visualizing extravasation dynamics of metastatic tumor cells · extravasate into the surrounding...

2332 Research Article

IntroductionFor a tumor cell to disseminate in the body it must perform severalimportant steps, including invasion of surrounding tissues,intravasation into the blood vessel, survival in the circulation,extravasation from the blood stream, and proliferation at a secondarysite in a foreign environment (Nguyen et al., 2009). The recentdevelopment of fluorescent protein techniques and intravital imagingmethods has significantly expanded our understanding of thisdynamic process in vivo (Sahai, 2007; Kienast et al., 2010). Themajority of these studies have focused on the initial steps of metastasis(tumor cell invasion and intravasation) because they are moreamenable to high-resolution in vivo imaging using existing animalmodels. Consequently, late steps of the metastatic cascade, such astumor cell extravasation, are not fully appreciated and poorlyunderstood. In fact, most of the data is inferred from low-resolutionin vivo studies or endpoint assays that indirectly monitor tumor cellextravasation by quantifying secondary tumor formation in mouseor chick CAM models, days or weeks after tumor cell inoculationinto the circulation (Luzzi et al., 1998; Podsypanina et al., 2008;Sahai, 2007; Townson and Chambers, 2006). However, given thatthe circulation is a hostile environment, it seems plausible thatsuccessful metastatic cells would rapidly exit the vessel within a fewhours or days to gain access to ECM-rich tissues and other survivalfactors. This suggests that circulating tumor cells that can efficientlyexit the blood system might have a distinct advantage during themetastatic cascade of events (Bos et al., 2009; Gupta et al., 2007).

Several studies have attempted to visualize cellular mechanismsof tumor cell extravasation in vivo using mouse or chick CAMhuman tumor xenograft assays. These studies led to the conclusion

that tumor cell extravasation is a complex process that might involvepassive or active tumor cell movement within the vessel lumen,adhesion of tumor cells to the vascular wall and transendothelialpassage of tumor cells using yet unknown mechanisms (Colmone etal., 2008; Kienast et al., 2010; Luzzi et al., 1998; Sipkins et al., 2005;Voura et al., 2004; Yamauchi et al., 2006). The extravasation kineticswere found to vary significantly depending on the cancer cell typeused and extravasation site (organ) studied, suggesting that it mightbe regulated not only by the metastatic potential of the cell, but alsoby the unique characteristics of the local endothelium (Colmone etal., 2008; Schluter et al., 2006; Kienast et al., 2010). Indeed, leukemiccells were found to home preferably to SDF-1-positive areas withinthe bone marrow endothelium before their extravasation (Sipkins etal., 2005). It has also been postulated that tumor cells could affectthe local structure and viability of the vessel endothelium at the siteof extravasation; however, the exact nature of these events remainsunknown (Heyder et al., 2006; Weis et al., 2004). All together, thesestudies suggest that extravasation of tumor cells involves a dynamicinterplay between the invading tumor cell and the vessel endothelium.However, the inability to observe these dynamic cell interactions inhigh-resolution detail in real time has hindered our understanding ofhow tumor cells modulate the endothelium and physically penetratethe vascular wall during extravasation.

Here, we investigate in high-resolution detail the dynamic behaviorof metastatic human cancer cells undergoing extravasation usingintravital confocal microscopy and optically transparent Tg(fli1:egfp)transgenic zebrafish that uniformly express GFP throughout theirvasculature. This line has been extensively used to image tumor-induced and developmental angiogenesis, and is uniquely suited for

Visualizing extravasation dynamics of metastatictumor cellsKonstantin Stoletov1, Hisashi Kato2, Erin Zardouzian1, Jonathan Kelber1, Jing Yang3, Sanford Shattil2 andRichard Klemke1,*1Department of Pathology and Moores Cancer Center, University of California, San Diego, 9500 Gilman Drive, MC0612, La Jolla, CA 92093, USA2Department of Medicine, University of California, San Diego, 9500 Gilman Drive, MC0612, La Jolla, CA 92093, USA3Department of Pharmacology, University of California, San Diego, 9500 Gilman Drive, MC0612, La Jolla, CA 92093, USA*Author for correspondence ([email protected])

Accepted 7 April 2010Journal of Cell Science 123, 2332-2341 © 2010. Published by The Company of Biologists Ltddoi:10.1242/jcs.069443

SummaryLittle is known about how metastatic cancer cells arrest in small capillaries and traverse the vascular wall during extravasation in vivo.Using real-time intravital imaging of human tumor cells transplanted into transparent zebrafish, we show here that extravasation ofcancer cells is a highly dynamic process that involves the modulation of tumor cell adhesion to the endothelium and intravascular cellmigration along the luminal surface of the vascular wall. Tumor cells do not damage or induce vascular leak at the site of extravasation,but rather induce local vessel remodeling characterized by clustering of endothelial cells and cell-cell junctions. Intravascularlocomotion of tumor cells is independent of the direction of blood flow and requires 1-integrin-mediated adhesion to the blood-vesselwall. Interestingly, the expression of the pro-metastatic gene Twist in tumor cells increases their intravascular migration andextravasation through the vessel wall. However, in this case, Twist expression causes the tumor cells to switch to a 1-integrin-independent mode of extravasation that is associated with the formation of large dynamic rounded membrane protrusions. Our resultsdemonstrate that extravasation of tumor cells is a highly dynamic process influenced by metastatic genes that target adhesion andintravascular migration of tumor cells, and induce endothelial remodeling.

Key words: Cancer metastasis, Extravasation, Zebrafish

Jour

nal o

f Cel

l Sci

ence

high-resolution multicolor confocal imaging of the interface betweentumor cells and the blood vessel wall (Isogai et al., 2003; Stoletovet al., 2007; Stoletov and Klemke, 2008). In addition, the zebrafishembryonic vascular system is fully functional and, unlike thevasculature of adult mammals, is precisely patterned, which allowsfor efficient detection of extravasating tumor cells and tumor-inducedchanges in the vascular system over time (Isogai et al., 2003). TheTg(fli1:egfp) embryos are also completely transparent and theimmune system is not fully developed, which allows for successfulxenotransplantation of human tumor cells for several days (Haldi etal., 2005; Lee et al., 2009; Nicoli et al., 2007; Stoletov et al., 2007).Thus, compared with traditional mouse and chick CAM models ofcancer progression, the zebrafish model system is highly amenableto direct observation of interactions between tumor cells and thevasculature at the cell level, and even at subcellular levels, usingstandard confocal microscopy. Using this model system, we foundthat extravasation of cancer cells is a dynamic process that involvesintravascular migration of tumor cells after arrest in small capillaries,endothelial cell clustering around arrested tumor cells and alterationsin endothelial cell-cell junction architecture. Furthermore, wedemonstrate that these processes are modulated by tumor cellexpression of the prometastatic genes Twist, VEGFA and ITGB1(which encodes 1 integrin).

