Volume:S

VIJNANA GANGA A PEER REVIEWED St;IENt;E

(RESEAR(;D JOURNAL) (J-fafJ year{y)

(Ju{y - 'December - 2014)

Editor Prot. T. B. Karegoudar

Assotiate Editor Prot T. sankarappa

PRASARANGA

GULBARGA UNIVERSITY

Kalaburagi-585106, Karnataka, India

Issue: 1

VIJNANA GANGA - A St:;IEN(;E PEER REVIEWED

tRESEAR(;D JOURNAL) Volume 5, issue 1, Year 2014

Editor Prof. T. B. Karegoudar

Associate Editor Prof. T. Sankarappa

Publisher Dr. Basavaraj Police Patil, Director, Prasaranga, Gulbarga University, Jnana Ganga, Kalaburagi 585 106

Copyright© 2014 Prasaranga, Gulbarga University, Kalaburagi 585 106

Pages: III + 89

Price: Rs 250 ; $ 50

Remittence for subscription in the form ofDD in favour ofthe Director, Prasaranga, Gulbarga University, Jnana Ganga, Kalaburagi 585 106

Printed at: Chaitra Enterprises No. 58, IIIrd Main Road, NewTaragupet, Bengaluru-560 002. Phone: 080-26706495, Mobile: 98441-46464

(ii)

CONTENTS

S.No. Title

01 Polarization and Pyroelectric studies of BaTi03-BaZr03 ceramics.P.Sateesh,

V.Gangadhar, G.S.Kumar and G.Prasad

02 Decolourization of Acid Blue 113 by Saccharomyces cerevisiae isolated from

dye contamination site.Vidya Govindareddy, Kushalatha Mutharasaiah and

Chandrakant Karigar

03 Photoluminescence of electron irradiated Li: ZnO thin films.Balaji Biradar,

V M J ali and S B Krupanidhi

04 Methicillin resistant Staphylococcus aureus: From Prevalence to Molecular

characterization and Morphogenesis in response to methicillin antibiotic.

Manjunath C, Rahul K, A jay K 0 and Chandrakanth Kelmani. R

05 Influence of Alkali Elements on Dielectric and Ferroelectric properties ofNBT

composites.Rajani Malathi, K. Kirana, G.S. Kumar and G. Prasad

06 Characterization ofkey Enzyme 4-Hydroxyphenylacetic acid Hydroxylase

from Klebsiella sp. GSK involved in Tyrosine-Melanin Pathway.Shrishailnath

S. Sajjan, Anand Nayak and T. B. Karegoudar

07 Tandardization ofNal (TI) based Gamma Spectrometer at the Environmental

laboratory for activity measurementsS. Rajesh, Avinash P R, Santosh Teerthe,

B. R. Kerur, S. Anilkumar and Narayani Krishnan

08 Ethno-veterinary practices for the treatment of mastitis disease of livestock in

Uttara Kannada District, Karnataka, India.Shivanand Dhanapal Payamalle,

AbhishekAshok Madiwal, Kadanthottu Sebastian Joseph, Smita S. Shinde,

Page

01

06

13

22

31

36

46

Aditya Jeevan Lengade, Vijayalaxmi S. Dandin, and H. Niranjana Murthy 53

09

10

Structural and magnetic properties ofLi-Zn ferrites.Vinod kumar Rathod,

V M J ali and VA Hiremath

Molecular Cloning, Sequencing and Characterization of Human GAPDH gene.

Rashmi Gadwal, Vinod P.S, Tathagat Waghmare, Manika Pal B and Utpal B

(iii)

63

71

(iv)

Polarization and Pyroelectric studies of BaTi03-BaZr03 ceramics P.Sateesh, V.Gangadhar, G.S.Kumar and G.Prasad*

Department of Physics, Osmania University, Hyderabad 500 007, India.

*Corresponding author email: gudurup@gmail.com

Abstract

BaZrxTi 1-x03 (BZT) ceramic samples were prepared by conventional solid state reaction method for various values ofx (0.05 to 0.30). These samples are studied by measuring Dielectric constant, Electric polarization, Piezo electric co-efficient and Pyro electricity. These samples show gradual transition from normal to diffuse phase transition behaviour. Hysteresis loops are decreases with increase of temperature also the shape of hysteresis loop changes. piezoelectric and pyroelectric coefficients decreased with increase of Zr concentration.

Key words: Dielectric, PE loop, Piezoelectric effect, pyroelectric effect.

1. Introduction

Various ferroelectric materials possess interesting structural and electrical properties. Among all ferroelectric materials BaTi03 is an excellent material [1] with numerous promising applications such as capacitors and piezoelectric transducers. It undergoes, rhombohedral- to -orthorhombic, orthorhombic- to- tetragonal and tetragonal- to- cubic transformations [2]; above the Curie point, the crystal symmetry becomes insufficient for piezoelectricity. Pure BaTi03 has lower piezoelectric properties than lead titanate zirconate. However, doped BaTi03 can exhibit competitive piezoelectricity in comparison with lead titanate zirconate ceramic with the benefit ofbeing lead free and of having reduced hysteresis loss in comparison with "soft" compositions. Addition of dopants shifts the phase transformation temperatures [3]. Many pyroelectric and piezoelectric detectors based on BaTi03 operate close to the transition temperature [ 4]. Hence it is desirable to lower the transition temperature towards room temperature. The phase transition temperature can be altered by B-site ion substitution. In the present work we report results of studies on higher ionic radius zr+4 (0. 72A 0 ) dopant substituted for Ti+4(0.605N). The change in the phase transition behaviour, Hysteresis, Piezoelectricity and Pyroelectricity are studied. An understanding of the results obtained is also presented.

2. Experimental

All BZT samples were prepared by solid state reaction method using BaCO, (SD Fine, 99% pure), Zr02 (Aldrich, 99% pure) and Ti02 (Merck, 99% pure) as starting reagents. Mixing of these powders is followed by grinding for about 1 Oh. The powder is pressed into square pellet which is calcined at 800°C-900°C for 4h. The square green pellets are crushed and pressed into circular pellets of 1 Omm diameter and 2mm thickness at 2MPa pressure using hydraulic press. To obtain the densification in the samples, these pellets were sintered at 1400°C-1450°C for 3h followed by intermediate grinding. Finally the obtained pellets were electrode with silver conducting paste to study the various properties. Dielectric measurements as a function

1

of temperature from 3 oac - 200°C) at 1 kHz frequency are done with H 4192A impedance analyzer. PE-Hysteresis loop measurements are using Marine India Instrument at 50Hz frequency. Piezoelectric coefficient d33 measurements are done using Piezometer PM100 system.

3. Results & Discussion

6000

_sooo

* c ~ 4000 c 8 u 3000

~ a; 2000 i5

1000

3.1. Dielectric properties

Temperature dependent of dielectric constant of the all samples at 1kHz frequency was studied by using HP 4192A Impedance analyzer and the heating rates was maintained 2 .5°C/min. Figure 1. shows that phase transition temperature of the BZT samples decreases with increasing Zr concentration due to the incorporation of larger ionic radius of Zr+4

into the Ti+4 site. And also FWHM of the peak increases with dopant concentration. Fittings of Curie Weiss and modified Curie Weiss laws indicate that these samples are exhibiting normal to diffuse phase transition to relaxor behaviour [5]. BaTi0.95Zr0.0503 sample shows a low temperature defect relaxation peak.

398 K X- 0.05 4000

" .. 3500 . . :§: .. ~

3000

'Uj . c 2500

• 8 § . u 2000 '1:

7 ·~ ~ 1500 ;; i5

1000

378K X= 0.10

r ... / .. ·· '

"',.

' ··,, ,, sooo,------------,

4500

-4000

"' '!3500 'Uj 83000

·~2500 13 '*2000 i5

1500

368K x=0.15

r·~ r.i"~ "'~ .,.,· \.

· .. \.

..,..,~

275 300 325 350 375 400 425 450 475 500 525

Temperature (K)

500 +--.,......-.,.....-.---.---,......-,,........,,.........,__,-1 300 320 340 360 380 400 420 440 460 480

Temperature (K)

1 000 -1--r-.......-.......-.......-.......-.......-.......--.-,-........--1 300 320 340 360 380 400 420 440 460

Temperature (K)

Fig !.Dielectric constant versus temperature graph for BaZrJi1_x03 •

3.2. Piezoelectric and Pyroelectric properties

Figure 2.shows the well saturated hysteresis loops for BZT system with regular shape having temperature dependent polarization. With addition of Zr, well saturated loops were appeared below the transition temperature for lower concentration; with further increasing Zr loosy elliptical loops were observed. It point outs the degradation of ferroelectric nature of the samples. Remnant polarization of the samples decreases from x = 0.0574 C/m2 for x = 0.05 to 0.0199 C/m2 for x = 0.20 with increasing temperature. It may be due to the discontinuity of the polarization across the grain and grain boundary of the sample. Here the observed transition temperature where the polarization becomes zero is slightly higher than the observed value of transition temperature in the dielectric measurement, which can be attribute to the existence of small residual polarization in the para electric region upon heating, the transition temperature shift to higher regions [6]

To measure the piezo electric coefficient, initially the samples were poled at room temperature under DC field of 2kV /em using a stabilized power supply. Piezoelectric coefficient measurement of the poled samples was done by using Piezometer PM100 system.

2

X= 0.15

-0.15+-,~-.-.--,-~~-.-:;:::::;;:::.:::;...~ -3k -2k -1k 0 1k 2k 3k

Electric field (kV/m) Electric field(kV/m)

O.OB,-------,------,

0.06

0.04

~ 0.02

2.

X= 0.30

5 0.00+----F--+---F---l

~~).02 l~).04

~).06

-1.5k -1.0k -500.0 0.0 500.0 1.0k 1.5k Electric field(kV/m)

Fig 2. Polarization versus electric field graph for BaZrJi 1_x03 •

Piezoelectric coefficient values for x = 0.05 is 120pC/N, for x = 0.10 is 26pC/N, and decreases with further increasing Zr concentration. This may be due to intrinsic contribution i.e grain size and extrinsic contribution i.e domain wall motion to the Piezoelectric coefficient The grain size affects the coercive field values which can influence the domain wall motion during polling process [7].

0_15 -x=O.OS RT -x=0.10 - x=0.15

0.10 - x=0.20

-0.15

(a)

-3k -2k -1k 0 1k 2k 3k Electric field(kV/m)

130

120

110

100

90

80

z 70

c:; 60

.S: 50

"'C~ 40

30

20

10

e (b)

\ I I \ I \ I I \ I \ I

·~ ·-•-.-~

0.05 0.10 0.15 0.20 0.25 0.3(] Concentration of Zr

.,...

1.8

1.6

1.4

1.2

... ~ 1.0

.§. 0.8

..Jk -2k -1k 0 1k 2k Jk

Electric filed (kV/m)

Fig 3(a) comparison graph ofP vs E for BZT. (b) d33 vs Concentration for BaZrJi 1_x03 •

(c) Strain versus electricfield.

Figure 3(b). Shows the variation of piezoelectric coefficient (d33) with concentration ofZr. Lower concentration of Zr samples shows high piezoelectric coefficient value, addition of Zr to barium titanate leads to decrease the d33 value, proportionally reducing in the spontaneous polarization which is observed in the figure 3(a). The strain is calculated from spontaneous polarization values using the relation S = QP2• And this supports the strain graphs (Figure 3( c)), the value of strain is higher for x = 0.05 composition and it decreases for higher concentration of Zr and also the degree of hysteresis gradually decreases, this indicates degrading nature of the ferroelectric property of the samples. Measurable d33 values could not be obtained for higher concentrations because non piezoelectric nature of the samples.pyro electric coefficient of the present samples is determined from the temperature dependence of

the spontaneous polarization using equation (1) [8], p = 8Ps I aT Here, p is pyro electric

coefficient, Ps is the spontaneous polarization. Figure 4 shows the pyroelectric coefficient

3

.-~ -~ " E 0 'g

" u

t 0 u e ,., c.

10

8

7

6

5

4

3

2

1

versus temperature graph for the BZT samples. It is observed from the graph that pyro electric coefficient has a peak similar to the temperature dependent of the dielectric constant curve. pyroelectric coefficient peak is less than the of transition.

X: 0.10 X= 0.15 X= 0.05 ......... ;;\, 3.0

;'- ;{ \ .,..... ; \ ~ / .\ ~

I \ 3 ~;;:::. 2.5 . \

-I<: ~-/ \ ~ I .

" 2 ·e

E g. 2.0 . \ I . 0 iii I \ ___ , ><1

/ "-·-·-·-·j \ iii \ u u IE iE 0 1!: 1.5

1!: \ e I e -1 l: 1.0 \ i . ,., I 0. ..... ·-· ·2 0.5

300 310 320 330 340 350 360 370 380 390 400 280 300 320 340 360 380 400 420 300 310 320 330 ,.. 350 3tiO 370

Temperalure(K) Temperature (K) Temper-ature (K)

Fig 4. Pyroelectric coefficient versus temperature for BaZrJi 1_x03 •

temperatures observed in dielectric measurements. Pyro electric peak could not be observed for higher concentration ofZr i.e forx > 0.15, because of their lower d33 values. To understand the infrared detection ability of the present Zr doped samples, figure of merit (FOM) is calculated for the samples. It is given as equation (2) [9].

