

Table ISpecies and prevalence of pharyngeal and cloacal bacteria in Dunnocks

in the Western Carpathians, Slovakia

Bacteria speciesStrain according

GenBank

Prevalence (n = 97)

TotalN (%)

PharynxN (%)

CloacaN (%)

n � number of examined birdsN � number of Yersinia positive samples with relative value in the brackets

81Short communication1

considered. No significant relationships were foundbetween the Yersinia spp., resp. Y. enterocolitica infec-tion and tarsus length or body weight of hosts.

When the dunnock sex and infestation by yer-siniosis were considered as independent variables, nostatistically significant difference was found in preva-lence of Yersinia between males and females (Table II).Therefore, both sexes were pooled together and testedagainst Yersinia as one group.

Y. pseudotuberculosis was not detected in any ofpharyngeal and cloacal swabs. The presence of the ailgene associated with the pathogenic strains of Yersiniawas not confirmed in any of the examined samples.

Recently, PCR method is widely used to identifyspecimens and studying the relationship of bacteria.

However, the target sequences of both primers Y1 andY2 using in this study are presented in more membersof the genus Yersinia; it was possible to determinatemore Yersinia species by using only one PCR array(Neubauer et al., 2000).

In this study, a lower occurrence of yersiniosis wasfound in subalpine habitats compared to the alpinezone in previous study (Novotný et al., 2007). Theauthors showed that in alpine accentors there is anunusually high prevalence of yersiniosis in compari-son to many other bird species. The authors attributethis to high adaptability of Yersinia species to coldenvironment. For example, Gill and Reichel (1989)referred to the ability of Y. enterocolitica to grow at�2°C. This might be the reason for its successful

Y. enterocolitica April (10) 7 (70) 3 (30)

May (32) 13 (40.6) 19 (59.4)0.03

June (25) 6 (24) 19 (76)July (30) 7 (23.3) 23 (76.7)

Yersinia spp. April (10) 8 (80) 2 (20)

May (32) 15 (46.9) 17 (53.1) NSJune (25) 10 (40) 15 (60)

July (30) 13 (43.3) 17 (56.7)

Y. enterocolitica Females (45) 17 (37.8) 28 (62.2)NS

Males (35) 13 (37.1) 22 (62.9)

Yersinia spp. Females (45) 25 (55.6) 20 (44.4)NS

Males (35) 16 (45.7) 19 (54.3)Y. enterocolitica Adults (80) 30 (37.5) 50 (62.5)

NSJuveniles (17) 3 (17.7) 14 (82.4)

Yersinia spp. Adults (80) 41 (51.3) 5 (29.4)NS

Juveniles (17) 39 (48.8) 12 (70.6)

Table IIThe prevalence of bacterial genera (species) in dunnocks according to the season

years, the host sex and age

Variable (n)Yersinia positive

N (%)Yersinia negative

N (%)P

n � number of examined birdsN � number of Yersinia positive (+) or negative (�) samples with relative value in the bracketsNS � not significant P > 0.05 (Chi-square test)

Y. enterocolitica Body weight (g) + 25 19.7 ± 0.8

� 46 19.1 ± 0.6NS

Tarsus length (mm) + 29 24.9 ± 0.2

� 48 24.8 ± 0.1NS

Yersinia spp. Body weight (g) + 34 19.6 ± 0.7� 37 19.1 ± 0.6

NS

Tarsus length (mm) + 39 24.8 ± 0.2

� 38 24.9 ± 0.2NS

Table IIIMorphological characters of adult dunnocks examined for yersiniosis

BacteriaMorphological

variablesYersinia

+ / �Number of adult

individualsMean ± SE P

NS � not significant, P> 0.05 (one � way ANOVA test)


expansion in high mountain environments and for itshigher prevalence in alpine accentors than in dunnocks.In this study we have confirmed that Y. enterocoliticais the most common yersinia in dunnocks in compari-son with other Yersinia species. Similar findings werereported in other species of birds (Niskanen et al.,2003; Novotný et al., 2007). Also other species ofYersinia (no pathogenic environmental species e.g.Y. intermedia, Y. frederiksenii or Y. kristenseni ect.)were frequently found in other species of birds(Niskanen et al., 2003; Janiga et al., 2007).

As our results show that distribution of yersiniosisin dunnock is seasonally dependent. Prevalence ofavian bacterial infections is known to have seasonaldynamics where social and other behaviours havebeen hypothesized to be a factor shaping these dy-namics (Faustino et al., 2004). The high occurrenceof Y. enterocolitica in cold months was confirmed inmany studies. For example, Kato et al. (1985) reportedsignificantly higher incidence of Y. enterocolitica inbirds in the spring than in the summer or autumnmonths. The highest prevalence of all Yersinia spe-cies in the dunnock was detected in April. In thismonth, the dunnock breeding season begins and birdsbegin to mate. Avian copulation involves cloacalcontact, which has been documented to host rich bac-terial communities (Lombardo, 1998; Lucas andHeeb, 2005). So, the risks of bacterial transmissionduring copulations in birds are expected to be high.Dunnocks have a variable mating system from mo-nogamy through polyandry to polygynandry (Davies,1985) and copulation with multiple partners furtherincreases the risk of avian infection. It seems bird dietmay also influence the occurrence of bacterial infec-tion. The dunnock is an insectivorous species and inApril, when the occurrence of insects increases in themountains, the risk of infection is higher. In the nextmonths (outside the mating period) the prevalence ofbacterial infection declines gradually. In July, whenthe juveniles have left the nests, the bacterial infec-tion may be slightly increased again. This phenom-enon is probably associated with reduced body con-dition of birds. The birds are exhausted after breedingand subsequent moulting may also have a significantimpact on the physiological status of the individuals.