ResultsHuman tumor cell lines have different extravasationabilitiesWe first determined whether known high (HT1080, MDA-MB-231, SW620) and low (MDA-MB-435 and SW480) metastatictumor cells showed a difference in the number of cells that can exit

2333Imaging extravasation of tumor cells

the blood stream after direct injection into the circulation (Koop etal., 1996). These cell lines display different metastatic potential inchicken, mice and zebrafish models of cancer metastasis, asdisplayed by their different abilities to form secondary metastaticcolonies (Stoletov et al., 2007; Hewitt et al., 2000; Zijlstra et al.,2002). However, their potential to extravasate has not beenpreviously investigated. After injection into the pericardium, humantumor cells or control 10-15 m beads were observed to enter theblood circulation 3-5 hours after injection, where they typicallylodged in small vessels (5-8 m) in the head and tail regions (Fig.1A). We focused our attention on cells that had arrested in the tailintersegmental vessels (ISV), because, as previously shown, thesevessels are readily amenable to confocal imaging, their cellularstructure is well characterized and they display a highly patternedmorphology (2-7 endothelial cells per vessel, ~300 m in length,5-14 m in diameter) (Fig. 1A) (Blum et al., 2008). In this model,beads were observed to lodge in the ISV after injection, but neverextravasated (0 out of >100 animals, ~500 beads observed).HT1080 cells displayed the greatest extravasation potentialcompared with the MDA-MB-231 or MDA-MB-435 cells (Fig.1B). These findings correlated with their relative metastaticpotential as measured in a chick CAM model of metastasis(HT1080>MDA-MB-231>MDA-MB-435) (Zijlstra et al., 2002).By contrast, the low metastatic human colon adenocarcinoma cellline SW480, which was derived from the primary tumor, showedsignificantly higher extravasation potential compared with the highmetastatic SW620 cell line that was derived from the lymph nodeof the same cancer patient (Hewitt et al., 2000). It is notable thatalthough SW620 cells show a significantly higher ability to formmetastatic sites when injected into mice, they are less invasive and

Fig. 1. Tumor cell extravasation correlates with metastatic potential. (A)Left panel shows whole-mount fluorescence image of a 2 d.p.f. Tg(fli1:EGFP)zebrafish embryo showing the perivascular tumor cell injection site (red arrow) and the ISV vessels in the tail region where cells typically arrest (box). Right panelis a multi-color confocal image of CFP- or RFP-expressing MDA tumor cells arrested in the ISV of Tg(fli1:EGFP) embryos and either inside or outside(extravasated) the vessel lumen. Image was taken 24 hours post injection (h.p.i.) with a 20� objective. (B)The percentage of extravasated tumor cells quantified 24h.p.i. for several human tumor cell lines: MDA-MB-435 (MDAwt) MDA-MB-231, HT1080, SW480 and SW620. (C)The percentage of extravasated tumor cellsquantified 24 h.p.i. for variants of MDA-MB-435 cell line used in the manuscript: MDAwt (wild type); MDA-MB-435 cells expressing the metastatic genesVEGFA (MDAVEGF) or Twist (MDAtwist). In addition, extravasation was measured for MDAwt cells depleted of the metastatic gene ITGB1 (MDA1KO) orthese cells reconstituted with ITGB1 (MDA1KOR). Results are means ± s.e.m. Scale bars: 200m.

Jour

nal o

f Cel

l Sci

ence

migratory in 2D and 3D in vitro culture systems, which might limittheir ability to extravasate (Hewitt et al., 2000; Kubens and Zänker,1998). The higher metastatic potential of SW620 cells is probablyattributable to their higher proliferation rate and/or resistance toapoptosis, which is independent of their invasive and extravasationpotentials (Hewitt et al., 2000; Kubens and Zänker, 1998). Theseattributes could better support SW620 survival in the circulation.Also, these cells might proliferate and form microtumors afterarrest in the vascular bed at the secondary site, without the need toextravasate into the surrounding tissue, as has been reported forother cells (Al-Mehdi et al., 2000). In any case, our findingsindicate that human tumor cells with different metastatic potentialexit the vascular system with different efficiencies and thatextravasation in this model is an active process and not a simplepassive event.

1 integrin, twist and VEGF modulate tumor cellextravasationAlthough numerous genes have been linked to the metastaticprocess, their role in extravasation is poorly understood. Therefore,we determined whether the expression of the metastatic genesTwist, ITGB1 and VEGFA could directly alter the ability of MDAcells to extravasate. Increased expression of these genes occurs invarious human cancers and has been previously associated withincreased metastasis and poor patient survival (Crawford andFerrara, 2008; Matsumoto and Claesson-Welsh, 2001; Morozevichet al., 2009; Wang et al., 2004; Weis et al., 2004; Yang et al., 2004).Additionally, the integrin 1 subunit is critically involved in tumorcell pulmonary arrest in the mouse human tumor xenograft model(Wang et al., 2004). MDA cells were engineered to overexpressTwist (MDAtwist) or the pro-angiogenic growth factor VEGFA(MDAVEGF). To examine the role of 1 integrins, we useda standard shRNA knockdown reconstitution strategy.Overexpression of Twist and VEGFA significantly increased thepercentage of extravasated tumor cells, whereas, silencing of ITGB1gene expression (MDA1KO) potently reduced this processcompared with levels in mock-transfected control cells (MDAwt,Fig. 1C). As expected, reconstitution of MDA1KO cells with 1integrin (MDA1KOR) restored their ability to extravasate (Fig.1C). Importantly, all cells displayed similar proliferation rates inzebrafish over the short 24 hour period of observation, indicatingthat the changes in extravasation were not due to changes in cellnumber (Al-Mehdi et al., 2000). These findings indicate that thereis a correlation between the ability of cells to extravasate and theexpression of specific genes (Twist, VEGFA and ITGB1) thatcontribute to metastasis of cancer cells.

Intravital imaging of tumor cell behavior after arrest andduring extravasationTo gain insight into how tumor cells interact with endothelial cellsand exit through the vascular wall, we imaged the behavior ofMDA tumor cells after arrest in the vasculature and duringextravasation through the vessel wall. We observed that circulatingbeads and tumor cells almost always lodged next to endothelialnuclei that project into the vessel lumen of the small intersegmentalvessels, which can be seen as bright areas of strong nuclear EGFPexpression (Isogai et al., 2003; Blum et al., 2008). Based on theseobservations, we conclude that the initial arrest in the ISVs is dueto size restriction and not due to the specific adhesive mechanismsbetween the tumor cell and the endothelium. Strikingly, we foundthat vessel-arrested MDA cells did not always remain passively

2334 Journal of Cell Science 123 (13)

lodged in ISVs as did Sepharose beads, but rather rapidly migratedalong the surface of the ISV lumen (24%, 16 out 65 cells weremigratory, maximum velocity 2.01 m/minute, mean migrationvelocity 1.26±0.56 m/minute) (Fig. 2A, supplementary materialMovies 1 and 2). In many cases, these migratory cells wereobserved to move against blood flow using a rounded morphology,compressing and flattening endothelial nuclei as they navigated thenarrow contours of the vessel wall (Fig. 2B, supplementary materialMovies 3 and 4). These findings demonstrate that a subset ofarrested tumor cells migrate within the vessel lumen, apparently bygenerating forces that allow movement against blood flow andthrough the narrow vessel confines.

The ability of tumor cells to undergo intravascular migration afterarrest could be an important mechanism adopted by metastatic cells

Fig. 2. Tumor cells arrest in small vessels then actively migrate along theluminal surface of the vascular endothelium. (A)MDAwt cell expressingCFP and migrating within the ISV lumen for the indicated times(supplementary material Movie 1). Right panel shows 3D isosurface renderingof the tumor cell body for each time point (supplementary material Movie 2).(B)MDAtwist cell expressing RFP and migrating in the lumen of an ISV forthe indicated times (supplementary material Movie 4). Right panel shows 3Disosurface rendering of the tumor cell body for each time point (supplementarymaterial Movie 5). (C)Multi-color confocal images of MDAwt andMDA1KO cells labeled with CFP or RFP that have arrested in the ISVlumen. Lower panel shows a control 10m fluorescent Sepharose bead(yellow) arrested in the ISV. (D)Quantification of distance from tumor cell tovessel wall for MDAwt, MDA1KO cells, and Sepharose beads as shown inrepresentative Fig. 2C above. Results are means ± s.e.m. Scale bars: 20m.