Where pis the peak pyroelectric coefficent and e.~. is the dielectric permitivity at T m· FOM is

11.8 ~-tCim2 °C for x = 0.05, 6.9 ~-tCim2 °C for x = 0.10 and 5.01 ~-tCim2 °C for x = 0.15. Figure of merit is decreases with increasing Zr concentration.

4. Conclusions

B-site substituion ofBaTi03 with higher ionic radius dopants lowers the transition temerature, also exhibits improved piezoelectric properties comparable to the lead free ceramics. From pyroelectric coefficent values of these samples one can conclude that these samples may be utilize for infrared detection applications.

Acknowledgement

Authors are thankful to U GC, New Delhi for providing the fmnancial assistance for the research work.

4

References

1. M. M. Vijatovic, J.D. Bobic, B. D. Stojanovic, Science ofSintering, 40: 155 (2008)

2. M. E. Lines, and A.M. Glass, Principles and Applications of Ferroelectics and Related Materials. Clarendon Press Oxford ( 1977).

3. Liang Dong, Donald S. Stone,and Rod eric S. Lakes, J .Appl Phys, 111: 0841 07 (20 12)

4. K Uchino Ferroelectric devices (New York: Marcel Dekker Inc) (1960)

5. C. E. CIOMAGA, M. T. BUSCAGLIA, M. VNIANI, V. BUSCAGLIA, L.MITOSERIU

A. STANCU and P. NANNI Phase Transitions 79: 389 (2006)

6. F. Benabdallah, A.Aydi, N. Abdelmoula, H. Khemakhem, A. Simon, R. Von Der Miihll,M.

Maglione Sloid state sciences 14: 1333 (2012)

7. F Xu,S T McKinstry,WRen,B Xu,Z L Xie and K J Henker J.Appl Phys,85: 1336 (2001)

8. B. A. Strukov and A. P. Levanyuk, Ferroelectric Phenomena in Cristals Berlin: Springer; (1998)

9. Petty, M., Tsibouklis, J., Davis, F., Hodge, P Petty, M.C., Feast, W.J. Journal of Physics D: Applied Physics 25: 1032 (1992)

****

5

Decolourization of Acid Blue 113 by Saccharomyces cerevisiae isolated from dye contamination site

Vidya Govindareddyi, Kushalatha Mutharasaiah2, and Chandrakant Karigar'*

1 Department of Chemistry & Biochemistry, Maharani Science College for Women, Ban galore 560001, India

2Department of Biochemistry, Maharani Lakshmi Ammanni College for Women,

Bangalore 560012, India 30epartment of Biochemistry, Bangalore University, Bangalore 560001, India

*Corresponding author email: karigar@bub.ernet.in

Abstract

A Saccharomyces cerevisiae capable of decolorizing textile dye; acid blue-113 (AB-113) was isolated by enrichment culture method. The dye AB-113 rapidly decolorized in batch cultures by S.

cerevisiae in presence of co-substrates. The organism exhibited remarkable de-colorization activity at high dye strengths. S. cerevisiae decolorized 99% of color with in 15 hours of incubation with dye. In addition the S. cerevisiae cells mediated AB-113 color removal for 10 cycles when cultured as repeat batch cultures. The process of dye removal was optimum at a pH between 6.5-7 .0, a temperature of35± 1 °C and under micro-aerophilic conditions. The metabolic pathway for AB-113 dye involved sulphanilic acid as an intermediate as evidenced on the basis of metabolite isolation from spent medium followed by its characterization by Thin Layer Chromatography (TLC) and Ultra Violet (UV) Spectral analysis. The biochemical assays carried out with S. crevisiae cultured as replacement cultures proved that sulphanilic acid undergoes further catabolism. Thus S. cerevisiae decolorizes and metabolizes AB-113 thereby targeting its employability in dye decontamination and detoxification of wastewater bodies polluted by textile industries.

Key words: Saccharomyces cerevisiae, phenol, sulphanilic acid, acid blue-113

1. Introduction

Environmental pollution is one of the most challenging problems being faced by human race. A huge number of chemicals and dyes that have negative impact on environment and human health are released from industries in the effluents. The release of colour imparting compounds into water bodies is undesirable since they attribute towards aesthetic appearance, affect photosynthesis in aquatic plants and the dye degradation products are carcinogenic to humans [ 1]. Thus, without adequate treatment of industrial wastewater these dyes remain in the environment for an extended period of time.

6

Azo dyes are the largest and most important group of dyes. They are used for coloring many different materials such as textile, leather, plastic, food, pharmaceuticals and for manufacturing paints and lacquers and for printing purposes [2]. The azo dyes are stable to solar radiation and microbial degradation in soil environment, making them candidates of major environmental concern [3].

Azo dyes constitute a major class of environmental pollutants amounting to 60-70% of all dyes and pigments in use. These compounds are characterized by presence of aromatic moieties linked together through azo groups ( -N=N-). During manufacturing and industrial use of azo dyes, an estimated 10-15% dyes are released unused into the environmentv[ 4,5]. This estimate is presently even higher when reactive dyes (which include azo dyes) are employed for industry since their fixation rate during dyeing process is as low as 50% [6]. Due to growing health concerns and the environmental impacts of azo dyes the strategies need to be developed for their decontamination and remediation from polluted sites. In this context it is essential to evaluate the fate of azo dyes during wastewater treatment and in the natural environment. Currently, much research has been focused on chemical and physical methods of decontamination of azo dyes from waste waters. These technologies however are cost prohibitive and produce large amounts of sludge and therefore are not viable options for treating large waste streams.

The primary objective ofthis study was to develop biological technique for color reduction and detoxification of dye industry effluents. Azo dye AB-113 has been used as the model textile dye pollutant. The fate of this pollutant during the biological degradation by a yeast isolate has been investigated.

2. Materials and methods

2.1 Textile dye

Textile azo dye, AB-113 ( CI263 60) was procured from local market and used as substrate for biodegradation studies without further purification.

Acid blue -113(CI 26360)

2.2 Microorganism and culture media

The microbial consortia degrading the reactive azo dye, AB-113 was enriched from textile dyes-contaminated soil by enrichment culture method. The most predominating and efficient microorganism degrading the AB-113 was isolated from the resulting consortia and purified by adopting standard microbial procedures and characterized based on their morphological, biochemical and physiological characteristics.

7

The isolated pure culture was cultured under oxygen limited conditions in Erlenmeyer flasks, containing 1 OOml (PH 7 .0) mineral salt medium (MSM), comprising of (giL) of K2HP04 (1.6), KH2P04 (0.2), NH4Cl (1.0), MgC12 (0.2), NaCl (0.1), CaCl2.2Hp (0.02), FeS04.H20 (0.01), Na2Mo04.2H20 (0.05), MnS04H20 (0.05), and Na2W04.2H20 (0.05), along with yeast extract(0.025% ) and peptone (0.025% ).

2.3 Growth and decolorization studies

The degradation study was initiated by incorporating the dye ( 1 OOmg/1) into MSM, as a sole source of carbon and energy for enrichment of dye degraders. The growth was enhanced by inclusion of other carbon substrates (0.5%) like glucose, sucrose or starch as co-substrates. Among these 0.5% starch served as the best co-substrate and was used in further studies.

Decolourization experiments with microorganisms were performed in duplicates in 250 ml Erlenmeyer flasks containing 100 ml MSM supplemented withAB-113 (0.1mg/ml) as growth substrate and 0.5% starch as co-substrate. The cells in their log phase (15 h) were harvested by centrifugation at 6000 rpm for 20 min. After cells were washed repeatedly with 50 mM phosphate buffer (pH=7 .0) they were used as inoculums to fresh medium. The flasks were incubated at 35±1° C, and at various time intervals; 2 ml aliquot of culture broth was with drawn to measure the turbidity at 600 nm. Blanks for these readings were prepared from aliquots of centrifuged medium. At high cell densities, samples were diluted with water by the same factor.

The degradation of the azo dye, AB-113 was monitored at different time intervals at 565 nm (AB-113 Amax=565 nm) with a spectrophotometer.

2.4 Extraction and characterization of metabolites

Metabolites from the spent medium were solvent extracted and characterized by Thin Layer Chromatography (TLC) and Ultra Violet (UV) analysis. Briefly, the acidified spent medium was extracted with ethyl acetate three times ( 1 :3 volume) for metabolites. The extract obtained was dried over anhydrous sodium sulphate, dissolved in methanol and characterized by TLC (Alugram Sil G0.20 mm thick layer, Macherey-Nagel GmbH & Co, Germany). The metabolites were separated by TLC using solvent system benzene: methanol (95:5 v/v). After development of the chromatogram, the metabolite spots on TLC plate were identified with iodine vapors, scrapped, methanol extracted and analyzed by comparison of its UV absorption profile with the standard samples.

2.5 Degradation route for metabolites from AB-113

The fate of the AB-113 metabolites was assessed by conducting replacement culture technique [7]. To know the pathway, microorganism was cultured in 100 ml MSM containing 0.5% starch and 0.025% yeast extract, 0.025% peptone supplemented with 1 OOmg/L of AB-113 and incubated at 3 5± 1 °C under anaerobic conditions. After 15 hours, the cells (log phase) were harvested and washed repeatedly with 50 mM phosphate buffer (PH=7.0). An appropriate volume of this cell suspension (lml; 0.050D) was further

8

inoculated into another 250 ml Erlenmeyer flask containing 100 ml sterilized MSM medium as before. When the decolorization (2 days) was complete the cells were collected by centrifugation and spent broth was used for the metabolite analysis as described earlier.

Alternatively an appropriate amount of cells (0.1 OD) were inoculated to the spent MSM medium, and subjected to aerobic degradation by placing the flasks at 35± I °C on a rotary shaker (11 0 rpm). After every 2 days interval, spent broth was withdrawn and extracted with ethyl acetate, dried over anhydrous sodium sulphate and dissolved in methanol and analyzed by TLC and UV analysis.

2.6 Determination of ammonia, sulphate and phenol

Various degradation products from the spent medium were determined. Ammonia release was quantified by the method of [8]. Sulphate was measured according to [9] and phenol was estimated by method with Collins & Daugulis[10].

3. Results and discussion

The microorganism degrading AB-113 was identified as Saccharomyces cerevisiae on the basis of its cultural and morphological, and metabolic characteristics. The de-colorization of AB-113 and microbial growth pattern in batch cultures were studied. The experimental results indicated that both growth of S. cerevisiae and AB-113 de-colorization occurred simultaneously (Fig.1 ). The dye degradation by S. cerevisiae was speculated to involve an initial bioabsorption [11] followed by a biological degradation. In a control experiment it was observed that only little or no visible dye adsorbed to the yeast cells and less than 1% of the initial color was recovered by extraction with phosphate buffer (pH 7.0). It was of interest to note that S. cerevisiae although displayed good growth in shake cultures, dye (colour) removal was optimal when the same cells were cultured as anoxic static cultures. S. cerevisiae is unique among eukaryotes in exhibiting fast growth under aerobic and anaerobic conditions [12]. Further the organism exhibited a remarkable color removal capacity even at high concentration of AB-113. In all cases (250-300mg) more than 96% of color reduction was achieved with in 15h of incubation. In repeated batch cultures AB-113 was decolorized for 10-12 cycles of dye feeding by same cells, amounting to about 1 giL dye decolourization.

1.4

1.2

bsorbance 0.8

0.6

0.4

0.2

0

0 10 20 30 40 50

Time (h)

Fig.l. Growth response and decolorization of Acid blue-113 by Saccharomyces cerevisiae (Growth A600nm ), (Decolorization AS 65nm)

9

The biodegradation pathway analysis using TLC showed a single metabolite with Rrvalue of 0. 77 and UV A max of 250nm. The comparison of this data by co-chromatography and UV analysis were conclusive enough to say that the isolated metabolite was sulphanilic acid. This was further evidenced by the results obtained with replacement cultures which indicated that sulphanilic acid accumulated and decreased with time following its further utilization by S. cerevisiae (Table.l ). Similar observations have been noticed [13, 14]. However this observation is contradictory with the previous results [15].

Time Remaining sulphanilic acid (d) (%) 1 29 2 18 3 14 4 0.1

Table.l. Degradation of sulphanilic acid by Acid blue-113 degarding Saccharomyces cerevisiae

The kinetic assays for sulphate and ammonia from the spent broth in replacement cultures, further supports the utilization of amines (Fig.2). Phenol was also utilized as the substrate in replacement cultures. Therefore acid dye degradation by S. cerevisiae involves phenol as likely intermediate which may further undergo aerobic degradation. Also the processes like deamination and desulphonation may help further mineralization of dye derived products. The S. cerevisiae cells also demonstrated induction of enzyme activities such as deaminase and sulphatase after 6-8 days of aerobic degradation.

