vijaya college research bulletin ug and pg …

STRUCTURAL & MORPHOLOGICAL PROPERTIES OF ZnS:Mn

DOPED POLYANILINE NANOCOMPOSITES Dr. Jayasudha Sriram

1, Dr. K.T Vasudevan

2,

1PG Department of Physics, Vijaya College, RV Road, Bangalore-560 004 2PG Department of Physics, Vijaya College, RV Road, Bangalore-560 004

Corresponding e -mail: [email protected]

Abstract

In the present work Nanocomposites of conducting polyaniline with ZnS:Mn nanoparticle

(PAni/ZnS:Mn) have been synthesised by chemical co-precipitation method. The weight percentage of

ZnS:Mn varied from 1 to 28%. PAni/ZnS:Mnnanocomposites has been synthesised by adding the

ZnS:Mn precipitate in to the prepared Polyaniline solution. The Structural and morphological properties

have been studied by X-ray diffraction and Field Emission scanning electron microscopy. Optical

characterization has been done by UV-Vis and Photoluminescence. From XRD pattern prominent peak of

PAni as well as ZnS:Mn are observed. Using Schrrer formula the particle size of composites also

calculated. FESEM image shows uniform distribution of ZnS:Mn on PAni matrix. UV-Vis graph of

PAni/ZnS:Mnnanocomposites shows three peaks in common at ~250 nm, and broad peaks at ~300 – 350

nm and ~400–450 nm. From UV-Vis graph it is observed that the composites peak got blue shifted

compared to ZnS:Mn. Photoluminescence emission of PAni/ZnS:Mn shows 5 peaks at ~273 nm, ~308

nm, ~400 nm, ~464 nm and ~484 nm.From the PL spectra it is also observed that as the

ZnS:Mn concentration increases in the composites there is a shift of peak position compared to ZnS:Mn.

Introduction

Conducting polymers and composites are

one of the major areas of experimental

research ever due to the possibility to control

electrical conductivity of these films from

insulating to metallic by doping. A number

of metal and metal oxide particleshave been

encapsulated into the conductive polymer to

form nanocomposites. The incorporation of

metal nanoparticles acts as a conductive

junction between PAni resulting in an

increase electrical properties of the

polyaniline composites.

These properties are extremely sensitive to

small changes in content, size and shape of

the metal nanoparticles incorporated.

ZnS nanoparticles added with transition

metal ions and rare earth ions have distinct

optical properties related to traditional bulk

materials. These nanocomposites widely

used as photoluminescence and

electroluminescence devices. Luminescence

of rare-earth doped systems mainly indicates

the features of the dopant.

Doped ZnS semiconductor materials have

extensive range of application in phosphors,

light emitting displays, and optical sensors

(WQ Peng et al., 2005). Mn2+

ions occupy

cation position in ZnS lattice. The impurities

of manganese isomorphically replace zinc in

the lattice. The degree of homogeneity of

Mn2+

ions is essential for high efficient

luminescence (G. Murugadoss et al., 2009).

ZnS doped with Mn2+

nanomaterials are

having high quantum efficiency and

luminous intensity. Among the synthesis

techniques chemical co-precipitation is most

popular due to its advantages like it is simple

to synthesise.

In this work, PAni/ZnS:Mn were preparedby

a chemical co-precipitation method.

1

Structural and morphological properties have

been studied by X-ray diffraction and Field

Emission scanning electron microscopy.

Optical characterization has been done by

UV-Vis and Photoluminescence.

Experimental Technique

Aniline and Ammonium persulphate are

prepared in 1:1.2 molar ratios in 3M HCl.

Ammonium persulphate solution was added

drop by drop to the prepared aniline solution

over a period of 30 min with continuous

stirring. A dark green colour was seen

indicating the formation of polyaniline.

Polymerized sample was purified by

dialyzing against distilled water and is dried

to form films at room temperature.

For the preparation of PAni/

ZnS:Mnnanocomposite, first ZnS:Mn

nanoparticles were prepared. The precipitate

was washed and dried. Then PAni was

prepared and after 2 hours of stirring,

ZnS:Mn precipitate was mixed in the PAni

solution. It was stirred continuously for 24

hrs. Dialysis was carried out for 48 hours

against double distilled water and the

dialyzed solution was kept for drying.

Results and Discussion

XRD

0 10 20 30 40 50 60 70 80

0

200

400

600

800

1000

1200

1400

inte

nsity (

CP

S)

2θ (deg)

ZnS:Mn

PAni

PAni/ 1% ZnS:Mn PAni/ 3% ZnS:Mn

PAni/ 5% ZnS:Mn

PAni/10% ZnS:Mn PAni/28% ZnS:Mn

Fig: 1 XRD of PAni, ZnS:Mn, and its

nanocomposites

Figure 1 illustrate the XRD pattern of PAni,

ZnS:Mn and PAni/ZnS:Mn of various

concentrations. XRD pattern of ZnS:Mn

shows 4 peaks at 28.51°, 47.6°, 56.3°,

76.76°.

Intense broad peak at 28.51° corresponding

to (110) plane of ZnS:Mn indicates the

formation of nanosturcture (Jyothi P. Borah

et al., 2008). XRD pattern also shows three

prominent peaks at 47.8° and 56.3° and

76.76° correspond to (220), (311) and (331)

plane of zinc blend structure. There is an

obvious broadening of the XRD pattern.

which indicates the formation of nano sized

ZnS:Mn.

The XRD pattern of nanocomposites shows

prominent peak at 25.42° for all the

concentrations and also both prominent peak

of PAni and ZnS:Mn are seen. The peak at

28.51° is shifted to lower 2θ value at 25.42°

in nanocomposites. The shift of peak to the

lower 2 theta may be due to the variation of

ionic radius of Zn and Mn and Mn2+

ions

occupying ZnS sites.

As the concentration of ZnS:Mn increased in

the nanocomposites, the peak intensity is

found to increase till 10%. When

theconcentration of ZnS:Mn is further

increased the peak intensity got decreased

indicating disorganization in the structure.

The decrease in peak intensity can also be

XRD peaks by using the Scherrer formula,

taking the average of the results from the

most prominent peaks. The particle size of

ZnS:Mn is found to be ~ 6 nm.

attributed to increased impregnation of new

nucleating centres. Broadening of the peak

confirms the reduction of particle size.The

average particle size of the crystallites of

each sample were determined from the full-

width at half maxima (FWHM) of the

2

FESEM Analysis

(a) PAni

(b) ZnS:Mn

(c) PAni/ZnS:Mn 28%

Fig 2: FESEM analysis of (A) PAni (B)

ZnS:Mn and (C) PAni/ZnS: Mn 28%

FESEM micrograph of PAni, ZnS:Mn and its

composites are presented in fig: 2.It is

observed that ZnS:Mn particles are

homogenously dispersed in PAni matrix

within nano range and it is almost spherical

shaped. Spherical morphology indicates that

all ZnS:Mn nanoparticles are within PAni

matrices. Compared to 5% of ZnS:Mn, 28%

has good uniform distribution, and it is

evenly distributed in the matrix. As it evenly

distributed, ZnS:Mn are well interconnected

which assist in the transportation of ionic

conduction.The FESEM images help us draw

a conclusion that the doping of ZnS:Mn has

a strong effect on the morphology of PAni,

as there is a participation of PAni in the

composites, it was observed that

PAniprevented the agglomeration of ZnS:Mn

to a certain level, this helps in easy transfer

of electron transfer from PAni to ZnS:Mn.

Some small particles are also found which

play an important role in the “size

quantization effect”.

References

1. Peng WQ et al. (2005) “Concentration

effect of Mn2+

on the photoluminescence

of ZnS:Mnnanocrystals” Journal of

Crystal Growth, 279:3-4: 454 – 460.

2. Murugadoss G. et al. (2009) “Synthesis

and Characterization of Water-soluble

ZnS: Mn2+

Nanocrystals”, Chalcogenide

Letters, 6:5: 197- 201.

3. Jyothi P. Borah et al., 2008 Borah J P. et

al. (2008) “Structural and optical

properties of ZnS nanoparticles”,

Chalcogenide letters, 5:9: 201 – 208.

3

Presented at 11th

KSTA Conference held on 1st

-2nd

February, 2019 at NMKRV College, Bangalore.

INVESTIGATION ON TIME VARYING POTENTIALS TO ACCOUNT FOR THE

VARYING FINE STRUCTURE

Darshan K V and Sovan Ghosh, PG Physics Department, Vijaya College, R. V. Road– 560004

Abstract

Following Large Number Hypothesis of Dirac the variation of fundamental constants emerged long

back. Variation of fine structure constant was assumed by Teller and others. The red shift data from

Quasar spectra confirmed the temporal variation of the fine structure constant. In 1982 Bekenstein

proposed a varying charge electrodynamics that can be a probable cause for the variation of the fine

structure. The current article deals with the investigation for a suitable potential to cause a varying

electrical charge using several different potentials.

Time-Varying function

Here in this work the current authors are in

search of the possible functions suitable for the

calculation of the variation of the fine structure

constant. The chosen functions for this work are

tCosω , tSinω , tCos ω2 , tSin ω

2 and tie

ω .

Conclusion

Four possible real functions and one complex

function are used to calculate the corresponding

charge and hence the time-varying scalar and

vector potentials. These potentials in turn

provide us the corresponding electric and

magnetic fields. The notable variation is

observed in case of sine function only. The

higher orders are found with delayed time. This

work is in good agreement with present research

in the field [7-8].

References:

1. Dirac P. A. M., Nat. Lett. (1937)139, 323

2. Milne E. A.,Proc. R. Soc. A (1937)158, 324

3. Teller. E., Phys. Rev. (1948)73, 801

4. Gamow G., Phys. Rev. Lett. (1967)19, 759

5. Dyson F. J., Phys. Rev. Lett. (1967)19, 1291

6. Bekenstein J. D., Phys. Rev. D (1982)1527,

25

7. Barrow J. D., Ann. Phys. (Berlin) (2010)19,

202

8. Ghosh S., Springer Proceedings in Physics

Introduction

Large Number Hypothesis by Dirac hinted

about the variation of the so called

physical constants [1]. Independently

similar proposals were there by Milne in

the same time [2]. Subsequent works of

Teller, Gamow and Dyson also prompted

regarding the signature of the variation of

the fundamental constants [3-5].

Resurrection of the research in this branch

of course owe to quasar spectra of medium

red shift and proposal of Bekenstein

advocating a time-varying fine structure

[6].

Bekenstein-prescription

The mathematical expression of the fine

structure constant contains the charge of

electron, reduced Planck’s constant and

the speed of light. So variation of fine

structure demands a variation in any or all

of these three well-known constants.

Bekenstein prescribed there the condition

with a time varying electrical charge,

which consists of two factors:i) a constant

and ii) a function of space-time. To be

précised this second factor is considered to

play the role in variation and the time

refers here only cosmic time.

4

Presented at 11th

KSTA Conference held on 1st

-2nd

February, 2019 at NMKRV College, Bangalore.

VARYING FINE STRUCTURE USING ELECTRIC POTENTIAL

Sreenath R and Sovan Ghosh, PG Physics Department, Vijaya College, R. V. Road– 560004

Fine structure constant and particle

properties

Properties of elementary particles can be related

by the fine structure constant [9-10]. So

variation of fine structure may lead us to a better

understanding of the properties of the

elementary particles [11]. So using different

relations provided by Macgregor [10] we can

understand relations of masses and life times.

Conclusion

Electric and magnetic field for different order is

found by using Legendre polynomials.

Prominent change is noticed from static to

dynamic case that predicts the behaviour of )(tq

expected by Bekenstein prescription.

References:

1. Milne E. A., Proc. R. Soc. A (1937) 158, 324

2. Dirac P. A. M., Nat. Lett. (1937) 139, 323

3. Teller. E., Phys. Rev. (1948) 73, 801

4. Gamow G., Phys. Rev. Lett. (1967) 19, 759

5. Dyson F. J., Phys. Rev. Lett. (1967) 19, 1291

6. Bekenstein J. D., Phys. Rev. D (1982)25, 1527

7. Barrow J. D., Ann. Phys. (Berlin) (2010) 19, 202

8. Griffiths D. J., Introduction to electrodynamics,

4th ed. (2013), PHI LPL

9. Ghosh S., Choudhury A. and SarmaJ K Indian J.

Phys. (2012)86481

10. MacGregor M H, The Power of α , World

Scientific (2007)

11.Ghosh S., Springer Proceedings in Physics 203,

Chapter 107 (2018)

Introduction

Variation of fundamental constants were

hinted independently by Milne and Dirac

at 1937 [1-2]. That concept was

investigated by Teller, Gamow, Dyson and

others [3-5]. In a comparatively recent

past Bekenstein proposed a time-varying

electric charge to resolve the problem

variation of the fine structure constant [6].

Red shift data of quasar spectra are the

experimental verification of the variation

of fine structure [6-7].

Time dependent electric potential

Fine structure constant consists of

electron’s charge, Planck’s constant and

speed of light. Hence variation of fine

structure opens up the option of

probability of variation of any of them or

all of them. There Bekenstein introduced

the condition of splitting electric charge

into two different parts, out of which one

is function of space-time.

In electrostatics the electric or scalar

potential is considered as a function of r ,

θ andφ [8]. Here t , time is also considered.

Then the solution of the Laplace’s

equation is expressed using Legendre

polynomials )(cosθlP .

In the present work, 0=l is used and the

corresponding electric and magnetic fields

Abstract

Varying constants were hinted long back by Milne and Dirac independently. Later, variation of fine

structure constant was assumed by Teller. From the red shift of recent quasar spectra the variation of

fine structure constant is confirmed. Theoretically Bekenstein proposed a varying electric charge that

contributes to understand the variation of the fine structure constant. Here in this article, Bekenstein’s

proposal is treated using electrical potential in terms of dipole, quadrupole etc. Following recent work

of one of the authors of the present article, the particle properties are incorporated in the relations with

fine structure constant.

5

High Selectivity Poly Silicon Etching

Dr. C. Ramachandra, Dept. Of Physics, PG Centre, Vijaya College

Abstract: High selectivity poly silicon etching process has been developed in a Reactive Ion

Etching system. High selectivity etching of poly silicon with respect to silicon dioxide and silicon

nitride is very much needed in failure analysis of sub micron scale semiconductor devices.

Effectiveness of high selectivity poly silicon etching in capturing IBC (Insufficient Buried Contact)

defects has been demonstrated.

Introduction: Semiconductor devices have multi layers. Typically there are more than ten

layers embedded in top few microns. These layers include polyimide, poly silicon, silicon

nitride, silicon oxide, titanium nitride, tungsten silicide etc. Poly plugs are one of the common

interfaces which provide structural support and electrical contact with the silicon substrate.

Electrical contact between silicon substrate and poly plug is of fundamental importance in

performance of the device.

Problem description:

In order to establish good electrical contact, silicon substrate is slightly over etched (typically

about 10 nm ) before poly deposition.

Figure 1 : Good contact between silicon substrate and poly plug.

Fig.2 : Marginal electrical contact

6

The electrical contact becomes poor / broken when there are no contact between

poly plug and the substrate.

Figure 3 : Poor / bad electrical contact

Detection of these insufficient buried contacts (IBC) is quite challenging as they

lie deep inside of the device structure.

There is a need to etch poly silicon layers in a controlled manner having very

high selectivity with respect to silicon oxide, silicon nitride, etc.

Methodology

Memory cell structure in the DRAM is shown in the figure below.

Figure 4 : Memory cell in a DRAM

A : Poly silicon plate, B : Memory cell ( Poly silicon ), C : Poly plug,

D : Silicon substrate, E : BPSG ( Silicon oxide )

7

We need to remove different types of poly silicon layers in a controlled manner without

damaging the substrate which is also silicon.

The high selectivity poly silicon etching has been achieved using RIE (Reactive Ion Etching

system. High selectivity poly silicon etching has been developed using CF4, CHF3 and O2

chemicals. Process parameters are shown in the table below:

STEP 1

RF Power Pressure CF4(SCCM0 CHF3(SCCM) O2(SCCM) Etch time

500 W 500 m

Torr

40 0 10 20 seconds

STEP 2

60 W 180 mT 50 5 4 12 minutes

Table 1 : Process parameters

Result and conclusion:

Devices which are suspected to have insufficient buried contacts have been used for

confirmation of the result. Samples are analysed using Scanning Electron Microscope.

Figure 5 : SEM image having good imprint of poly plug

8

Fig 6 : SEM image showing insufficient buried contact.

The chemicals used in the system are not so hazardous. The process parameters used are

portable with little modifications.

References:

1. D. Dane, et all, “ Etching of poly silicon in a high density electron cyclotron

resonance plasma with collimated magnetic field”

Journal of Vacuum Science and Technology, B : 10 : Issue 4, pp: 1312 – 1319, 1992

2. K.M. Chang, et all, “ High selectivity etching of poly silicon and etch induced damage

to gate oxide with halogen bearing electron cyclotron plasma resonance”. Journal of

Applied Physics, Vol : 80, No: 5, 1998

3. K.M. Chang, et all, “ Dry etching of poly silicon with high selectivity using a chlorine

plasma in an ECR reactor” Materials: Chemistry and Physics, Vol : 45, Issue : 1, pp:

22 – 26, 1996

4. Kihaamak.J. et all, “Deceleration of silicon etch rate at high aspect ratios”

Journal of Vacuum Science and Technology :A, Vol : 18, No : 4, pp: 1385 – 1389

5. G.S. Oehrlein, et all, “ Study of plasma – surface interactions: Chemical dry etching

and high density plasma etching” Plasma Sources Science and Technology : Vol : 5 ,

1996, pp: 193 - 199

9

ABSTRACT

On the light of literature findings and in continuation of our research work on heterocycles

having various biological activities, it was planned to utilize isoniazide (1) and substituted isatins (2a-c)

to synthesize some N'-[(3Z)-2-oxo-1,2-dihydro-3H-indol-3-ylidene]pyridine-4-carbohydrazides (3 a-c).