Jour

nal o

f Cel

l Sci

ence

to survey the endothelium for a suitable site of extravasation. Manymetastatic genes including ITGB1, Twist and VEGFA increase themigration of cancer cells (Matsumoto and Claesson-Welsh, 2001;Morozevich et al., 2009; Yang et al., 2004). However, although it isgenerally believed that increased migration contributes to cancer celldissemination, active intravascular migration after vessel arrest hasnot been previously investigated. Therefore, we determined whetherintravascular migration of MDA cells would be altered by metastaticgene expression. Indeed expression of Twist in MDA cells increasedboth tumor cell extravasation (Fig. 1C) and intravascular migration(47%, 26 of 57 cells; Fig. 2B, supplementary material Movies 4 and5) compared with control cells (24%). Interestingly, although controland MDAtwist cells migrated at the same speed (1.26±0.56 and1.18±0.43 m/minute, respectively), MDAtwist cells displayed moremembrane protrusions (Fig. 2B, supplementary material Movies 4and 5). This was associated with their ability to rapidly adapt theirshape to the narrow contours of the inner luminal surface and tomove through small vessel branch points (2-5 m) (Fig. 2B,supplementary material Movies 4 and 5) (Sahai, 2007). By contrast,arrested MDA1KO cells and Sepharose beads were not protrusive,remained completely immotile in the vessel lumen (0 motileMDA1KO cells out of 9 imaged; Fig. 2C, supplementary material


Movies 6 and 7) and did not extravasate efficiently. High-magnification imaging of arrested tumor cells revealed thatMDA1KO cells and Sepharose beads were not as closely associatedwith the luminal surface of the vessel wall as were MDAwt orMDA1KOR cells, suggesting that they do not readily adhere to thevessel surface in the absence of 1 integrins (Fig. 2C,D). Thesefindings demonstrate that some tumor cells actively migrate in thevessel lumen after arrest and this process can be modulated byexpression of ITGB1 and Twist. These findings also support thenotion that the ability of tumor cells to successfully extravasate isassociated with their ability to adhere to the endothelium and migratealong the vascular wall.

Twist induces a switch from an integrin-dependent to anintegrin-independent mode of tumor cell extravasationTo investigate in more detail the mechanisms of Twist-inducedtumor cell extravasation, we co-injected and simultaneously imagedthe behavior of MDAtwist (RFP, red) and MDAwt (CFP, blue)cells after their final arrest in the ISVs. MDAtwist cells wereobserved to rapidly change their shape, and produced large roundedprotrusions. By contrast, MDAwt cells remained relatively roundedand displayed less protrusive activity (Fig. 3A-C, supplementary

Fig. 3. Twist promotes tumor cell extravasation by increasing tumor cell intravascular migration and membrane-protrusion dynamics dependent onROCK kinase activity. (A)Comparison of membrane protrusion dynamics of MDAtwist and MDAwt cells. Middle panel, red and blue channels showingindividual tumor cell shapes. Right panel shows schematic outlines of the blood vessel and MDAtwist tumor cell. (B)Intravascular shape index (sphericity,round1.0) for individual MDAtwist and MDAwt cells for the indicated times. Each line in B represents relative change in sphericity over the indicated time periodfor individual MDAwt or MDAtwist tumor cells. (C)Average speed of shape index change for MDAwt and MDAtwist cells. (D)Effect of ROCK and MLCKinhibition on Twist-induced tumor cell extravasation. (E)1 integrin expression on MDAwt and MDAtwist cells (MFI, mean fluorescence intensity units) asdetermined by FACS analysis. (F)Average numbers of MDAwt and MDAtwist cells attached to various extracellular matrixes (3 hour time point) per 40� field.Results are means ± s.e.m. Scale bars, 20m.

Jour

nal o

f Cel

l Sci

ence

material Movies 8-10). Importantly, Twist-induced extravasationwas not dependent on 1 integrins because silencing of ITGB1expression in MDAtwist cells did not inhibit this process (Fig.3D). It is notable that exogenous Twist expression in MDAwt cellsdid not alter cell-surface expression of endogenous 1 integrin, nordid it inhibit their adhesion to ECM proteins indicating thatfunctional 1 integrins are still present on these cells (Fig. 3E,F).These findings suggest that the switch to 1-independentextravasation occurred downstream of the integrin receptor orthrough modulation of its ligand on the surface of the endothelium.Alternatively, these cells may use a different non-1-integrin-mediated pathway to extravasate.

We also examined the role of 1 integrins in VEGF-mediatedextravasation because VEGFR activation can modulate integrinfunctions including cell adhesion and migration (Matsumoto andClaesson-Welsh, 2001). In this case, silencing of expression ofITGB1 in VEGF-secreting MDA cells significantly reduced VEGF-induced extravasation (from 27±2.1% to 16±2.3%), indicating thatthis process is 1-integrin dependent. Thus, extravasation of tumorcells might occur in an integrin-dependent or integrin-independentmode depending on which metastatic gene is expressed in thesecells.

Protrusion of tumor cell membrane has been shown to beregulated by ROCK kinase and myosin contraction (Wyckoff etal., 2006). Recently, Twist was shown to modulate expression ofthe metastatic gene RHOC, which is an upstream regulator ofROCK activity (Ma et al., 2007; Narumiya et al., 2009).Additionally, ROCK is strongly involved in regulation ofrearrangement and migration of the endothelial cell cytoskeleton(Fischer et al., 2009). To investigate whether ROCK activity isnecessary for MDAwt and MDAtwist tumor cell extravasation, weused the well-characterized ROCK kinase inhibitor, Y27632(Wyckoff et al., 2006). Treatment of animals with Y27632dramatically decreased MDAtwist-induced extravasation, whereasinhibition of MLCK activity with M7, which also inhibits myosincontractility, independent of ROCK activation, did not have anysignificant effect (Fig. 3D). Both compounds worked efficiently inour model as demonstrated by their ability to alter the sphericityof MDAtwist tumor cells (supplementary material Fig. S1).Importantly, inhibition of ROCK or MLCK activity did not preventMDAwt cell extravasation, indicating that ROCK specificallymediates Twist-induced extravasation (Fig. 3D). Together thesefindings indicate that tumor cells can use different cytoskeletalsignaling mechanisms to regulate extravasation in vivo.

Extravasating tumor cells induce clustering of endothelialcellsWe next investigated how arrested tumor cells alter endothelial cellbehavior because this process has not been examined in vivo.Previous in vitro work using cultured endothelial cells suggeststhat the vessel endothelium presents a non-dynamic and staticbarrier to arrested tumor cells and that tumor cells induceendothelial cell death and vascular leakage during theirextravasation (Heyder et al., 2006; Weis et al., 2004). However,during the course of numerous time-analyses of arrested tumorcells, we never observed loss of endothelial cells at sites ofextravasation, nor did we detect vascular leak in animals injectedwith Dextran-Rhodamine (Fig. 4A-B). Importantly, ISVs are notuniquely resistant to vascular leak because morpholino knockdownof VE-cadherin, which is necessary for the maintenance of theendothelial cell-cell junction integrity, induced a strong vascular


leak, which corroborates previous findings (Fig. 4A) (Montero-Balaguer et al., 2009). Instead, time-lapse imaging revealed anincrease in the movement and clustering of endothelial cell nucleiaround arrested tumor cells. These vessels also showed a thickeningof the vascular wall surrounding arrested tumor cells (Fig. 4A-E,supplementary material Movie 3). By contrast, the arrest of 10-15m Sepharose beads did not induce these responses in the ISVs(Fig. 4B,C,E; supplementary material Movie 7).

We next determined whether expression of ITGB1, Twist andVEGFA altered the clustering of endothelial cells at sites of tumorcell arrest. For this purpose, we directly monitored the position ofindividual endothelial cell nuclei in the vicinity of tumor cellsusing a zebrafish transgenic line that specifically expresses GFP inthe nucleus (Siekmann and Lawson, 2007). This approach waspreviously used by other groups to track individual endothelial cellposition within the ISVs (Siekmann and Lawson, 2007). Trackingof endothelial cell nuclei revealed that MDAwt and MDAVEGFtumor cells induced rapid nuclei movement that resulted inclustering of individual endothelial cells at the tumor cell-vascularinterface (Fig. 4D-G). This did not result from an increase inendothelial cell proliferation because the total number of endothelialnuclei was the same in vessels containing control and tumor cells(4.2±1.3 and 4.0±0.9 nuclei, respectively). Importantly, the dynamicrearrangement of the endothelium was not simply due to the passivearrest of the tumor cell in the vessel, but was regulated by tumorcell adhesion to the vascular wall, because depletion of 1 integrincompletely abrogated this response (Fig. 4C,E). In support of this,MDAtwist cells, which do not use 1 integrins to extravasate, didnot significantly increase vascular wall thickness or clustering ofendothelial cell nuclei when compared with control Sepharosebeads (Fig. 4C,E,G). By contrast, vessel walls around MDAVEGFcells displayed dramatically increased thickness of the vessel wall,which was dependent on the expression of 1 integrin (Fig. 4C,G).The tumor-cell-induced alteration in the vascular wall wasassociated with an increase in the number of endothelial cell-celljunctions as revealed by ZO-1 staining (2.8±0.3 junctions/100 mof vessel length) compared with empty ISVs without tumor cells(1.3±0.13 junctions/100 m of vessel length) (Fig. 4H). Thesefindings indicate that tumor cells induce endothelial cell clusteringand remodeling of their cell junctions at sites of extravasation.