~ E -c ::I 0 e:

od;

0.8

0_7 I'""

0 .6

0.5 ..,

r-0 .4 • Sulpha te

0.3 -- • Ammon ium

0.2 • Phenol

0 .1

0 J • l::::::l

0 2 4 6 8 10 12

Time (d )1

Fig.2. The sulphate, ammonium ions and phenol determined from Saccharomyces cerevisiae spent broth.

The observed time delay may be due to the requirement of fresh cells to adapt to the new cultural environment. The above conclusions thus showed that the acid dye decolourization

10

and reduction in S. cerevisiae is considerably different from that carried out by bacteria. These results conclude that the azo dyes get reduced during anaerobic phase forming sulfonated amine, which further undergoes deamination and desulfonation forming a phenolic compound. The proposed pathway of degradation of acid blue 113 operating inS. cerevisiae is represented in Fig.3.

H so,H

so,H

N

NH2

TCAqcle

so,H

OH

Fig.3. The proposed pathway for the degradation and decolrization of Acid Blue-113 by Saccharomyces cerevisiae.

Most of the azo dyes are non-toxic, but many of their intermediates have been identified as carcinogens[ 16]. The aromatic amine dye intermediates in particular are potent toxicants that require further degradation for their detoxification [ 1 7]. During the biodegradation of sulfonated azo dyes many different sulfonated aromatic amines will be formed and these compounds are not likely to be degraded further with ease. Therefore special attention should be paid on the removal of such of these compounds. Interest is there now focused on microbial degradation of dyes as better alternatives [ 18].

4. Conclusion

This study has demonstrated that S. cerevisiae is a potent microbial member with an ability to degrade toxic reactive textile dyes. This work provides evidence that S. cerevisiae can behave as good bioremediation agent for azo dyes. Their growth and viability is not affected by the presence of toxic dyes and their reduction products. It is very important and significant that the isolated yeast strains are able to use the resulting amines as carbon and nitrogen sources. Therefore this ability of yeasts would allow the complete detoxification of wastewater contaminated with azo dyes like AB-113. S. cerevisiae biomass is a readily available, and inexpensive bio-resource with a high potential for dye bioremediation.

11

References

1. Walsh G.E Bahner L.H and Horning W.B Environ Poilu (Sr A), 2, 179 ( 1980).

2. Zollinger H, Color Chemistry- Syntheses, properties and applications of organic dyes pigments. VCH, New York, NY(1987).

3. VaidyaA.Aand Datye K.V, Colourage, 14: 10 (1982).

4. IARC, Some aromatic azo compounds. Monographs on the evaluation of the carcinogenic risk of chemicals to humans. 8., Lyon, France: IARC (World Health Organization International Agency for Research on Cancer) ( 1975).

5. IARC, Some industrial chemicals and dyestuffs. Monographs on the evaluation of the carcinogenic risk of chemicals to human,. 29., Lyon, France: IARC (World Health Organization International Agency for Research on Cancer) ( 1982).

6. Easton J .R The dye maker's view, in Colour in dye house effluent, P. Cooper, Editor. Society of Dyers and Colourists: Bradford, England ( 1995).

7. Suneetha P Manjunath N.H and Karigar C.S Biodeg, 19: 137 (2008).

8. Russell J .A J. Bioi. Chern. 8: 457 ( 1994 ).

9. Dodgson K.S Biochemical J, 78:312 (1961).

10. Collins L.D and Daugulis A.J Biotechnol Bioeng, 55: 155 ( 1997).

11. Sivarajasekar N. R Baskar, and Balakrishnan V, J. Univ. Chern. Techno I. Metallurgy, 44: 157 (2009).

12. Ter Linde J.J Liang M.H Davis R.W Steensma H.Y Van Dijken J. P and Pronk J. T, J. Bacterial., 181: 7409 (1999).

13. Tan N.C.G, Annemarie van Leeuwen, Ellen M. van Voorthuizen, Tan Field Biodegradation, 16: 527 (2005).

14. Poonam Singh, Birkeland N, Leela I and Ramanathan,. Biodeg, 17,495 (2005).

15. Ramalho P.A Scholze H Cardoso M.H Ramalho M.T and Oliveira-Campos A.M Enzyme Microbial. Technol. 31: 848 (2002).

16. Brown M.A and DeVito S.C, Crit. Rev Env. Sci. Tee., 23: 249 (1993).

17. Levine W.G, Drug Metabol. Rev., 23,253 (1991).

18. An H, Qian Y, Gu X.S and Tang W.Z, Chemosphere, 33: 2533 (1996).

****

12

Photoluminescence of electron irradiated Li: ZnO thin films Balaji Biradar1, V M JalP *and S B KrupanidhF

1 Department of Physics, Gulbarga University, Gulbarga- 585 106, India 2Materials Research Centre, Indian Institute of Science, Bangalore- 560 012, India

*Corresponding author email: vmjali@gmail.com

Abstract

The present paper is a report of the results on the electrical and optical properties of electron irradiated (8 MeV energy) Li doped ZnO films. The electron irradiation was carried out forthe All LZO/Pt-Si thin films by varying the fluence of the electron beam viz. 3x 1012, 3x 1013 and 3x 10 14

electrons/cm2 • Photoluminescence spectra showed two emission peaks for unirradiated thin films: one Near Band Edge (NBE) emission at 2.98 eV and the other Green-Yellow-Red (GYR) emission at 2.30 eV. After electron irradiation, ablue shift in the peak positions was observed indicating irradiation induced modification of defect and band structure. Raman spectra showedE2(High) and E1 (LO) modes. After electron irradiation, there were no significant changes in the peak position of E2and E1 modes. An additional peak was observed at 737 cm-1 for the film irradiated with the highest fluence i.e., 3x 1 014 electrons/cm2 that was ascribed to multiple phonon scattering processes. The ideality factor and the barrier height were calculated. After electron irradiation, decrease in the value ofbarrier height and an increase in the value of ideality factor were observed which further confirmed the creation of radiation induced defects due to electron irradiation.

Keywords: Li doped ZnO thin films, Photoluminescence, Raman spectroscopy, Electron irradiation

1. Introduction

Zinc oxide (ZnO) is a potential candidate for optoelectronic applications because of its wide band gap at room temperature and a large exciton binding energy. In addition to its good optical properties, it has excellent electrical properties also [1 ].The defects created due to electron irradiation can alter their optical and electrical properties. The defects can act as radiative or non-radiative recombination centers and play an important role in changing the efficiency of UV and visible LED devices. ZnO is more radiation resistant material than the other semiconductor materials like GaN, SiC, Si and GaAs [2-4].Photoluminescence (PL) study is widely exploited to probe the native defect states in the photo luminescent materials and is an effective method for examining the presence of defects in semiconductors. Combined Raman and PL spectra can reveal the presence of complex defect sites in materials. Therefore, the Raman and PL studies of electron irradiated Lithium doped Zinc Oxide thin films were carried out in order to understand the role of radiation induced defects in altering their electrical and optical properties.

2. Experimental

Li-doped Zinc oxide (Zn0 93 Li0070, LZO) thin films were synthesized by sol-gel technique. The details of the synthesis are reported in our earlier paper [5].The films were irradiated in

13

air and at room temperature with 8 MeV electrons of varying fluence Viz. 3x1012, 3x1013 and 3x 1014 electrons/ cm2using Microtron Accelerator (Man galore University).

2.1 Device fabrication

The device was fabricated in the Metal/Semiconductor/Metal configuration as AIILZO/ Pt-Si. It involved a series of steps: 1) Cleaning of platinized Silicon substrates in boiling Isopropanol and Acetone at 150°C for 15 min. each and finally drying under Nitrogen atmosphere, 2) the cleaned substrates were spin coated at a spinning speed of2000 rpm for 30s to get 0.5 flm LZO thin films, 3) circular Aluminum top contacts, each with radii of250 flm were deposited onto the spin coated films. A schematic view of the device is shown in Fig. 1.

---------------- - AI - - - - - - ~

U:ZnO a Pt"!Si--

Fig. 1. The AI/Li: ZnO/Pt device.

The current-voltage measurements were performed using a Keithley 2611 A Source Measure Unit, on both the un-irradiated and irradiated thin films at different temperatures, in the range 313-373 K.

3. Results and Discussion

3.1 Photoluminescence

The optical properties of the films were characterized by PL spectroscopy. The PL was measured using a Jobin Yvon LabRAM HR 800 UV system with a Helium-Cadmium laser source with 325 nm excitation wavelength. The films were scanned in the range of 300-800 nm to obtain a PL emission peak. Fig.2. shows the PL spectra of both unirradiated and irradiated LZO thin films at room temperature.

The PL spectrum ofunirradiated LZO thin films show two emission bands: one near the band edge (NBE) emission at 2. 98 e V and the other is Green-Yellow-Red (GYR) emission at 2.30 eV. The near band edge emission is assigned to the electronic transitions from the conduction band to the deep level acceptors, or to the transitions from the deep donor levels to the valance band [6]. The Green-Yellow-Red (GYR) emission band is assigned to the radiative recombination of photo-generated hole with an electron that belongs to a singly ionized oxygen vacancy [7]. The NBE emission was observed at 2.98 eV for unirradiated LZO thin film. Generally, the NBE emission for undoped ZnO occurs at 3.34 eV. But, for the LZO thin film it is found at 2.98 eV. This could be due to the presence of intrinsic defects. The presence of intrinsic defects in LZO is further confirmed from the calculated ideality factor, which is greater than one.

14

c "Vi c .l!l c .....

...J a..

NBE

(a) -e (b) ~(c)

(d)

2.2 2.4 2.6 2.8 3.0 3.2 3.4 3.6 3.8

Photon Energy (eV)

Fig. 2. PL spectra of Zn093 Li00p thin films before and after electron irradiation.

(a) Unirradiated (b) 3 X 10 12 (c) 3 X 1013 (d) 3 X 1014 electron/cm2 fluence.

After electron irradiation, NBE emission peaks shifted significantly towards higher energy side. For unirradiated film the NBE peak was at 2.98 eV. After irradiation with varying fluence Viz. 3xl 012, 3xl 013 , 3xl 014 electrons/cm2,NBE peak shifted to 2.98, 2.99 and 3.04 eV, respectively, with a significant reduction in the peak intensity. After irradiation, intensity of the GYR peak remains same. It was attributed to the non-radiative recombination due to the extrinsic defects created upon electron irradiation. Son et.al have observed a similar behavior in which the PL intensity decreased upon electron irradiation [8]. The created extrinsic defects change or degrade the crystallinity of the material and the same can be observed from E2

(High) mode in the Raman spectra.

3.2 Raman spectroscopy

According to group theory, the Raman active modes of ZnO can be represented using the optical phonons at the r point of the Brillouin zone [9].

r opt = 1A1 + 2B1 + 1E1 + 2E2 ---+ (1)

where A1 and E 1 modes are polar. The A1 and E 1 modes split into transverse optical (TO) and longitudinal optical (LO) phonons, all modes are Raman and IR active. The E2

mode is non-polar and it has two modes one at the higher frequency; E2 (High), other one at lower frequency; E2 (Low), both are Raman active. The 8 1 mode is IR and Raman inactive, thus, it is a silent mode. From Fig. 3it can be seen that after irradiation; the position of the E2 (high) mode remains same for all the irradiation fluence. Thus, this confirms that there is no structural change in the LZO thin film upon electron irradiation.

15

But, the intensity ofthe E2 (high) mode slightly decreases with fluence, ascribed to the degradation of crystallinity. The position of E1 (LO) mode also remains same after irradiation. This confirms that there is no stress or strain developed in the film after irradiation. However, for the thin film irradiated with the highest fluence i.e., 3xl 014

electrons/cm2 an additional peak was observed at 737 cm-1 which is associated to the multiple phonon scattering processes [1 0]. Tseng et. al. observed the peak at 737 cm-1

and assigned it to the multiple phonon scattering processes. Multiple phonon modes were strongly related to local vibrational modes associated with point defects and their corresponding optical processes were correlated. The multiphonon scattering process leads to the non- radiative process [11]. The non-radiative process is reflected in the PL.

1000 .----------:---------.,.-------------.

800

-:::s 600

~ -~400 ·;; r:: IV t: 200

11-1

0

E2( High~ 437cm-'

-200 .__ _ _._ _ __._ _ _,__.___.....__ _ _.___:.__. __ ...___--L. _ ___. _ __,

300 400 500 600 700 800

Raman Shift (cm-1)

Fig. 3. Raman spectra of Zn0 93Li0 070 thin films before and after electron irradiation.

(a) Unirradiated (b) 3 X 1012 (c) 3 X 1013 (d) 3 X 1014 electron/cm2 fluence.

3.3 1-V characteristics

Current-Voltage characteristics ofLZO thin films were measured using a Keithley Source Measure Unit, SMU-2611A. The 1-V plot of the AI/Li:ZnO/Pt hetero-junction device structure is shown in Fig. 4.The voltage scans from -2 to 3 V results in the rectifYing behavior of the device with a change in the slope, which is due to the formation of Schottky contact between theAl electrode and LZO thin film. The forward bias current­voltage characteristics of the hetero-junction device at different measuring temperature are shown in Fig. 5 .At a particular bias the current increases as the measuring temperature increases. This indicates that the current is induced by thermionic emission. The barrier

16

height and ideality factor values ofthe hetero-junctions were calculated using a thermionic emission model. The current through a Schottky diode according to thermionic emission theory is given by [12].