Colonisation of nestlings by environmental mi-crobes begins soon after hatching. Mills et al. (1999)detected cloacal microorganisms in nestlings of thetree swallow (Tachycineta bicolour) two days afterhatching. The inoculation of nestlings by microbesmay occur from the environment via ingestion of adultsaliva, from food provided by the parents or from nestmaterials (Mills et al., 1999; Berger et al., 2003). Inour study, we detected about 20% fewer contaminationof Yersinia in juveniles than in adult birds. The lowinfection of juveniles during whole research period

indicates that infection of juveniles by Yersinia occurslater. We therefore suggest that young birds are in-fected by bacteria mainly during the breeding seasonin the following year.

To conclude, we confirmed that the prevalence ofbacterial infections in dunnocks shows seasonal dy-namics. In early spring, the high occurrence of Yersiniacontamination may be associated with changes in diet,but is most likely a consequence of the increased riskof contamination during mating. We observed thatthe sex of birds did not influence the distribution ofYersinia spp. in the dunnock and that bacterial occur-rence in birds increases with nestling age and stabi-lizes in adults. We didn�t found relationship betweenmorphological parameters (tarsus length and bodyweight) and Yersinia infestation, therefore we assumethat bacteria do not affect health and body conditionof individuals. Our findings support the idea that theYersinia species are surely a common member of bac-terial microflora in dunnocks.

Literature

Berger S., R. Disko and H. Gwinner. 2003. Bacteria in starlingnests. J. Ornithol. 144: 317�322.Cover T.L. and R.C. Aber. 1989. Yersinia enterocolitica. NewEngl. J. Med. 321: 16�24.Davies N.B. 1985. Cooperation and conflict among dunnocks,Prunella modularis, in variable mating system. Anim. Behav. 33:628�648Faustino C.R., C.S. Jennelle, V. Connolly, A.K. Davis,E.C. Swarthout, A.A. Dhondt and E.G. Cooch. 2004. Myco-plasma gallisepticum infection dynamics in a house finch popula-tion: seasonal variation in survival, encounter and transmissionrate. J. Anim. Ecol. 73: 651�669.Gill C.O. and M.P. Reichel. 1989. Growth of the cold-tolerantpathogens Yersinia enterocolitica, Aeromonas hydrophila andListeria monocytogenes on high-pH beef packaged under vacuumor carbon dioxide. Food Microbiol. 6: 223�230.Hussein H.M., S.G. Fenwick and J.S. Lumsden. 2001. A rapidand sensitive method for the detection of Yersinia enterocoliticastrains from clinical samples. Lett. Appl. Microbiol. 33: 445�449.Janiga M., A. Sedlárová, R. Rigg and M. Novotná. 2007. Pat-terns of prevalence among bacterial communities of AlpineAccentors (Prunella collaris) in the Tatra Mountains. J. Ornithol.148: 135�143.Kaneuchi Ch., M. Shibata, T. Kawasaki, T. Kariu, M. Kanzakiand T. Maruyama. 1989. Occurrence of Yersinia spp. in migra-tory birds, ducks, seagulls and swallows in Japan. Jpn. J. Vet. Res.51: 805�808.Kato Y., K. Ito, Y. Kubokura, T. Maruyama, K. I. Kanekoand M. Ogawa. 1985. Occurrence of Yersinia enterocolitica inwild-living birds and Japanese Serows. Appl. Env. Microbiol. 49:198�200.Lombardo M.P. 1998. On the evolution of sexually transmitteddiseases in birds. J. Avian Biol. 29: 314�321.Lucas F.S. and P. Heeb. 2005. Environmental factors shape cloa-cal bacterial communities in great and blue tit nestlings. J. AvianBiol. 36: 510�516.Mills T.K., M.P. Lombardo and P.A. Thorpe. 1999. Microbialcolonization of the cloacae of nestling tree swallows. Auk 116:947�956.


Nakamura M. 1990. Cloacal protuberance and copulationbehavior of the Alpine Accentor (Prunella collaris). Auk 107:284�295.Neubauer H., A. Hensel, S. Aleksic and H. Meyer. 2000. Iden-tification of Yersinia enterocolitica within the genus Yersinia. Sys.Appl. Microbiol. 23: 1�5Nikolova S., Y. Tzvetkov, H. Najdenski and A. Vesselinova.2001. Isolation of pathogenic Yersiniae from wild animals in Bul-garia. J. Vet. Med. 48: 203�209.Niskanen T., J. Waldenström, A.M. Fredriksson, B. Olsen andH. Korkeala. 2003. virF-Positive Yersinia pseudotuberculosis

and Yersinia enterocolitica found in migratory birds in Sweden.Appl. Env. Microbiol. 69: 4670�4675.Novotný M., M. Feèková, M. Janiga, M. Lukáò, M. Novotnáand Z. Kovalèíková. 2007. High incidence of Yersinia enteroco-litica (Enterobacteriaceae) in Alpine Accentors Prunella collarisof the Tatra Mountains. Acta Ornithol. 42: 137�143Schiemann D.A. 1979. Synthesis of a selective agar medium forYersinia enterocolitica. J. Microbiol. 25:1298.Wannet W.J.B., M. Reessink, H.A. Brunings and H.M.E. Maas.2001. Detection of pathogenic Yersinia enterocolitica by rapid andsensitive duplex PCR Assay. J. Clin. Microbiol. 39: 4483�4486.