DiscussionMost of our understanding of extravasation of tumor cells has beengleaned from histological sections of secondary tumors isolatedfrom various organs of mice or chickens. This static picture isusually taken days or weeks after the injection of tumor cells intothe circulation, and therefore does not report on the ability of cellsto penetrate the vessel wall. A large drawback to the standardimaging methods is the inability to visualize extravasation of tumorcells in vivo in real time, which typically occurs in small capillariesdeep within the tissue. Consequently, this step in the metastaticcascade has been difficult to distinguish from the later metastaticevents such as transition of tumor cells from dormancy andsecondary colony formation. Our work here shows that the opticaltransparency and the highly patterned vascular system of zebrafishprovide a unique model to visualize human tumor cell extravasationin real time in a live animal. This approach revealed that theprocess is complex and involves dynamic interaction betweentumor cells and endothelial cells.

We found that expression of the pro-metastatic genes Twist,VEGFA and ITGB1 affects intravascular migration of arrested

Jour

nal o

f Cel

l Sci

ence

tumor cells, and their capability to remodel the vasculature andexit the circulation. These findings suggest that genetic orepigenetic factors that influence migration and vasculatureremodeling of tumor cells could provide a metastatic advantageby increasing the number of cells that exit the vasculature afterarrest. This could have a deleterious outcome because more tumorcells would gain access to extravascular tissues rich in ECMproteins and other survival factors, increasing their chances ofsurvival and forming secondary tumors. Indeed, these genes have


already been shown to be important metastatic signaturesassociated with poor patient outcome. Given that Twist, ITGB1and VEGFA also support survival and proliferation of tumor cells,as well as motility, these genes would arm the tumor cells for bothextravasation and secondary tumor growth (Matsumoto andClaesson-Welsh, 2001; Morozevich et al., 2009; Shibue andWeinberg, 2009; Yang et al., 2004).

The precise mechanism that drives intravascular tumor cellmigration after arrest is not yet known, but appears to involve the

Fig. 4. Tumor cells induce vessel remodeling in response to metastatic gene expression, but do not induce vascular leakage. (A)Single optical sections ofMDAwt or MDAVEGF cells expressing CFP and arrested in ISVs with or without reduced VE-cadherin expression (VE-Cad morpholino), which serve as apositive control for vascular leakage (Montero-Balaguer et al., 2009). Vessel-wall integrity and leakage around arrested tumor cells (blue) was assessed by injectionof Rhodamine-Dextran (MW2�106, red) into the circulation. (B)Representative images of vascular wall changes of ISVs with an arrested Sepharose bead (left),MDAwt cell (center) and MDAVEGF cell (right). (C)The thickness of the vessel wall was measured around arrested Sepharose beads or MDA cells expressing theindicated genes. (D)Left panel, representative image of MDAwt-RFP cell-induced movement of endothelial cell nuclei at the indicated times (supplementarymaterial Movie 3). Right panel shows movement of endothelial cell nuclei in a normal vessel without an arrested tumor cell. Colored arrows indicate individualnuclei positions at the indicated times. (E)Nuclei speed was measured in ISVs with arrested Sepharose beads or MDA cells expressing the indicated genes. Eachbar represents increase or decrease (percentage) above the average endothelial nuclei movement speed for a particular condition. (F)Representative image ofendothelial cell nuclei clustering around a MDAwt cell expressing CFP (blue) and arrested in the ISV of a Tg(fli1:nEGFP) embryo in which GFP is expressedexclusively in the nucleus. (G)Quantification of endothelial cell nuclei clustering around ISV-arrested Sepharose beads or MDA cells expressing the indictedgenes. (H)Confocal image of anti-ZO1 immunofluorescence staining (red) of cell-cell junctions (arrows) of an ISV with an arrested MDAwt cell (blue). Rightpanels show schematically EC cell-cell junctions and the tumor cell. Arrows indicate individual cell-cell junctions. Scale bars: 20m.

Jour

nal o

f Cel

l Sci

ence

actin-myosin contractile system and formation of dynamic roundedmembrane protrusions. A striking finding is that tumor cells canmigrate with or against blood flow and navigate through narrowvessel lumen openings and vessel branch points. These findingssuggest that tumor cells generate strong traction forces andmembrane protrusions that propel the cell forward while deformingand stretching the endothelium. We speculate that motile tumorcells are surveying the endothelial surface for a suitable site toextravasate and/or remodel the endothelium to create new sitessuitable for vessel penetration.

Although the mechanisms are not understood, the process oftumor cell extravasation was found to be 1-integrin dependent orindependent based on the metastatic gene being overexpressed.The integrin-dependent mode of cell movement and extravasationwas used by wild-type MDA cells and was associated with arounded morphology, decreased cell membrane protrusion,remodeling of the vascular endothelium and augmented by VEGFAexpression. In this case, the thickening of the vascular wall anddynamic clustering of endothelial cell nuclei at the site ofextravasation results in an increased number of endothelial cell-cell junctions, which would increase the number of potential sitesfor tumor cell extravasation (Engelhardt and Wolburg, 2004). Bycontrast, Twist-induced tumor cell extravasation was independentof 1 integrins. Correspondingly, in this case, tumor cellextravasation was not associated with vascular remodeling. Theintegrin-independent mode of extravasation used by MDAtwistcells might be facilitated by strong membrane-protrusive forcesthat directly penetrate the endothelium without the need forsubstrate adhesion. A highly protrusive cell phenotype similar tothat displayed by MDAtwist cells has been associated with anamoeboid-like mode of tumor cell migration, which can beindependent of integrin adhesions and ECM degradation (Friedl,2004; Pinner and Sahai, 2008; Wolf et al., 2003). Interestingly,Twist has been shown to regulate the small GTPase RhoC, whichin turn regulates ROCK, myosin contractility and formation ofrounded protrusions (Ma et al., 2007; Narumiya et al., 2009). Ourfindings that the ROCK inhibitor Y27632 inhibited Twist-inducedextravasation, support a mechanism by which a Twist-ROCK-myosin contraction mediates cell extravasation through anamoeboid-like mechanism that occurs independently of endothelialcell clustering. In MDAwt cells, 1 integrins mediate extravasationthrough an alternative mechanism, because Y27632 did not preventthis process. In this case, movement and extravasation of tumorcells might be mediated more through integrin-adhesionmechanisms that induce actin polymerization leading toinvadapodia formation and/or cell locomotion and vascular-remodeling events (Friedl, 2004; Pinner and Sahai, 2008; Wolf etal., 2003). Interestingly, VEGFA-mediated tumor cell extravasationalso relies on expression of 1 integrin and is associated withvascular remodeling. In this case, 1-integrin-mediated contactbetween tumor cells and endothelial cells might assure efficientdiffusion of VEGF from the tumor cell to the endothelium surfacewhere it activates the VEGFR and its associated downstreamsignals that facilitate vascular remodeling (Matsumoto andClaesson-Welsh, 2001). The induction of vascular-remodelingevents combined with strong integrin-mediated membrane adhesionto the endothelium surface might work cooperatively to facilitatepenetration of the vascular wall, possibly through binding toendothelial VCAM (Haddad et al., 2010). In the case where tumorcells express Twist and secrete VEGF, cell extravasation might relymore heavily on force generation, leading to membrane protrusion


and intravascular migration, and might not rely as much on directadhesion of tumors and endothelial cells or vascular remodelingevents. Confirmation of our results using mammalian models ofcancer cell metastasis would be an appropriate next step beforeapplying them to human clinical therapies.