Compounds (3 a-c) were subjected to cyclisation with acetic anhydride to yield the respective 3'-acetyl-5'-

(pyridin-4-yl)-3'H-spiro[indole-3,2'-[1,3,4]oxadiazol]-2-yl acetate (4 a-c). Compounds (3 a-c) were

converted into N-(2,4'-dioxo-1,2-dihydro-3'H-spiro[indole-3,2'-[1,3]thiazolidin]-3'-yl)pyridine-4-

carboxamide 5 (a-c) by their reaction with thioglycollic acid in presence of zinc chloride in dry benzene

under reflux conditions. Compounds 3 (a-c) when allowed to react with sulphuricacid yielded

corresponding 3-(pyridin-4-yl)[1,3,4]oxadiazino[6,5-b]indole 6 (a-c). All these compounds have been

screened for their antibacterial activity against Staphylococcus aureus, Escherichia coli, Bacillus

substilus, antifungal activity against Aspergillus niger & Candida albicans and antituberculosis activity

against Mycobacterium tuberculosis (H37Rv).

DESIGN, SYNTHESIS AND EVALUATION OF ANTIMICROBIAL ACTIVITY OF

SOME NOVEL N'-[(3Z)-2-OXO-1, 2-DIHYDRO-3H-INDOL-3-YLIDENE]PYRIDINE-

4-CARBOHYDRAZIDES

1S. M. Basavarajaiah and

2Shashikumar G R

1Assistant Professor,

2Student

P. G. Department of Chemistry, Vijaya College, R.V. Road, Basavanagudi, Bengaluru-

560004, INDIA

N

H

N

O

NH

O

N

R

N

O

N

NN

R

N

NH

S

N

H

O

O

O

N

R

1 2 (a-c) 3 (a-c)

4 (a-c) 5 (a-c) 6 (a-c)

N

N

O

N

N

COCH3

CH3COO

R

N

H

O

RO

NH2NH

O

N

10

Note: For more information, kindly refer to R. Kavithaet al.,Materials Today Communications 17

(2018) 391-401, Elsevier

Synthesis of BaTiO3/α-S8 composite for enhanced photocatalytic activity

under UV/Solar light in comparison with α-S8 and BaTiO3 photocatalysts:

Effect of spontaneous polarization

L. Gomathi Devi1∗∗∗∗, P.M. Nithya

1,R. Kavitha

1,2

1Department of Post-Graduate Studies in Chemistry, Central College City Campus, Dr.

Ambedkar Street, Bangalore University, Bangalore 560001, India 2Department of Chemistry, Post-graduation studies, Vijaya College (Affiliated to Bangalore

University), Basavanagudi, Bengaluru-560004, Karnataka, India,

Abstract

The BaTiO3/α-S8 composite is fabricated via grinding method combined with melt-diffusion strategy. Non centrosymmetric

crystal structure of BaTiO3 induces a permanent spontaneous polarization which drives the electrons and holes to the

opposite surfaces. This resultant surface polarization causes band bending based on C+/C− domain. Under the UV light, the

C+ domain of BaTiO3 influences the energy bands to bend downwards and drives the CB electrons towards the CB of α-S8

and the VB holes of BaTiO3 react with the surface adsorbed hydroxyl anions. Under the illumination of solar light, the

charge carriers are generated only in the α-S8. The photogenerated electrons from the CB of α-S8 are trapped by the surface

oxygen molecules and the holes move upwards to the VB of BaTiO3, as this energy level is located at 0.08 V higher than

the VB of α-S8. The compositeexhibited enhanced photocatalytic activity for the degradation of fast red dye under UV/solar

light due to the efficient vectorial charge carrier separation. The band bending at the junction of two semiconductors results

in a spatially distinct redox chemistry. This favors the enhancement in the photocatalytic activity of the BaTiO3/α-S8

composite.

The property of spontaneous polarization

influences the extent of band bending at the

interface where the charge carriers gets

accumulated and it effects both the

photocatalysis and the photovoltaic behavior of

the material [9].

However, the drawbacks of BaTiO3 includes, it

is active only under ultraviolet light irradiation

owing to its wide bandgap energy and shows

high rate of photogenerated charge carrier

recombination. These limitations of BaTiO3 as a

photocatalyst can be overcome by various

strategies like coupling it with a narrow band

gap semiconductor, doping of metal

ion/nonmetal ion, surface metallization etc. [10–

12]. Such strategies exert a substantial influence

on quantum efficiency of a photochemical

reaction under UV/solar light illumination.

Among these strategies, the concept of coupling

BaTiO3 with another narrow band gap

semiconductor is adopted in the present research

to construct an interface which can bring about

efficient charge carrier transfer and show better

photocatalytic activity [13]. The junction

properties of BaTiO3 and α-S8 composite can

lead to the improved charge carrier separation

and extend the absorption of BaTiO3 to the

visible region.

1. Introduction

Semiconductor photocatalysis is based

on in situ generation of free radicals

which is an attractive strategy for

wastewater purification as well as for

solar energy conversion, owing to its low

cost and non-selectivity [1]. Despite the

extensive study on TiO2, thrust for

search of various photocatalysts has been

continuously taking place. Wide bandgap

metal oxides like BaTiO3, SrTiO3,

La2Ti2O7, CaTiO3, NaTaO3, and

ZnGa2O4, have also been employed as

photocatalysts in the energy and

environmental remediation [2–7].

Among them, BaTiO3 is a well known

bi-metallic perovskite oxide which is

widely used due to its unique

optoelectronic properties [2–7]. BaTiO3

being a ferroelectric material

demonstrates significant photocatalytic

properties that arises from the non-

centrosymmetric nature of its crystal

structure [8]. In this context, the internal

electric field of BaTiO3 exhibits a

spontaneous polarization that acts like an

internal p-n junction [9].

11


(2018) 391-401, Elsevier

The efficiency of the photocatalyst was

probed for the degradation of fast red dye

under UV/solar light illumination. An attempt

has been made to demonstrate that the

internal fields can indeed result in spatial

separation of charge carriers, reduces the

photogenerated charge carrier recombination

losses and potentially enhances the solar light

response.

Photocatalytic activity

Photocatalytic activities of α-S8, BaTiO3 and

BaTiO3/α-S8 compositewere evaluated for

the degradation of FR under UV/solar light

irradiation.The photocatalytic activity of the

catalysts under UV lightshows the following

decreasing order: BaTiO3/α-S8>BaTiO3>α-

S8(Fig. 7) while under solar light, theactivity

of the catalysts changes to:

BaTiO3/α-S8>α-S8>BaTiO3 (Fig. 8). The

higher photocatalytic activityof the composite

under both UV/solar light compared to

individualcounterparts BaTiO3 and α-S8 is

due to the efficient vectorialcharge carrier

migration and separation. Charge transfer

process whichcan take place in a particular

direction can be termed as vectorialcharge

transfer process. Charge transfer in the

reverse direction will beimpossible since the

positions of the energy levels does not permit

suchprocess. The thumb rule for such charge

transfer process is that electronsalways move

downhill and holes always move uphill. The

degradation

experiment with BaTiO3/α-S8 composite

showed two foldincrease under UV light and

five fold increase under solar light

withrespect to α-S8. The rate constant for the

BaTiO3/α-S8 composite undersolar light is

two orders of magnitude higher than BaTiO3.

Conclusions

The higher efficiency of BaTiO3/α-S8

composite compared toBaTiO3 and α-S8 can

be accounted in the following ways:

• The band edge positions of BaTiO3, α-S8 and

BaTiO3/α-S8 compositewere

thermodynamically suitable for the reduction of

surface adsorbedoxygen to from superoxide

radicals and oxidation of hydroxylanion to

hydroxyl free radical.

• The absorption co-efficient of BaTiO3/α-S8

composite was found tobe higher compared to

the other photocatalysts.

• The efficiency in the charge carrier separation

increases in the caseof BaTiO3and BaTiO3/α-

S8 due to the presence of in-built

spontaneouspolarization. The electrons and

holes are driven in the oppositedirections to C+

and C− a domain which further influences

theextent of band bending to facilitate their

movement.

Fig.8 Plots of C/C0 versus time for the

degradation of Fast Red (FR) under solar light

illumination.

•

12


(2018) 391-401, Elsevier

Upon illumination the following process

takes place: (i) electronholepairs are

generated, (ii) positive shifting of CB and VB

edgepositions takes place and (iii) changes in

the internal electric fieldstake place through

the creation of charged interfaces in the

composite.This was found to be a promising

strategy to enhance the surface

photochemistry.

The sulfate species on the surface acts as

strong electron trappingsite, reduces the

electron-hole recombination and promotes

theformation of hydroxyl radicals.

The strong interaction between the sulfate

anion and titanium cationincreases the

positive polarity on the titanium cation. The

highelectronegativity of sulfur can also

induce polarization of neighboring

hydroxyl groups.

• The polarization effect within the BaTiO3

lattice and the polarizationeffect caused by

the presence of sulfate groups on the

surfacecan be compared to a situation where

two parallel plate capacitorsare in series

which enhances the efficiency of

photocatalysis.

References

[1] S.G. Kumar, L.G. Devi, J. Phys. Chem. A

115 (2011) 13211–13241,

[2] R. Wang, Q. Zhu, W. Wang, C. Fan, A.

Xu, New J. Chem. 39 (2015)4407–4413

[3] T.R.N. Kutty, L.G. Devi, P. Murugaraj,

Mater. Res. Bull. 21 (1986) 1093–1102,

[4] A. Nashim, S. Martha, K.M. Parida,

RSC Adv. 4 (2014) 14633–14643,

[5] K. Shimura, H. Yoshida, Energy Environ.

Sci. 3 (2010) 615–661,

[6] L. An, H. Onishi, ACS Catal. 5 (2015) 3196–

3206,

[7] P. Li, X. Zhao, H. Sun, L. Wang, B. Song, B.

Gao, W. Fan, RSC Adv. 6 (2016)74483–74492

[8] M.R. Morris, S.R. Pendlebury, J. Hong, S.

Dunn, J.R. Durrant, Adv. Mater. 28 (2016) 7123–

7128,

[9] C.R. Bowen, H.A. Kim, P.M. Weaver, S.

Dunn, Energy Environ. Sci. 7(2014) 25–44

[10] K. Maeda, ACS Appl.Mater. Interfaces 6

(2014) 2167–2173

[11] J. Cao, Y. Ji, C. Tian, Z. Yi, J. Alloys

Compd. 615 (2014) 243–248

[12] J. Liu, Y. Sun, Z. Li, CrystEngComm 14

(2012) 1473–1478,

[13] Q. Li, R. Li, L. Zong, J. He, X. Wang,

Int.J. Hydrogen Energy 38 (2013) 12977–12983

[14] C. Hu, C. Lian, S. Zheng, S. Duo, R. Zhang,

Q. Hu, S. Zhang, X. Li, Y. Sun, F. Chen,J. Mol.

Catal. A: Chem. 407(2015) 182–188,

13

CARTAN’S IDENTITY FOR VECTOR-VALUED MEROMORPHIC

MAPPINGS

Veena L PujariPG Department of Mathematics, Vijaya College,

R. V. Road, Basavanagudi, Bengaluru – 560 004, [email protected]

Abstract

In this article, we present analogous result of Cartan’s identity for vector-valued meromorphic functions in an infinite dimen-sional complex Banach space and also discuss its important application.

Keywords: Nevanlinna theory, meromorphic function, Banach space and volume function.2010 Subject classification: Primary 30D35, Secondary 46G20;58B12.

1 IntroductionIn 1980, H.J.W Ziegler [5] made a remarkable contributionin extending the classical Nevanlinna theory to finite dimen-sional complex Banach space Cn in his Ph.D thesis. FurtherC.G Hu and C.C Yang [3] made a significant contributionto Nevanlinna theory with range in an infinite dimensionalHilbert space. In 2006, the Poisson-Jensen-Nevanlinna for-mula, the Nevanlinna’s first and second fundamental the-orem were proved by considering meromorphic functionswith range in an infinite dimensional Banach space by C.GHu and Q Hu [1].

2 Preliminary Definitions and El-ementary Results in E-valuedNevanlinna theory

Assume that E is an infinite dimensional complex Banachspace with a Schauder basis {ej}∞j=1 and C is a complexplane. Let D = Cr = {z : |z| < r}.An E-valued meromorphic function f(z) in a domain D ⊂C can be written as

f(z) =

∞∑j=1

fj(z)ej = (f1(z), f2(z), . . . , fj(z), . . .)

where each fj(z) is a complex-valued meromorphic func-tions in D.We now introduce the generalized quantities of the Nevan-linna theory (see [1]) :For any a ∈ E ∪ {∞} , n(r, a, f) = n(r, a) denotes thenumber of a-points of f in |z| ≤ r, counted with multiplic-ities and n(r,∞, f) = n(r, f) denote the number of polesof f in |z| ≤ r. Then, the analogous of the Nevanlinna’scharacteristics are introduced as follows:

N(r, a) ≡ N(r, a, f) = n(0, a) log r+

∫ r

0

n(t, a)− n(0, a)

tdt

N(r, f) ≡ N(r,∞, f) = n(0, f) log r+

∫ r

0

n(t, f)− n(0, f)

tdt

m(r, f) ≡ m(r,∞, f) =1

2π

∫ 2π

0

log+∥∥f(reiφ)

∥∥ dφ,m(r, a) ≡ m(r, a, f) =

1

2π

∫ 2π

0

log+ 1

‖f(reiφ)− a‖dφ,

where a 6=∞ and log+ x = max {log x, 0}.

T (r, f) = m(r, f) +N(r, f).

The volume function associated with E-valued meromor-phic function f is given by

V (r, a, f) =1

2π

∫Cr

log

∣∣∣∣rξ∣∣∣∣∆ log ‖f(ξ)− a‖ dσ ∧ dτ

and the curvature function is given by

V (r, 0, f ′) = G(r, f) =

∫ r

0

dt

2πt

∫Ct

∆ log ‖f ′(ξ)‖ dσ∧dτ

3 Some Auxiliary LemmasLemma 3.1. [6] Let f : Cr → E be a meromorphic map-ping , which does not reduce to the constant zero element0 ∈ E. Then

T (r, f) = T

(r,

1

f

)+ V (r, 0, f) + log ‖f(0)‖

where

V (r, 0, f) =1

2π

∫Cr

log

∣∣∣∣rξ∣∣∣∣∆ log ‖f(ξ)‖ dσ ∧ dτ

Lemma 3.2. [4]

v(r, a) =1

2π

∫Cr

∆ log ‖f(ξ)− a‖ dσ ∧ dτ

is non-negative and non-decreasing function of r.

14

Lemma 3.3. [4]

V (r, a) =

∫ r

0

v(t, a)

tdt, a ∈ E

is non-negative, non-decreasing function of r and convexfunction of log r.

4 Main ResultsThe present investigation centers around the Cartan’s iden-tity, which states that"Suppose that f(z) is meromorphic function in | z |< R.Then, for 0 < r < R

T (r, f) =1

2π

∫ 2π

0

N(r, eiθ, f)dθ + log+ | f(0) | ” (4.1)

In this paper, we prove the analogous result of Cartan’sidentity for vector-valued meromorphic functions in an infi-nite dimensional Banach space E and its application.

Theorem 4.1. Let f(z) be an E-valued meromorphic func-tion in CR. Then for 0 < r < R, a ∈ E, we have

T (r, f) =1

2π

∫ 2π

0

(N(r, eiθ, f) + V (r, eiθ, f)

)dθ

+ log+ ‖f(0)‖

As an application of Cartan’s identity, we prove the fol-lowing result.

Corollary 4.1. T (r, f) is an increasing function of r andconvex function of log r (0 < r < R).

References[1] Hu, C.G and Hu Q., The Nevanlinna’s theorem for a

class, Complex Variables and Elliptic Equations, Vol.5,777-791(2006).

[2] Hu, C.G., Nevanlinna’s Theory in a Banach Space, Pro-ceedings of the Fifth International Colloquium on Com-plex Analysis, 109-115(1997).

[3] Hu, C.G. and Yang, C.C., Some remarks on Nevan-linna’s theory in a Hilbert space. The Bulletin of theHong Kong Mathematical Society, 1, 267-271(1997).

[4] Pujari, V.L., Volume Deficiency of E-Valued Meromor-phic Functions. Journal of Analysis, 1-15(2018).

[5] Ziegler, H.J.W., Vector-Valued Nevanlinna Theory, Pit-man Advanced Publishing Program, Boston, London,Melbourne, 1982.

[6] Pujari V. L., On a result of Fang for E-valued meromor-phic functions, Analysis, 38(1), 1-10(2018).

15

Paper presented at RBANM'S college – a National conference on Empowering Employability in Higher

Education on 27th Feb 2019

INDUSTRY INSTITUTION INTERFACE (I-I-I) IN HIGHER EDUCATION FROM

STUDENTS PERSPECTIVE

Dr.KVN Lakshmi1, Shaziya iffath

2, Divya V

2, Sanjana s

2

1Asst. Professor, Dept. of PG Commerce, Vijaya College, RV Road, Bangalore,

2 Student (M. Com), Vijaya college

“Nothing is permanent except change, and it is difficult to achieve without collaboration” (I.I.I)

ABSTRACT

Industry Institution Interface could be defined as interactive and Collaborative arrangement between business

organization and Academic institutions for the achievement of certain mutually Inclusive goal and objectives.

Academic world is creative and Industry has the task of commercializing ideas. A productive Interface between

Academic and industry in present times of Knowledge economy is a critical requirement interaction between

Universities Institutions and private industry has discussed in a growing body of different issues and collaboration.