SHORT COMMUNICATION

* Corresponding author: B. Kowalska, Institute of Horticulture, Konstytucji 3 Maja 1/3; 96-100 Skierniewice, Poland; e-mail:[email protected]

Onion (Allium cepa L.) is one of the major vege-table crops grown in Poland. Since the onion harvest-ing period often coincides with rainy weather and dur-ing cultivation it may hail, complex bacterial andfungal diseases often occur. In the last years especiallybacterial diseases of onion cause very serious prob-lems in Poland. These diseases may cause significanteconomic losses because they are difficult to control.Bacterial soft of onion bulbs is the most frequentand it can appear during cultivation, storage or trans-portation. It is common knowledge that in Poland,bacterial diseases of onion are caused by Burkhol-deria gladioli, Burkholderia cepacia, Pectobacteriumcarotovorum subsp. carotovorum (Sobiczewski andSchollenberger, 2002). Foreign reports conclude thatbacteriosis of onion can also be caused by Pseudo-monas marginalis (Kim et al., 2002; El-Hendawy,2004), Pseudomonas syringae, Pseudomonas viridif-lava (Gitaitis et al., 1998), Pantoea ananatis (Gitaitiset al., 2002), Enterobacter cloacae (Schroeder et al.,2009; Schwartz and Mohan, 2008), Burkholderiaambifaria and Burkholderia pyrrocinia (Jacobs et al.,2008). Also bacterium Serratia spp. was noted as anonion pathogen in Brasil (Beriam, 2007). The libera-lization of policies concerning border protection andintense trade favor transmission of pathogens fromforeign countries.

During the summer and autumn of 2003, 2006and 2007, disease symptoms of unknown origin were

observed on onion (Allium cepa L.) bulbs in the fieldand storage houses in different places in Poland.These symptoms were typical for bacterial disease� water soaked and pale brown lesions appeared onthe internal scales, they enlarged and extended toexternal scales with an associated sour smell. Bacte-ria from the infected bulb tissues were isolated andpurified on nutrient agar. About forty isolates wereobtained and these isolates were examined for theability to macerate onion tissue. The pathogenicitytest was conducted on healthy onion bulbs cv.Grabowska. The bulbs were peeled, washed with run-ning water and sterilized in 70% ethanol for 30 secand in 0.5% NaOCl for 5 min. The bulbs were washedin sterile water and cut lengthwise into two parts.Three onion pieces were placed, cut side down, intoa Petri dish (180 mm in diameter). The outer scaleof each piece was wounded with the microbiolo-gical needle and inoculated by 20-µl aliquot of bac-terial suspension of density 1.0�2.5×108 cfu/ml. Foreach isolate three Petri dishes were included. Con-trol treatment remained uninoculated. The Petridishes were incubated 4 days at 28°C. Nine of fortyisolates expressed rot symptoms on the scales. Theseisolates were studied by using biochemical andmolecular methods.

Biochemical identification of the isolates were per-formed by using the API 20E system (bioMerieux)which gave a bacterial code of 1207763 (Table I)

First Report of Serratia plymuthica Causing Onion Bulb Rot in Poland

BEATA KOWALSKA*, URSZULA SMOLIÑSKA and MICHA£ OSKIERA

Institute of Horticulture, Skierniewice, Poland

Received 6 January 2010, revised 18 December 2010, accepted 20 December 2010

A b s t r a c t

Specific bacterial disease symptoms were observed on onion bulbs in almost all regions in Poland. For the purpose of identification ofagents causing disease, bacteria were isolated from the symptomatic plants. Their pathogenicity was confirmed by using pathogenicity teston onion scales. These bacteria were identified biochemically and molecularly as Serratia plymuthica.

K e y w o r d s: Serratia plymuthica, bacterial disease, onion

86 Kowalska B. et al. 1

Table IBiochemical profile of tested isolates conducted using identification system API 20E

ON

PG

AD

H

LD

C

OD

C

CIT

H2S

UR

E

TD

A

IND

VP

GE

L

GL

U

MA

N

INO

SO

R

RH

A

SA

C

ME

L

AM

Y

AR

A

OX

+ � �� +��+ +++++ � ++++ �

test reactions / enzymesONPG $-galactosidase

ADH arginine dihydrolaseLDC lysine decarboxylase

ODC ornithine decarboxylase

CIT citrate utilizationH

2S H

2S production

URE urease

TDA tryptophane deaminaseIND indole production

VP acetoin production

GEL gelatinaseGLU fermentation / oxidation (glucose)

MAN fermentation / oxidation (mannitol)

INO fermentation / oxidation (inositol)SOR fermentation / oxidation (sorbitol)

RHA fermentation / oxidation (rhamnose)

SAC fermentation / oxidation (saccharose)MEL fermentation / oxidation (melibiose)

AMY fermentation / oxidation (amygdalin)

ARA fermentation / oxidation (arabinose)OX cytochrome oxidase

(% identity = 59.6; T = 1.0). The numerical profileshowed a correct identification of all examined strainsas Serratia plymuthica. Additionally, some biochemi-

cal tests were conducted. The microorganisms wereGram-negative, catalase positive, oxidase negative andgrew in anaerobic condition.