In summary, our findings provide evidence that extravasation oftumor cells is influenced by specific metastatic gene signaturesthat alter the actin-myosin cytoskeleton and induce vasculatureremodeling. These findings challenge the widespread belief thattumor cell extravasation is a simple passive process and not acrucial determinant in the metastatic cascade. In light of thesefindings, a detailed understanding and confirmation of theregulatory mechanisms that govern tumor cell extravasation inzebrafish and mammals could provide valuable clinical markersthat predict metastatic potential and provide novel therapeutictargets designed to block the spread of cancer in patients.

Materials and MethodsCell lines and constructsStable fluorescent tumor cell line MDA-MB-435 (MDA; human breastadenocarcinoma and HT1080 human fibrosarcoma) were generated as previouslydescribed (Stoletov et al., 2007). Stable fluorescent tumor cell lines MDA-MB-231human breast adenocarcinoma, SW480 and SW620 human colon adenocarcinomacell lines were generated using pCFP-N1 or pDsRed-N1 expression vectors(Invitrogen). To generate MDAtwist cells, mouse Twist was cloned intopLentiCMVMCS. Twist-encoding viral particles were used for infection of MDA(RFP) cells, whereas MDAwt (CFP) cells were infected with empty vector virus.Twist was overexpressed 4.2-fold above the endogenous level as measured bywestern blotting (Yang et al., 2004). To generate ITGB1-knockdown MDA cells(MDA1KO), a lentiviral vector expressing ITGB1-specific shRNA was used, asdescribed previously (Watanabe et al., 2008; Qin et al., 2003). Recombinant humanVEGF adenoviral vector (Cell Biolabs) was used at multiplicity of 100 for VEGFexpression in MDA cells as described by the manufacturer. Unselected populationof virus-infected cell lines were used for all the experiments. To exclude thepossibility that increased or decreased extravasation of a particular tumor cell linewas due to its increased or decreased cell-proliferation rate, MDAwt, MDAtwist,MDA1KO, MDA1KOR, MDAVEGF and HT1080 cells were injectedintravenously into zebrafish embryos and counted at 0 and 24 h.p.i. All the cell linestested showed only a minor increase (less than 5% in 24 hours) in the total cellnumber that was independent of the cell type when injected intravenously in zebrafishembryos. Significantly, during our time-lapse analysis (>300 cells imaged) we neverdetected apoptotic tumor cell death and fragmentation within the vasculature. 10-15m fluorescent Sepharose beads were purchased from Molecular Probes. Anti VE-Cadherin morpholino was used at concentration of 0.5 ng/embryo, as previouslydescribed (Montero-Balaguer et al., 2009).

Animal preparation and injection of human tumor cellsAnimals were maintained according to the University of California San Diegoanimal welfare guidelines as described (Nusslein-Volhard and Dahm, 2002). Zebrafishembryos were obtained using standard mating conditions and staged by h.p.f. At 48h.p.f., embryos were de-chorionized if necessary, anesthetized with 0.003% tricaineand positioned on their right side on a wet agarose pad (~4 mm). Human tumor cellswere lifted from culture dishes using non-enzymatic cell-lifting solution (Gibco) andwashed twice with PBS at room temperature. Cells were resuspended in PBS at aconcentration of 106 cells per 50 l and kept on ice before injection. Thirty to 100tumor cells or 10-15 m beads (Molecular Probes) suspended in PBS were injectedinto the common cardinal vein (CCV) using an Eppendorf FemtoJet injector equippedwith a 0.75 mm borosilicate glass needle (no filament, L50 mm, diameter of theneedle opening20 m). Tumor cells were injected approximately at the site whereCCV opens into the heart (Fig. 1A). The approximate injection parameters were:injection pressure300 p.s.i., holding pressure10 p.s.i., injection time0.2 mseconds.Injected embryos were washed once with E3 embryonic medium, transferred to 10cm dishes containing 10 ml E3 and kept at 35.5°C. Injected tumor cells couldnormally be seen entering the vasculature 15-30 minutes after injection and startingto arrest in the ISVs 2-3 hours after injection. Generally, 5-30 cells per embryo werearrested in the ISVs. Embryos that contain ISV-arrested cells were selected usingLeica MZ-FLIII stereo fluorescent microscope and used for further experiments.Normally, tumor-cell-injected embryos were euthanized at the end of experiments(~3.5 d.p.f.) by tricaine overdose (Nusslein-Volhard and Dahm, 2002). For ROCKand MLCK pharmacological inhibition, Y27632 and ML7 (Calbiochem) were addeddirectly to the water starting at 3 h.p.i. for 21 hours at 30 and 40 M finalconcentrations of E3 medium, respectively. DMSO was used as a vehicle control.E3 medium plus drug was changed every 12 hours.

Jour

nal o

f Cel

l Sci

ence


Live imagingA thin layer (3-4 mm) of 1.5% agarose (Sigma) containing 0.01% tricaine, pH 7.4,was made on a 2.2 cm circular coverslip (Fisher). A round trench (0.4 mm) was cutin the middle of the agarose layer using 1 ml plastic pipette tip and filled with E3medium, 0.01% tricaine, pH 7.4. Anesthetized embryos (E3 medium, 0.01% tricaine,pH 7.4) were positioned in the middle of the trench using fine forceps. Embryoswere adjusted to lie on their side as close as possible to the coverslip. E3 mediumfrom the trench was removed and changed to 0.8% agarose containing 0.01%tricaine, pH 7.4. Agarose was allowed to solidify and coverslip was put insidehumidified o-ring imaging chamber (Molecular Probes). The agarose layer inside thechamber was then covered with a thin (<2 mm) layer of E3 embryonic mediumcontaining 0.01% tricaine, pH 7.4. The imaging chamber was wet-sealed usinganother coverslip and small drop of E3 medium. The temperature was maintained at35.5°C using a 20�20 Technologies heating unit. For static (3D) images, z-stackswere taken with a Nikon C1-si confocal microscope with a step number between 20and 50 and step size of 0.5-2.0 m. For time-lapse (4D) images, z-stacks were takenevery 5-15 minutes for a total time of up to 13 hours with a step number between10 and 40 and step size of 0.5-2.0 m. During imaging, z-stack position was adjustedevery 1-2 hours to correct for embryo movement.

Generation of ITGB1-knockdown cellsTo generate MDA1KO cells, a lentiviral vector was prepared as described previously(Qin et al., 2003). Plasmids containing shRNA encoding human integrin 1 (ITGB1)and the human U6 promoter were amplified by PCR: 5�-CACCGATTTAGGTGA-CACTATAG-3�, 5�-AAAAAGGACTGACCACAGTTATTACGACACTCCTCA -AGCTTCAAGAGTGCCGTAACAACTGTGGTCAATCCGGTGTTTCGTCCTTT -CCACAA-3�, and cloned into the lentiviral vector FG12 (Watanabe et al., 2008).Viruses were collected from culture supernatant 3 days after calcium-phosphate-dependent co-transfection of HEK293T cells with FG12, pCI-vesicular stomatitis virusG-protein, and packaging plasmid pCMV dR8.91. To achieve knockdown of ITGB1,MDA-MB-435 cells were incubated for 16 hours with 8 g/ml Polybrene (Sigma) andlentivirus-containing medium. To rescue expression of ITGB1 after knockdown(MDA1KOR), silent mutations were introduced in ITGB1 (expressed in MDA-MB-435 cells using FG12 lentiviral vector) by substituting a DNA fragment from overlapextension PCR. ITGB1 gene expression was downregulated approximately 34-fold inMDA1KO or MDAtwist1KO when compared with mock-infected cells asdetermined by FACS (Watanabe et al., 2008). Reconstitution of ITGB1 gene expressionrestored normal 1 integrin expression levels. Control cells (MDAwt) were mockinfected. Primer sequences used were: 5�-AAATCAGTGAATGGGAACAACGA-3�,5�-GTTAACGACTGTAGTGACAGCGCTTTTATAAATAGGATTTTCACCCGT-GTCCCATTT-3�, 5�-AAGCGCTGTCACTACAGTCGTTAACCCGAAGTATGA -GGGAAAATGAGTACTG-3�. The sequence 5�-TTTCTCGAGCCCTGGCATGA -ATTACAACA-3� was used as an RNAi target sequence. To test ITGB1 expressionlevels on MDAwt and MDAtwist, FACS analysis was used as previously described(Watanabe et al., 2008). Mean fluorescence intensity (MFI) units ± s.e.m. are shownin Fig. 3E. To test the adhesion of MDAwt and MDAtwist to various extracellularmatrixes MDAwt and MDAtwist cells were lifted from culture dishes using non-enzymatic cell-lifting solution and allowed to attach for 3 hours under normal cultureconditions on extracellular matrixes shown (laminin, fibronectin, collagen). Averagenumbers of cells per field (40�) ± s.e.m. are shown in Fig. 3F.