This research paper examines the objective challenges and benefits of Industry Institution Interface in Higher

Education. The dynamic forces operating within the industry institution interface are analyzed in this paper the goal

of this research paper is to analyze practical implication for current learning extent of interface between industry and

Academics through the efforts of educational Institutions and companies and finally the view of Corporate managers

and Student’s perspectives that the academic is not up to the standards of industry level view of universities differs

with the view of Corporate managers under student’s perspective. This work draws upon both primary and

secondary data this research has been conducted among students and passed out students of Bangalore which were

50 in number through questionnaires. The technique Used for collecting sample was the simple random sampling.

The main objective was to give pragmatic suggestions to analyze Student’s perception about the benefits from

different tools of Industry Institution Interface.

Key words: Industry Institution Interface, Knowledge economy, Higher Education, Academics

INTRODUCTION:

Higher Education means education at a college or university where subjects are studied in great detail & at an

advance level (Cambridge University)

Education beyond the secondary level especially education provided by college or university (Merriam Webster)

Education at universities is similar educational establishment, especially to degree level (oxford dictionary)

Higher also called post secondary education, third level or tertiary education. It is an optional final stage of formal

learning that occurs after completion of secondary education. Often delivered at university, academies, college,

seminars & institutes of teaching Higher Education is also available through certain college level institutions,

including vocational schools, trade schools & other carrier colleges that award academic degrees or professional

certificates. The right of access to higher education is mentioned in number of international human right instruments

The present-day challenge is how to make the higher education to make compatible with the industry’s standards.

The present paper addresses few of the issues which guides us through this.

Industry Institute interface:

Institutions are responsible for the types of the students they produce. Industry is the user & utilizer of the teaching

towards the production of products & services. University & industry alliance is a production interface in the present

times of knowledge economy.

Institutions include the universities & other institutions of higher learning including independent & autonomous to

schools engaged in imparting business education.

OBJECTIVES:

� To analyze practical implication for current learning

� To know the extent of interface between Institution and industry.

� To know the level of satisfaction from the present curriculum.

� To know constantly changing management paradigm In response to growing complexity of business

environment

16



� To give pragmatic suggestions.

� To analyze student’s perception about the benefits from different tools of industry academic interface

Methodology:

SAMPLING TECHNIQUES: Simple random sampling technique is used for the analysis.

SAMPLING UNIT & SIZE: The sample unit is student respondent from different educational background of

different institutions in Bangalore south.

A total of 50 student respondents were randomly selected, a well structured questionnaire is given to them. An

analysis of the same is done.

Tools of data collection:

PRIMARY DATA:The Primary data have been collected from students of different educational background of

different institutions in Bangalore south.

SECONDARY DATA: Secondary data is been collected by websites & magazines.

Scope of the study:

The scope of the study of I.I.I is

� The study of students Perspective residing in Bangalore.

� The students of different institutions of south Bangalore are the sample units.

� Opinion of the student plays the major role in this study.

Limitations:

� Everything is dependent on responding of the respondents.

� Confined to the student’s fraternity and those areas restricted to Bangalore only.

ANALYSIS:

I.I.I is necessary for having a better teaching learning experience. The dynamic forces which operates within the

industry makes the inductive to have a complex atmosphere to adjust & work with. Hence establishing a better

collaboration between industry & institution will produce high skilled individuals.

In the present era of knowledge economy it is necessary to establish the links with industry to make the students to

have a better exposure. There are various tools of interface through which the industrial knowledge can be implanted

into a student. Those tools can be listed as follows

1) Guest lecturers from trained staff

2) Industrial visits

3) Workshops

4) Project work for students

5) Training according to industry requirement

6) Orientation programs

7) Identification of skills & its development

8) PPT

9) Seminars

10) Classroom presentation

A detail analysis of I.I.I using various parameters is as follows:

1. Table showing the productive interface between Industry and Academy

Level of education Highly satisfied Satisfied Neutral Dissatisfied

Highly

dissatisfied

PG 0 1 5 10 6

DEGREE 0 0 4 15 4

17

Paper presented at RBANM'S college

From the above chart it can be understood that the respondents from different educational backgrounds express their

dissatisfaction regarding the extent of productive interface between the industries & academy in their

These respondents are the students of different institution studying in Bangalore.

From this parameter it can be inferred that the respondents are not at all satisfied with industry institution interface

& corrective measures has to be underta

2. Table showing the respondents opinion to groom the faculty.

Level of consent

PG

DEGREE

This table explains the consent of the respondents towards preparing the faculty to be fit enough to make the

students ready to use for industries.

that faculty is the primary source for

3. Table showing the promotion of entrepreneurship:

Promotion of

entrepreneurship

Strongly

agree

PG 17

DEGREE 15

The above table interprets the opinion of the students about promotion of entrepreneurship. If the institutio

collaborates with an industry. It can be inferred that if an organization collaborates with an industry, it promotes

entrepreneurship which results in rapid industrialization.

7. Table showing the impact on Research & Development:

RESEARCH & DEVELOPMENT

ACTIVITIES

PG

DEGREE

The Above table shows the influence of I.I.I on outreach research activities under taken by the Students.

Majority of the respondents agreed that, an exposure to industrial atmosphere in their student’s life is going to

encourage them to take up more & more research activities.

FINDINGS & CONCLUSIONS:

1) In a present era of knowledge economy, majority of the resp

satisfied with the extent of interface between industry & academy in their institution. Thus, it can conclude that

the productive interface is not at all satisfactory in the institution in which the respondents

0

10

20

30




dissatisfaction regarding the extent of productive interface between the industries & academy in their

These respondents are the students of different institution studying in Bangalore.


& corrective measures has to be undertaken by the educational institution to cater to students’ requirements.

Table showing the respondents opinion to groom the faculty.

Strongly

agree Agree Neutral Disagree

3 13 3 5

2 9 5 6

explains the consent of the respondents towards preparing the faculty to be fit enough to make the

It can be inferred that the students from different educational background agree

that faculty is the primary source for training the students to make them best fit for the industrial requirements.

Table showing the promotion of entrepreneurship:

Strongly

agree

Agree Neutral Disagree Strongly

disagree

17 9 0 0 0

15 7 1 1 0

The above table interprets the opinion of the students about promotion of entrepreneurship. If the institutio

It can be inferred that if an organization collaborates with an industry, it promotes

ts in rapid industrialization.

Table showing the impact on Research & Development:

RESEARCH & DEVELOPMENT

YES NO

20 5

19 6



encourage them to take up more & more research activities.

In a present era of knowledge economy, majority of the respondents have opined that they are not at all


the productive interface is not at all satisfactory in the institution in which the respondents

Yes No

Pg

Degree

a National conference on Empowering Employability in Higher


dissatisfaction regarding the extent of productive interface between the industries & academy in their institution.


ken by the educational institution to cater to students’ requirements.

Strongly disagree

3

1

explains the consent of the respondents towards preparing the faculty to be fit enough to make the

It can be inferred that the students from different educational background agree

training the students to make them best fit for the industrial requirements.

Strongly

disagree

The above table interprets the opinion of the students about promotion of entrepreneurship. If the institution

It can be inferred that if an organization collaborates with an industry, it promotes

NO

5

6



ondents have opined that they are not at all


the productive interface is not at all satisfactory in the institution in which the respondents are studying.

Degree

18



2) An analysis of the student’s opinion about nurturing the faculty to make them fit enough to meet industrial

standards, the respondents opined that the primary source for a student development would be the faculty.

Hence the faculty should be made fit enough to best fit the industrial standards to train the students.

3) Out of the different tools of interface majority of the respondents strongly believe that the industrial visits &

project work for the students are the ones which support developing the industrial knowledge in a student.

Many other respondents have agreed that seminars, workshop & implantation of industrial skill would support

Industry Institute interface.

4) When the question of establishment of links at the national, regional& state levels with agencies &

organizations responsible for policy making, funding & accreditation, was analyzed it can be inferred that

students are very firm in their opinion that the institution must necessarily establish the links with the different

organization. So that they can raise funds or sponsorship for different job-oriented courses & institution can

have better contacts which enlighten & improve the actual performance of the institution which directly

impacts student’s performance.

5) An analysis of collaboration Industry Institute interface the respondents expressed their opinion that if

educational institutions collaborates with industry then, the institution becomes a primary hub for grooming

intrapreneurs which results in promotion of entrepreneurs & further rapid industrialization.

6) A co-joint supervisor from the industry will enrich the students with the industrial knowledge which is helpful

for the students for getting acquainted with industrial atmosphere. Hence the supervisor from the industry

would be a great support for final year project.

7) A collaboration of an industry with institution, gives the students an opportunity to get exposed &to get know

the industrial requirement. This makes the students also to know the flaws that is present in an industry &

encourage them to undertaken innovative research activities.

8) According to the respondents, communication impacts Industry Institution Interface. Industry requires better

ability to communicate & this communication enhances the understanding of the present industrial atmosphere.

This makes them to have a better placement & perform the job well.

9) An analysis of the institution syllabi & the industrial requirement, it is clear that the learning is not according to

the realistic expectation. Its only partial real.

10) When respondents are asked to expressed their opinion as to whether there is a growing pressure from

industries to make their inductive productive, there was a big YES from the respondents who opined that the

industry try to reduce subsequent training cost by employing trained youth. And the rest expressed that the

industry grooms the employees on their own & hence industry employed untrained people for the vacant

position.

SUGGESTIONS & RECOMMENDATION:

1) An industry should invite educational institution to collaborate with it in its various project implemented to

provide practical tint of the functional areas to the academics.

2) Institution should always try to collaborate with industries & ascertain real requirement of industry provide

students skills in that line

3) Initiations from the college to trained students according to the requirements of the industries.

4) Instead of only classroom studies their must more practical sessions to improve the required skills of the

students.

5) Academia expectations – funding & infrastructure, equal partnership placements feasible goals.

6) Industry should frankly & honestly talk with academia based on logical thinking & scientific back ground,

which would be helpful to close engagement with academia.

REFERENCES

• An overview of industry institute collaboration on the quality of education in engineering institutions

(www.researchgate.net)

• Industry Institute Interaction (shodhganga.inflibnet.ac.in)

• Role of Industry Institute Interaction to promote education and entrepreneurship (link.springer.com)

19

PHYSICS EXPERIMENTS USING SMARTPHONE WITH SENSORSSuhas, ChetanSurya, Anjana

Final BSc PCM section, Vijaya College RV Road Basavanagudi, Bengaluru*Associate prof, Department of Physics

Abstract— Technology plays an important role in which we learn and teach. In the last few years ICT

based learning techniques like open online courses and mobile learning are catching up. Among their

benefits, these two technologies ease the access to knowledge. In physics teaching, smartphones and

tablets can be used not only as knowledge facilitators, but also as powerful experimental tools as they are

coming with many sensors as add on features: accelerometer, gyroscope, m

Students can use their own smartphones either in laboratories or in convenient locations. Experiments

with smartphones can be easily performed in non

among many others.

INTRODUCTION

Science for a complete teaching and learning

requires both theoretical discussions and

practical experimentation.Using mobile

devices kindle interest on physics experiments,

ease its understanding and opening the

possibility of more active learning techniques.

By analyzing everyday activities, the students

can observe nature, test their knowledge and

acquire abilities necessary in the experimental

work in the laboratory. The use of smartphones

as experimental tools can help building low

cost laboratories. Science for a complete

teaching and learning requires both

theoretical discussions and practical

experimentation. Current mobile devices open

a new way thanks to their affordable

electronics and built-in sensors. In many cases,

data from the mobile devices' sensors are

easily accessible through free applications that

can be downloaded from the app’s stores.

These are the reasons why some groups of

teachers have recently started developing apps

specially intended to be use in physical

measurements by students.

Examples: phyphox, physics tool box

Experiments : In this paper three

experiments are presented which were

performed using mobile applications.

1. Helmholtz resonator

2. Malus law verification

3. Angular velocity of roll

PHYSICS EXPERIMENTS USING SMARTPHONE WITH SENSORSSuhas, ChetanSurya, Anjana,Nagendra,Manoj,Madhu, Geetha R S*

inal BSc PCM section, Vijaya College RV Road Basavanagudi, Bengaluru

Department of Physics, Vijaya College, RV Road, Basavanagudi

Technology plays an important role in which we learn and teach. In the last few years ICT


nologies ease the access to knowledge. In physics teaching, smartphones and


coming with many sensors as add on features: accelerometer, gyroscope, magnetometer, sound, light, ...


with smartphones can be easily performed in non-traditional places as playgrounds, travel facilities, home

NTRODUCTION

Science for a complete teaching and learning

requires both theoretical discussions and

practical experimentation.Using mobile

devices kindle interest on physics experiments,

derstanding and opening the

possibility of more active learning techniques.

By analyzing everyday activities, the students

can observe nature, test their knowledge and

acquire abilities necessary in the experimental

work in the laboratory. The use of smartphones

as experimental tools can help building low

e for a complete

teaching and learning requires both

theoretical discussions and practical

Current mobile devices open

a new way thanks to their affordable

in sensors. In many cases,

ices' sensors are

easily accessible through free applications that

can be downloaded from the app’s stores.

These are the reasons why some groups of

teachers have recently started developing apps

specially intended to be use in physical

Examples: phyphox, physics tool box

three

experiments are presented which were

performed using mobile applications.

1. Helmholtz resonator

A bottle is filled with water at different levels.

For each water level, the volume of the air

cavity is obtained. Blowing across the top of

the bottle, produces a resonance. in the cavity.

The sound spectrum app

spectrum in real time

which corresponds to the resonance frequency.

f2 vs (1/V) graph is plotted. The sound speed c

is related to the slope of the graph as ��

��.�� where

A is cross section area of the neck of bottle

L is the resonating length and

a is radius of the neck of bottle

Table 1

Graph 1

0

20000

40000

60000

80000

100000

0 0.005

f2

Helmholtz Resonator

PHYSICS EXPERIMENTS USING SMARTPHONE WITH SENSORS , Geetha R S*

inal BSc PCM section, Vijaya College RV Road Basavanagudi, Bengaluru

Basavanagudi, Bengaluru-560004

Technology plays an important role in which we learn and teach. In the last few years ICT


nologies ease the access to knowledge. In physics teaching, smartphones and


agnetometer, sound, light, ...


traditional places as playgrounds, travel facilities, home

A bottle is filled with water at different levels.

For each water level, the volume of the air

cavity is obtained. Blowing across the top of

the bottle, produces a resonance. in the cavity.

app is used to obtain the

and the highest peak

which corresponds to the resonance frequency.

graph is plotted. The sound speed c

is related to the slope of the graph as ��

A is cross section area of the neck of bottle

ing length and

a is radius of the neck of bottle

Table 1

Graph 1

y = 9E+06x + 1810.

0.005 0.01 0.015

1/V

Helmholtz Resonator

21

2. Malus law

According to conservation of energy applied to

electromagnetic fields (Poynting's theorem),

the energy flow (intensity or illuminance,

associated to an electromagnetic wave (light)

is proportional to the square of the amplitude

of the electric field. When light interacts with

matter its behavior is modified, mainly its

intensity and its velocity. Moreover, some

materials can modify light differently in each

spatial direction. This is the case for instance

of linear polarizers that can convert

unpolarized light into linear polarized light. An

ideal polarizer fully attenuates light polarized

in one direction, and fully transmits light with

the orthogonal polarization. Consider a beam

of linear polarized light incident over a

polarizer. Let θbe the angle between the axis of

the polarizer and the polarization of the

incident light. The electric field that passes

through the polarizer is the component in the

direction of the axis,

E=E0 cos θ. Therefore, the intensity of the light

passing the polarizer is

I=I0 cos2 θ

where I 0, is the intensity of the light before the

polarizer. Equation 1 is the called

In this experiment, a source of polarized light,

a polarizer, a photometer and a way to measure

angles are needed.

The source of linear polarized light is a flat

computer monitor (or LCD TV screen) in plain

white colour. The ambient light sensor of

smartphone, located near the front camera is

used as a photometer and the orientation

sensor is used to measure the angles. A small

piece of polarizer is placed over the ambient

light sensor as shown in fig. The ambient light

sensor works as a linear photomete

measures the illuminance, i.e.,

luminous flux incident on a surface, per unit

area whose unit is lux. However, in the Malus

law, the relevant variable is the irradiance (or

light intensity, i.e., the total power received by

According to conservation of energy applied to

electromagnetic fields (Poynting's theorem),

the energy flow (intensity or illuminance, I)

associated to an electromagnetic wave (light)

is proportional to the square of the amplitude

of the electric field. When light interacts with

matter its behavior is modified, mainly its

intensity and its velocity. Moreover, some

t differently in each

spatial direction. This is the case for instance

of linear polarizers that can convert

unpolarized light into linear polarized light. An

ideal polarizer fully attenuates light polarized

in one direction, and fully transmits light with

Consider a beam

of linear polarized light incident over a

be the angle between the axis of

the polarizer and the polarization of the

incident light. The electric field that passes

omponent in the

. Therefore, the intensity of the light

(1)

, is the intensity of the light before the

polarizer. Equation 1 is the called Malus ‘law,

In this experiment, a source of polarized light,

a polarizer, a photometer and a way to measure

The source of linear polarized light is a flat

computer monitor (or LCD TV screen) in plain

white colour. The ambient light sensor of

tphone, located near the front camera is

used as a photometer and the orientation

sensor is used to measure the angles. A small

piece of polarizer is placed over the ambient

light sensor as shown in fig. The ambient light

sensor works as a linear photometer and

i.e., the total

luminous flux incident on a surface, per unit

area whose unit is lux. However, in the Malus’

law, the relevant variable is the irradiance (or

, the total power received by

a surface per unit area measured in W/m

illuminance, contrarily to the irradiance,

considers the fact that human eyes' are more

sensitive to some wavelengths than others,

and, consequently every wavelength is

weighted differently. In the experimental

setup, since the spectrum of the light source

does not change, the irradiance is proportional

to the illuminance.