Fig. 1. Homology sequence alignment of the 16S rRNA region of type strain S. plymuthica DSM 4540 acc. no. AJ233433.1, testedisolate 466 acc. no HM596429.1, strain of the nearest BLAST match S. plymuthica RVH1 acc. no AY394724.1. Sequences wereretrieved from the GenBank (National Center for Biotechnology Information) database under the accession numbers indicated.

AJ233433.1 CGTGTGTGAAGAAGGCCTTAGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGG--CAGTG

||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||

HM596429.1 361 CGTGTGTGAAGAAGGCCTTAGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGGTTCAGTG 420|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||

AY394724.1 CGTGTGTGAAGAAGGCCTTAGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGGTAGTGTG

AJ233433.1 TTAATAGCACAT-TGCATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAG

|||||||||| | | | |||||||||||||||||||||||||||||||||||||||||||

HM596429.1 421 TTAATAGCAC-TGTRCATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAG 479|||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||

AY394724.1 TTAATAGCACAT-TRCATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAG

AJ233433.1 AGAA-TT-CGCTAGAGATAGCTTAGTGCCTTCGGGAACTCTGAGACAGGTGCTGCATGGC

|||| || | | |||||| | || ||||||||||||||||||||||||||||||||||||

HM596429.1 960 AGAACTTTC-C-AGAGATGGATTGGTGCCTTCGGGAACTCTGAGACAGGTGCTGCATGGC 1017||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

AY394724.1 AGAACTTTC-C-AGAGATGGATTGGTGCCTTCGGGAACTCTGAGACAGGTGCTGCATGGC


The identity of the isolates was confirmed by mo-lecular techniques � 16S rRNA sequence analysis.DNA was isolated by �Genomic mini� kit accordingto producent�s clues (A & A Biotechnology). The 16SrDNAs were amplified by using universal primersfD1 (5�AGAGTTTGATCMTGGCTC3�) and rP2(5�ACGGCTACCTTGTTACGACTT3�) (Weisburget al., 1991). Additional sequensing primers wereused: 800f (5�ATTAGATACCCTGGTAG3�) and 800r(5�CTACCAGGGTATCTAAT3�) (Fouad et al., 2002).The amplified PCR products, lenght 1500 bp, wereseparated by 1.5% agarose gel electrophoresis, thenextracted and purified from gel with the DNA Frag-ment Purification Kit (A & A Biotechnology). DNAsequences were compared to NCBI database (www.ncbi.nlm.nih.gov) using BLAST program (Basic LocalAlignment Search Tool), demonstrated that 16S rRNAgene of the studied isolates of bacteria shared highidentities (99.7%) with Serratia plymuthica RVH1,NCBI GenBank database accession no. AY394724.1(Fig. 1, Table II). The 16S rRNA sequence of theone representative isolate (466) has been depositedin the GenBank database under the accession numberHM596429.1.

The biochemical test data along with sequenceanalysis of a portion of the 16S rRNA gene confirmedall the isolates to be Serratia plymuthica. Accordingto our knowledge, this is the first report of S. plymu-thica causing a bulb rot of onion in Poland.

AcknowledgmentsThis work was supported by grant NN 310299734

DSM 4540 � type strain AJ233433.1 Germany 98.9% 1449/1465

466 � tested isolate HM596429.1 Poland 100% 1460/1460

RVH1 AY394724.1 Belgium 99.7% 1456/1461

Table IIBLAST search results for 16S rRNA gene sequence of representative isolate 466

S. plymuthica isolate Accession no Country Identity Match

Literature

Beriam L.O. S. 2007. Palestra doencas bacterianas em hortalicas.Biologico 69: 81�84.El-Hendawy H.H. 2004. Association of pectolytic fluorescentpseudomonads with postharvest rots of onion. Phytopathol.Mediterr. 43: 369�376.Fouad A.F., J. Barry, M. Caimano, M. Clawson, Q. Zhu,Carver R., K. Hazlett and J.D. Radolf. 2002. PCR-based iden-tification of bacteria associated with endodontic infections.J. Clin. Microbiol. 40: 3223�3231.Gitaitis R., G. MacDonald, R. Torrance, R. Hartley,D.R. Sumner, J.D. Gay and W.C. Jahnson. 1998. Bacterialstreak and bulb rot of sweet onion: II. Epiphytic survival ofPseudomonas viridiflava in association with multiple weed hosts.Plant Dis. 82: 935�938.Gitaitis R., R. Walcott, S. Culpepper, H. Sanders, L. Zolobow-ska and D. Langston. 2002. Recovery of Pantoea ananatis, casualagent of center rot of onion, from weeds and crops in Georgia,USA. Crop Protect. 21: 983�989.Jacobs J.L., A.C. Fasi, A. Ramette., J.J. Smith, R. Hammer-schmidt and G.W. Sundin. 2008. Identification and onion patho-genicity of Burkholderia cepacia complex isolates from the onionrhizosphere and onion field soil. Appl. Environ. Microbiol. 74:3121�3129.Kim Y.K., S.D. Lee, C.S. Choi, S.B. Lee and S.Y. Lee. 2002.Soft rot of onion bulbs caused by Pseudomonas marginalis underlow temperature storage. Plant Pathol. J. 18: 199�203.Schroeder B.K., L.J. du Toit and H.F. Schwartz. 2009. Firstreport of Enterobacter cloacae causing onion bulb rot in theColumbia Basin of Washington State. Plant Dis. 93: 323.Sobiczewski P. and M. Schollenberger. 2002. Bacterial deseasesof horticulture plants (in Polish). pp. 64�67; 54�57. PañstwoweWydawnictwo Rolnicze i Le�ne. Warszawa.Schwartz H.F. and S.K. Mohan. 2008. Compendium of onion andgarlic diseases and pests. APS PRESS, St. Paul, Minnesota, USA.Weisburg W.G., S.M. Barns, D.A. Pelletier and D.J. Lane.1991. 16S ribosomal DNA amplification for phylogenetic study.J. Bacteriol. 173: 697�703.