I= r,[exp(~;)]-+ (2)

with

I, = AA*T2 exp ( -z;R) ---+ (3)

where A* is the Richardson constant, A is the area of the heterojunction, Tis temperature

in Kelvin, Vis the junction voltage, q is the electronic charge, rp 8 is the barrier height, lJ is the ideality factor and k is the Boltzmann constant.

2x10.5

_ 1x10"5

<( -

•2X1 o·S

-2 ~ 0 1 2 3 Applied Bias (V)

Fig.4. I-V measurement on Al/Li: ZnO/Pt device for unirradiated thin film.

17

1E-4

1E-5

1E-6

<( 1 E-7 --c 1E-8 Q,) ..... .....

::::::1

u 1E-9

1E-10

1E-11 0 .0 0 .5

~1oooc

-o- 90°C ----&-- aooc --<:t- 70°C ~sooc

~ sooc

--Y- 40°C

1.0 1.5 2.0 2 .5 3.0 Applied Bias (V)

Fig.S. 1-V characteristics of pristine AI/Li: ZnO/Pt device.

The ideality factor, (11) and barrier height ( qJ8 ) of the hetero-junctions were determined

from the slope and the intercept of semi-logarithmic forward biased I-V plot at V> 3kT I q using Eqs. (4) and (5).

lJ = q ---+ (5) kT x slope

The calculated 11 and qJ8 values of unirradiated LZO thin film were 4.0 and 0.36 eV,

respectively. The ideality factor of the unirradiated is found to be higher (> 1) and it is attributed to the presence of interface states between the metal and the semiconductor, since an interfacial film of atomic dimensions always exists between a metal contact and LZO [13].

18

100r-----------------------------------------, ---o- (a) ~(b) --<t- (c) -4-- (d)

.______ ... o,._--1••· --Qa.__-•a· _ .

300 310 320 330 340 350 360 370

Tern peratu re(K.)

Fig. 6. Ideality factor of Zn0 93Li0 oP thin films before and after electron irradiation

(a) Unirradiated (b) 3 X 1012 (c) 3 X 1013 (d) 3 X 1014 electron/cm2 fluence.

O.&T----------------------------------~ ~(a) ---4-- (b)

0.55 ---Q- (c)

> ---A- (d) ~ - 0.5 ~

.2> cu

:::t: ~ 0.45

·;:: .... ca m

0.4

300 310 320 330 340 350 360 370 380

Temperature (K)

Fig. 7. Barrier height of Zn093 Li00p thin films before and after electron irradiation.

(a) Unirradiated (b) 3 X 1012 (c) 3 X 1013 (d) 3 X 1014 electron/cm2•

19

The calculated ideality factor and barrier height as a function of temperature for different

irradiation fluence are shown in Fig. 6 and Fig. 7, respectively. After electron irradiation, the

rpB is found to decrease with increase in the fluence, 11 is found to increase with increase in

the irradiation fluence. The change in the barrier height after irradiation indicates change in

electrical properties and the changes are attributed to the introduction of defects in the interface. 1-V characteristics are affected by the interface states, which act as trap centers. The increase

in the density of the interface states results in an increase in the ideality factor and lowers the barrier height [14]. The increase in density of interface states is due to the creation of defects

after electron irradiation in the crystal lattice. This could be seen by photoluminescence and Raman spectrum. From the ideality factor it is clear that there are defects produced after

irradiation. These produced defects are ascribed to the Lii or Zni or Oi etc. Further studies are on to investigate the type of defects created upon electron irradiation.

4. Conclusions

Photoluminescence studies of the LZO thin films after e-irradiation exhibit a blue shift. Raman

spectrum confirmed that there were no changes in the structure of LZO thin film and no stress or strain was developed in the film after irradiation. The appearance of a peak at 73 7 cm-1 after electron irradiation is attributed to the multiple phonon scattering processes. I­

V characteristics show increase in the ideality factor and decrease in the barrier height; it

was attributed to the increase in the density of the interface states which lowers the barrier

height.

Acknowledgment

This work was carried out under the Project No. 2009/34/13/BRNS supported by the Board

of Research in Nuclear Science, Department of Atomic Energy, Bhabha Atomic

Research Centre, Mumbai (India). The authors thank Dr. Ganesh Sanjeev, Microtron Centre, Man galore University (Man galore) for extending the Microtron facilities.

References

1. Ozgur U, Alivov Y. A, Liu C, Teke A, Reshchikov M. A, Dogan S, Avrutin V, Cho S. J and Morkoc H. J. Appl. Phys. 98 041301 (2005).

2. Ahmad A, Pan C, Zhao J, Iqbal J and Zhu J, Mat. Chern. and physics 120 319 (20 1 0).

3. Look D.C, Coskun C, Claafan Band Forlow G.C, Physica B 32 340 (2003).

4. LookD.C, Reynolds D.C, Hemsky J.W, Jones R.Land Sizelove J.R,Appl. Phys. Lett.75 811 (1999).

5. Biradar B, JaliV. M, B Murali, KrupanidhiS. Band Sanjeev G. Adv. Mat. Res. 699257(20 13).

20

6. Zeng Y. J, Ye Z Z, Lu J G, Xu W. Z, Zhu L. P, Zhao B. H and Limpijumnong S App. Phy. Letters89 042106 (2006).

7. Vanheusden K, Warren W L, Seager C H, Tallant DR, Voigt J A and Gnade BE J. Appl. Phys.79 7983 (1996).

8. Son N. T, Ivano I G, Kuznetsov A, Svensson B. G, Zhao Q X, Willander M, Morishita N, Ohshima T, Itoh H, !soya J, Janzen E, Yakimova R J. Appl. Phys.102 093504 (2007).

9. Jothilakshmi R, Ramakrishnan V, Thangavel R, Kumar J, Sarua A and Kuball M,J. Raman Spec .. 40 556 (2009).

I 0. Senthilkumar K, Tokunaga M, Okamoto H, Senthilkumar 0, Lin J, Urban B, Neogi A and Fujita Y, Phys. Status Solidi C 7 1586 (2010).

II. Tsenga Y. C, Lin Y.J, Chang H. C, Chen Y.H, Liu C. J and Zou Y. Y, Journal of Luminescence 132 1896 (2012).

12. Physics of Semiconductor Devices, SzeS.M, Second ed., Wiley,Inter. Science, New York (1981).

13. Card H.C and Rhoderick E.H, J. Phys. D: Appl. Phys. 4 1589 (1971).

14. KrishnanS, Sanjeev G and PattabiM,N ucl. In st. and Meth. Phys. Res. B,266621 (2008).

****

21

Methicillin resistant Staphylococcus aureus: From Prevalence to Molecular characterization and Morphogenesis in response to

methicillin antibiotic Manjunath C1, Rahul K1, A jay K 0 2 and Chandrakanth Kelmani. R1 *

1Department ofP.G. Studies and Research in Biotechnology, Gulbarga University, Gulbarga, Karnataka , India

2V.G. Shiv dare College of Arts, Commerce & science , Solapur, Maharashtra, India

*Corresponding author email: ckelmani@gmail.

Abstract

Methicillin resistant Staphylococcus aureus (MRSA) is the major threat that caused due to uncontrolled use of antibiotics causing huge loss in health and wealth, so understanding their prevalence is required if public health is concerned. The aim of this study was to determine the prevalence of methicillin resistant MRSA among the clinical samples obtained from various hospital and health care centers of the Gulbarga region in India. All the collected samples were subjected for the isolation of S. aureus. Isolated S. aureus were further characterised by conventional and molecular methods then performed their antibiotic profiling. Further, the response of methicillin antibiotic on cell morphology was studied using scanning electron microscopy. A total 126 S. aureus were isolated from the clinical samples which showed, 100% resistant to penicillin, 55.5% to oxacillin, 75.3% to ampicillin, 70.6% to streptomycin, and 66.6% to gentamicin, 8.7% to vancomycin and 6.3% to tecoplanin. The selected MRSA strains possessed mecA (gene coding for penicillin binding protein 2A) andfemA (factor essential for methicillin resistance) genetic determinants in their genome. Further, the methicillin response in resistantS. aureus showed enlarged and malformed on cell morphology. The rate of methicillin resistance among S. aureus isolates has considerably increased in recent days, so; our study beneficial to assist and improves in beta-lactam therapy, especially in the case of multiresistant staphylococcal variants such as MRS A.

Keywords: Staphylococcus aureus, Methicillin resistant Staphylococcus aureus, Coagulase and Protein A (Spa).

1. Introduction

The fight between humans and tiny creatures called microorganisms (especially the pathogenic microorganisms) is from ancienttimes. The discovery of first antibiotic penicillin by Alexander Fleming ( 1928) started the golden era of antibiotic, everything seemed to be controlled well, but soon because of widespread and uncontrolled use of penicillin, the golden age came to end as microorganism became resistant to them. Not only penicillin various other antibiotics

22

have also become resistant, which increased the high morbidity and mortality [1]. Among various drug resistant microorganisms methicillin-resistant forms of Staphylococcus aureus (MRSA) are a major threat causing a wide range of infections from skin to pneumonia [2,3]. Since its first report in years 1961 till now its prevalence has increased drastically causing various health problems worldwide [ 4,5] so, studies in understanding its prevalence are required if public health is concerned [6]. In this regard, the present study is an attempt towards understanding (a) The prevalence ofMRSA in Gulbarga region, India. (b) To understand the response of methicillin on various forms of S. aureus.

2. Materials and Methods

2.1 Isolation and identification of S. aureus

In this study, a total126 strains of S. aureus were isolated from different clinical sample like pus, blood, and other exudates collected from different hospitals and health care centers of Gulbarga region India, during the period from March 2012 to April20 13. The preliminary identification of S. aureus was done using mannitol salt agar which was detected by changes in color of the medium from red to yellow due to mannitol fermentation. Further, the S. aureus were identified based on cultural, morphological, and biochemical tests. Standard strainS. aureus (MTCC 96) was obtained from the Microbial Type Culture Collection and Gene Bank centre, Chandigarh, India and used as control.

2.2 Antibiotic susceptibility test

The phenotypic detection ofMRSA was done by an antibiotic susceptibility test performed using eight antibiotics discs which include penicillin, ampicillin, gentamicin, streptomycin, kanamycin, tecoplanin, methicillin and vancomycin (Hi-media, Mumbai) and used as recommended by the Clinical and Laboratory Standards Institute (CLSI) guidelines [7] by the agar disc diffusion method.

2.3 Minimum inhibitory concentration (MIC)

The MIC is defined as the lowest antibiotic concentration with no visible growth. Based on the MIC values i.e. MIC in the range of 0.5- 4.0 11g/mL and MIC above 16 11g/mL with respect to oxacillin antibiotic the S. aureus were considered as methicillin sensitive S. aureus (MSSA) and MRSA respectively. The MIC was determined by agar dilution method using the CLSI guidelines on plates of Muller-Hinton agar containing serial two­fold dilution. Bacterial suspension incoulum equivalent to 0.5 MacFarland standard and then inoculated on the surface of muller hinton plates, with the help of sterile cotton swabs overnight incubation at 37°C, zone of inhibition around each antibiotic was measured with the help of zone measuring scale (Himedia) and recorded.

2.4 Response of antibiotic on S. aureus morphology

The antibiotic response on S. aureus morphology was determined using scanning electron microscopy (S-200C scanning electron microscope). The isolated MRSA, MSSA and standard control MTCC 96 were grown on Brain Heart Infusion (BHI). The bacterial cells from each culture were recovered by centrifugation at 6000 RPM for 5 minutes and the cells were washed twice with potassium phosphate buffer (50 mM, pH 7.0). Bacterial

23

cells were fixed by immersing in 2.5% glutaraldehyde in potassium phosphate buffer (50 mM, pH 7) for overnight at 4°C. Then the specimens were washed twice with buffer and dehydrated by ethanol series (v/v) ranging from 30%,40%, 50%, 60%, 70%, 80%, 90% to 100%. For SEM analysis, all the specimens were dried to the critical point, coated with gold. The cell volume and surface area obtained from SEM photograph were directly measured and calculated by using the following equations;

V (f.l m3) = 4/3 m 3,

a ( f.l m2) = 4nr2;

Where "r" is the radius, "V" is volume and "a" is surface area. The average cellular volumes and surface areas were calculated by using 30 individual bacteria per population. Cells showing deformations were not considered. The mean values were calculated from SEM photographs by taking 3 0 bacteria per population. Statistics were calculated using the ANOVA using excel2007 [8, 9].