The experiment starts by placing the

smartphone upright over the screen, with a

pitch angle of-90º. Next, keeping the

smartphone upright, the polarizer is

looking for a minimum in the light intensity. In

this position, the polarizer is fastened with a

tiny piece of tape over the light sensor. As a

result, the axis of the polarizer is perpendicular

to the polarization of the light from the screen.

collect data with the app

gently rotated in front of the screen completing

at least a quarter of revolution.

Once the data is recorded, the app saves a

file that can be downloaded to a PC or tablet

and analysed using appropriate soft

Fig 2

nit area measured in W/m2). The

illuminance, contrarily to the irradiance,

considers the fact that human eyes' are more

sensitive to some wavelengths than others,

and, consequently every wavelength is

weighted differently. In the experimental

the spectrum of the light source

does not change, the irradiance is proportional

The experiment starts by placing the

smartphone upright over the screen, with a

90º. Next, keeping the

smartphone upright, the polarizer is rotated

looking for a minimum in the light intensity. In

this position, the polarizer is fastened with a

tiny piece of tape over the light sensor. As a

result, the axis of the polarizer is perpendicular

to the polarization of the light from the screen.

app and the smartphone

gently rotated in front of the screen completing

at least a quarter of revolution.

Once the data is recorded, the app saves a csv

file that can be downloaded to a PC or tablet

and analysed using appropriate software.

Fig 2

22

Table 2

Graph 2

By equation 1, ln(I/I0) = 2 ln(cos(

slope of the line =2 in graph 2. It is seen that,

the equation in the inset indicates that the slope

is 1.9.

Angular velocity of a roll

A paper or metal roll is taken. A smartphone

and another device (another smartphone or

tablet can be used). Smartphone is placed

inside the roll with some padding. ‘Allow

remote access feature’ is enabled. Given URL

is opened on the second device.

the second device is pressed and the velocity is

recorded. App uses the gyroscope in the phone

to find the angular velocity by using the radius

of the roll.

y = 1.889x - 0.023

-2 -1.5 -1 -0.5

ln(I

/I0)

ln (cos(θθθθ))

Malus Law

) = 2 ln(cos(θ)), thus the

slope of the line =2 in graph 2. It is seen that,

the equation in the inset indicates that the slope

Angular velocity of a roll

A paper or metal roll is taken. A smartphone

another smartphone or

tablet can be used). Smartphone is placed

inside the roll with some padding. ‘Allow

remote access feature’ is enabled. Given URL

is opened on the second device.Play button on

the second device is pressed and the velocity is

recorded. App uses the gyroscope in the phone

to find the angular velocity by using the radius

Fig 3

Graph 3

Conclusions

These experiments have successfully

demonstrated that smartphone sensors have the

potential to become excellent pedagogical

tools. Time taken for conducting the

experiments is less.

Students can perform experiments in their

convenient space and time and this has

generated lot of interest for self

of data is generated in short time. More

number of experiments using phone sensors

can be explored.

Nevertheless, as teachers, we must advise that

sometimes the sensors and free apps may not

be designed or implemented as learning tools,

and even in some cases their results may not

-3

-2

-1

0

0 0.5

0

0.2

0.4

0.6

0.8

0 0.3

Ve

loci

ty (

m/s

)

Tangential Velocity of roll

Fig 3

Graph 3

These experiments have successfully

smartphone sensors have the

potential to become excellent pedagogical

tools. Time taken for conducting the

Students can perform experiments in their

convenient space and time and this has

generated lot of interest for self-learning. Lot

of data is generated in short time. More

number of experiments using phone sensors

Nevertheless, as teachers, we must advise that

sometimes the sensors and free apps may not

be designed or implemented as learning tools,

and even in some cases their results may not

0.6 0.9 1.2 1.5

time (s)

Tangential Velocity of roll

23

be of desired accuracy either in the recorded

data or in how data are presented.

These are important issues if a teacher wants to

use the mobile device to do measurements, but

it is more important yet if it is a student who

uses that device to measure and learn.

Acknowledgements

Dr Keshavamurthy, Research professor,

Ramaiah Institute of advanced Sciences for

valuable discussions.

Dr A S Govind, Head, Department of Physics,

Vijaya College

Lalitha,sharadamba vidya Niketan

References

1. A bottle of tea as a universal

Helmholtz resonator by Martín

Monteiro(a), Cecilia Stari(b), Cecilia

Cabeza(c), Arturo C. Marti(d),

2. https://phyphox.org/

3. Yavuz, A. (2015) "Measuring the speed

of sound in air using smartphone

applications"

4. Physics Education, 50(3), 281

24

ANALYTICAL SOLUTION FOR MHD BOUNDARY-LAYER FLOW OF

NANOFLUIDS OVER A MOVING SURFACE

Dr. S B Sathyanarayana

Department of Mathematics, Vijaya College, R V Road, Basavanagudi, Bengaluru – 04

Abstract

All Boundary value problems are represented by non linear partial differential equations. These problems

can be reduced to non linear ordinary differential equations. Homotopy analysis method is a method used

to find analytical solution of non linear ordinary differential equations. Many chemical Engineering

processes can be modeled as flow over a moving surface.

Eshetu Haile and Shankar[2] studied the influence of thermal radiation, viscous dissipation and chemical

reaction effects on nanofluids. Viscous nanofluid flows play very important role in chemical engineering.

The transformed nonlinear ordinary differential equations subject to the boundary conditions are solved.

Velocity, temperature and concentration profiles are obtained by using Mathematica, the solutions are

obtained and discussed through graphs for the various parameters

Introduction

Boundary Layer Theory has a lot of practical applications such as extrusion of plastic sheets,

rolling and manufacturing of plastic films, cooling of metallic plates and boundary layer flow

over heat treated materials between feed roll, a windup roll and in Aerodynamics.

The study of heat and mass transfer of nanofluid flow with effects of chemical reactions over the

stretching surface has a wide range of applications in chemical industries like production of

polymers and food processing, cooling and drying processes, nuclear reactors cooling,

manufacturing of ceramics and glass wares and also in petroleum industries.

MHD and nano effect on the flow over a moving surface in presence of thermal radiation,

viscous dissipation and chemical Reaction. The effect of chemical reactions can change the

property and quality of any product.

Mathematical Formulation of the problem

Consider the steady 2D MHD boundary layer flow of a nanofluid inpresence of thermal radiation,past a

moving semi- infinite flat plate in a uniform free stream in addition to chemical reaction and viscous

dissipation.Uniform free stream whose velocity is assumed as U, velocitytowards a moving semi-infinite

flat plate is given by Uw= λU where λ is the velocity parameter in presence of thermal radiation. The

flow being confined at � ≥ 0.it is assumed that y co-ordinate is measured normal to the moving

surface and uniform magnetic field B is applied in ‘y’ direction. It is assumed that the induced magnetic

field, the external electric field and the electric field due to the polarization of charges are negligible in

comparison to the applied magnetic field. Let TwandCw are the temperature of fluid and nanoparticle

fraction at wall where as �∞and�∞are the temperature of fluid and nanoparticle concentrationfar from

the sheet.The governing equations of the flow are taken as discussed by Eshetu Haile and Shanker[33],

the geometry of flow, continuity, momentum, energy and diffusion with thermal radiation, viscous

dissipation and chemical reaction effects of the MHD boundary layer flow of a nanofluid past a moving

semi infinite flat plate in a uniform stream are given by

25

Figure1

�� +�� = 0,�1�

�� + � �� = � �� + �

��²��²

− ��ρ � − ��,�2�

�� + � �� = α�� +μ��

�u��!

� − 1��

�q#�� + τ $D& ��! + �'(�∞

! ��!�),�3�

�� + � �C�� = D&�� +

D,T∞

�²��y²

− /0�� − �1�,�4� where u and v are the velocity component along the x-axis and along the y-axis respectively'3the

Brownian diffusion coefficient,'( the Thermophoresis diffusion coefficient, B = &5√7 where B0is

constant, σ is the electrical conductivity of the base fluid, τ is the ratio of the nanoparticle heat capacity

and the base fluid heat capacity,/8 thermal conductivity of the base fluid, ν is the kinematic viscosity

coefficient α = k/��9:�8 is the thermal diffusivity of the fluid, T is the temperature, ρ, µ, k and C are the

density, dynamic viscosity, thermal conductivity and nanoparticle concentration, λ is the velocity

parameter. λ >0 corresponds to the downstream movement of the plate from the origin and λ <0

corresponds to the upstream movement of the plate.

The associated boundary conditions are taken as

� = 0, = �; = <�, � = �=, � = �= >?� = 0�5� → �,� → �1, � → �1>B� → ∞.�6�

By making use of similarity transformation and associated boundary conditions, the continuity

equation is identically satisfied. Momentum equation and energy equation and nanoparticle

concentration equation reduces to ODE.

26

The governing coupled non linear equations for this problem are

f FFF + ff FF −Ha�f F − 1� = 0,�13� �3 + 4I�

3 θFF + PrMfθF + Ecf FF�+PQφFθF +PSθF�T = 0,�14� φFF + LefφF + NXPQ θFF − LeYZRe7φ = 0,�15� f�0� = 0, f ′�0� = λ, f ′ → 1asη → ∞,�16� θ�0� = 1, θ → 0asη → ∞,�17� _�0� = 1, _ → 0>B` → ∞.�18�

Where b0is the radiative heat flux, Nb is the Brownian motion parameter, Nt is the Thermophoresis

parameter, Cc is the Skin-friction coefficient, d;is the Shear stress, b; is the heat flux, Sh7theLocal

Sherwood number, bg Mass flux, Rex is the Local Renolds number, R the Radiation parameter, Pr the

Prandtl number, Le Lewis number, Ha the Hartman number, Nu7is the Nusselt number, YZ is the scaled

chemical reaction parameter, /0 is the chemical reaction parameter,

Homotopy Analysis Method is used for solving nonlinear boundary value problems

4. RESULT AND ANALYSIS

In HAM solutions, effects of magnetic field, viscous dissipation, thermal radiation and chemical

reaction on heat and mass transfer characteristics of a moving plate of nanofluids were

considered. The nonlinear ordinary differential equations subject to the boundary conditions

were solved. Velocity, temperature and concentration profiles were obtained.HAM results were

discussed for the various embedded parameters graphically. By using Mathematica program the

solutions are obtained and discussed through graphs for the various parameters. Nb Nt Le, Ha,

Rex,λ,R, Pr, and YZ make the system complicated and the effect of all these are discussed and

reported in graph.In fig2we notice that the effect of magnetic parameter Haincrease the velocity

profile. In fig 3 as Pr increases, the temperature profile increases. In fig 4 as the radiation

parameter R increases, the temperature profile increases. In fig 5 brownian motion parameter Nb

enhance the temperature. In fig 6 as the thermophorosis parameter Nt increases temperature

profile increases.

Effect of both magnetic and velocity parameters enhance the velocity profile. Brownian motion,

thermophoresis parameters, viscous dissipation and thermal radiation, enhance the temperature

profile whereas Prandtl number Pr and the velocity parameter < reduce it. Thermophoresis

parameter enhances the concentration profile, Reynolds number, Lewis number, radiation

parameter, Brownian motion parameter; chemical reaction parameter and velocity parameter

decrease the nanoparticle concentration profile.

27

5. CONCLUSIONS

In this study we observed that the semi analytical method HAM works well for non-linear differential

equations. We have shown that HAM solution exactly similar with numerical result obtained byEshetu

Haile and Shankar B in which shooting technique along with the fourth order Runge-Kutta integration

scheme method is applied directly to non linear ODE.

Fig1. Velocity profiles for different values of Ha

Fig2. Temperature distribution for different values of Pr

Fig3. Temperature distribution for different values of R

Fig4. Temperature distribution for different values of Ph

Ha = 0,0.3,0.6,0.9

1 2 3 4 5 6�

0.2

0.4

0.6

0.8

1.0

f'��

Pr = 0.5,20,50,75

2 4 6 8 10�

0.2

0.4

0.6

0.8

1.0

��

R=0.1.5,2.5,3.5

1 2 3 4 5 6�

0.2

0.4

0.6

0.8

1.0

��

Nb=0.1,1.5,2.5,3.5

2 4 6 8�

0.2

0.4

0.6

0.8

1.0

��

Fig5. Temperature distribution for different values of PS Fig 6. Nano particle fraction for different values of Le

Nt= -1,0,0.5,1

2 4 6 8�

0.2

0.4

0.6

0.8

1.0

��

Le=2,10,15,20

2 4 6 8 10�

0.2

0.4

0.6

0.8

1.0

��

28

Published in :International Journal of Applied Business and Economic Research, ISSN:0972-

7302, Serials Publications Pvt. Ltd. Volume 15,Number 21, November 2017

A comprehensive LR model for predicting Bank’s stock performance in

Indian stock market

Nataraja N.S1,Nagaraja Rao Chilale

2 ,GaneshL

3

1Alliance University, Bangalore.,

2Vijaya College, Bangalore University, Bangalore.

3Christ University, Bangalore.

ABSTRACT The study focusses on developing a Logistic Regression model to distinguish between “Good”

and “Poor”Performance of Bank-stocks which are traded in Indian stock market with regard to

the financial ratios. The study- sample comprises of financialratios of 40 nationalised and

private banks, for a period of six years. The study ascertains and scrutinizes eleven financial

ratios that can categorize the Banksbroadly into two categories as “good” or “poor”, up to the

accuracy level of 78 percent, based on their rate of return. First, the study predicts the

performance of banks by using financial ratios and tries to build the goodness of fit by using

Logistic Regression approach. The studyalso emphasizes that this model can enrich an

investor's ability to forecast the price of various stocks.The study reveals that the model could

be useful to potential investors, fund managers, and investment companies to improve their

strategiesand to select the ‘out-performing’Bank-stocks.

Keywords: stock performance, logistic regression, market rate of return, key financial ratios,

NIFTY, SENSEX

I. INTRODUCTION:

The Financial stability of a country can be significantly determined by studying the

Performance of the banking sector in stock market.Financial ratios are significantgears for

gaugingforthcoming stock performance. Ratio analysis has proven to be one of the key

parameters to ascertain the intrinsic value of Banks stock shares (ArunUpadhyayetal, 2012).

Financial ratios are regarded as the baseline for investor’s stock price anticipations and,

hence, significantly impact investment decisions. Thus, selection of appropriate ratios is very

decisive in snowballing the success rate of prediction. The focal aim of the authors is to

understand andanalyse the financial data of various banks and to develop a simplified model

for testing the bank’s stock performance.

II. REVIEW OF LITERATURE

Many researchers have analysed about the bank performance and found that internal factors

relates to banks characteristics and external factors related to economic and legal

environment (Athanasoglou, Brissimis& Delis, 2008).In India, Indian stock market has

garnered widespread attention from investors worldwide due to its prospectivepotential and

accelerating growth for investment.On account of this growth it has been able to be the

cynosure of attention from various quarters. A number of research papers predict stock

performance as well as pricing of the stock index across the globe. AvijanDuttaetal (June

2012) have used the Logistic Regression model to find the performance of stocks based on

few important ratios and observed thatthe model can enhance an investor's stock price

forecasting ability.ArunUpadhyayet al (2012) used the Multinomial Logistic Regression

(MLR) to predict the outperforming stock based on the financial ratios.

29



RESEARCH OBJECTIVE AND METHODOLOGY

Themain objective of this study is to test the model efficacy on predictionbased on the

financial ratios for examining the out-performing Banksin the Indian stock market.

Methodology

For the purpose of the study, those Banks which have large market capitalizations have been

considered and most of these Banks are part of the BSE SENSEX (i.e.BANKEX). The

relevant data taken for this analysis are from websites, moneycontrol.com, Annual reports of

Banks and Capitaline.The study sample consists of the ratios of 40 Banks of both

nationalized and private over a period of Six-years (2010-2015), which are actively traded on

the Indian stock exchange taken for classification purposes. In order to calculate the return,

financial ratios and stock prices of Banks were considered.

Conceptual framework

The coefficients are estimated not by ordinary least squares method rather, by maximum

likelihood estimator (MLE) method which is a maximizationof the probability of classifying

the observed data into the appropriate category given the regression coefficients (Hosmer

&Lemeshow, 2000).The model takes the form

Logit(y) =In(odds)= In� �� = β0 + β1x1 +β2x2 +…………..+βkxk.

Where

p = the probability of the event of interest, Xi = ith

predictor variable, β0= constant of the

equation βi = ith

coefficient of predictor variable Xi, k = number of predictors

III. Empirical framework

We have calculated the value of a Bank’s stock and the market return for each year. For a

particular year, investment option is classified as “Good” when bank’s stock value rose above

the market return on the other hand if it is less than market return then classified as a “Poor”

investment option. Market return of the stock has been taken using theBANKEX (Index of

Mumbai Stock Exchange). Market returns are calculated at the end of each financial year

considering the closing prices of every year (March end).

The following formula has been used to calculate the return.

Return of stock = ��

Χ 100 Where, t= Price in the tth

year Pt-1= Price in the (t -1)th

year

Market return = ��(�)��(��)

��(��)

The dependent variable is categorical takes values 1(GOOD) or 0 (POOR) performance.

Explanatory variables are performanceratios, profitability ratios, efficiencyratios, capital

adequacy ratio and equity ratio and provision ratio, which are generally, determine the value

of share in the stock market.Based on these ratios, the (predictors) variables

areEPS,ROA,ROE,CIR,NIM,ER,CDR,IDR,CD,CAR,LLP.

The data has been analysed through SPSS. Based on the several financial ratios considered in

the study, the suggested model for the prediction of stock performance of bank is

Logit(y)=-7.046-0.003EPS-0.462ROA+0.254ROE+0.060CIR-0.387NIM+0.221ER-

0.059CDR+0.032IDR -0.034CD+0.197CAR +0.177LLP

30



The results of the logistic regression study are analysed in four categories.

a) The overall fit of a model

H0: Financial ratios do not affect performance of Bank’s Stocks (model is not significant)

H1: Financial ratios do affect performance of Bank’s Stocks (model is significant)

The equivalent form of the above hypothesis is

H0:β1 = β2 =…………=βk = 0 Vs H1: at least one βi≠0

In order to test the above hypothesis, test statistic, -2 log likelihood is applied and which

follows chi-square distribution with degrees of freedom equal to the number of predictors in

the model.