88 Kowalska B. et al. 1

Polish Journal of Microbiology2011, Vol. 60

Scope

Polish Journal of Microbiology publishes descrip-tions of all aspects of basic and applied research thatfocuses on topics of basic research and practical valuein microbiology. Topics that are considered includemicrobiology in the area of basic biological propertiesof bacteria and archaea, viruses, and simple eukaryoticmicroorganisms, genetics and molecular biology,microbial ecology, medical bacteriology, public healthas well as food microbiology, industrial microbiologyand bacterial biotechnology.

A manuscript of the original paper (full lengthpaper and short communication) submitted to Pol.J. Microbiol must present reports of original researchthat have not been previously published and is notbeing considered for publication elsewhere. All authorsof manuscripts areresponsible for their content andit is assumed that they all have contributed substan-tially to the presented research, read and approvedthe manuscript.

Minireviews in areas of particular interests andimportance in microbiology are also published. Theyare usually invited, but authors wishing to submita mini-review should contact the Editor in Chiefdirectly for further information

How to Submit Manuscripts

Submit via e-mail the electronic version (text andtables as a Word 7 attachment, with figures in jpg/pdfformat saved individually) to the address: [email protected], The manuscript should be accompanied bya cover letter stating the postal address, phone andfax numbers and e-mail of the corresponding authorwho is responsible for the all correspondence regard-ing the submitted paper. Receipt of each manuscriptwill be confirmed by e-mail to the correspondingauthor within five business days. It will be givena PJM number which the corresponding author isasked to refer to in correspondence with the editors.Correspondence is by e-mail.

Beside the main title of the paper include in thecover letter the proposed �running title� of the manu-script (about 50 characters in length, including spaces).

Before writing a manuscript authors are advisedto consult a current issue of Polish Journal of Micro-

biology and carefully read the Instructions to Authors(available at www.microbiology.pl/pjm and printed inthe first issue of the volume) in order to be familiarwith the general form of papers published.

The manuscript should be written in English.Grammar, syntax and spelling must be carefullychecked before submission of the paper. Authors whoare unsure of proper English usage should have theirmanuscript checked by someone proficient in both theEnglish language and biological terminology. Manu-scripts may be rejected on the basis of poor Englishor lack of conformity to accepted standards of stylebefore the review process.

Junior scientists submitting his/her paper must havethe submitted manuscript accepted by the head of thescientific unit where the research was carried out.

Illustrations may be supplied as PDF/jpg files forreviewing purposes only on initial submission. Afterreceiving the Letter of Acceptance, please submitillustration at their intended publication size in tiffformat (with LZW compression) at the correct reso-lution: 300 dpi for grayscale and color, 600 dpi forcombination art (lettering and images) and 1,200 dpifor line art. Halftone images (those with various den-sities or shades) must be prepared in tiff, not bitmapor jpg. For instructions on creating acceptable tifffiles, refer to the Cadmus digital art website.

There is no page charge for publication in PJM,except to color illustrations.

The Review Process

All manuscripts are subjected to pre-screening bythe Editor in Chief and can be rejected at this stageor returned for corrections before evaluation (if theydo not meet the criteria given in the Instruction toAuthors, including language quality or are out ofscope of PJM). After passing the pre-screening stagethe manuscripts are processed by one of the editorsand sent to at least one qualified outside referee, butthe editors may also act as reviewers.

Authors may suggest, in the cover letter, the names(together with contact details) up to 5 potential refereeswhich may be used at the discretion of the editor. Whena manuscript is returned to the authors for modifica-tion, it should be returned to the editorial office within3 months; otherwise it may be considered withdrawn.

Instruction to Authors

(modified, effective Vol. 60, 2011)

90 Instruction to Authors 1

While the paper is accepted for publication thetransfer of copyright to the Publisher becomes effec-tive. The papers are generally printed in no more thanthree months after returning the corrected version andobtaining its final acceptance.