Immunofluorescence stainingEmbryos at 72 h.p.f. (24 hours after tumor cell injection) were fixed in 4%paraformaldehyde for 2 hours at room temperature. Embryos were then washed threetimes for 10 minutes in PBST (0.1% Tween20 in PBS) and once (10 minutes) inPBSTX (PBS, 0.1% Tween20, 0.1% Triton X-100). Embryos were then blocked inPBSTX, 10% BSA, 1% NGS for 24 hours. Embryos were incubated with primaryantibodies (in PBSTX, 1% BSA, 0.1% NGS) overnight at 4°C. Embryos were thenwashed five times for 30 minutes in PBSTX, 1% BSA, 0.1% NGS and then incubatedwith the secondary antibody (in PBSTX, 1% BSA, 0.1% NGS) overnight at 4°C.Embryos were finally washed several times (30 minutes to overnight) in PBST. Allsteps were performed at RT except for antibody incubations. The following antibodieswere used: mouse anti-human ZO-1, 1:200 (Zymed); Alexa Fluor 568 goat anti-mouse IgG, 1:1000; Alexa Fluor 633 goat anti-mouse IgG (Invitrogen), 1:1000. z-stacks were acquired with a Nikon C1-si confocal microscope (~50 optical sectionsper stack at a step size of 0.25 m, 60� objective).

Quantification of tumor cell extravasationFor quantification of tumor cell extravasation (Fig. 1B-C, Fig. 3D), embryos injectedwith tumor cells (or Sepharose beads) were immobilized in a small drop of E3medium containing 0.01% tricaine in a humidified o-ring imaging chamber. Onlythe embryos that contained at least 5 ISV-arrested cells were used for analysis.Immobilized embryos were imaged using a Nikon C1-si confocal microscope and20� objective. Tumor cell extravasation was scored based on analysis of single (1-2 m) optical sections. A particular cell was considered extravasated if at least 50%of its body was outside of the vessel lumen and in the surrounding tissue. Forsimplicity, only the ISV-arrested cells were included in the analysis. Data wasdisplayed as a percentage of tumor cells that are outside of the vessel to the totalnumber of cells in ISVs. For Fig. 1B, 10-16 animals were analyzed for each tumor

cell type. For Fig.1 C, numbers of animals were 56 for MDAwt, 31 for MDAVEGF,40 for MDAtwist, 23 for MDA1KO and 16 for MDA1KOR. For Fig. 3D numbersof animals were 24 for MDAwt, 18 for MDAwt/Y27632, 24 for MDAwt/ML7, 25for MDAtwist, 10 for MDAtwist/Y27632, 17 for MDAtwist/ML7, 19 forMDAtwist1KO.

Time-lapse analysis of intravascular tumor cell migrationFor time-lapse analysis of intravascular tumor cell migration (Fig. 2A,B) embryosinjected with tumor cells were anesthetized and embedded in 0.8 or 1.5% agarose asdescribed above. Imaging field (512�512, 60�) was selected to include ISV-arrestedtumor cell and most of the ISV. z-stacks (10-40 steps) were taken every 5 minutesfor a total time of up to 5 hours with a step size of 0.5-1 m. If necessary, theimaging field was adjusted manually during the imaging procedure to correct forembryo movement. Acquired 4D datasets were analyzed using Imaris Track functionto measure tumor cell track speed. Imaris Contour Surface function was used tomanually isolate migrating tumor cell body which was then 3D rendered for eachtime point using Imaris Isosurface function (Fig. 2A,B). If any signs of animaldistress were observed, time-lapse imaging was stopped.

Quantification of tumor cell intravascular attachmentFor quantification of tumor cell intravascular attachment (Fig. 2D), tumor cellinjected embryos were immobilized in small 0.8% agarose drops on the coverslipand sealed in the o-ring imaging chamber as described above. z-stacks (10-20 steps)of ISV arrested tumor cells or control beads were acquired using 60� objective witha step of 0.5 m. Measurements were done based on a single optical section thatcontains maximum tumor cell or control Sepharose bead diameter. For each tumorcell or control bead, a line passing through its center was drawn and a distancebetween tumor cell or bead surface and inner vessel wall along this line wasmeasured. At least 22 (5-10 animals) independent measurements (one per eachtumor cell or bead) were done for each MDA mutant cell or bead.

Quantification of intravascular tumor cell dynamicsFor quantification of intravascular tumor cell dynamics (Fig. 3B,C) embryos injectedwith tumor cells were anesthetized and embedded in 0.8 or 1.5% agarose as describedabove. z-stacks (10-40 steps) were taken every 5 minutes for a total time of up to 5hours with a step of 0.5-1 m. Single, immotile ISV-arrested MDAwt or MDAtwisttumor cells were digitally isolated at each time point using Imaris Contoursurfacefunction. A separate Isosurface was then built for each cell based on Contoursurface-isolated pixels and tumor cell sphericity was measured at each time point. Sevenindividual tumor cells of each type were used for analysis. Sphericity of particular3D object (such as tumor cell) ranges from 0 (line) to 1 (sphere) and shows how thisshape deviates from a sphere. For Fig. 3B, absolute cell sphericity measurements foreach cell are displayed at each time point. For Fig. 3C, average percentage of cellsphericity change for MDAwt or MDAtwist per 5 minutes is shown. To exclude thepossibility that the change in the tumor cell shape was induced by tumor cell passagetrough the narrow part of the vessel lumen, only the finally arrested immotile tumorcells were used for analysis. Seven tumor cells of each type (MDAwt and MDAtwist)from nine independent animals were analyzed.

Injection of fluorescent DextranFor intravital analysis of blood vessel wall integrity (Fig. 4A) embryos wereanesthetized with 0.001% tricaine 24 hours after injection of tumor cells. Dextran-Texas-Red (0.5 l) in PBS (5 mg/ml, molecular mass, 2´106 Da; Molecular Probes)was injected into the CCV using an Eppendorf FemtoJet injector equipped with a0.75 mm borosilicate glass needle (L50 mm, diameter of the needle opening2-5m). The approximate injection parameters were: injection pressure50 p.s.i., holdingpressure5 p.s.i., injection time0.1 mseconds. Injected embryos were washed oncewith E3 medium and transferred to a Petri dish with pre-warmed (35.5°C) E3medium for 15 minutes. Embryos were transferred to the temperature controlled o-ring imaging chamber in a small drop of E3 medium containing 0.01% tricaine. z-stacks (10-20 steps) of ISV-arrested tumor cells or control beads were acquired using60� objective with a step of 0.5 m. Red-channel-intensity measurements (561 nmlaser line, range 0-4095) were recorded along the vessel walls of tumor cells(MDAwt, MDAVEGF, MDAtwist) or control Sepharose bead (10-15 m) based onthe single optical sections that contain maximum tumor cell or Sepharose beaddiameter. Although there was some tissue autofluorescence in the fish gut, skin, eyesand sensory cells, no significant difference in red-channel intensity was detectedbetween embryos injected with tumor cells or control beads or non-injected embryos.It should be noted that approximately 30 minutes after injection of Dextran-Texas-Red, Dextran started to leak uniformly from vessels containing tumor cells orcontrols, possibly because of a non-specific transendothelial exclusion process.Uniform Dextran leakage was also detected outside lymphatic vessels 15-30 minutesafter injection. At least six animals were analyzed for each MDA cell mutant. Bycontrast, rapid Dextran leakage was detected within 3 minutes of injection in embryosinjected with VE-cadherin morpholino (Fig. 4A, right panel).