The value of chi-square 224.664whichis significantly greater than the chi square table value

and indicates the rejection of null hypothesis.Thus,study concludes that the predictors

(financial ratios)are statistically significant

b) Statistical tests of individual predictors

The Wald statistic and associated probabilities which provide an index of the significance of

each predictor in the model. The Wald statisticfollows a chi-square distribution.It is noted

from the outputthat the variables ROE, CIR, CDR, and LLP are significant (p<0.05) in

measuring the Banks’s stock performance. The LR coefficient which is statistically

significant measures the impact of estimated probability and in turn the prediction of group

membership.

c) goodness-of-fit statistics

Hosmer and Lemeshow Test

Step Chi-square Df Sig.

1 6.107 8 .635

The Hosmer-lemeshow test is to examine whether the observed proportions of events are

similar to the predicted probabilities of occurrence in subgroups of the model population.This

test creates 10 ordered groups of subjects and then compares the observed numbers in each

group with the predicted numbers in each group obtained by LR model. The p-value0.635

which is greater than 0.05,clearly indicates that there is no significant difference between

observed and model-predicted values, implying that the model fits the data at an acceptable

level.

d)An assessment of the predicted probabilities.

Classification Accuracy:

The classificationtable is a method to evaluate the predictive accuracy of the logistic

regression model (Pend &So, 2002).In this, the observed values for the dependent variable

and the predicted values (at a user defined cut-off value) are cross-classified. If the predicted

31



probability of a case (response) is greater than user-specified cut off value, then it is classified

into category 1, otherwise, it is classified into category 0.

The above tablepresents the degree to which predicted probabilities agree with actual events

(outcomes) in a classification table. In this study, 74.2 % were correctly classified for the

Good performancestock group and 80.5% for the Poorperformancestock group.The overall

correct prediction is 77.8%. This tells us that the model with selected predictors is a

significantly better model.

CONCLUSION:

The results of the above logistic regression analysis conducted to predict the performance of

banks stock with the help of different financial ratios as predictors, clearly indicates that the

financial ratios do have an impact on the stock performance of the banks. Model indicates

that the predictors as a set reliably distinguished between good performance and poor

performance of Bank- stocks. Prediction success overall was 77.8 % (74.2% for Good and

80.5% for poor).Thus, the study reveals that the model can be used by investors, fund

managers, and investment companies to enhance their ability to select out-performing Banks

stock.

REFERENCES

1. AvijanDuttaetal,Prediction of Stock Performance in the Indian Stock Market Using

LogisticRegression,International Journal of Business and InformationVolume 7,

Number 1, June 2012

2. Ali Ghezelbash and FarshidKeynia,A New Approach Based on Artificial Intelligent

Models for Forecasting of Financial Markets,IOSR Journal of Engineering

(IOSRJEN),Vol. 04, Issue 03 (March. 2014), ||V5|| PP 46-52

3. Kryzanowski, L., Galler, M., & Wright, W. (2009). Using artificial neural networks to

pick stocks. Financial Analyst Journal, 49, 21–27.

4. Mu-Yen Chen,Predicting corporate financial distress based on integration of decision

tree classification and logistic regression, Expert Systems with Applications,Volume

38, Issue 9, September 2011, Pages 11261–11272

Classification Tablea

observed

Predicted

PER Percentage

Correct POOR GOOD

Step 1

PER

POOR 107 26 80.5

GOOD 25 72 74.2

Overall Percentage 77.8

a. The cut value is .500

32

BASIC LEARNING OF MONTESSORI KIDS – A CASE STUDY

Jalajakshi.S1,.Bhargavi.K.M

2,.Meghana.T.P

3, Shubha.N

4,.Sudhruti.L

5,

2,3,4,5 UG students, Vijaya College, R.V.Road, Basavanagudi, Bangalore-560004.

1Corresponding Author: Jalajakshi.S, Assistant Professor, Genetics Department. [email protected]

Abstract:

The current study aims at analysing the basic learning methods of Montessori kids and comparing the

methods of learning between boys and girls. The Montessori education is concentrated on the self-

directed activity, hands on learning and scientific observation of children. The two Montessori’s of

south Bangalore Leo kids and Samskruti were selected as the study area. The age group considered

was from 3-5 years and were grouped as PKG (Pre Kinder Garden), LKG (Lower Kinder Garden), and

UKG (Upper Kinder Garden). Out of 115 children, 67 were boys and 48 were girls. The performance

level of boys and girls were analysed under four different tasks and activities classified under

identification criteria, memory skills, physical ability and mathematical ability. The total percentage of

performance level of boys was 82.09% andgirls was 83.66%. The ANOVA - one way classification

was used between groups and within groups. The f value was calculated and was compared with F

critical value. In the conclusion drawn, there is no significant difference between the performance

level between boys and girls at early age of Montessori education.

Keywords: Montessori kids, performance level, boys, girls, ANOVA and f value.

Introduction:The childhood stage is considered to be the most important one in man’s life

because the child at this stage is most susceptible to the influence of the surrounding

environment (Zahria. I. Abdel Haq etal, 2015). This concept led Maria Montessori to

establish a Montessori in 1907, Rome. She stressed that the organism and the mind form a

structured whole and that mental development is the product of interaction between the

structure of the organism and the structure of the environment (Solveiga Miezitis, 1971).

Montessori developed a set of manipulable objects designed to develop the learning of kid’s

sensorial concepts like colour, dimensions, shape and academic concepts of mathematics,

literacy, and geography. It is the first study in India that systematically analysed the

relationship between skills and exposure to television for children and doesn’t suffer from any

of the forementioned problems (Ashish Singh, Sarthak Gaurav, 2013).Movement is a

positive addition to the classroom. It provides students with the opportunity to move while

learning at the same time. Physical activity is said to help a child’s brain cells and engages the

child to want to learn. Movement not only affects the children, but it also affects the teachers

since it gives teachers time to plan what will happen next while the child is off doing a

movement break (Abby Akkerman, 2014). No competition is set up between the students and

there is no system of extrinsic rewards or punishment. These two aspects- the learning materials

and the nature of the learning, make Montessori classroom look strikingly different to

traditional teaching (Chole Marshall, 2017).

The current study aims firstly at, investigating the active involvement of boys and girls of the

age group between 3-5 years. Secondly, to evaluate the performance level, vocabulary, writing

33

and technical skills. The study also focuses on nurturing the basic concepts of learning like

general knowledge, English and common science.

Materials and Methods:In the current study, the two Montessori’s of Bangalore south

i.e. Leo kids and Samskruthi were selected. The survey included the total number of 117

children of which 67 were boys and 48 were girls and 2 were special kids. The age group

considered was 3-5 years. The methodology in analyzing the basic learning methods included

the simple English vocabulary and mathematical concept of learning. The English vocabulary

included the identification of fruits, vegetables, animals, birds, colors, vehicles, animal sounds

etc. the mathematical concept of learning included the counting of numbers and identifying

shapes. Physical activities like running race and dropping the ball in the bucket were also

conducted. A memory game was also organized to observe the active involvement of the

children. The source of materials to conduct the study comprised of the charts, puzzles, pictures

etc. YouTube was used as an audio output for the recognition of animal sounds. The data was

collected and it was processed using ANOVA - one way classification. The null hypothesis was

set up stating that there was no significant difference between the performance level between

boys and girls.

Results and Discussion:From the survey done for various activities among boys and

girls with different age groups, it was found that girls’ performance was better compared to

boys. In the four criteria included, i.e. identification criteria, memory skills, physical ability and

mathematical ability, among the boys group the UKG boys performance was fairly good in all

the activities with an average of 87.5% whereas LKG boys’ performance was low compared to

PKG boys with a percentage of 78.5% and 80.25% respectively. Among the girls, the UKG

girls excelled in all the tasks with an average of 95.83% whereas LKG girls performance was

low than that of PKG girls sharing a percentage of 78.565% and 85.95% respectively.

The performance level for various activities conducted for all the age group of boys, was found

that mathematical ability showed a good performance level of 90.5%, whereas physical activity

showed a low performance of 70%. Similarly, among the girls for all the age groups, they

performed very well in mathematical ability i.e. 96.82% where as their performance in memory

game was moderate with 80.97%.

Further the overall performance level of boys and girls were analyzed and found that the overall

percentage of boys was 82.09% and that of girls was 83.66%. The statistical application,

ANOVA one way classification was used to find out the variance between the means and

weather two population means and variance are significant or not. The P value is larger for both

boys (0.265) and girls (0.722) than the α level (0.05), the f value for boys is 1.95 and girls is

0.464 which is smaller than the f critical value (6.519). Hence indicating that the means of all

the results are significant, hence the null hypothesis is accepted.

34

TABLE NO 1: Analysis of ANOVA and F value for boys

Source of

Variation

SS

Between

Groups 473.7826

Within

Groups 326.2233

Total 800.0059

0%

100%

PE

RC

EN

TA

GE

AGE GROUP ACCORDING TO CLASS

Fig No 1 :Boys Performance in

0%

20%

40%

60%

80%

100%

PKG

PE

RC

EN

TA

GE


FIG No 2 : Girls Performance In

nalysis of ANOVA and F value for boys

df MS F P-value

473.7826 3 157.9275 1.9364352 0.26548

326.2233 4 81.55581

800.0059 7

PKG LKG UKG



Different Activities

MATHEMATICAL ABILITY

PHYSICAL ABILITY

MEMORY

IDENTIFICATION

CRITERIA

PKG LKG UKG


FIG No 2 : Girls Performance In

Different Activities


PHYSICAL ABILITY

MEMORY

IDENTIFICATION

CRITERIA

value F crit

0.26548 6.591382



PHYSICAL ABILITY

IDENTIFICATION

CRITERIA


PHYSICAL ABILITY

IDENTIFICATION

CRITERIA

35

TABLE No 02:Analysis of ANOVA and F value for girls Source of

Variation SS df MS F P-value F crit

Between

Groups 318.2359 3 106.0786 0.464038 0.7228476

6.5913

821

Within

Groups 914.3963 4 228.5991

Total 1232.632 7

References:

• Abby Akkerman.2014. Benefits of Movement in a Montessori Classroom on Children’s

Behaviour and Focus, 5-27.

• Angeline S.Lillard.2013. Playful Learning and Montessori Education, The NAMTA journal

volume 35, No 2, 158-164.

• Ashish Singh, Sarthak Gaurav.2013. Television exposure and academic skills of children:

new findings from India, Journal of communication technology and human behaviors, 1-24.

• Christopher Lopata, Nancy Wallace and Kristin Finn.2005. Comparison of Academic

Achievement between Montessori and Traditional Education Programs, Journal of research

in childhood education volume 20, Issue 1, 5-13

• Chole Marshall.2017. Montessori education: a review of evidence based on science of

learning, 2-4.

36

Current research paper was published in Journal of Entomology and Zoology Studies February

2019; 7(2): 895-897

Phylogenetic Analysis of Cox I Gene in Identification of Spiders 1Jalajakshi.S 2Usha.R.N

1Assistant Professor Genetics Department,Vijaya College,Basavanagudi, [email protected]

2Assistant Professor, Biotech Department, Mother Teresa Women’s University [email protected]

Abstract:

Morphological diversity refers to diversity of species at the genetic or molecular level. In order

to study the diversity at the genetic level the taxonomic method DNA barcoding is used. The cox

gene has a frequency of faster mutation rate and are highly conserved among the species hence

Mt-Cox I sequence was used for the practical method of species identification.In the present

study, the most dominant female spiders collectedwereArgiopeaemula, Nesticodesrufipes,

Oxyopeslineatype, Laucaugedecorata, Nephilakuchlii, and Nephilaphilipis. These spiders were

preserved in 70% ethanol and DNA was extracted. The amplification of the gene and PCR

analysis was done by treating forward and reverse primers. The phylogenetic analysis revealed

the relationship between molecular and morphological taxonomy.The six species with different

families have raised from a common ancestor.At each branch point lies the most recent common

ancestor of all the groups descended from that branch point. The four descendentsN.rufipes,

N.kuchli, N.philipis and O. lineatyperaised from one common ancestor, but O.lineatype emerged

as an out group species from the others. Argiopeaemula and Laucaugedecorataraised from the

other common ancestor, indicating the homology sharing.

Keywords:Biodiversity, Spider species Mt-CoxI, BLASTSequence, Morphological

taxonomy,Phylogenetic analysis.

Introduction: S

Spiders belonging to the order Araneae of class Arachnida are the most abundantand potential

generalist predator of insect pests [6]

. As for as biodiversity of spiders are concerned there is a

significant record of the wide variety of species in world, India and also in Karnataka. In the

present life scienceworld, the word biodiversity is taking avarious meaning. Basically,it refers to

varieties of life forms present on the earth. It is often defined as the totality of genes, species and

ecosystem of a region. Biodiversity is not distributed evenly on earth and is richest in the tropics.

Some of the traditional types of biological diversity methods used are taxonomic diversity,

ecological diversity, morphological diversity and functional diversity. Morphological diversity

refers to the diversity at the genetic or molecular level. In order to study the diversity at the

genetic level the taxonomic method DNA barcoding is used.It uses a designated portion of a

specific gene or genes to identify an organism to species[4]

. The most commonly used barcode

37


2019; 7(2): 895-897

region for animals and some protists is found in mitochondrial DNA(Mt-DNA)i.e. a portion of

the cytochrome oxidase I (Mt-COX I) gene. The DNA barcoding represents a promising

approach to resolve the taxonomic impediment of difficulties in species identification[7].The

present study aims at, recording the most dominant species from the study area. The female

spiders were selected to study the morphological diversity, as they exhibit the sexual size

dimorphism. The MT-Cox sequence from different families of spiders were used as the

molecular source in order to draw the phylogenetic relationship among the selected species.

Materials and Methods:

Spiders were collected from the surroundings ofTurahalli forest 8km off from the Banashankari

temple of South Bangalore. The total area of the forest is 590 acres, with 888 mt elevation. The

coordinates are 12,88168310 N, 77.5249823

0 E. The collection was done by a visual encounter

method and hand collection method. Female spiders were collected, and preserved in 70%

ethanol for further usage.

DNA extraction and PCR analysis

100mg of spider tissue was weighed and frozen in dry ice and the thugh was added with 200 µl

of cTAB homogenize 0.5ml cTAB wasvortexed vigorously and incubated at 60°C for 1h.To the

lysate, 0.5 ml of phenol - chloroform, Iso-amylalcohol was added and mixed for 2-3 minutes. It

was centrifuged at 10000rpm for 15 min at 4oC.The upper aqueous layer was taken in a new

tube, to which double the volume ofcold 100% ethanol was added and 3M sodium acetate was

added and was incubated for1h at 4⁰C, Centrifuged at 10000 rpm for 15 min. The

supernatant,was removed and DNA pellet was washed in 70% ethanol and centrifuged at 5000

rpm for 10 minutes.Again,the supernatant was removed, the DNA pellet was air dried and was

finally dissolved in TE buffer.The PCR mixture (final volume of 20 µL) contained 2 µL of DNA,

10 µL of Red Taq Master Mix 2x (Amplicon) and 1µM of each complementary primer specific

forward and reverse. The samples were denatured at 94oC for 5 minutes, and amplified using 40

cycles of 94oC for 30 seconds, 44

oC for 30 seconds, and 72

oC for 1 minute followed by a final

elongation at 72oC for 10 minutes. The optimal numbers of cycles have been selected for

amplification of the gene.Primers used for Cox gene

38


2019; 7(2): 895-897

Lco1490FPGGTCAACAAATCATAAAGATATTGG

hco2198RPTAAACTTCAGGGTGACCAAAAAATCA(710bp amplicon size)

The PCR product was sequenced using the LCO F primers. Sequencing reactions were

performed using an ABI PRISM® BigDyeTM Terminator Cycle Sequencing Kits with

AmpliTaq®DNApolymerase (FS enzyme) (Applied Biosystems). The samples were re

suspended in distilled water and subjected to electrophoresis in an ABI 3730xl sequencer

(Applied Bio systems).

Results and Discussion:

In the present study the most dominant female spiders collected from the study areawere,

Argiopeaemula, Nesticodesrufipes, Oxyopeslineatypes, Leucaugedecorata, Nephilakuchlii, and

Nephilapilipes.The Mt- COX I gene was sequenced and was used for the practical method of

species identification.. This method also involved in finding the evolutionary relationship which

yields the highest probability of evolving the observed data [3]

.At each branch point lies the most

recent common ancestor of all the groups descended from that branch point. The two species

Leucaugedecorataand Argiopeaemularaised from one common branch point. Leucaugedecorata

belongs to tetragnathidae family is commonly called as long jawed orb weaver or decorative

silver orb spider. The body shape and leg shape has silver black and yellow marking. Studies

have revealed that evolution of web building has been from irregular to more regular webs[1]

.