Preparation of Manuscripts

Regular paper

The manuscript of the full length original paper ingeneral should not exceed 20 typed pages (up to 1800letters per page) including tables and figures. Typeevery portion of the manuscript double-spaced using12 points Times New Roman. Do not use bolded fontsexcept for subtitles or italics except for microor-ganism names (Escherichia coli), genetic loci (repA)or Latin words like: in vivo, et al., etc., journal titleabbreviations (J. Bacteriol.) and book titles (not titlesof the chapters). No part of the manuscript shouldbe underlined and written using CAPITAL letters).Number all pages in sequence, including abstract,tables, figures and figure legends.

The full length paper should be divided into thefollowing sections written in sequence: Title, Abstract,Introduction, Experimental: Materials and Methods,Results, Discussion, Acknowledgments, Literature.

Title

The title should describe the contents of the paperin a concise but attractive for readers way. Below thetitle of the manuscript include: full name (includingfirst name and middle initial) of each author, nameof the institution(s) at which the work was performed,or each co-author�s affiliation if different.

Street address, telephone/fax number and e-mailaddress should be given only for the correspondingauthor and placed in the footnote at the bottom ofthe first page.

Abstract

Limit the abstract to 250 words or fewer. Becausethe abstract will be published separately by abstract-ing services, it must be complete and understandablewithout reference to the text. It should be writtenin an impersonal form. Abbreviations, diagrams andreferences are not allowed.

Key words

Up to five key words or short phrases should begiven and placed below the abstract. If names of mi-croorganisms are used, they should precede the key

words, and be followed by the latter in alphabeticalorder. All key words should be relevantly connectedwith the subject matter (avoid common terms like:bacteria, medium, soil, temperature etc.) as they willbe used for indexing purposes.

Introduction

The introduction should provide background infor-mation to allow the reader to understand and evaluatethe results of the present study and describe the pur-pose of the undertaken research. However, broad�academic lectures� on the subject and extensiveliterature reviews should be avoided.

Experimental

Materials and Method

This section should contain description of materials(biological and others) used and sufficient technicalinformation so that the experiments can be repeated.For commonly used materials and methods (e.g. com-monly used media, protein determination) a simplereference is sufficient. Novel or modified proceduresshould be described in detail.

When a large number of microbial strains or mu-tants were used in a study, include strain tables identi-fying the sources and properties of the strains, mutants,bacteriophages, plasmids, etc.

For names of microorganisms, follow the guide-lines of the International Nomenclature Committee(up to date names available as validation list of Inter-national of the Systematic and Evolutionary Micro-biology). Species names are written in full the first timethe name appears in text; subsequently, only use thefirst letter of the genus name followed by the speciesepithet (e.g. Escherichia coli, then E. coli). Geneticloci are italicized (repA), protein products of the lociare not italicized (RepA).

The source of materials (media or chemicals) shouldbe indicated if critical for the validity of experimentalresults. For centrifugation conditions preferably givethe centrifuge forces in �g� (10 000×g) rather than rpm.

Units of measurement should be used in SI system,but for practical reasons, some exceptions to SI unitsare allowed; e.g. for liter use �l� not �L� (1 l not 1 L,20 mg/ml not 20 mg/ml). Always include the spacebetween the number and the unit (2 mM not 2 mM).

Results

In the �Results� section, include only the resultsof the experiments; reserve extensive interpretation ofthe results for the �Discussion� section. While justified

91Instruction to Authors1

by the nature of the paper the ,,Results� and ,,Discus-sion� sections may be combined (e.g. �Results andDiscussion�). Present the results as concisely aspossible and illustrate them with tables or figures ifapplicable (presentation of the same results in bothtables and figures is not acceptable). Avoid the use ofgraphs to present data that might be more conciselypresented in the text. Limit illustrative materials tothose that are absolutely necessary to demonstratethe original experimental findings. Number figures(Arabic numerals) and tables (Roman numerals) in theorder in which they are cited in the text, and be sureto cite all figures and tables.

Tables. Each table must be typed on separate pagesand numbered with Roman numerals (Table I., etc.)in the order they are cited in the text. The headingsshould be sufficiently clear so that the data will beunderstandable without reference to the text. Explana-tory footnotes are acceptable. Prepare your tables assimple as possible in Word not in Excel, no �decora-tive� frames should be made.

Figures (graphs, diagrams etc.) should be submit-ted ready for reproduction, each on a separate sheet(or as a separate document on a floppy disc or CD).The preferred graphic application is Photoshop orCorelDraw saved in tiff format (with LZW compres-sion). Figures should be numbered as in the text(Arabic numerals, Fig. 1., etc.) and marked with thename of the first author. Figures should be under-standable without referring to the text. Originalrecorder tracing (outprints) of NMR, IR, ESR spectraetc. are not acceptable for reproduction; they shouldbe redrawn. Figure titles and legends must be listedon a separate page. Photographs need to be in goodquality with proper resolution used (minimal resolu-tion are 300 for halftones and 600 dpi for combina-tion of photos with lettering). Color illustration canbe made only at the author�s expenses (further detailsare available at the Editorial Office).

New nucleotide sequences must be accompaniedby the accession number obtained from proper data-bases and should be included in the text.

Discussion

The �Discussion� should provide an interpretationof the obtained results in relation to previously pub-lished work and to the experimental system at handand should not contain extensive repetition of the,,Results� section or reiteration of the introduction.In some papers the Results and Discussion can becombined into one section as mentioned above.

AcknowledgementsAcknowledgements for financial support and for

a personal assistance (with the permission of person

named) are given in two separate paragraphs belowthe main text.