Quantification of tumor-cell-induced vessel remodelingEmbryos that contain ISV arrested tumor cells or control beads were embedded insmall 0.8% agarose drops 24 hours after injection of tumor cells or control beads, as

Jour

nal o

f Cel

l Sci

ence


described above. z-stacks (10-20 steps) of ISV-arrested tumor cells or control beadswere acquired using 60� objective with a step of 0.5 m (Fig. 4C). Vessel-wallthickness was measured based on a single optical section that contained maximumdiameter of vessel-arrested tumor cells or control beads. Measurements were donerandomly in the vessel-wall areas that directly contacted tumor cells or controlSepharose beads. Twenty-five random vessel wall measurements were done for eachMDA tumor cell mutant, 12 animals were used for each condition.

Quantification of tumor-cell-induced endothelial cell nuclei movementFor time-lapse analysis and quantification of tumor-cell-induced endothelial cellnuclei movement (Fig. 4D,E) tumor-cell-injected embryos were anesthetized andembedded in 0.8 or 1.5% agarose, as described above. Imaging field (512�512,60�) was selected to include ISV-arrested tumor cell and entire (or most of) ISV. z-stacks (10-40 steps) were taken every 5 minutes for a total time of up to 5 hours witha step of 0.5-1 m. If necessary, the imaging field was adjusted manually during theimaging procedure to correct for embryo movement. Acquired 4D datasets wereanalyzed using Imaris Track function to measure track speed and duration.Specifically, endothelial cell nuclei positions were first assigned automatically usingImaris spot detection function and if necessary, nuclei positions were adjustedmanually for each time point. Based on the nuclei positions individual nuclei trackswere created and track speed was measured using the Imaris built-in trackingfunction. Track speeds of control (empty), bead or tumor cell containing ISVendothelial cell nuclei were measured and used for analysis. Individual endothelialcell nuclei were included in analysis if they were within 30 m of ISV-arrestedtumor cell surface. Since significant variability between average backgroundendothelial nuclei movement speeds in individual embryos was detected (up to fivetimes) data was displayed as increase or decrease (percentage) above the averageendothelial nuclei movement speed for a particular embryo. Ten endothelial cellnuclei from at least five independent animals were tracked for each MDA cellmutant or controls.

Quantification of tumor-cell-induced nuclei clusteringFor quantification of tumor-cell-induced nuclei clustering (Fig. 4G), fluorescentlylabeled (CFP or DsRed) MDAwt cells or control 10-15 fluorescent Sepharose beadswere injected into Tg(fli1:nEGFP) embryos (www.zebrafish.org). This transgeniczebrafish line specifically expresses EGFP in the endothelial cell nuclei. 24 hoursafter injection, embryos were fixed using 4% paraformaldehyde. z-stacks (20-30steps) of ISV-arrested tumor cells or control beads were acquired using 20� objectivewith a step of 1 m. The number of ISV nuclei within 20 m of tumor cells orcontrol beads was counted. ‘Empty vessel’ shows average number of endothelial cellnuclei per 20 m of ISV length. A total of 26 (6-10 animals) measurements for eachMDA cell mutant or bead were made.

Statistical analysisAll data were analyzed using unpaired Student’s t-test built into the GraphPad Prizmsoftware (www.graphpad.com) for statistical significance. Data plots show meanvalues ± s.e.m., except Fig. 3B and Fig. 4C, which depict distributions of singlemeasurements (Fig. 4C shows single measurements and mean values).

We are grateful to Yinchun Wang, Sharif Rumjahn and TheresaReno for critical reading of the manuscript and to Emerald Butko forhelp with image analysis. This work was supported by CaliforniaBreast Cancer Research Program Postdoctoral Fellowship 11FB-0088(to K.S.) and National Institutes of Health Grants CA129231 andCA097022 (to R.K.). Deposited in PMC for release after 12 months.

Supplementary material available online athttp://jcs.biologists.org/cgi/content/full/123/13/2332/DC1

ReferencesAl-Mehdi, A. B., Tozawa, K., Fisher, A. B., Shientag, L., Lee, A. and Muschel, R. J.

(2000). Intravascular origin of metastasis from the proliferation of endothelium-attachedtumor cells: a new model for metastasis. Nat. Med. 6, 100-102.

Blum, Y., Belting, H. G., Ellertsdottir, E., Herwig, L., Lüders, F. and Affolter, M.(2008). Complex cell rearrangements during intersegmental vessel sprouting and vesselfusion in the zebrafish embryo. Dev. Biol. 316, 312-322.

Bos, P. D., Zhang, X. H., Nadal, C., Shu, W., Gomis, R. R., Nguyen, D. X., Minn, A.J., van de Vijver, M. J., Gerald, W. L., Foeken, J. A. et al. (2009). Genes that mediatebreast cancer metastasis to the brain. Nature 459, 1005-1012.

Colmone, A., Amorim, M., Andrea, L., Pontier, A. L., Wang, S., Jablonski, E. andSipkins, D. A. (2008). Leukemic cells create bone marrow niches that disrupt thebehavior of normal hematopoietic progenitor cells. Science 322, 1861-1865.

Crawford, Y. and Ferrara, N. (2008). VEGF inhibition: insights from preclinical andclinical studies. Cell Tissue Res. 335, 261-269.

Engelhardt, B. and Wolburg, H. (2004). Transendothelial migration of leukocytes:through the front door or around the side of the house? Eur. J. Immunol. 34, 2955-2963.

Fischer, R. S., Gardel, M., Ma, X., Adelstein, R. S. and Waterman, C. M. (2009). Localcortical tension by myosin II guides 3D endothelial cell branching. Curr. Biol. 19, 260-265.

Friedl, P. (2004). Prespecification and plasticity: shifting mechanisms of cell migration.Curr. Opin. Cell Biol. 16, 14-23.

Gupta, G. P., Nguyen, D. X., Chiang, A. C., Bos, P. D., Kim, J. Y., Nadal, C., Gomis,R. R., Manova-Todorova, K. and Massagué, J. (2007). Mediators of vascularremodelling co-opted for sequential steps in lung metastasis. Nature 446, 765-771.

Haddad, O., Chotard-Ghodsnia, R., Verdier, C. and Duperray, A. (2010). Tumorcell/endothelial cell tight contact upregulates endothelial adhesion molecule expressionmediated by NFkappaB: differential role of the shear stress. Exp. Cell. Res. 316, 615-626.

Haldi, M., Ton, C., Seng, W. L. and McGrath, P. (2005). Human melanoma cellstransplanted into zebrafish proliferate, migrate, produce melanin, form masses andstimulate angiogenesis in zebrafish. Angiogenesis 9, 139-151.

Hewitt, R. E., McMarlin, A., Kleiner, D., Wersto, R., Martin, P., Tsokos, M., Stamp,G. W. and Stetler-Stevenson, W. G. (2000). Validation of a model of colon cancerprogression. J. Pathol. 192, 446-454.

Heyder, C., Gloria-Maercker, E., Hatzmann, W., Zaenker, K. S. and Dittmar, T.(2006). Visualization of tumor cell extravasation. Contrib. Microbiol. 13, 200-208.

Isogai, S., Lawson, N. D., Torrealday, S., Horiguchi, M. and Weinstein, B. M. (2003).Angiogenic network formation in the developing vertebrate trunk. Development 130,5281-5290.

Kienast, Y., von Baumgarten, L., Fuhrmann, M., Klinkert, W. E., Goldbrunner, R.,Herms, J. and Winkler, F. (2010). Real-time imaging reveals the single steps of brainmetastasis formation. Nat. Med. 16, 116-122.