The web is slanted rather than vertical. TheLeucauge spider rests in the middle of the web with

its underside facing upwards.Argiopeaemulabelongs to Araneidae family exhibits sexual size

dimorphism, where females are greatly larger than males. It shows female gigantism or male

dwarfism.Sexual Size Dimorphism, (SSD) and morphometric analysis of Argiopeanasuja has

Nesticodesrufipes LCO

Nephila kuchli LCO

Nephila pilipes LCO

Oxyopeslineatipes LCO

Leucauge decorate LCO

Argiope aemula LCO

96

55

65

Fig 01: The Maximum Likelihood method of evolutionary relationship among

39


2019; 7(2): 895-897

revealed that the females are four times larger than males in their total body length [ 5]

. The web

pattern of these species is in zig-zag form resembling the letter; hence they are commonly called

as signature spiders. The other four descendantsraised from one common ancestor, but

O.lineatypebelongs to Oxyopidae family is commonly called as jumping spider, golden lynx

spiders, emerged as an out group species from the others..The setae are present on the legs to trap

the predators. This could be the reason for O. lineatypeto arise as an out group.The branch

pointrepresented the most recent common ancestor for orb weavers

Nephilakuchlii,Nephilapilipes, and Nesticodesrufipes.N.rufipes emerged out as an out group

whichbelongs to family Theridiidae and is commonly called as red house spider. It has dark

brown globular abdomen, the front half of a spider and legs are red brown in color. Nesticodes

builds a small tangled web in dark corners of home or under the rims of garden pots.

Extreme sexual size dimorphism species of orb-weaving spiders with large females and small

males is seen in Nephila.[2]

.Nephilakuchlii and NephilaPilipes belongs to family Nephilidae also

has the characteristic feature of exhibiting sexual size dimorphism.Morphologically the legs of

Nephila species has alternating dark and light banding pattern. The web pattern is highly

complex, builds non sticky, fine meshed barrier webs.

References:

1. Coddington J.A(1991) Systematics and evolution of spiders(Araneae).

Annu.Rev.Ecol.Syst.22:565-592

2. Elgar, M. A. 1991. Sexual cannibalism, size dimorphism, and courtship behavior in

orb-weaving spiders (Araneidae) Evolution 45: 444-448.

3. Felsenstein.J, (1981)Evolutionary trees from DNA sequences, a maximum likelihood

approach.journal of molecular Evolution, 17:368-376

4. Hebert,P. D. N., S. Ratnasingham, and J. R. deWaard. (2003b).Barcoding animal life:

cytochrome c oxidase subunit 1 divergence among closely related species.

Proceedings of the Royal Society of London B 270 : S96 – S99

5. Jalajakshi, S. and Vinutha, C (2014). Sexual size dimorphism (SSD) and

Morphometric analysis of Argiopeanasuja(signature spider) of south Bangalore,

Karnataka Vol. 6, Issue, 04, pp.6059-6063,

40

THE EFFECT OF RED LABEL TEA(RLT) ON Drosophila melanogaster

Jalajakshi1, Divyashree

2, MadalaHoneyshree

3, Niveditha B.S

4, Pooja

5

1Assistant Professor, Department Of Genetics, Vijaya College, Basavanagudi, Bangalore

2,3,4,5 UG students, Department Of Genetics, Vijaya College, Basavanagudi, Bangalore

Corresponding Author [email protected]

ABSTRACT

In the current study Brooke Bond Red label Natural Care Tea (RLT) was used to see the

effect on Drosophila melanogaster. In addition to the natural goodness of tea, RLT contains

many Ayurvedic ingredients, which are known to have beneficial effects on immune health.

Drosophila melanogaster belongs to family Drosophilidae. This species is generally known as

the common fruit fly or vinegar fly. These flies were trapped and transferred into the culture

bottle with the rava-jaggery media. The control and treated bottles containing different

concentrations of tea extract 0.01g/ml,0.02g/ml,0.1g/ml were maintained for two generations.

One male and one female fly were transferred to the control and RLT treated bottles. The

second-generation progenies were observed.. As the concentration of tea extract increased

there was significant increase in the viability of eggs, life span and survival rate of the flies

and their ability to move against the gravity. However, supplementing the media with tea

extract significantly increased the fertility of the flies. There was approximately equal

number of male and female progeny flies produced in control whereas in the experimental

bottles the female progenies were more than that of male flies. Hence, there was a significant

effect of tea on Drosophila melanogaster. Since, there is a genomic similarity between

humans and drosophila, we can presume that there might be an effect of tea on humans.

Introduction :

Drosophila melanogaster belongs to the phylum Arthopoda, order Diptera and family

Drosophilidae. The species is known generally as the common fruit fly or vinegar fly[1]

. It is

also known as the “Cinderella of Genetics” hence is used as a model organism right from the

beginning of the 20th

century.At room temperature fruit flies can develop into adults within

one or two weeks. The egg and larval stages span approximately eight days, while the pupal

stage lasts six days. The adult fruit flies lives for several weeks. Twenty four hours after a

female fruit fly lays egg, larvae hatch[2]

. Drosophila females are larger than males, because

females contain eight segments in the abdomen whereas males contain only six [3]

. Male flies

have dark rounded genitalia at the tip of their abdomen, whereas females have light, pointed

genitalia [4]

. The male flies exhibit darkly pigmented dorsal cuticular plates on the fifth and

sixth abdominal segments, whereas female flies display a much reduced pattern of lighter

pigmentation restricted to the dorsal posterior stripe. Males contain sex comb in their foreleg [5]

.Tea is an aromatic beverage, originated in South-West China. Tea may be early in the day

to heighten calm, alertness; it contains L-theanine, theophylline, and bound caffeine. Tea has

properties of both the solution and a suspension. It is a solution of water soluble compounds

that have been extracted from the tea leaves such as polyphenols and amino acids but in a

suspension all the insoluble components are considered such as the cellulose in the tea leaves.

41

Caffeine constitute about 3% of tea’s dry weight. The astringency in tea can be attributed to

the presence of polyphenols. These are the most abundant compounds in tea leaves making

upto 30-40% of their composition. It has been suggested that green and black tea protect

against cancer and other diseases Obesity, Alzheimer disease etc.,[6]

. In our experiment we

have used Brooke Bond Red Label Natural Care Tea, in addition to the natural goodness of

black tea, contains five ayurvedic ingredients and they are ginger, ashwagandha, tulsi,

mulethi, cardamom which are known to have beneficial effects on immune health [7]

.

In Humans regular consumption of tea is a proven fact that it increases the body’s ability to

burn fat as fuel which accounts for improve muscle endurance.(references) thus keeps the

man active and relieves from stress.(references) The current study aims at finding the effect

of tea on life cycle, morphological characters and motile behaviour of Drosophila flies.

MATERIALS AND METHODOLOGY

Distilled water(300ml), rava(30g),agar-agar(3g), yeast powder(3g), propionic acid(2-3 drops)

and red label tea extract(0.01,0.02 and 0.1).

Composition of red label tea powder: Tea leaves, cardamom(1.5%),ginger(1.5%),

mulethi(0.5%), ashwagandha(0.5%), tulsi(0.5%).

Preparation of culture media: Rava and jaggery are boiled in distilled water until a paste is

formed. To that, agar-agar and yeast powder were added. Then the different amount of red

label tea powder (0.5,1.0 and 5.0g) were weighed and soaked in 50ml of distilled water for

15 minutes separately, and was filtered. Thus, the 2ml of the obtained filtrate of different

concentrations were pipetted into the respective sterilized bottles along with rava - jaggery

medium. After cooling propionic acid was added to avoid fungal infection in the medium.

Then the vapours produced by the propionic acid were wiped using cotton buds and the

bottles were cotton plugged.

Fly husbandry: The Drosoplila melanogaster flies were transferred into a culturing bottle

containing a rava-jaggery media and the culture was maintained until the two generations of

these flies were formed. These second-generation flies were then transferred into the bottles

containing different concentrations of red label tea.When the larvae were fed with the

different concentrations of tea powder, the third instar larvae differed in size with different

concentrations of tea extract. The larvae were obsessed as the concentration of the tea extract

decreased. At the lower concentration (0.01g\ml) the larvae were more obsessed than the

higher concentrations (0.02g\ml and 0.1g\ml). As the concentration of the tea extract

increased the larval size gradually reduced.

Results and Observation

Motility of third instar larvae:The time taken by the third instar larvae of different

concentrations were recorded.[9]

The mobility of 3rdinstar larvae was compared in both

control and RLT treated medium. The time taken for the movement of 1cm distance was

recorded. In the normal media, the larvae took 38 seconds to travel where as it took 18.8,

25.5, and 28.8 seconds with 0.01, 0.02, and 0.1 concentration respectively for the

movement. This indicated that as the RLT concentration increased the time taken for its

mobility also increased. (Table No 01, Fig No 01)

42

Fertility assay: Four virgin female and four virgin male flies from the respective holding

bottles (R1,R2,R3 AND CONTROL) groups were recombined into four independent progeny

breeding cages and allowed to mate and age. The flies in these four bottles were maintained

on standard rava-jaggery media and were given fresh food every alternative day. The identity

and purity of these files was strictly observed. On the designated age, eggs were collected on

a laying plate from the respective holding bottles and dispensed into four bottles each, at a

density of twenty five eggs per bottle with 15ml of standard experimental media which

contained different concentrations of red label tea powder extract. All the four bottles were

incubated at room temperature. The number of emerging flies from each of these bottles were

recorded. The sex ratio of the flies were calculated and the result was that, there were more

number of female progenies obtained than male flies.

Vertical climbing assay:

The ability to move against gravity and climb is suggested to indicate the level of physical

fitness of test animals. Vertical climbing ability of the flies that emerged from different

treatment bottles was assessed. Ten flies per treatment group were collected and transferred

to the empty 0 to 15 cm graduated vial. The vial was gently tapped and placed in vertical

position. The number of flies that crossed 10cm mark in 30sec was counted. The data is

expressed as the percentage of flies that crossed the 10cm mark.

Table 1: Motility of third instar larvae

Sl.

No

Concentration of tea

extract(g/ml)

Distance travelled by

3rdinstar-larvae (cm)

Time in

seconds

1 Control 1 38.0

1 0.01 1 18.8

2 0.02 1 25.5

3 0.1 1 28.8

Table 2: Vertical ClimbingAbility

Sl. No Concentration of

tea extract (g/ml)

Distance

travelled

by flies(cm)

Time in

seconds

1 control 5 7.2

2 0.01 5 5

3 0.02 5 5.6

4 0.1 5 5.8

43

Longevity in life span and stages of life cycle The life span and staged of life cycle were compared the result was very significant. The

survival rates of both female and male flies were significantly influenced by tea

supplementation compared to that of flies in control. The life span of flies in control was

around 40 days, but that of the experimental flies were around 45 to 50 days. normally the

formation of egg to third instar-larval stage takes 4days and from larval to pupal stage takes

4days at room temperature 28°C, but the flies grown in the experimental media took

around 6 days for transformation for both egg to larval stage and also from larval to pupal

stage. The age of the flies significantly influenced their fertility.

DISCUSSION

Tea is an aromatic beverage and it is the most consumed beverage in the world after water.

Tea is a product of the plant Camilliasinensi. It has been popularised as an excellent source of

health modulating dietary antioxidant which is rich in flavonoids known as catechins,

epicatechingallate(ECG). Caffeine constitutes about 3% of tea’s dry weight. The astringency

in tea can be attributed to the presence of polyphenols. These are the most abundant

compounds in tea leaves, making up 30-40% of their composition. The flavoured and scented

teas add new aromas and flours to the base tea. This can be accomplished through directly

adding flavouring agents such as ginger or dried ginger, cloves, mint leaves, elaichi, tulsi,

ashwagandha, mulethi and cardamom.Tea may be consumed early in the day to heighten

calm and alertness. Life span-the time lag between birth and death of an organism is an

important evolutionary adaptation (Carey 2003). Several studies in the past have successfully

enhanced the life span of model organism by dietary supplementation with reactive oxygen

species (ROS)- scavenging substances (Howitz et al.2003;wood et al 2004). However in lost

diet manipulation studies (Chippinadale et al. 1993; chapman and partridge 1996; Tu and

Tatar 2003) corelated response to increase longevity has been the reduced fecundity. Any

manipulation that reduces fecundity is going to affect the fitness of the organism. Further, the

current lifestyle changes demand that we identify and evaluate molecules that could

potentially increase reproductive health span. In the present study the tea supplementation of

D.melanogaster significantly increased the life span.[8]

REFERENCES:

1. Composition of brooke bond red label natural tea K.T.Chandrashekara, Sonampopli,

M.N.Shakarad (2014) Curcumin enhances parental reproductive life span and progeny

viability in Drosophila melanogaster American aging association; 36:9702.

2. K.T.Chandrashekara, Sonampopli, M.N.Shakarad (2014) Curcumin enhances

parental reproductive life span and progeny viability in Drosophila melanogaster

American aging association; 36:9702.

3. Terry Lopez, Samuel E. Schriner, [….], and MahtabJafri. 2014 Dec 1; Green Tea

polyphenols extend the lifespan of male Drosophila melanogaster while impairing

reproductive fitness.doi: 10.1089\jmf.2013.0190; 17(12):1314-1321.

44

STUDY OF NATURAL RESISTANCE AND PHYTOREMIDIATION OF HEAVY METALS [Pb, Cd, Ni] IN

INDIAN NATIVE PLANTS (Ricinuscommunis, Brassicajuneca)

Priyadarshini P A1, Jyothi R Kumar2, R Harshitha3, Amrutha D 4, R Mamtha5, AmrinFathima6, ShaziaFathima7, Bindu T R 8.

1,2Assistant Professor and 3,4,5,6,7,8(UG Students)

Department of Genetics and Biochemistry, Vijaya College, R V Road, Basavanagudi, Bengaluru – 560 004, India

ABSTRACT

Heavy metals are the most important contaminants in the soil. Several methods are used to remove the heavy metals from the soil but using

plants is easier and cost effective. Removal of heavy metals from the environment using plants is called phytoremediation. Accumulation of

metals in the soil causes adverse effects, therefore removal of these metals is very important. In the present study, we have used Indian

nativeCastor and Mustard plants for the removal of heavy metals from the soil. The Heavy metals (Pb, Cd, Ni) of known concentration were

added to the soil in laboratory and the seeds of the two plants were sowed and was grown for three months. After three months when the soil

was analyzed there was a decrease in the concentration of heavy metals in the soil of both the plants.

KEY WORD -Phytoremediation, Indian native castor and mustard plants, lead nitrate, cadmium sulphate, nickel sulphate.

INTRODUCTION

In today’s world there is a huge discussion on measures taken towards environmental pollution. Undoubtedly industrialization and

urbanization became a huge boon to human race, but it has also caused many negative results like pollution. Pollution is not only causing

harmful effects to the organisms living in this world but it has also lead to global warmingand is also leading to genetic disorders and

diseases in human.

Soil pollution is manly caused due to adverse effect of pesticides, insecticides,fungicides etc which are used in agricultural land

field.Chemical or heavy metal contamination in soil is mainly caused by industrial effluents which are untreated. Soil pollution can also lead

to ground water pollution, because rain water gets absorbed in these contaminated sites and takes away the toxics present in the upper

surface of soil. Sites contaminated with high level toxic chemicals are not suitable for cultivation of edible crops.

Bioremediation deals with usage of living organismsfor cleaning up of contaminated soil and water. ‘REMEDIATE’ means to solve the

problem and ‘bioremediate’ means to solve an environmental problem with the help of plants and microorganisms.

HEAVYMETAL -It is a dense metal or metalloid that is noted as potentially toxic to environment as well as living organisms.

Heavy metals are naturally found on earth they become toxic/harmful when they get concentrated beyond the safe limit due to human

activities.

The plants which are natural and genetically resistant are taken for phytoremediation of soil contaminated by heavy metals. It is seen

thatCastor (Ricinuscommunis)and Mustard (Brassicajuneca) growwildly and so must be naturally resistant to soil pollutants. These two

plants are annual plants i.e. it grows throughout the year.

Castor(Ricinuscommunis) have a diploid chromosome number(2n=20). It reproduces with a mixed type of pollination. It can reach up to the

height of 6-15 meters.It produces large leaves with 8 lobes and pointed tips. Castor seeds are used to produce castor oil and the leaves are

used to feed Silk worms.

Mustard (Brassicajuneca) havedifferent origins. Both are considered to be natural amphidiploids (AABB genome,2n=36) of B. rappa (AA

2n =20) B. nigar (BB 2n=16) crosses, it has chromosomal number 2n=18. It is a perennial herb. It grows up to 1meter or more it has 1-2

lobes and leaflets, seed germination within 5 days, grow rapidly and leaves are harvestable after 3 weeks. It is self- fertile, fruits develop

rapidly and are ready for harvesting within 4 weeks from flowering. (MeghaKaushik ,2015, BrassicaJuneca, Biotech article)

MATERIALS AND METHODS

Heavy metals - lead nitrate, cadmium sulphate, nickel sulphate has been selected for the present study,Castor plants and Mustardplants were

the plants selected.1g of lead nitrate,1g of cadmium sulphate and 1g of nickel sulphate were dissolved in 100 ml distilled waterthis was

divided into 2 equal parts. One part was added to pot 1 containing 500g of soil in which mustard seeds were sown. Second part was added to

pot 1 containing 500 g of soil in which castor seed were sown. Similarly, the above procedure was followed for 0.5 g and 0.25g of heavy

metal compounds. 150-200 ml of water was poured every day for the growth of the plant.

REAGENTS USED FOR THE ANALYSIS OF HEAVY METALS IN SOIL:

DTPA (diethylenetriaminepentacetate)Extractant: 0.005 M calcium chloride and 0.1 M Tri ethanol amine (TEA) with pH 7.3. Dissolve

149.2 g of reagent grade TEA, 19.67g DTPA in approximately 200 ml distilled water. Dilute to about 9L and adjust the pH to 7.3 using

dilute HCl or NaOH and make up to 10L.

45

STANDARD SOLUTION OF MICRONUTRIENT CATIONS:

All standards should be made from National institute of standards and technology (NIST) traceable Atomic absorption spectroscopy (AAS)

grade primary standards.

For about 10 g of soil taken, DTPA extractantwere added and was shaken for 2 hours in horizontal shaker. Later the suspension was

filteredthrough what man No.40 filter paper. Later the sample was analysed with the instrument having an appropriate hallow cathode lamp

and readings were recorded.