2.5 Preparation of Chromosomal DNA.

Cells from an overnight culture in BHI broth collected by centrifugation were suspended in lysis buffer (phosphate-buffered saline [PBS] containing 1% sodium dodecyl sulfate [SDS] and 100 f.lg/mL Proteinase K). The cell suspension was incubated at 3 TC for 1 h, and an equal volume of phenol:chloroform (1: 1) mixture was added to the cell suspension and vortexed. The samples were centrifuged, and the aqueous phase was transferred to a fresh tube. The DNA was precipitated by the addition of 100 f.!L of 3M Sodium acetate and 3 volume of chilled absolute ethanol; the DNA pellet was washed twice with chilled 70% alcohol, air-dried, and suspended in 50 f.!L ofTE buffer (10 mM Tris-HCl [pH 8.0], 1 mM EDTA) f101.

2.6 PCR for detection of coa, spa, femA and mecA

For all molecular studies five highly resistant isolates designated as VMRSA 102 VMRSA26, MRSA09 MRSA 10, MRSA20 were selected. The identification of Coagulase (coa) and the X region of the protein A (spa) gene were amplified by PCR using the forward primer 52 -CAAGCACCAAAAGAGGAA -32 and the reverse primer 52 -CACCAGGTTTAACGACAT -32 for coa and the forward primer 52 -AGACGATCCTTCGCTCAGC -32 and reverse primer 52 GCTTTTGCAATGTCATTTACTG -32 for spa. The PCR was performed according to the procedure of [ 10, 11] respectively.

The presence of the mecA (gene coding for penicillin binding protein 2A) and femA (factor essential for methicillin resistance) genes were amplified by PCR using the forward primer 52 -ACTGCTATCCACCCTCAAAC-32 and the reverse primer 52 -CTGGTGAAGTTGTAATCTGG-32 for mecA and the forward primer 52-AAAAAAGCACATAACAAGCG-32 and the reverse primer 52 GATAAAGAAGAAACCAGCAG-32 for femA. The PCR was performed according to the procedure of f10l. The amplified products were purified and run on the 1% agarose gel containing ethidium bromide and observed the bands under UV transilluminator and recorded the number of bands and their positions.

24

3. Results and discussion

3.1 Antibiotic profile and resistance rate among the S. aureus isolates

In this study, a total of 126 S. aureus were isolated from the clinical samples collected from various hospitals and health care centres of Gulbarga region, India. All the S. aureus isolates were subjected to antibiotic susceptibility testing and results showed in Table (1a, b). Among 126 S. aureus 53.9% of isolates were found to methicillin resistant, which were mainly isolated from pus and blood samples. Antibiotic resistant profile of S. aureus isolates showed 100% resistant to penicillin, 55.5% to oxacillin, 75.3% to ampicillin, 70.6% to streptomycin, 66.6% to gentamicin, 8.7% to vancomycin and 6.3% to teicoplanin.

Table la: Distribution of S. aureus isolates in clinical samples

Sl. no Clinical Sample No of strains isolated No ofMRSA(%) 1 Pus 56 38 2 Urine 24 09 3 Blood 30 16 4 Sputum 11 03 5 Miscellaneous 05 02 6 Total 126 68

In our earlier 2008 study conducted in the same region the prevalence rate was 35% [12] However, recently the prevalence rate was reported 42% from other parts oflndia [13]. So our study shows an alarming high incidence rate of MRSA in Gulbarga region when compared with other parts of India [12, 13]. The increase rate of the prevalence may be due to inadequate use of antibiotics, lack of awareness and unethical treatment before coming to the hospital have been contributing factors. On other hand there maybe a chance of emerging new strains with MDR in nature through horizontal gene transfer.

Table lb: Antimicrobial resistance rate among the S. aureus isolates

Antibiotics No of resistance strains Percentage(%) P-lactam

Penicill in(1 Ounits) 126 100 Oxacillin (1 meg) 70 55.5 Methicillin ( Smcg) 68 53.9 Aminoglycosides Gentamicin (1 0 meg) 84 66.6 Streptomycin ( 10 meg) 89 70.6 Ampicillin (1 0 meg) 95 75.3 Glycopeptides Vancomycin (30mcg) 11 8.7 Teicoplanin (30mcg) 08 6.3

25

3.2 Mininimum Inhibition concentration (MIC)

Out of 126 strains of S. aureus 68 were MRSA, and 58were MSSA. Further based on

the MIC results MRSA isolates were classified as low-level oxacillin resistant (n = 30)

strains (MICs ranged from 16 to> 128 flg/mL) and high-level oxacillin resistant strains

(n =38; MIC > 128flg/mL). The highest and lowestMICs for MRSAisolates were recorded

as 720flg/mL for the isolates VMRSA 102 and 16flg/mL for MRSA8 isolates. The rate

ofMIC was found to be similar to earlier reports [12].

3.3 Response of antibiotic on S. aureus morphology

The changes inS. aureus cell morphology noted as an adaptive response to overcome the

adverse environmental conditions mainly occurred due to antibiotic stress in this study

and this response has already been reported with several bacterial species [14, 15]. In

order to evaluate the antibiotic response on S. aureus morphology SEM was carried out

and summarized in Table (2). The results showed MRSA cells altered their morphology

with respect to MSSA and standard S. aureus MTCC 96. The cell morphology of both

MSSA and MTCC 96 cells were apparently normal (Fig. 1 a, b), but enlarged and

malformed in the MRSAcells (Fig. 1c). The change in the morphology may be occurring

due to antibiotic stress; the increase in cell size reduces the relative contact surface and

consequently reduces the attachable surface for organic (antibiotic) compounds. Therefore,

bigger cells can tolerate the stress conditions better than normal cells of the same species

[16, 9]

Table 2: The mean cell size of MRSA and MSSA

Bacterial Radius" (!lm) Volumeb(f!m3) Surface area Strains (f!m2)

MTCC 96 0.346±0.0 158 0.177±0.0239 1.49±0.151

MSSA 0.343±0.023 0.164±0.025 1.48±0.265

MRSA 0.453±0.0316 0.399±0.076 2.59±0.354

a Volume, b surface area is calculated by using formula as described in materials and methods each mean value, was the average of30-cell size based on the scanning electron microscopy photos.

26

Fig 1: Scanning electron micrographs of S. aureus cells (a)MTTC 96 (b) MSSA (c)MRSA. Bar 1 11m

3.4 Detection of coa, spa, femA and mecA

The production of coagulase, an important feature used worldwide for the identification and virulence factors of S. aureus. The five selected isolates VMRSA I 02, VMRSA26, MRSA09 MRSA I 0, and MRSA20 were coagulase positive. Though the five isolates were coagulase positive, but the coagulase gene can be differentiated from each other on the basis of the presence of PCR products and their size. A single PCR product from MRSA I 0 and MRSA20 strains was amplified by the amp Iicon size of270 bp, while two PCR products were amplified from VMRSA I 02, VMRSA26 and MRSA09 strains and their sizes approximately ranged from 270 and 500 bp (Fig 2). The strain VMRSA I 02, VMRSA26, MRSA09 gave rise two amplified PCR product, that strongly suggest these S. aureus isolates have more than one allelic form of the coagulase gene compare to a single PCR product obtained from MRSA 10 and MRSA 20. Further, our results moderately correlating with the earlier reports [ 1 7].

The polymorphic X-region was used for detection of the protein A gene (spa). All the five strains were tested for protein A positive gave rise to single PCR product of 300 bp Fig (3). Mainly because the lack of allelic form of the protein A gene, the result correlates with earlier reported [ 18].

27

SOObps

270bps

2 3 4 s 6

IOOOObps

300bps

Fig 2: PCR products of coa gene of methicillin resistantS. aureus isolates on 1% agarose gel Lane 1-3 VMRSA102, VMRSA26, MRSA09 showing two bands at 270 bps & 500bps and Lane 4-5, MRSA 10, MRSA20 showing single band corresponding to 270 bps and Lane-6-Marker-High range ON A Ruler( 1 OObp-1 Okb)

l OKbp

300bps 300bp~

l OObps

Fig 3: PCR product of spa 300bp of methicillin resistantS. aureus isolates on 1% agarose gel Lane 1-5 VMRSA102, VMRSA26, MRSA09, MRSA10, MRSA20 all showing single band at 300 bps and Lane-6-Marker-High range DNA Ruler(100bp-10kbp)

The presence of the mecA, considered as the rapid and the gold standard for identification of MRSA strains [IOJ, Another genefemA, cooperates with mecA which appears to be a unique feature of S. aureus, and serves as a species identification marker [19, 20]. The five selected isolates VMRSA 102, VMRSA26, MRSA09 ,MRSA 10 and MRSA20 found to be mecA andfemA positive. The size of the amplified products for mecA and femA was 130 bp and 170 bp respectively (Fig. 4& 5).

28

2 3 4 5 6

10kbb

130bp 200bp

Fig 4: PCR products of the mecA gene of methicillin resistantS. aureus isolates on I% agarose gel Lane 1-5 VMRSAI02, VMRSA26, MRSA09, MRSAIO, MRSA20 and Lane-6-Marker-High range DNA Ruler( I OObp-1 Okbp)

2 3 4

170bp ..,..._

5 6

10Kbp

200bp

100bp

Fig 5: PCR products ofthefemA of methicillin resistantS. aureus isolates on I% agarose gel Lane 1-5 VMRSAI02, VMRSA26, MRSA09, MRSAIO, MRSA20 and Lane-6-Marker-High range DNA Ruler(IOObp-IOkb)

4. Conclusion

In conclusion the rate of methicillin resistance among S. aureus isolates has considerably increased in recent days, so; our study beneficially helps to assist and improves in beta-lactam therapy, especially in the case of multiresistant staphylococcal variants such as MRSA.

Acknowledgement

We gratefully acknowledge help from the Microbiology, Gulbarga University, Gulbarga for this work. We express our sincere thanks to Dr. Nagveni shivshetty Research Associate,

29

L.V. Prasad Eye Institute, Hyderbad and Dr. Rajeshwari for helping us with valuable guidance and suggestions during the progress of this work.

References

1. Alexander Fleming, Br. J. Exp. Pathol, 3 226 (1929)

2. Lowy, F.D, N. Engl. J. Med, 339, 520 ( 1998)

3. Chambers, H.F, N. Engl. J. Med, 352, 1485 (2005)

4. Barber, M, J. Clin. Pathol, 14:385 (1961)

5. Sfeir M, Obeid Y, Eid C, Saliby M, Farra A, Farhat H and Mokhbat, J. E, Am. J. Infect. Control. 42: 160 (2014)

6. Cailin Liu, Zhong-ju Chen, Ziyong Sun, Xianju Feng, Mingxiang Zou, Wei Cao, Shanmei Wang, Ji Zeng, Yue Wang and Mingyue Sun. Journal of Microbiology, Immunology and Infection, 10: 1016 (2014)

7. Clinical and Laborataory Standards Institute 27: M100-S 17 (2007)

8. Neumann G, Veeranagouda Y, Karegoudar T B, Sahin 0, Mausezahl I, Kabelitz, N, Kappelmeyer U, Heipieper H. J, Extremophiles, 9, 163 (2005)

9. Rajeshwari H, Nagveni S, Ajay Oli, Deepti Parashar and Chandrakanth K. R,World. J. Microbial. Biotechnol, 25: 2263 (2009)

10. Arakere G, Nadig S, Swedberg G, Macaden R, Amarnath S. K, and Raghunath D, J. Clin. Microbial, 43: 3198 (2005)

11. Shopsin B, Gomez M, Montgomery S.O, Smith D. H, Waddington M, Dodge D.E, Bost D. A, Riehman M, Naidich S, and Kreiswirth, B.N, J. Clin. Microbial, 37:3556-3563 (1999)

12. Raju S, A jay Kumar Oli, Patil S. A, Chandrakanth, K. R, World. J. Microbial. Biotechnol, 26: 171 (2009)

13. Sangeeta J, et al., Indian. J. Med. Res, 137: 363 (2013)

14. Raju S, Gururaj Rao, Patil S. A, and Chandrakanth, R. K, World. J. Microbial. Biotechnol, 23:1227 (2007)

15. Antibiotics in Laboratory Medicine, Lorian V, Williams and Wilkins. Baltimore, (2nd ed), 515 (1986)

16. Peter Giesbrecht, Thomas Kersten, Heinrich Maidhof and J org Wecke, Microbial. Mol. Biol. Rev., 62: 1371 (1998)

17. Murat K, Burhan C, Vet J. 174,428 (2007)

18. Lange Carla, Cardoso Marisa, Senczek Dagmar and Schwarz Stefan, Veterinary Microbiology., 67: 127 (1999)

19. Unal S, Hoskins J, Flokowitsch J E, Wu C Y, Preston, D. A, Skatrud P. L, J. Clin. Microbial., 30: 1685 (1992)

20. Vannuffel P, Gigi J, Ezzedine H, Vandercam B, Delmee M, Wauters G, Gala J. L, J. Clin. Microbial., 36: 2864 (1995)

****

30

Influence of Alkali Elements on Dielectric and Ferroelectric properties of NBT composites

Raj ani Malathi, K. Kirana, G.S. Kumar and G. Prasad*

Department of Physics, Osmania University, Hyderabad, 500 007, India

*Corresponding author email: gudurup@gmail.com

Abstract

0.90NBT +0.1 OST and 0.90NBT +0.1 OCT (where NBT=Na05Bi05 Ti03, ST=SrTi03 and CT=CaTi03)

composites are prepared by solid state reaction method where individual powders are prepared with sol gel chemical route. XRD and SEM confirm the formation of composites. A dense microstructure with large grains was developed due to high temperature sintering. Dielectric and PE loops are studied as a function of temperature. The relative density, grain size, and ST concentration influenced the polarization properties of the specimens. The phase transition in NBT is associated with changes in alignment of dipoles into micropolar regions. For NBCT composite, the ferroelectric and polarization properties are degenerated. Activation energy of the composites was calculated using dielectric parameters.