Literature

It is the responsibility of authors to verify each ref-erence against the original article as well as make surethat each paper cited in the text is included in thelist. Keep the number of citations reasonable, avoidexhaustive citations of �historical� papers except ifabsolutely necessary.

In the text references should be cited by the namesof the authors and the year of publication, e.g. Nowakand Kowalski (1999) stated that...; as previouslydescribed (Nowak and Kowalski, 2000; Nowak,2005). When a paper has more than two authors, thefirst author�s name should be followed with et al. andthe year of publication, e.g. Nowak et al., 2002. Whilereferences occur that are not identified by the authors�names and year, use a, b etc. after the year (Nowaket al., 2002a; 2002b).

The list of the papers cited (Literature) must bearranged alphabetically according to the last nameof the first author and not numbered. Papers with one only author are listed in chronological order (theearliest first); papers with two authors are listedalphabetically according to the last name of the firstauthor and by the last name of the second author;paper with three or more authors appear as those withtwo authors and are listed chronologically. When thepaper has more than ten authors state the names of thefirst ten, followed by .. ..and others. For citationsof books, books chapters, thesis, printed conferenceproceedings etc. see examples given below.

Please follow the punctuations, brackets, capitalletters etc. exactly as shown. Put and not & beforethe last author�s name. Use the proper journal titlesabbreviations (ISO) as indicated in the PubMedJournal Database.

Examples of literature citations

Books and book chapters:

Sambrook J., E.F. Fritsch and T. Maniatis. 1989.Molecular Cloning; a Laboratory Manual, 2nd ed. ColdSpring Harbor, NY: Cold Spring Harbor Laboratory.Snyder L. and W. Champness. 2003. Molecular Gene-tics of Bacteria. 2nd ed. ASM Press, Washington, D.C.Funnel B.E. and G.J. Phillips (eds). 2004. PlasmidBiology. ASM Press, Washington, D.C.Belfort M., V. Derbyshire, M.M. Parker, B. Cousi-neau and A.M. Lambowitz. 2004. Mobile introns:pathways and proteins, pp. 761�783. In: Funnel B.E.and G.J. Philips (eds). Plasmid Biology. ASM Press,Washington, D.C.

92 Instruction to Authors 1

Journal articles:1 author:Eckhardt T. 1978. A rapid method for identificationof plasmid desoxyribonucleic acid in bacteria. Plasmid1: 584�588.

2 authors:So³yga A. and D. Bartosik. 2004. Entrapment vectors� how to capture a functional transposable element.Pol. J. Microbiol. 53: 139�144.

3 to 10 authors:Bartosik D., M. Szymanik and J. Baj. 2004. Iden-tification and distribution of insertion sequences ofParacoccus solventivorans. Appl. Environ. Microbiol.69: 7002�7008.

More than 10 authorsRoberts R.J., M. Belford, T. Bestor, A.S. Bgagwat,T.A. Bickle, J. Bitinaite, R.M. Blumenthal, S.K.Degtyarey, D.T. Dry den, K. Dybyig and others.2003. A nomenclature for restriction enzymes. DNAmethyl-transferases, homing endonucleases and theirgenes. Nucleic Acids Res. 31: 1805�1812.

Papers in a language different than English � the titleshould be translated into English and the original lan-guage should be stated in parenthesis.Bartosik D. 2001. Bacterial plasmids stability (inPolish). Post. Biochem. 47: 138�145.

Ph.D. ThesisSzymanik M. 2006. Ph.D. Thesis, (title optional).Warsaw University. Warsaw. Poland

Conference materials (exceptionally)Dziewit L., M. Jazurek, L. Drewniak, J. Baj andD. Bartosik. 2006. Identification of a novel family ofaddiction systems. Abstracts of International PlasmidBiology Conference. Plasmid Biology 2006. FallenLeaf Lake, South Lake Tahoe California. USA. p. 163.

Papers in press or personal communication and un-published results should not be included in the Lit-erature citation list.

Short communications

A short communication is intended for the presen-tation of brief observations that do not warrant a full-length paper. Submit it in the same way as a full-lengthpaper. Each Short communication must have an ab-stract of no more than 100 words. Do not use sectionsheading in the body of the text. All the required for-mation (introduction, methods, results and discussion)

except for the Literature must be given in single sec-tion. Total length cannot exceed 8 double printedpages including illustrative material (in total no morethan 3 figures and tables). They undergo the samereview process as full length papers and are not printedmore quickly.

Minireviews

Minireviews are published in areas of particularinterest and importance. They are usually invited, butauthors wishing to submit a minireview should contactthe Editor in Chief directly for further information.Authors need to be experts on the topic revieweddocumented with published achievements in the field.

Proofs

The text for proof will be e-mailed (as .pdf file) tothe corresponding author. It should be printed out andafter introducing necessary corrections, returned bypriority mail to the postal address of editorial office assoon as possible. If the required corrections are minor,the author (especially foreign) may list them and e-maildirectly to the address [email protected] (do not forgetto state the paper title and given editorial number ofthe manuscript).