RESULT

In the present study, heavy metals of the range 1 ,0.5,0.25 grams were added to the soil, the castor seeds and mustard seeds where planted in

each of these three concentrations.After 6 weeks castor plant in the pot containing 1 g of heavy metals dried and the plants in all the other

pots continued to grow.After three months,the plants were uprooted and the soil and the whole plants were analysed for heavy metals.

Analysis of different concentration of heavy metals in soil in which Mustardplants were grown (after 3 months)

The concentration of heavy metals.ie lead, cadmium and nickel in the soil is as given below.

TABLE- 1

LEAD CADMIUM NICKEL

MUSTARD PLANT

(1g)in Pot 1

0.124 0.0074 0.023

MUSTARD PLANT (0.5

g) in pot 2

0.100 0.0075 0.0184

MUSTARD PLANT

(0.25g) in pot 3

0.073 0.0072 0.01612

Mustard plant grown in Pot 1(soil containing 1 gram of lead, cadmium, nickelcompounds) showed drastic reduction in the concentration

after 3 months with 0.124 g,0.0074 g ,0.023g respectively.

Mustard plant grown in Pot 2 (soil containing 0.5 g of lead, cadmium, nickelcompounds) showed drastic reduction in concentration after 3

months with 0.100 g ,0.0075 g ,0.0184 g respectively.

Mustard plant grownin Pot3 (soil containing 0.25 g of lead, cadmium, nickel compounds)showed drastic reduction in concentration after 3

months with 0.073g,0.0072g,0.01612grespectively.

CASTOR

PLANT [1g]

CASTRO

PLANT [0.5g]

CASTRO

PLANT [0.25g]

LEAD [g] 0.129 0.108 0.073

CADMIUM [g] 0.0078 0.0073 0.0072

NICKEL[g] 0.0224 0.0205 0.0161

CO

NC

OF

HE

AY

V M

ET

AL

S I

N G

RA

MS

CASTOR PLANT

ANALYSIS OF HEAVY METALS IN SOIL OF CASTOR PLANT

46

GRAPH 1- ANALYSIS OF HEAVY METALS IN SOIL OF CASTOR PLANT GROWN AFTER 3 MONTHS

Analysis of different concentration of heavy metal inwhole castorplant andmustard plantAfter 3 months

The concentrations of heavy metals i.e. Lead, cadmium, nickel in the plant is as given below.

TABLE -2

LEAD(g) CADMIUM(g) NICKEL(g)

MUSTARDPLANT (CONTROL) 0.01965 0.01315 0.02275

MUSTAD PLANT (1 g) 0.04655 .1175 0.0283

MUSTARD PLANT(0.5g) 0.04001 .11895 0.02515

MUSATRD PLANT (0.25g) .0224 .0839 .0168

CASTOR PLANT (CONTROL) .0178 .00925 0.01305

CASTORPLANT (0.5g) 0.02435 .02605 0.0101

CASTOR PLANT((0.25g) 0.0686 .07195 0.0361

GRAPH 5: ANALYSIS OF HEAVY METAL COCENTRATION IN WHOLE CASTOR PLANT AND MUSTARD PLANT AFTER 3

MONTHS.

CASTOR PLANT (1g)

CASTOR PLANT (0.5 g)

CASTOR PLANT (0.25g)

LEAD 0.129 0.108 0.073

CADMIUM 0.0078 0.0073 0.0072

NICKEL 0.02242 0.0205 0.01612

0.129

0.108

0.073

0.0078 0.0073 0.0072

0.02242 0.02050.01612

0

0.02

0.04

0.06

0.08

0.1

0.12

0.14C

ON

CE

NT

RA

TIO

N O

F H

EA

VY

ME

TA

LS

CASTOR PLANT

MUSTAR

D PLANT

(CONTRO

L)

MUSTAR

D PLANT

(1g)

MUSTAR

D PLANT

(0.5g)

MUSTAR

D PLANT

(0.25g)

CASTOR

PLANT

(CONTRO

L)

CASTOR

PLANT

(0.5g)

CASTOR

PLANT

(0.25g)

LEAD (g) 0.0196 0.0465 0.04 0.0224 0.0178 0.00243 0.0686

CADMIUM (g) 0.01315 0.1175 0.11895 0.0839 0.00925 0.02605 0.0719

NICKEL (g) 0.02275 0.0283 0.02515 0.0168 0.01305 0.0101 0.0361

0

0.02

0.04

0.06

0.08

0.1

0.12

0.14

CO

NC

EN

TR

AT

ION

OF

HE

AV

Y M

ET

AL

S

MUSTARD AND CASTOR PLANT

ANALYSIS OF HEAVY METAL CONCENTRATION IN WHOLE CASTOR PLANT

AND MUSTARD PLANT

47

Thus, from the above results obtained we can interpret that when compared to mustard and castorplant, both plants more or less equally

accumulate the heavy metals in them and thus helps in removal of toxic metals from contaminated soil

CONCLUSION

Based on our work we can conclude that Indian native plants (castor and mustard) absorb Heavy metals lead, nickel, and cadmium from the

soil. These plants may be grown in contaminated sites which helps inthe removal of these heavy metal from soil.

REFERENCE

1. BiebyVoijantTangahu, etal (2011) “A review on heavy metals (As, Pb, Hg) uptake by plants through phytoremediation”. International

Journal of Chemical Engineering. Vol2011: 1-2p

2. De Vos H R; Ernst W H O (1991). “Increasedresistance to copper induced damage of root cell plasmalemma in copper tolerant

Silenecucubalus”. Physio logiaplantarum 82:523-52.

3. Hutchinson, T C, Whitby, L M (1974). “Heavy metal population in Sudbury mining and smelting region in Canada, soil and vegetable

contamination by nickel, copper and other metals”. Environmental conservation 1: 123-132

4. KorkmazBellitruk, etal (2015). “The importance of phytoremediation of heavy metal contamination soil using vermicompost for

sustainable agriculture”. OMICS International.

5. Koeppe, D E (1981). “Lead: understanding the minimal toxicity of lead in plants .in effect of heavy metal pollution on plants”. Vol1

:55p.

6. MeghaKaushik (2015). “BrassicaJuncea(Indianmustard)-characteristics and uses”

Biotech Article.

NOTE: The complete research article is published in the following:

GLOBAL JOURNAL FOR RESEARCH ANALYSIS VOLUME-8, ISSUE-5, MAY-2019 • PRINT ISSN No. 2277 - 8160

48

DETERMINATION OF PIPERINE CONTENT IN PEPPER BY USING

DIFFERENT ORGANIC SOLVENTS: THROUGH HPLC

Priyadarshini.P.A1, Niveditha.B.S

2 , Pooja

3, Madala Honeyshree

4

1Asst.Professor, Department of Genetics, Vijaya College R.V. Road, Basavanagudi B’lore-560 004

2,3,4(UG students), Department of genetics, Vijaya College R.V. Road, Basavanagudi B’lore-560 004

ABSTRACT

Chromatography can be described as a mass transfer process involving adsorption using a

nonpolar stationary phase and a mobile polar phase titrating through the column. The active

component of the column, the sorbent or the stationary phase , is typically a granular material

made of solid particles (e.g. silica, polymers, etc.,). The component of the sample mixture are

separated from each other by means of mobile phase and different degrees of interaction with

the sorbent particles based on their relative polarity. In the present study we have extracted

piperine from grounded pepper using different chemicals such as petroleum ether, acetone

and methanol. Petroleum ether extraction showed higher piperine content of 9.12% than

methanol and acetone 3.15% and 3.37% respectively.

KEY WORDS: stationary phase, mobile phase, piperine, petroleum ether, acetone and methanol.

INTRODUCTION

High performance liquid chromatography is a chromatographic technique used to separate a

mixture of components in a analytical chemistry and biochemistry with the purpose of

identifying, quatifying or purifying the individual components of the mixture before the

invention of HPLC Chemists had chromatography at their disposal, and column

chromatography was time consuming.

To speed up a classic column chromatography, chemists would have to use a short column

for separation, however this lead to poor separation of molecular components held within

solution. The basic setup of a classic column chromatography would include the column that

varied in internal diameter from 10nm to 50nm and column lengths of 50-500cm. The

column was then packed with the stationary phase ranging particle size from 150-200mm

thick. Chemists, wanting to speed the separation process up, first experimented with the

introduction of a vacuum source or a high pressure source. However, they found with the

increased negative or positive pressure, the column length would have to be increase linearly

in order to acquire a valid separation that could be used for analytical data with a confidence

level .Chemists realized that with the development of pressurized systems, reducing the

particle size would increase the efficiency. It was not until the late 60s that chemists and

industrial engineering process acquired adequate technology and manufacturing techniques to

develop a smaller grained stationary phase that would be cohesive with a pressurized system.

Today, HPLC has many uses including medical, legal, research (e.g. separating the

components of a complex biological sample, or of similar synthetic chemicals from each

other).

Black pepper belongs to the family piperaceae. It is cultivated for its fruit which is usually

dried and used as spice. It was discovered in 1819 by Hans Christian Orsted, who isolated it

from the fruits of Piper nigrum, the source plant of both the black and white pepper grains.

Anderson first hydrolysed piperine by alkalis into a base and an acid, which were later named

piperidine and piperic acid respectively. The alkaloid was first synthesized by the action of

piperoyl chlorid on piperidine. The pungency of piperine is caused by activation of the heat

49

and acidity sensing TRPV ion channel TRPV1 and TRPA1 on pain sensing nerve cells .The

full mechanism of piperines bio-availability-enhancing abilities is unknown but it has been

found to inhibit human CYP3A4 and para-glycoprotein, enzymes important for the

metabolism and transport of xenobiotics and metabolites. In animal studies, piperine also

inhibited other CYP450 enzymes important for drug metabolism . Piperine has been shown to

dramatically increase the bioavilability of curcumin in humans.

MATERIALS AND METHODS

Standard solution and different solvent extract for methanol, acetone and petroleum ether

were prepared using standard chromatographic conditions for all the solvents

A. PREPARATION OF STANDARD SOLUTION : Accurately weighed about 20mg of

standard in 50ml of volumetric flask. To this 30ml of methanol was added and sonicated for

about 5 to 10minutes, allowed it to cool under room temperature, made up with the same

solvent and mixed it thoroughly. Then transferred 1ml of resulting solution into a 10ml

volumetric flask with mobile phase and mix it thoroughly. Later it was filtered using 0.45µm

nylon membrane and the filtrate was collected in a HPLC vial and was loaded for injection. B. STANDARD CHROMATOGRAPHIC CONDITIONS:

Column Venusil XBP C18(l) 5µg, 150A˚

Detector UV-visible

Wave length 342nm

Flow rate 1.0ml/min

Mobile phase solvent: Water(70:30)

Injection volume 20µl

Column temperature 30˚C

C. SAMPLE PREPARATION FROM METHANOL: Weighed accurately about 375mg

to 425mg of pepper powder to 50ml flask, 25ml methanol was added and sonicated for 15

min, then it was made up with the same solvent . Later 1ml from this solution was added to

25ml flask, diluted with diluents (methanol : water, 70:30) filtered then followed by injection.

D. SAMPLE PREPARATION FROM ACETONE : Piperine was extracted from pepper

using acetone. Therefore, approx. 6g grounded black pepper was exactly weighed in a

suitable flask and 50ml acetone were added followed by 30 min ultrasonic bath at 60˚C. After

a total extraction time at 6O˚C of about 120minutes, the powder was sedimented and the

supernatant was collected. While caring that no precipitation occurs in the sample 600µl

water were added per 1ml extract. After filteration through a 0.45µm filter, the solution was

ready for injection to the HPLC system respectively the purification via preparative HPLC.

E. SAMPLE PREPARATION FROM PETROLEUM ETHER: 5g of pepper powder was

extracted by soxhlet method at 90˚C using petroleum ether(40˚C to 60˚C) for about

2hours.Then it is filtered and distilled under reduced pressure. After, the preparation of

petroleum ether extract, the sample was again extracted using methanol at 90˚C for about an

1hour.Then it is centrifuged, sonicated for about 1hour and filtered through 0.45µm nylon

membrane .The filtrate was collected in a HPLC vial and was loaded for injection.

50

F. CALCULATION OF RETENTION TIME AND AREA USING STANDARD

DEVIATION AND RELATIVE STANDARD TO FIND OUT PIPRINE CONTENT .

i. Calculation For Stanadard Deviation:

SD =√∑(X-x)²/(n-1) where X is average retention time, x is trial retention time and n is number of

trials.

ii.Calculation For Relative Standard:

RSD% = SD/AVG*100 where SD is standard deviation, AVG is average retention time.

iii.Calculation of Piperine Content (%):

Piperine content=A2A1 × W1V1 × V2W2 × P100 × (100-LOD1)(100-LOD2) ×100=…….. %

Piperine content= sample area/standard area*standard weight/dilution*dilution/sample weight*purity

of standard/100

DISCUSSION

Jansz et al (1983) method of determination of piperine in Sri Lanka pepper provides a bank

of data illustrating high levels of piperine in Sri Lanka pepper- generally in the range of 7-

15% as against 2-7% of the commercial Indian, Malaysian and other varieties by direct uv

method. This paper introduces a new technique of piperine assay based on TLC-UV

densitometry which produces nearly identical results to the already known TLC-UV

spectrophotometric method.

Compared to Jansz et al(1983) method the piperine percentage obtained was more through

petroleum ether method than that of the other solvents such as methanol, acetone by HPLC.

REFERENCES

1. Jansz.E R, Pathirana.I.C and Packiyasothy.E.V(1983) Determination of piperine in

pepper.In J.Natn.Sci.Coun.Sri Lanka 11(1)

2. Saha.K.C, Seal.H.P and Noor.M.A(2013) Isolation and characterisation of piperine from

the fruits of black pepper. In J.Bangladesh Agril.Univ.11(1)

3. Shingate.P.N, Dongre.P.P and Kannur.D.M(2017) New method development of

extraction and isolation of piperine from black pepper. In International journal of

Pharmaceutical Sciences and Research .

4. Padalkar.K.V and Gaikar.V.G(2008) Extraction of piperine from black pepper by

aqueous solutions of surfactant, hydrotrope mixtures. In separation sciences and

technology journal. NOTE: Complete research article is published in the following journal:

INTERNATIONAL JOURNAL OF SCIENTIFIC RESEARCH Volume-8 | Issue-6 | June-2019 | PRINT ISSN

No. 2277 - 8179

51

Survey on Effect of Menstrual problems Among Females of

Bengaluru population: An approach for well-being of females.

Priyadarshini P A1, Girija A Yalagi

2, Nethra V

3, Prakruthi S

4, Prathiksha Y

5, Tejas M

6, VigneshV

7

1Assistant Professer and

2,3,4,5,6,7(UG Students)

Department of Genetics, Vijaya College, R V Road,Basavanagudi, Bengaluru–560 004, India

Abstract

Menstrual problems are the major gynaecological problems which occur frequently in

majority of female. Menstrual problems affect the physiology, psychology and well-being of

a female. By knowing what type of symptoms and when to expect symptoms, help female to

schedule her activities. The problems may be due to heredity or hormonal imbalance.

A study was conducted with 125 females of in and around Bengaluru, within the age group of

12-35 years, to understandbetter about the common menstrual problems faced by female

during their menstrual period. The survey identified about menstruation, and limited options

for alleviating their menstrual discomfort. The survey revealed that choice of products used to

manage menstruation (either cloth or disposable pad) is mostly influenced by cost factors,

comfort and habit as well as cultural restrictions. Females are largely not aware of the

environmental impact.

Keywords

Gynaecological problems, Menstrual problem, Heredity, Hormonal imbalance,Environmental

impact

Introduction

In a life cycle, a women’s body is vulnerable to a variety of changes. The cycle of these

changes in women every month, positively in pregnancy is called menstrual cycle. When an

ovum is unfertilized the uterus lining sheds and leads to hemorrhage, calledmenstruation. In a

girl, menstruation starts from the age of 10-16 when she attains puberty and this beginning is

known menarche. The ending of menstruation is known as menopause which takes place at

the age range of 50.The first day of bleeding is marked as the first day of menstrual cycle and

period from one menstrual cycle to another can vary from 28 to 30 days.

Before discussing the different phases of menstrual cycle, it is important to have a glimpse of

female reproductive system and organs involved in the cycle. They mainly include:

1. A pair of ovaries which stores nourishes and releases ova.

2. Uterus (womb) where implantation of a fertilized egg takes place and the fetus develops.

3. Pair of the fallopian tube connecting the ovaries and uterus

The count of the ovum in each ovary is decided and fixed before the birth of the girl. As

she reaches puberty,hormones stimulate the development and release of one ovum each

month. This continues till menopause.The menstrual cycle is divided into four phases

namely:

1. Menstrual phase

2. Follicular phase

3. Ovulatory phase

4. Luteal phase

52

The three stages of the menstrual cycle are described below:

• DAY 1-5 MENSTRAUL PHASE

• DAY 6-14 PROLIFERATIVE PHASE

• DAY 15-28 SECRETORY PHASE

Menstruation is the physiologic shedding of endometrium. It is also called menstrual bleeding

or menses, periods or catamenia. Follicular phase, also called proliferative phase during

which the ovarian follicles are stimulated to mature. The matured follicle is called Graafian

follicle, which undergoes changes to form ovum. Ovulation is a process in which the ovum is

released from the ovary. Luteal phase is also called secretary phase, during which the corpus

luteum is formed. It secrets several hormones. Menstruation is a slave to certain hormones.

Every phase of the menstrual cycle is influenced by a female hormone namely estrogen,

progesterone, FSH and LH. Menstrual problems affect physiology, psychology and well-

being of women.The problems may be due to heredity or hormonal imbalance.According to

the abnormality of the menstrual cycle they are classified as:

Menorrhagia, Metrorrhagia, Menometrorrhagia, Oligomenorrhea, Dysmenorrhea,

Amenorrhea, Euromenorrhea.