Key words: NBT, ST, CT, Relaxor and PE loops

1. Introduction

Composites are playing a vital role in the fabrication of memory devices, industrial applications etc. Research on NBT based ferroelectric materials is being carried out for long time. NBT is a relaxor ferroelectric with rhombohedral symmetry [1]. It has a perovskite structure with a high Curie temperature (Tc=320°C). NBT has a relatively large remnant polarization of Pr = 38flC/cm2 and a high coercive field ofEc= 7.3MV /mat room temperature [2]. The substitution at A site in NBTcrystal structure with alkali ions show better results. The changes in polarization and ferroelectric properties ofNBT with Sr2+ and Ca2+ substitutions at A site were reported by many authors [3,4]. SrTi03 is an incipient ferroelectric with cubic symmetry and CaTi03 is also incipient ferroelectric with orthorhombic symmetry [5,6]. In the present work the polarization measurements are carried out with the composites prepared with NBT and ST showing good ferroelectric and dielectric properties. It is possible to exploit the advantageous properties of component phases in composite. This inspired the author to prepare the composites ofNBT-ST and NBT-CT ceramic composites and investigate the ferroelectric and conducting properties of these ceramics. From application point of view, studies ofpevoskite composites are important because the possibility of tailoring the properties.

2. Experimental

Composites are prepared using sol gel technique. From here after the samples 0.90NBT +0.1 OST, and 0.90NBT +0.1 OCT are named as NBST and NBCT. X-ray diffraction peaks are recorded using Pan Analytical X'pert plus Diffractometer, with Cu-Ku (1.54u) radiation, at room

31

temperature in the range of 1 ood"28d"80°, at a scan speed of 2°/min. SEM pictures of composites are observed using ZEISS EVO 18 special edition at SkV. EDS is recorded using oxford system attached to the electron microscope. Dielectric constant of silver coated samples is measured with HP 4192A LF impedance analyzer from room temperature to 400"C at 1kHz frequency. The heating rate is maintained at 2.5°/min. The instrument is interfaced with PC to acquire data using LAB VIEW software. Polarization of the samples is observed by using custom built automatic PE loop tracer of Marine India Ltd, working at 50Hz frequency.

3. Results and discussion

3.1 XRD

Figure 1 shows the X-ray diffraction patterns of the NBST and NBCT composites ceramics. Dual phase perovskite structure is observed for NBST and NBCT composites. The peaks are observed in the diffraction patterns of NBST composite show both rhombohedral and cubic phases. Rhombohedral and orthorhombic peaks are observed for NBCT composite. The dual phases in XRD are conformed to the SEM micrographs. Densities of the ceramic composites are measured by Archimedes principle and are compared with X-ray densities and these are more than 90%. The lattice parameters are obtained by using POWD software are a=5.496A0 and c=13.5929N for NBT.

NOT IIBST IIBCT

i" i" 0

i: i: :::) :::)

~ ~ .! .! :e - :e ~ N

0 ~ .a- ~. J ~j

N .a-N 1 "iii - ft "iii 1:: 1::

1 1 • • .E .E

t0203U40~601080 to 20 30 40 ~ 60 10 uu to 20 3U -10 ~ 60 10 uu 28(degree) 28(degree) 28(degree)

Fig 1: XRD pattern ofNBST and NBCT samples.

3.2 SEM

Figure 2 shows the SEM pictures ofNBT and composites. The image ofNBST composite shows the presence of two different grain morphologies indicating existence of both NBT and ST phases. The spherical grains indicate NBT phase. Long grains shows the presence ofST phase in the samples. Small amount ofCT in NBTresults in smaller grain size. The grain morphology ofNBCT sample show low density and high porosity when compared to NBT and NBST sample. Asymetrical grains are observed in NBCT sample.

32

Fig 2: SEM micrographs ofNBT, NBST and NBCT.

3.3 Dielectric properties

....

Figure 3 shows the dielectric measurement plots for the composites. NBT graph shows the presence of two transitions. The two transitions represent FE-AFE (Ferroelectric­Antiferrroelectric) and AFE-PE (Antiferroelectric-Paraelectric) transitions which are observed ~200°C and ~320°C. NBST composite shows similar dielectric response with NBT. As for the NBT, near 200°C and 320°C two transitions observed for NBST. This type of behavior is observed in case of solid solutions [6]. Enhanced dielectric properties ofNBST sample is due to Sr ions present in the sample strengthen the Ti06 octahedral. Relaxation observed at transition peak for NBST indicates the composition fluctuations present in the samples. NBCT sample show decreased dielectric properties because the lower polarizability nature ofCa ions [7]. CT in NBT transforms the micro polar regions to nano polar regions which results the decrease of polarization in the sample.

MIT

&

~~. ~ .. ~---~---------, • 5k . "'" ""

·~~~~~~~~~ =¥1t:UD-400-COfOO:-q,QtrSt

Ternperatum(K} Temp;m~ttml{K) .... -

Ternpera!IJm(K}

Fig 3: Dielectric constant vs temperature graphs for NBT, NBST and NBCT

3.4. PE loops

Figure 4 shows the variation of polarization with electric field for composites at room temperature. The loop area of the composites is varying with ST content in the samples. The remnant polarization and coercive field of the samples also changes with ST content. Pure NBT shows no saturated loop. ST phase in NBT matrix reduces the ion migration

33

in the samples and enhances the ferroelectric properties and hence saturated PE loops are observed. Whereas for CT addition in NBT leads to decrease the ferroelectric properties. Ca ions compress the oxygen octahedral leading to decrease of the ferroelectric nature. Addition of paraelectric phase causes decreased ferroelectric properties in the samples.

"'" 4""-

E"''" 0 c ..... 0

;-t---Yfl--t--Hi!l-----1

"5-L,.

.. ~ ~ 4 ~ t ~ a a • Electlic fiGid(ltvlm}

Fig 4: Polarization vs electric field loops ofNBT, NBST and NBCT samples.

The conductivity of the samples is calculated by using the equation, crac = 2IIf£0 £tan8, where f is frequency, £0 the permittivity of free space, £the dielectric constant and tan8 the dissipation factor. The dielectric constant and dissipation factor valued obtained from dielectric measurement is used to find the conductivity values. By plotting the log conductivity versus 1 000/T graph activation energies of the samples are obtained. The values obtained for NBT, NBST and NBCT are 0.42eV, 0.24eV and 0.15eV. The activation energies indicate that the multi valance ions and oxygen vacancies present in the samples. Conductivity ofNBT is more when compared to the conductivity of the composite samples. The addition of STand CT in NBT leads to decrease the conductivity ofNBT sample. The present samples sintered at higher temperatures and the measurement also performed with the variation of temperatures. These high temperatures enable the ions to migrate with different oxidation states which results in the creation of positive and negative charges. These charges are responsible for the observed conductivity changes of the samples. The conductivity ofNBT, NBST and NBCT samples are increasing with temperature.

4. Conclusions

The dielectric, ferroelectric properties and microstructures of NBST and NBCT ceramics have been studied in this work. The present investigations show that ST addition in NBT leads to enhance dielectric and ferroelectric properties of NBT. NBST sample show saturated ferroelectric loops indicated that the addition of ST improves the ferroelectric properties. The dielectric constant decreased and dielectric peak broadened by adding Ca. The addition ofCa in NBT weakens the ferroelectricity and induces paraelectric behaviour. For NBCT sample the Curie point does not change, but dielectric peak amplitude at Tc significantly lowered. The conductivity ofNBT decreased with STand CT addition.

34

Acknowledgements

The authors thank the University Grant Commission, New Delhi for providing the financial assistance.

References

1. Aparna M, Prasad G and Kumar G.S, Ferroelectrics, 324: 63 (2005)

2. J. Suchanicz, K. Roleder, A. Kania, J. Handerek. Electrostrictive strain and pyroeffect in the region of phase coexistance in Na0.5Bi0.5Ti03. Ferroelectrics.;77: 107 (1988)

3. Rajeev Ranjan, Rohini Garg etal, J. Phys.: Condens. Matter, 22: 075901 (2010)

4. Yuji Hiruma, Yoshitaka lmai, Yoshinori Watanabe, Hajime Nagata, and Tadashi Takenaka, Appi.Phys.Lett, 92: 262904 (2008)

5. Lemanov V. V., Ferroelecrrrcs, 226: 133 (1999)

6. Cavalcanate L.S eta!, Chern. Eng. J., 143: 299 (2008)

7. Seung-Eek Park and Kug Sun Hong, J. Mate Res, 12: 2152 (1997)

8. Y. Yuan, C. J. Zhao, X. H. Zhou etal, J Electroceram, 25: 212 (2010)

****

35

Characterization of key Enzyme 4-Hydroxyphenylacetic acid Hydroxylase from Klebsiella sp. GSK involved in Tyrosine­

Melanin Pathway Shrishailnath S. Sajjan, Anand N ayak and T. B. Karegoudar*

Department of Biochemistry, Gulbarga University, Gulbarga- 5 85106, Karnataka, India.

*Corresponding author email: goudartbk@rediffmail.com

Abstract

In this study, 4-hydroxyphenylacetic acid hydroxylase (4-HPA-hydroxilase) was isolated from Klebsiella sp. GSK. The enzyme involved in melanin biosynthesis pathway converts L-tyrosine to L­dopa then to melanin pigment. This enzyme was purified to its homogeneity by salt precipitation, ion-exchange and gel filtration chromatographic techniques. The purified enzyme showed sub units of 40 and 45 kDa on SDS-PAGE. 4-HPA-hydroxylase is a monooxygenase and showed the absolute recruitment ofNADH for activity. The optimum pH and temperature for its maximum activity was 7.0 and 20°C respectively. Km value for 4-HPA was 7.4 x 102 M. It was strongly inhibited by Ag2+

and Cd2+ metal ions and slightly with OTT and EDTA. Further, this enzyme serves as a good candidate in the formation of dihydroxyphenolic compounds in the biotransformation reactions.

Key words: Melanin, 4-Hydroxyphenylacetic acid hydroxylase, Klebsiella, biotransformation, L­dopa.

1. Introduction

The ability to produce melanin is widespread among microorganisms. From the chemical point of view the only common feature of microbial melanins is being a product of oxidative polymerization of various phenolic substances. Tyrosinases, laccases, polyketide synthases and 4-hydroxyphenylacetic acid hydroxylase (HPA), are the enzymes of microbial melanogenesis. The synthesis follows basically two procedures, which involves most commonly the oxidation ofL-tyrosine or L-3, 4-dihydroxyphenyl alanine, though other starting materials have also been used [1]. In Gram-positive bacteria, including thermophilic Bacilli, 4-HPA is metabolized through a meta-cleavage pathway with 3, 4-DHPA as the dihydroxylated intermediate and succinate and pyruvate as the final products [2]. The initial step in the aerobic catabolism of 4-HPA is carried out by hydroxy lases or monooxygenases, which introduce a single hydroxyl group into the phenyl ring according to the following reaction [3].

4-Hydroxyphenylacetic acid hydroxylase (HPA, EC 1.14.13.3), belongs to a separate family of hydroxylases [4]. Besides its main substrate, 4-hydroxy phenylacetic acid it catalyzes hydroxylation of other aromatic compounds, which leads to the formation of dibenzoquinone and other a-quinone derivatives, which then polymerize spontaneously to allomelanin-like polymers [5]. Tyrosine is also a substrate ofHPA, but (unlike tyrosinase) this enzyme does not contain copper, which does not increase its enzymatic activity. All subsequent steps in melanin

36

polymerization (oxidation and polymerization) are nonenzymatic. In the present manuscript we have isolated and characterized 4-HPA hydroxylase from Klebsiella sp. GSK.

4-HPA hydroxylase from Klebsiella sp . GSK

L-Tyrosine --------•

2. Material and methods

L-Dopa ----+ Melanin

DEAE-cellulose, G-75, 4-HPA, NADH, FAD, OTT and L-tyrosine were purchased from Sigma Chemicals. All the other chemicals were of analytical grade and commercially available.

2.1 Bacterial culture

Klebsiella sp. GSK was isolated from soil samples collected from agriculture crop field. Culture was grown in 250 ml Erlenmeyer flasks containing 100 ml of mineral salt medium (pH 7.2) supplemented with 55 mM glucose and 1.4 mM L-tyrosine. The medium was autoclaved at 15 psi (121 ac) for 20 min. Then these flasks were inoculated with the 2% inoculum and at 37 oc on a rotary shaker at 220 rpm for 72-96 hrs.