Reprints

Beginning 2007 the Journal has not provided freereprints. The corresponding author will be providedwith a pdf of his article by the Editorial Office.If printed copies of the article are required they canbe ordered (in multiples of 20) together with returnof the corrected proof. The reprints will be mailedafter receiving payment (conditions of payment maybe obtained at [email protected], Ms Beata Mazinska).Free of charge copies are available at

www.microbiology.pl/pjm

Copyrights

Submission of the manuscript implies that theresearch presented has not been published before(except in the form of a conference abstract or a partof PhD thesis). Transfer of copyrights to the publisherbecomes effective if and when the article is acceptedfor publication. All articles published in Polish Journalof Microbiology are protected by copyrights whichcover the exclusive rights to reproduce and distributethe article as well as the translation. No part of thepublished material can be reproduced without obtain-ing written permission from the publisher.

POLISH JOURNAL OF MICROBIOLOGY

(founded in 1952 as Acta Microbiologica Polonica)

www.microbiology.pl/pjm

EDITOR-in-CHIEF: Stanis³awa TYLEWSKA-WIERZBANOWSKA

EDITORS: Izabela SITKIEWICZWaldemar SIUDAAnna SKORUPSKA

EDITORIAR OFFICE: Ilona M¥CZKA

EDITORIAL SECRETARY: Anna KRACZKIEWICZ-DOWJAT

POSTAL ADDRESS: Polish Journal of MicrobiologyChocimska 2400-791 Warsaw, POLAND

CONTACT: Phone / Fax: (48 22) 5421250E-mail: Editorial Office ([email protected])

Editor-in-Chief ([email protected])

EDITORIAL BOARD

President: Andrzej PIEKAROWICZ (Warsaw, Poland)

Agata Budkowska (Paris, France) Teresa Lagergård (Göteborg, Sweden)Hanna Dam (Olsztyn, Poland Wanda Ma³ek (Lublin, Poland)Estera Dey (Lund, Sweden) Zdzis³aw Markiewicz (Seattle, USA)Jaros³aw Dziadek (£ód�, Poland) Barbara Ró¿alska (£ód�, Poland)Waleria Hryniewicz (Warsaw, Poland) Geoffrey Schild (Potters, Bar, UK)Katarzyna Jagusztyn-Krynicka (Warsaw, Poland) Wac³aw Szybalski (Madison, USA)Donovan P. Kelly (Coventry, UK) Torkel Wadström (Lund, Sweden)Józef Kur (Gdañsk, Poland) Krystyna I. Wolska (Warsaw, Poland)

PUBLISHER: POLISH SOCIETY OF MICROBIOLOGISTS

Published quarterly with the financial support of the Ministry of Science and Higher Education

SUBSCRIPTION:For information for Polish subscribers contact Secretary of Polish Society of Microbiologists,Che³mska 30/34, 00-725 Warsaw, Poland; phone: (48) 22 8413367, fax: (48) 22 8412949,e-mail: [email protected]

For information for foreign subscribes contact �Ars Polona� � e-mail: [email protected];phone: + 48 (22) 5098661-5 also www.arspolona.com.pl

Cover illustration: Setose of C. dematium in SEM (Photo M. Wróbel).ZOFIA MACHOWICZ-STEFANIAK: Occurrence and characterizationof Colletotrichum dematium (Fr.) Grove, in: Polish J. Microbiology 59, 3, 191�200

Typesetting and print: Publishing House Letter Quality, 01-216 Warsaw, Brylowska 35/38Circulation: 300

Polish Journal of Microbiology, founded in 1952 as Acta Microbiologica Polonica, is a broad-based inter-national microbiological journal covering: general microbiology, bacterial physiology, molecular biologyand genetics, virology, clinical bacteriology, environmental microbiology and biotechnology.

Polish Journal of Microbiology publishes mainly original research articles including short communica-tions, but also minireviews, book reviews and press releases. All the papers should be prepared accordingto �Instruction to Authors� which is included in the first issue of every volume and also available atwww.microbiology.pl/pjm. The papers appear usually within 3 months after final acceptance.

Abstracts and full texts of the papers (as pdf-s) are available under www.microbiology.pl/pjm directly afterthe printed version appears.

Polish Journal of Microbiology is currently covered by Science Citation Index Expanded (ISI) andJournal Citation Reports (JCR)/Science Edition, Thomson Master Journals List, Biological Abstracts,BIOSIS Previews, EMBASE/Excerpta Medica, Index Medicus/MEDLINE, Cambridge ScientificAbstracts, SCOPUS, Index Copernicus.

Submissions of manuscripts in various areas of microbiology are very welcome.

After acceptance of the paper the copyrights are reserved to the Publisher. No part of the publication may bereproduced in any form without prior written permission of the Publisher, Polish Society of Microbiologists.

Subscription information for Polish subscribers under [email protected], for foreign subscribersunder www.arspolona.com.pl or [email protected]

Advertising offer

The Editorial Office of the Polish Journal of Microbiology encourages our Readers to place advertisementsin our quarterly. Our journal reaches scientists working in various research and educational institutions andinvolved in different fields of microbiology.We ensure rapid appearance of the ad.

Price of black and white ad on inside cover: half of page = 150 PLN, full page = 300 PLNPrice of ad inside an issue: half page = 75 PLN, full page 150 PLN.

Please send file with graphical layout directly to the editorial officeof the journal or contact us at [email protected].

The Editorial Office and Publisher do not take any responsibility for the contents of advertisementand announcements.

ISSN � 1733-1331Index � 35119

vol 6012011

Documents