In 2000, Demieret.al performed a study on dysfunctional uterine bleeding and other

menstrual problems of secondary school students in Adana, Turkey. Age at menarche and

menstrual problems were studied. Dysmenorrhea was experienced by 38.7% of the girls and

41% uses pain killers during menstruation, half of them used the drugs on consultation with

their family members, while other half had taken self-medications. Most of the students

discussed their menstrual problems with their mothers.

In 2001, Warner et.al made a cross sectional survey of symptoms, reasons for referral and

management of menstrual problems. Most of the individuals visited the clinics mainly due to

menstrual loss. Some have undergone hysterectomy due to heavy bleeding.

In 2003, Sharma and Gupta performed a survey on menstrual pattern and abnormalities in

high school girls of Dharan. Majority had spasmodic dysmenorrhea, among which only 20%

experiences disturbances in their daily activities. The majority of students are ignorant about

abnormal menstruation.

In 2004, Demerathet.al studied recent decline in age at menarche. They found that the decline

in age at menarche is due to increased Body Mass Index (BMI) during childhood or

adolescence.

In 2006, Lee et.al did a cross-sectional analysis of menstruation among adolescent school

girls in Malaysia, in which 75% of individual’s experiences premenstrual syndrome and 69%

showed dysmenorrhea.

Material and Methods

A survey was carried out to study various menstrual problems experienced by the girls and

women with the age group between 12–35 years. A questionnaire was designed and their

details were collected.

53

Table.1: Data

Graph.1: Analysis of

0

20

40

60

80

100

120

Data analysis of Menstrual cycle in Females

Data analysis of menstrual cycle in femalesMenstrual

period

If Irregular Twice

amonth

6

Days between

two successive

periods

Periods of

menses

1 day

Bleeding

Spotting between

periods

Pain during

menstrual

periods

Stomach pain

Food

Data Analysis

.1: Data analysis of menstrual cycle in females.

Graph.1: Analysis of menstrual cycle in females.


Data analysis of menstrual cycle in femalesRegular Irregular

98 27

Twice

in

amonth

Once

in three

months

Once

in six

moths

Once in

nine

moths

6 18 1 2

More than 28 days Less than 28 days

101 24

1 day 1-3 days 5 days

0 26 67

Light Medium Heavy

3 102 19

Yes No Sometimes

8 101

Yes No Sometimes

76 19

Intense Moderate Sometimes

28 28

Vegetarian Non-Vegetarian

40 85


Data analysis of menstrual cycle in females

Irregular

Once in

Once in a

year

0

Less than 28 days

7 days

32

Spotting

1

Sometimes

16

Sometimes

32

Sometimes

69

Vegetarian

54

Results

A total of 125 members were interviewed randomly in and around the area of Kanakapura

village and other places. Among the respondents about 98% of women belong to the age

group of 15–35 years.

The age of menarche of these women was studied of which their first menses at the age of 14

and some female’s menarche at 16 year and above. The prevalence of irregular

menstrual period was too low i.e. 21.6% of which about 22.2% women experiences menstrual

periods twice in a month, 66.6% have their menses once in 3 months, 3.7% have their menses

once in six months and 7.4% have their menses once in nine months. About 78.4% of females

have regular menstrual period.

About 80.8% of females have the menstrual cycle of more than 28 days. Whereas only19.2%

of females experiences less than 28 days of menstrual cycle.The period of menses in majority

of the respondents with the period length of 5 days. Only 53.6% have bleeding more than 5

days.The female’s food habit also plays a vital role in menstrual cycle. Among 125 females

32% of female are pure vegetarian and 68% are non-vegetarian.

The bleeding range is also medium in majority of the respondents 81.6%. The light bleeding

is about 2.4%and heavy bleeding is 15.2%.The spotting between periods was experienced by

6.4% of females while 12.8% of the females experienced spotting sometimes and 80.8%of

them did not experience spotting at all.Prevalence of pain was studied among the women of

which majority 60.8% of them experiences pain during their menstrual periods. Chest pain is

found in very less cases and stomach and hip pain was found to be more common followed

by pain in arms and legs and the days of severe pain seems to be on the 1st day of the menses,

which was 22.4% of cases, 15.2% of females were free from pain during menstrual cycle and

25.6% of them were having pain only sometimes.Some of the other

physiologicalsymptoms such as confusion, anger, irritabilities, are also studied of which

irritability 52% and is more prevalent are compared to other symptoms.Among the

psychological symptoms, 14.4% experiences anxiety, 14.4% have a confused condition

during their menses. Depression was seen in 30.4% of cases, 5.6% reported to have

forgetfulness, 52% experiences irritability, followed by difficulty in concentrating 43.2% and

mood swing 55.2%. Of which the most prevalent symptoms are anger which is reported in

38.4% of individuals. Sleeplessness was seen in 38.4% of cases.

In the present survey, 80.8% have been showing a menstrual cycle of more than 28 days and

19.2% with 28 days cycle and less percentage have been showing a short cycle.

In the present work 20.8% were reported to be having the period of menses for 1-3 days and

53.6% for 5 days and 0 % has the period of 1 day and 25.6% have all the seven days. The

duration between two successive periods is more than 28 days for 80.8% females. Some

treatment taken during menstrualcycle was surveyed. About 97.6%of females are not taking

any treatment whereas only 2.4% of female are treated with some drugs to postpone the

menses during busy schedule.

NOTE: The complete research paper is published in the following journal

INDO AMERICAN JOURNAL OF PHARMACEUTICAL SCIENCES

http://doi.org/10.5281/zenodo.2861472 ISSN: 2349-7750

55

STUDY ONWATER QUALITY OF YEDIYUR LAKE Mouliraj J

1, DivyaA

1, Jyothi V

1, Vidhatri V

1, Gopalakrishna

2

1 B Sc VI semester (2018-19)CZBt students, Vijaya College, R V road. 2 Associate Professor and Head, Department of Biotechnology, Vijaya College, R V Road.

Abstract

Physico-chemical and bacterial analysis was carried out on water samples of Yediyur Lake,

Bengaluru. The lake is used for recreation. The wateranalysis showed the water is slightly

coloured and contaminated while the other characteristics fall within Indian permissible limits.

Key words: Yediyur Lake, Water, Physico-chemical, Bacteria, Analysis, Characteristics.

1. Introduction

Assessing water quality of a water body may be

complete if the bacterial population of the water

body is assessed along with the physic-chemical

characteristics. Several workers have studied

bacterial characteristics of drinking water bodies.

Few like Ayyappan, Manoharachary have

contributed to bacteriological analysis of ponds

and lakes in India.

Believed to be one of the oldest lakes in the city,

Yediyur Lake sits at the edge of Basavanagudi.

Easily accessible via the arterial Kanakapura Road,

Yediyur Lake, many deem, exists from the days of

the Hoysala kings — that’s about 1,400 years ago.

It’s one of the last standing lakes in the city and is

popular with the locals.

Yediyur Lake is designed to have 12 feet of water,

regardless of season. Channels that are 6 km long

are constructed on the four sides of the lake to feed

the lake when it rains. An amount of Rs 60 lakh

was spent exclusively on lake for silt removal and

construction of these subsidiary channels. Even

during highest rates of evaporation, just a slight

rain is sufficient to fill the lake up.

Yediyur Lake is a hotbed for birds. The water body

attracts a variety of birds through the year and you

can spot everything from waddling ducks to Black

Winged Kites, Asian Koels, Jacanas, Mottled

Wood Owls, Spotted Doves, and kingfishers.

2. Material and Methods

Water samples were collected for the purpose of

the study in sterilized glass bottles at monthly

intervals for 6months. Physico-chemical analysis

and bacterial enumeration were undertaken

following standard methods of APHA.

Bacterial enumeration was done by ‘serial dilution

and plating technique’ and ‘most probable number

(MPN)’ method. Dilutions of water samples used

were 10-1

and 10-2

.

Sterile petri plates with respective agar media for

different types of bacteria inoculated with diluted

water samples were incubated in anincubator at

37°C for 24 hr and then colony forming units were

counted.

For MPN method sterile tubes containing lactose

broth media inoculated with diluted samples were

incubated in incubator for 48hr to 72hr and MPN

were estimated using standard MPN table.

3. Results and discussion

3.1 Physico-chemical Analysis

Physico-chemical characters like temperature, pH,

free carbon dioxide, dissolved oxygen, salinity,

chlorinity, phosphate andnitrate are very important

biotic factors of an aquatic ecosystem which play

major role in growth and sustaining of organisms

in the system.

56

The findings of physico-chemical characteristics of

water are given in Table 1 in the form of ranges of

parameters.

Table 1. Physico-chemical characteristics

Parameters Values (range)

Water temperature(°C)

pH

Free CO2 ( mg l-l)

Conductivity (µ mho cm-1

)

Chlorinity( mg l-l)

Salinity( mg l-l)

Nitrate ( mg l-l)

Phosphate ( mg l-l)

Dissolved O2 ( mg l-l)

Dissolved organic matter

22.0 – 26.2

7.6 – 8.4

0.0 – 5.6

115.28 – 426.39

0.07–0.08

0.128 – 0.162

Traces – 0.23

Traces to 0.22

8.9 – 11.4

1.8 – 6.3

Water temperature: The range of water

temperature recorded was 22.0 – 26.2°C. The

minimum temperature was recorded in January and

the maximum in March.

pH: Water was found to be slightly alkaline

throughout the study period with pH ranging from

7.6 to 8.4. The pH was slightly lesser in August

and September probably due to rain.

Conductivity: Conductivity ranged from 115.28 –

426.39µ mhocm-1

. It also remained low during

August and September.

Free Carbon dioxide: The free CO2 content of

water ranged from 0.0 to 5.6 mg per litre. The

higher CO2 level was observed in January which

may be due to decreased photosynthetic activity.

Chlorinity: The chlorinty ranged between 0.07–

0.08mg per litre.

Salinity: The salinity of water ranged between

0.128 – 0.162mg per litre.

Nitrate: It ranged from traces to 0.23 mg per litre,

minimum during January and maximum in

September. Nitrate is an important factor for all

aquatic organisms.

Phosphate: Phosphate is also aimportant factor for

aquatic plants and microbes. It ranged between

traces to 0.22 mg per litre.

DissolvedOxygen: The dissolved oxygen in the

water ranged between8.9and11.4 mg per litre,

minimum being during summer and maximum

during rainy season. Comparatively high oxygen

level may be due to lower water temperature.

Dissolved organic matter: The dissolved organic

matter in the water ranged between 1.8and6.3mg

per litre. Dissolved organic matter is an indicator

of pollution by organic wastes.

Physico-chemical analysis reveals that water of the

pond is not so polluted.

3.2 Bacterial Analysis

The bacterial properties are given in Table 3 in the

form of range of values and discussed in detail

below;

Table 3. Bacteriological properties (No. in the

bracket indicate maximum)

Sl.No. Type of Bacteria Counts

(No. ml-1

)

- range

1

2

3

4

5

6

7

8

Total Coliforms

Aerobic heterotrophic

bacteria

Nitrogen fixing bacteria

– Aerobic

- Anaerobic

Ammonifying bacteria

Nitrifying bacteria

Ureolytic bacteria

Phospholytic bacteria

Methanogenic bacteria

46 – 130

(680)

190 – 480

(1600)

13 – 65

8– 32

160 – 370

(1080)

12 – 30

(110)

110 – 280

(580)

6 – 28

(135)

3 – 18

57

Total coliforms:

Coliforms are generally estimated from a water

body to check its potability as it is an indicator of

contamination of water by faecal matter. Water

samples showed Coliforms in the range between

46 – 130 per ml of water with a maximum of 680

in Augustdue to rains.

Aerobic heterotrophic bacteria:

Aerobic heterotrophic bacteria numbers varied in a

range of 190 – 480 per ml. During rainy season

hetrotrophic bacteria number increased with a

maximum 1600 per ml in August. This may be due

to more dissolved oxygen content of water during

rainy season.

Ammonifying bacteria:

Ammonifying bacteria counts 160 – 370 per ml

was slightly higher due to sewage bringing in more

organic matter which provides substrate for these

bacteria.

Nitrifying bacteria:

The counts of nitrifying bacteria were varied from

12 – 30 per ml with a maximum of 110 per ml

during August - October. These counts were

slightly higher due to high counts of ammonifying

bacteria which make the required substrate for

Nitrobacter available.

Ureolytic bacteria:

Number varied from 110 – 280 per ml with a

maximum 580 per ml observed in August. The

number was higher when water temperature was

high. The higher number of ureolytic bacteria were

also coinciding with the higher number of

ammonifying bacteria, both actively engaged in

decomposing activity.

Phospholytic bacteria:

They varied between 6 – 36 per ml with a

maximum of 122 noticed in July. These are the

bacteria that are responsible for solubilising

inorganic phosphate. Their presence also

corresponds to the phosphate content of water.

Methanogenic bacteria:

Methanogenic bacteria numbers range from3 – 18

per ml. Their presence may be due to organic

matter coming with sewage, which provide

substrate for their activity.

4. Conclusion

The physico- chemical analysis of water showed

that water of Yediyur lake is not polluted. This is

mainly because of the activities of ammonifying

bacteria, ureolytic bacteria and methanogenic

bacteria which cause the decomposition of organic

matter leading to satisfactorily good water quality.

From this it is also evident that most of the

coliforms present in the water are not of faecal

origin.

Acknowledgement

We are very much grateful to biotechnology department

of our college and Dr. Gopalakrishna, Head of the

department for permitting us to conduct this small

project, guiding us and supporting us.

We are grateful to BBMP, Bangalore, for allowing us

collect water samples from the Yediyur lake.

References

Lynch, J.M. & Poole N.J.(Ed). Microbial Ecology: A

Conceptual Approach, Blackwell Scientific Publication.

David, R. Boone. & Richard, W. Castenholz. (Ed).

Bereey’s Manual of Systematic Bacteriology, 2nd

Ed.

Spriger.

David, C. Sigee, Freshwater Microbiology –

Biodiversity and Dynamic interactions of

Microorganisms in the Aquatic Environment, John

Wiley & Sons, Ltd.

58

Collin, H. Lyne, P.M, Grange, J.M. & Franklin III J.O.

(Ed). Collins & Lyne’s Microbiological Methods, 8th

Edition.

Mishra, P.C. Trivedy, R.K.(Ed). Ecology and Pollution

of Indian Lakes and Reservoirs.Ashish Publishing

House.Cha 10, 11, 15.

Adhikari, S. 2006 Soil and water quality management in

aquaculture.Handbook of fisheries and

aquaculture.Indian Council of Agricultural research,

New Delhi.

Arvind Kumar. (Ed). Aquatic

Ecosystems,A.P.H.PublishingCoporation. Cha. 16, 18,

22, 31,51.

APHA. 1992. Standard methods for the examination of

water and waste water, 18th

Edition.

Kang, H. and Seki, H. 1983.The gram stain

characteristics of the bacterial community as a function

of the dynamics of organic debris in a mesotrophic

irrigation pond, Arch.Hydrobiol.98: 39-58.

Tiwary,B.K. and Mishra, R.R..1985. Population and

productivity of heterotrophic bacteria in a freshwater

lake.Acta. Bot. Indica, 13, 51-56.

Tiwary,B.K. and Mishra, R.R..1989. A study on

biological activity measurement s and heterotrophic

bacteria in a small freshwater lake.Hydrobiologica, 94,

257-267.

Chakrapani, B.K.1989. Ecology and Dynamics of

Plankton in a Lentic Habitat, Ph.D.Thesis.Bangalore

University.

Ayyappan, S. KatreShakuntala and Parameswaran, S.

1992. Microbial ecology of a tropical freshwater lake. J.

Indian Inst.Sci. Jan –Feb. 1992, 72, 1-13.

GnanaSudha, J. and Johnson, M.E.C. 1998. Bacterial

status in various types of drinking waters of Hyderabad

city.Geobios 25, 249-252.

Roy, P.N. 2000. Studies on Hydrobiological status of a

stream in SanthalParaganas [South Bihar] with special

reference to pollution. Indian J. Environ.andEcopl.3(1).

127-130.

Mishra, P.C. and Patel, R.K. 2002. Study on the water

qualities of Sundargarh town a district head quarter of

Western Orissa. Indian J. Environ &Eoplan.6(1), 89-94.

Dhirendra, K. 2002.Physico-chemical characteristics of

two ecologically different ponds. In: Ayyappan S, Jena

JK, Mohan M(eds) The fifth Indian fisheries forum

proceedings,AFS 13 and AOA, Bhubaneswar,139-198.

Harsha, T.S. and, Malammanavar,

S.G.2004.Assessment of phytoplankton density in

relation to environmental variables Gopalaswamy pond

of Chitradurga. Karnataka J Environ Biol 25, 113-116.

Sunkad, B.N. and Patil, H.S. 2004. Water quality

assessment of Fort lake of Belgaum (Karnataka) with

special reference to zooplankton. J Environ Biol 25(1),

99-102.

Ramachandra Mohan. 2009. Monitoring the water

quality of lakes of Bangalore rural and urban areas and

environmental protection approach with global

perspective.

Manjare, S.A. Vhanalakar, S.A. and Muley, D.V. 2010.

Water quality assessment of Vadgaon tank of Kolhapur

(Maharastra), with special reference to zooplankton,

Int.JAdvBiotechnolog Res. l(2), 91-98.

Tiwari,S.C. ShriPrakash. and Mishra, B.P. 2012.

Assessment of Water Quality in Relation to

Phytoplankton in Devi Tank of Beohari, District-

Shandol(MP), J of Nat.Acad.Sci.,India,Sect. B Biol.Sci.

82(3), 385-389.

Gopalakrishna, Sumer Sing and Chakrapani, B.K..2014.

Ecology of Bannerghatta Kavalkere pond in relation to

bacterial population. J. The International Journal of

Science and Technoledge. July.2014, 7, 181-183.

59

vijaya college research bulletin ug and pg …

Documents