2.2 Preparation of cell-free extract

Cell-free extract was prepared from the bacterium grown in mineral salt medium containing 55 mM glucose and 1.4 mM L-tyrosine. Cells were harvested in mid-exponential phase by centrifugation at 5,500 x g for 10 min at 4°C and the resulting cell pellet was washed twice with 50 mM phosphate buffer (pH 7.0) and resuspended in the same buffer. The cell suspension was disrupted by sonication (Vibracell ultrasonicator model 375, USA) at a nominal power of70 W for 6 min periods; each period of disruption was followed by 1 min off cycle during which the disrupted cells and oscillator probe were cooled in ice. Unbroken cells and cell debris were removed by centrifugation at 19,500 x g for 30 min at 4°C. The resulting cell-free extract served as an enzyme source for all the subsequent studies.

2.3 Assay of 4-Hydroxyphenylacetic acid hydroxylase

The 4-hydroxyphenylacetic acid hydroxylase was assayed by monitoring rate of oxidation ofNADH spectrophotometrically at 340nm. An absorption coefficient= 6,220 M" em" for NADH was used for calculating the activity. The reaction was performed in 1.0 ml quartz cuvettes with a 1 em light path. Activity was assayed at 30°C by adding 10 fll 4-HPA(0.1 M) to 0.5 ml of a solution containing 50 mM sodium phosphate buffer (pH 7.0), 0.2 mM NADH, 0.6 flM FAD, and 50 fll of enzyme. Values were corrected for oxidation of NADH in the absence of substrate. A unit of activity is defined as the amount of enzyme that catalyzes the oxidation of I flM ofNADH/min. Protein concentration was determined by the method of Lowry et al. [6] using Bovine serum albumin as a standard.

2.4 Purification of 4-HPA-hydroxylase

4-HPA-hydroxylase purified by employing ammonium sulphate fractionation, ion exchange and gel permeation chromatography techniques. All purification procedures were performed at 4°C. To the cell-free extract (228 mg of protein) solid ammonium sulphate was added up to 50% saturation and the resulting precipitate was separated by

37

centrifugation at 19,500 x g for 30 min. Additional ammonium sulphate was then added to the supernatant to reach 70% saturation. The resulting precipitate was collected by centrifugation and dissolved in 50 mM potassium phosphate buffer (pH 7.2). The solution was then dialyzed overnight against 100 volumes of25mM sodium phosphate buffer, pH 7.0, containing 0.2 mM OTT and 1 mM MgS04 at 4°C. The dialyzed protein sample was loaded on to the diethylaminoethyl (DEAE)-cellulose column (3/30 em) operated on an AKTA basic FPLC system (GE Healthcare) equilibrated with the 25mM sodium phosphate buffer (pH 7.0), and the column was washed with 500ml of the same buffer. Protein was then eluted with a linear gradient of 0 to 1.0 M NaCl in 25mM buffer, and active fractions of 2 ml were collected at a flow rate of 1 ml/min. The active fractions were pooled and applied to the G-75 column (previously equilibrated with buffer and air free packed) and the column was washed with 500 ml of this buffer. Most of the protein applied to the column was removed in the first 70 ml collected at this stage, and these fractions were completely devoid of 4-HPA-hydroxylase activity. After the remaining 74-85 ml of elute emerged, essentially free from unwanted protein, the enzyme was eluted with 12 ml of the phosphate buffer mixture containing 4-HPA-hydroxylase, were collected at a flow rate of30 ml/h. Activity was confined to middle fractions, these were pooled. The active fractions were analyzed for protein concentration then protein was dialyzed and concentrated by reverse osmosis.

2.5 Polyacrylamide gel electrophoresis

Protein purity and subunit structure were determined in 12% gel according to Laemmli [7] using Bio-Rad mini prot instrument. The separating gel consisted of 12% polyacrylamide and the stacking gel consisted of 5% polyacrylamide. The sample (12 f!l) and 8 fll of sample buffer with 50 mM Tris HCl (pH 6.8), 10% SDS, 0.1% bromophenol blue, ~-mercaptoethanol, and glycerol was loaded into the well, molecular mass markers were run parallel to the samples. An electric current of I 00 V was supplied using a Bio­Rad power pack. The gel was stained using CBB and then distained using a mixture of methanol, glacial acetic acid, and distilled water ( 4: I :5).

To determine the native molecular weight of the protein electrophoresis under non­denaturing conditions was performed in 10% (w/v) acrylamide slab gel using a Tris­glycine buffer, pH 8.3, using Bio-Rad mini prot instrument to examine the final enzyme preparation for its purity. Protein bands were stained with Coomassie Brilliant Blue (CBB) R-250.

2.6 Effect of pH and temperature

The optimum pH of enzyme activity was examined at pH range of 4.0-10.0 under standard assay conditions. 50 mM various buffers were used: citrate (pH 4.0-5.0), sodium phosphate (pH 6.0-8.0), tris base (pH 9) and glycine NaOH (pH 1 0.0). The effect of temperature on enzyme activity was performed at temperatures ranging from 1 0-70°C in 50 mM sodium phosphate buffer at pH 7.0 the enzyme activity was measured under standard assay conditions.

38

2. 7 Substrate specificity and kinetic parameters

The activity of purified enzyme was determined using different substrate analogues ( 4-HP A, 2-HP A, L-Tyrosine, Phenyl alanine, Tyramine, Dopa, Dopamine, 3-HBA, 4-HBA, 3-Cl BA,2-carboxy PA, Mandellic Acid, 2,4-DHBA) under the optimum conditions.

The Michaelis-Menten kinetic parameters Km and Vmax were estimated by using 4-HPA as substrate. These reactions were performed with various concentrations of substrate from 1 mM to 1 0 mM under the optimum conditions of activities.

2.8 Effect of metal ions and inhibitors The effects of various metal ions (Hg2+ Cu2+ Fe2+ Mg2+ Mn2+ Pb2+ Cd2+ Zn2+ Ag+ ' . ' ' ' ' ' . ' ' ' Sn2+) and inhibitors (EDTA, OTT, P-mercaptoethanol) on the enzyme activity were determined by measuring the activity of the enzyme in the presence of 1 mM metal ion or chemical in the reaction mixture using 50 mM sodium phosphate buffer, pH 7 .0, under the optimum conditions.

3. Results

3.1 Purification of 4-HPA hydroxylase

The 4-HPA hydroxylase received attention because it is an intermediate enzyme in the metabolism ofL-tyrosine to L-dopa then to melanin pigment. The bacterium, Klebsiella sp. GSK produces 4-HPA hydroxylase within two days. The 4-HPA hydroxylase was purified from a cell-free extract to near homogeneity. Many contaminant proteins were removed by 50-70% ammonium sulphate precipitation, approximately 61.2% yield was obtained. The dialyzed protein sample was then subjected to DEAE cellulose column. The elution pattern of 4-HPA hydroxylase enzyme using DEAE-cellulose is shown in figure 1. 4-HPA hydroxylase activity was observed in fraction numbers 68 to 76. These fractions collectively yielded 45 .2%. The dialyzate from ion-exchange chromatography was concentrated to a small volume by reverse osmosis and subjected to gel filtration on a G-75 column for further purification to attain homogeneity. In this second step of purification (G-75 gel permeation chromatography), 3.1 fold of purification and overall yield of approximately 23.8% were observed (Table 1 ). The procedure yielded 18 mg of purified enzyme from 2 liter of culture spent medium, and the recovery of 4-HPA hydroxylase total activity was 130 IU (Table 1). After simple purification steps, PAGE and SDS-PAGE of the final enzyme preparation showed a single band. The molecular mass ofthe sub units of purified enzyme was 40 and 45 kDa (Fig. 2).

Table 1. Purification of 4-Hydroxyphenylacetic acid hydroxylase from Klebsiella sp. GSK

Step Protein (mg) Total Specific Activity Yield(%) Fold Activity Purification

Crude Extract 228 542 2.3 100 ---50-70% (NH4)2S04

94 332 3.5 61.2 1.5 precipitation

DEAE-Cellulose 56 245 4.3 45.2 1.8 G-75 18 130 7.2 23.8 3.1

39

A unit (U) of activity was defined as the amount of enzyme that catalyzes the oxidation of 1 11mol ofNADH per minute. Specific activity was expressed as units per milligram of protein.

""u a ))1:4

mAU 'N.O!

-2.100

-llOO

1000

""'

Fig.l: Elution profile of protein and 4-HPAhydroxylase activity profile. DEAE-cellulose ion exchangen chromatography (A). Gel permeation chromatography (B). Highlighted peaks showed the enzyme activity.

A B c 0 E

kDa

116

66

45

35

25

18

Fig. 2 SDS-PAGE analysis and purification of the 4-HPA hydroxylase from Klebsiella. sp. GSK: Lane A, molecular mass markers; lane B, soluble crude extract from GSK; lane C, Ammonium salt precipitation 50-70%; lane D, DEAE-cellulose fraction; lane E, Purified 4-HPAhydroxylase subunits.

40

3.2 Effect of pH and temperature on 4-HPA hydroxylase activity

4-HPA hydroxylase from Klebsiella sp. GSK is optimally active at pH 7.0 (Fig. 3) and thereafter activity of the enzyme gradually decreased. Optimum temperature for 4-HPA hydroxylase activity was found to be at 20°C (Fig.4).

120

_100 *-->- 80 .t:: .:! t:l 60 ltl Q.l

,;:: 40 ...

ltl Qj 0::

20

0

4 5 6 7 8 9 10

pH

Fig. 3 Effect of pH on 4-hydroxyphenylacetic acid hydroxylase activity.

120

100 -~ -~ 80 ·:; +=i u 60 I'll

CLI :>

+=i 40 ..!!! CLI a:

20

0 0 10 20 30 40 50 60 70 80

Temperature (0 C)

Fig. 4 Effect of temperature on 4-hydroxyphenylacetic acid hydroxylase activity.

41

3.3 Substrate specificity and determination of kinetic parameters

Kinetic parameters Km and Vmax of 4-HPA hydroxylase is shown in figure. 5. 4-HPA hydroxylase had a higher affinity towards 4-HPA (Km 7.4xl 0-2). 4-HPA hydroxylase showed affinity for structurally analogue compounds namely 3-HPA, 2-HPA, L-tyrosine, dopamine,

0.006

0.005

;::. 0.004 s

0.003 u <(

0.

-0.75 -0.5 -0.25 0 0.25 0.5 0.75 1.25

1/S (4-H PA mM)

Fig. 5 Km and Vmax for substrate 4-hydroxyphenylacetic acid.

mandellic acid, hence the enzyme showed good activity with these substrate. Likewise, the enzyme converted 3-HBA and 4-HBA to the product 3, 4-DHBA.

Table 2. Enzyme activity using different substrate analogues.

Substrates

Blank

4-HPA

2-HPA

L-Tyrosine

Phenyl alanine

Tyramine

Dopamine

3-HBA

4-HBA

3-CI BA

2-Carboxy PA

Mandellic Acid

2,4-DHBA

42

Relative activity (%)

00

100

77

80.5

68.5

68

100

70.5

70.5

67

77.5

92

65

4.

3.4 Effects of inhibitors and metal ions

The effect of different inhibitors and metal ions on 4-HP A hydroxylase activity is depicted in table 2. Among inhibitors tested, EDTA, P-mercaptoethanol and DTT did not inhibit the 4-HPA hydroxylase activity. Among the metal ions tested on 4-HPA hydroxylase activity, cadmium and silver ions (Cd2+ Ag+) completely inhibited enzyme activity. Significant inhibitory effect was also observed in the presence ofSn2+, Pb2+, Hg2+, Fe2+, Mg2+, Mn2+and Zn2+.

Table 3. Effect of different metals ions and inhibitors on 4-HPA hydroxylase activity.

Metal Relative

ions/inhibitors activity (%)

None 100

Hgz+ 40

Cu2+ 12

Fe2+ 39

Mgz+ 33

Mn2+ 27

Pb2+ 48

Cd2+ 00

Zn2+ 27

Ag+ 00

Sn2+ 75

P-Mercapto ethanol 62

DTT 73

EDTA 65

Discussion

The 4-HPA is an inducible enzyme. L-tyrosine synephrine, 4-HPA [8] and phenolic amines are the known potent inducers of this enzyme production [9]. 4-HPA of Klebsiella sp. GSK is inducible, the potent inducer in this organism is L-tyrosine. The enzyme was reported to be unstable [9, 1 0]. However, in our study it was stable up to 30 days or even more with gradual loss of activity in the presence of OTT and Mg2+ ions at 20°C. 4-HPA hydroxylase from P putida is a dimer with total molecular weight of 90 kDa [8] and Adachi et al [ 1 0] reported partial purification of this enzyme from P ovalis, wherein the enzyme precipitated in two different fractions and the combination of both fractions was essential for the activity. Hence,

43

it was suggested that 4-HPAhydroxylase might consist of two components. 4HPAhydroxylase of Klebsiella sp. GSK is also a dimer with sub units 40 and 45 kDa. However enzyme is obtained as a single, homogeneous fraction. After simple purification steps, the purified enzyme showed a single band in native PAGE and two bands SDS-PAGE. The enzyme requires NADH for its activity like in P. oval is [I OJ and P. putida [8] unlike in gram positive bacteria, where NADPH carried out the hydroxylation [11].