Koop, S., Schmidt, E. E., MacDonald, I. C., Morris, V. L., Khokha, R., Grattan, M.,Leone, J., Chambers, A. F. and Groom, A. C. (1996). Independence of metastaticability and extravasation: metastatic ras-transformed and control fibroblasts extravasateequally well. Proc. Natl. Acad. Sci. USA 93, 11080-11084.

Kubens, B. S. and Zänker, K. S. (1998). Differences in the migration capacity of primaryhuman colon carcinoma cells (SW480) and their lymph node metastatic derivatives(SW620). Cancer Lett. 131, 55-64.

Lee, S. L., Rouhi, P., Dahl Jensen, L., Zhang, D., Ji, H., Hauptmann, G., Ingham, P.and Cao, Y. (2009). Hypoxia-induced pathological angiogenesis mediates tumor celldissemination, invasion, and metastasis in a zebrafish tumor model. Proc. Natl. Acad.Sci. USA 106, 19485-19490.

Luzzi, K. J., MacDonald, I. C., Schmidt, E. E., Kerkvliet, N., Morris, V. L., Chambers,A. F. and Groom, A. C. (1998). Multistep nature of metastatic inefficiency. Am. J.Pathol. 153, 865-873.

Ma, L., Teruya-Feldstein, J. and Weinberg, R. A. (2007). Tumour invasion and metastasisinitiated by microRNA-10b in breast cancer. Nature 449, 682-688.

Matsumoto, T. and Claesson-Welsh, L. (2001). VEGF receptor signal transduction. Sci.STKE 112, 1-17.

Montero-Balaguer, M., Swirsding, K., Orsenigo, F., Cotelli, F., Mione, M. and Dejana,E. (2009). Stable vascular connections and remodeling require full expression of VE-cadherin in zebrafish embryos. PLoS ONE 4, 1-14.

Morozevich, G., Kozlova, N., Cheglakov, I., Ushakova, N. and Berman, A. (2009).Integrin alpha5beta1 controls invasion of human breast carcinoma cells by direct andindirect modulation of MMP-2 collagenase activity. Cell Cycle 8, 2219-2225.

Narumiya, S., Tanji, M. and Ishizaki, T. (2009). Rho signaling, ROCK and mDia1, intransformation, metastasis and invasion. Cancer Metastasis Rev. 28, 65-76.

Nguyen, D. X., Bos, P. D. and Massague, J. (2009). Metastasis: from dissemination toorgan-specific colonization. Nat. Rev. Cancer 9, 274-284.

Nicoli, S., Ribatti, D., Cotelli, F. and Presta, M. (2007). Mammalian tumor xenograftsinduce neovascularization in zebrafish embryos. Cancer Res. 67, 2927-2931.

Nusslein-Volhard, C. and Dahm, R. (2002). Zebrafish: A Practical Approach, 1st edn.Oxford: Oxford University Press.

Pinner, S. and Sahai, E. (2008). Imaging amoeboid cancer cell motility in vivo. J.Microsc. 231, 441-445.

Podsypanina, K., Du, Y. C., Jechlinger, M., Beverly, L. J., Hambardzumyan, D. andVarmus, H. (2008). Seeding and propagation of untransformed mouse mammary cellsin the lung. Science 321, 1841-1844.

Qin, X. F., An, D. S., Chen, I. S. and Baltimore, D. (2003). Inhibiting HIV-1 infectionin human T cells by lentiviral-mediated delivery of small interfering RNA againstCCR5. Proc. Natl. Acad. Sci. USA 100, 183-188.

Sahai, E. (2007). Illuminating the metastatic process. Nat. Rev. Cancer 7, 737-749.Schluter, K., Gassmann, P., Enns, A., Korb, T., Hemping-Bovenkerk, A., Holzen, J.

and Haier, J. (2006). Organ-specific metastatic tumor cell adhesion and extravasationof colon carcinoma cells with different metastatic potential. Am. J. Pathol. 169, 1064-1073.

Shibue, T. and Weinberg, R. A. (2009). Integrin beta1-focal adhesion kinase signalingdirects the proliferation of metastatic cancer cells disseminated in the lungs. Proc. Natl.Acad. Sci. USA 106, 10290-10295.

Siekmann, A. F. and Lawson, N. D. (2007). Notch signalling limits angiogenic cellbehaviour in developing zebrafish arteries. Nature 445, 781-784.

Sipkins, D. A., Wei, X., Wu, J. W., Runnels, J. M., Côté, D., Means, T. K., Luster, A.D., Scadden, D. T. and Lin, C. P. (2005). In vivo imaging of specialized bone marrowendothelial microdomains for tumour engraftment. Nature 435, 969-973.

Stoletov, K. and Klemke, R. (2008). Catch of the day: zebrafish as a human cancermodel. Oncogene 27, 4509-4520.

Stoletov, K., Montel, V., Lester, R. D., Gonias, S. L. and Klemke. R. (2007). High-resolution imaging of the dynamic tumor cell-vascular interface in transparent zebrafish.Proc. Natl. Acad. Sci. USA 104, 17406-17411.

Townson, J. L. and Chambers, A. F. (2006). Dormancy of solitary metastatic cells. CellCycle 5, 1744-1750.

Jour

nal o

f Cel

l Sci

ence


Voura, E. B., Jaiswal, J. K., Mattoussi, H. and Simon, S. M. (2004). Tracking metastatictumor cell extravasation with quantum dot nanocrystals and fluorescence emission-scanning microscopy. Nat. Med. 10, 993-998.

Wang, H., Fu, W., Im, J. H., Zhou, Z., Santoro, S. A., Iyer, V., DiPersio, C. M., Yu, Q.C., Quaranta, V., Al-Mehdi, A. et al. (2004). Tumor cell 31 integrin and vascularlaminin-5 mediate pulmonary arrest and metastasis. J. Cell Biol. 164, 935-941.

Watanabe, N., Bodin, L., Pandey, M., Krause, M., Coughlin, S., Boussiotis, V. A.,Ginsberg, M. H. and Shattil, S. J. (2008). Mechanisms and consequences of agonist-induced talin recruitment to platelet integrin IIb3. J. Cell Biol. 30, 1211-1222.

Weis, S., Cui, J., Barnes, L. and Cheresh, D. (2004). Endothelial barrier disruption byVEGF-mediated Src activity potentiates tumor cell extravasation and metastasis. J. CellBiol. 167, 223-229.

Wolf, K., Mazo, I., Leung, H., Engelke, K., von Andrian, U. H., Deryugina, E. I.,Strongin, A. Y., Bröcker, E. B. and Friedl, P. (2003). Compensation mechanism intumor cell migration: mesenchymal-amoeboid transition after blocking of pericellularproteolysis. J. Cell Biol. 160, 267-277.

Wyckoff, J. B., Pinner, S. E., Gschmeissner, S., Condeelis, J. S. and Sahai, E. (2006).ROCK-and myosin-dependent matrix deformation enables protease-independent tumorcell invasion in vivo. Curr. Biol. 16, 1515-1523.

Yamauchi, K., Yang, M., Jiang, P., Xu, M., Yamamoto, N., Tsuchiya, H., Tomita,K, Moossa, A. R., Bouvet, M. and Hoffman, R. M. (2006). Development of real-time subcellular dynamic multicolor imaging of cancer-cell trafficking in live micewith a variable-magnification whole-mouse imaging system. Cancer Res. 66, 4208-4214.

Yang, J., Mani, S. A., Donaher, J. L., Ramaswamy, S., Itzykson, R. A., Come, C.,Savagner, P., Gitelman, I., Richardson, A. and Weinberg, R. A. (2004). Twist, amaster regulator of morphogenesis, plays an essential role in tumor metastasis. Cell 117,927-939.

Zijlstra, A., Mellor, R., Panzarella, G., Aimes, R. T., Hooper, J. D., Marchenko, N. D.and Quigley, J. P. (2002). A quantitative analysis of rate-limiting steps in the metastaticcascade using human-specific real-time polymerase chain reaction. Cancer Res. 62,7083-7092.

Jour

nal o

f Cel

l Sci

ence

visualizing extravasation dynamics of metastatic tumor cells · extravasate into the surrounding...

Documents