In P. putida [8] the enzyme was drastically inhibited by Hg2+ and Cu2+ ions but not by Mn2+, Mg2+, Fe2+ and Fe3+. It is evident that 4-HPA hydroxylase from other microbial sources like Pseudomonas putida shows pH of7.5 and temperature of 40 and 45°C [8, 12]. Similar to our results, 4-HPA hydroxylase from Pseudomonas putida does not inhibited to OTT and 8-mercaptoethanol, but it was inhibited to mercury and copper ions [8].

4-HPA hydroxylase, the range of applications of this enzyme is very wide; there is always a scope for novel enzyme with better characteristics, which may be suitable in the diverse fields of applications. Furthermore, it was noted that the enzyme was stable up to 30-40 days at-20°C. Polymer synthesis mechanism implies hydroxylation of the substrate, if it is monohydroxylated, and its later oxidation, resulting in compounds with a high capacity to polymerize. This mechanism would be similar to that of the tyrosinase in the synthesis of melanins. Nevertheless, in this process the copper ion in the active tyrosinase plays a relevant role in binding the phenol group of the substrate. 4-HPAhydroxylase does not contain copper in its structure; thus, the substrate binding must involve a different mechanism [5].

Melanin pigment protects from UV-visible light, extreme temperatures [13] and readily interacts with free radicals and other reactive species due to the presence of unpaired electrons in their molecules [14]. Such broad specificity has already been reported in E. coli, which shows hydroxylase activity for p-chlorophenol and p-cresol [15], and to flurophenylacetic acid [8].

5. Conclusions

4-HP A hydroxylase from bacteria other than its substrate ( 4-HP A) it can show good activities with L-tyrosine to convert L-dopa which is a good pharmaceutical agent to prevent Parkinsons disease. 4-HPAhydroxylase enzyme has been described as exhibiting broad substrate specificity. From the industrial application point of view, it could also help establish a protocol for the biosynthesis of melanin pigment and dihydroxyphenolic compounds from different precursors, such as L-tyrosine and monohydroxy phenolic compounds Bacterium possessing 4-HPA hydroxylase are able to convert monohydroxy phenolic compounds to dihydroxy phenolic compounds thus be performed in environmentally friendly conditions and used for industrial applications other than melanin biosynthesis.

Acknowledgments

Shrishailnath Sajjan wishes to thank Indian Council ofMedical Research (ICMR), New Delhi for financial assistance in the form of SRF. The work in the TBK lab is supported by UGC­SAP, New Delhi, India.

44

References

1. Prota G, Melanins and Melagenesis, Academic, San Diego, 1992.

2. Ali S, Fernandez-Lafuente Rand Cowan D.A, Enzyme Microbial Techno!, 23:462 (1998).

3. Dagley S, Advan Microb Physiol, 6, 1 (1971).

4. GibelloA, Suarez M, Allende JL, Martin M (1997)Arch Microbiol167: 160 (1997)

5. Gibello A, Ferrer E, Sanz J and Martin M, Appl Environ Microbial, 61: 4167 ( 1995).

6. Lowry O.H, Rosebrough N.J, Farr A.L and Randall R.J, J Bioi Chern, 19:,265 (1951).

7. Laemmli U.K, Nature, 227,680 (1970).

8. Raju S, Kamath V, Vaidyanathan C, Biochem Biophys Res Commun, 154:537 (1988).

9. Cusky S.M and Olson R.H, J Bacterial, 170: 393 ( 1988).

10. Adachi K and Takeda Y, Biochim BiophysActa, 93: 483 (1964).

11. Sparnins V.L and Chapman P.J, J Bacterial, 127: 362 (1976).

12. Alberto F and Jose M, Ferns Microbial Lett, 157: 47 (1997).

13. JenningsA.C, Anal Biochem, 118: 396 (1981).

14. Plonka P.M and Grabacka M, Acta Biochim Pol, 53: 429 (2006).

Prieto M.A, Perez-Aranda A and Garcia J.L, J Bacterial, 175: 2162 (1993).

****

45

Standardization of N al (Tl) based Gamma Spectrometer at the

Environmental laboratory for activity measurements S. Rajesh 1, Avinash PR1, Santosh Teerthet, B. R. Kerur1; S. Anilkumar2 and

N arayani Krishnan2

1Department ofPhysics, Gulbarga University, Gulbarga, Karnataka-585 106, India 2Radiation Safety System Division, BARC, Mumbai-400 085 .India

*Corresponding Author: Email: kerurbrk@yahoo.com

Abstract

The natural radionuclides 238U, 232Th are embedded in geological materials in low quantities, which continuously emit ionizing radiations through the various daughter products of the decay chain. In the present work the performance of the newly installed 4 "x4" Nai(Tl) based gamma ray spectrometer in our laboratory was studied for its use in environmental radioactivity measurements. Standard procedure was followed for the collection and preparation of sample for gamma spectrometric measurements. The spectrum was analyzed using a PC based 1 k MCA (winTMCA 32 scinti SPEC). The analysis of complex spectra from the detector due to 238U, 232Th and 4°K was carried out by least squares method. The same samples were also analyzed using a high resolution HPGe detector based gamma spectrometer and the results obtained were in agreement, validating the method of analysis of environmental radioactivity using Nal(TI) detector and subsequent analysis of spectral data by least squares method. It is also important to note that Nal (TI) detector can be used instead of HPGe detector, which is very costly and difficult to maintain in remote areas. Though the resolution ofNal (Tl) detector is poor, it is more efficient for the higher energy detection, which also contributes to improved detection limits for natural radionuclides.

1. Introduction

Radiations present in environment comprise the terrestrial and extraterrestrial radiations. The natural radionuclides 238U and 232Th are embedded in geological materials in low quantities, which continuously emit ionizing radiations through the various daughter products of the decay chain. The gamma radiations emitted from 238U, 232Th decay series and 4°K present in soil, rock, sand and other environmental materials contribute significantly to the collective dose received by organisms [ 1]. Earlier researchers have found out few regions in world including India with high radiation background areas [2]. Gamma spectrometric features such as high resolution, large photo peak efficiency etc makes gamma ray spectroscopy an important tool in the field of environmental radioactivity measurements. The purpose of the study was to investigate the performance of newly installed 4" X 4" Nal (TI) gamma spectrometry system to be used for analysis ofradionuclides in environmental samples.

46

2. Experimental

2.1. Sample collection and preparation

In the present work 20 environmental samples have been collected from North - East Karnataka region according to ASTM procedure. The only constraints that no sampling site should not be taken close to a field boundary, road, tree, building or other obstruction was chosen for sampling. For soil sample collection an area of 0.5 m X 0.5 m was marked carefully and all the debris was cleared to a few centimeter depths. Collected soil samples were mixed thoroughly in order to obtain a representative sample of that area. These samples were crushed to fine powder and made to pass through a 200 mesh sieve and air dried using hot air oven at 383 K for 24 hr. The powdered soil samples were transferred to 250 mL plastic containers and were labeled with information such as location, time, date, depth of core and area sampled following a coding procedure. The containers were then firmly sealed with an adhesive araldite for secular equilibrium prior to gamma spectrometric measurements. Each of the environmental sample remained for four weeks which is the sufficient time required to attain a secular radioactive equilibrium after their progeny [3]. If a system is closed for a significantly larger period than the half-life of the daughter nuclide, the system will approach secular equilibrium, i.e. the activities (rates of decay) of the parent and the daughter will tend to equality. The geographic coordinates and elevation was taken with a Garmin portable hand held GPS.

2.2. Gamma Ray Spectroscopy

Gamma spectroscopy using either scintillation or semiconductor detectors have been in use for decades in the identification and measurement of the activity levels of naturally occurring radioactive materials in soil and building materials. At the present time, there are two main gamma spectrometer materials of major importance: Sodium Iodide (N ai), and High Purity Germanium detector (HPGe ). Both of these spectrometers have their advantages and disadvantages. Nai offers higher detection efficiency, while HPGe detectors provide superior energy resolution [ 4]. This paper discusses the principle of the two main y-ray analytical techniques and their applications. Minimum Detectable Activity (MDA) of the HPGe and Nai (Tl) Gamma spectrometry system has been estimated with 95% confidence level. In both the detector geometry used is face to face geometry. The detector's diameter and thickness define the sensitivity. Thickness directly influences the energy beyond which the efficiency starts to decrease sharply [5]. Efficiency calibration curves are usually represented by expressing the efficiency as a function of energy. The generally accepted and simple expression is as follows [ 6]

In s = a1 + a2 In E

Where sis the absolute full energy peak efficiency; a1 and a2 are fit parameters; E is the energy (keY) of the corresponding gamma line.

The minimum detectable activity (MDA) is defined as the smallest quantity of radioactivity that could be measured under specified conditions, and is another factor which is an important concept in low level activity measurement. The MDA depends on the lower

47

limit of detection (LLD) and the counting efficiency of a counting system. The MDA is very important, particularly in environmental level systems, where the count rate of a sample is same as the count rate of the background. Under these conditions, the background is counted with a blank sample, such as empty box, and everything else that may be counted with an actual sample. The prominent gamma energies are showed in Table 1.

2.3. Nal (Tl) detector

Gamma spectrometric measurements were performed with a scintillation detector of high efficiency and low resolving gamma ray spectrometer. A 4"X4" Nal (Tl) detector (manufacturer by thermo fishers) was adopted and covered with 3" thick lead shield to reduce

Table: 1 Prominent gamma energies used for estimation of activity

Parent nuclide Gamma ray energy (ke V)

HPGe Detector N ai(Tl) Detector

352 23su 609.3 1764

1764

238.6

232Th 911

2614.5 583.2

2614.5 4oK 1460 1460

background radiations originating from the walls and cosmic rays [7]. Background activities obtained without sample for 232Th energy at 2614 keV was 0.06 counts /s. and subtracted to get the net count rate for each sample. The gamma ray spectrum was recorded using PC based multichannel analyzer winTMCA 32. The output from the detector was analyzed using a lk PC based multi-channel analyzer with a built in spectroscopy amplifier, efficiency calibration for the system was carried out using the standards uranium, thorium and potassium ore procured from International Atomic Energy Agency (IAEA) in geometry available for the sample. Experimental set up of the detector is as shown in Figure !.The analysis of complex gamma spectra from the detector due to 238U, 232Th and 4°K was carried out by least squares method [8]. The determination ofradionuclide activity in the soil sample was based on the, 1764 ke V, 2614 ke V and 1460 ke V gamma photo peaks emitted from 238U, 232Th and 4°K, respectively by sample counting of60,000 s to obtain gamma spectra with good statistics.

48

2.4. High Purity Germanium Detector

Gamma spectrometric measurements were performed with a high resolution coaxial semiconductor detector. The detector is a P-type HPGe with a total volume of 190 cm3

manufactured by Eurisys Mesures, France. The measured resolution of the detector is 2 keV for 1332 keV gamma-rays of 6°Co. The detector is shielded with 3" lead shield for reducing the background radiation. The output from the detector is analyzed using an 8 k PC based multi-channel analyzer with a built in spectroscopy amplifier. The multi­channel analyzer and detector bias PC AD DON cards have been installed into an industrial PC (made by Advantech) for continuous and stable spectrometry. The computer program SAMP05 is used for the analysis of closely spaced peaks in the spectrum. A performance test using the IAEA standard reference material Uranium Ore (RGU-1) was used for checking the efficiency calibration for the system. A total often prominent gamma energies from 226Ra, 214Pb and 2148i were used in the estimation of activities. The counting time for the each sample was selected to be 50,000 s to obtain gamma spectra with good statistics. The detector has a relative efficiency of I 0% compared toNal (Tl) detector.

Fig. 1. Photograph of experimental set up used in study.

3. Result and Discussion

3.1. Activity

The results of activity of natural radionuclides 238U, 232Th and 4°K using Nai (Tl) detector, and HPGe detector are shown in the Table 2. In Nai (Tl) detector activity of 238U ranged from 5.65 to 55.6Bq kg-1, activity of 232Th ranged from BDL to 94.3Bq kg-1, activity of 4°K ranged from 81.03to 481.4 Bq kg-1, Using HPGe detector, the activity of238U ranged from BDL to 55.6 Bq kg-1, activity of 232Th ranged from BDL to 114.4Bq kg-1, activity

49

Sample

No

01

02

03

04

05

06

07

08 09

10

II

12

13

14

15

16

17 18

19

20

of4°K ranged from 77.4 to 396.8 Bq kg-1.The world average radioactivity concentration ranges of 238U 232Th and 4°K in soil have been expressed as 25 (10-50), 25 (7-50) and 370 (100-700) Bq kg-1 respectively C9l. Activity comparison of 238U in Nai (Tl) and HPGe detector is as shown in Figure 2.

The minimum detectable activities (MDA) of the detectors are presented in Table 3. The activity concentrations in the study area for 238U, 232Th and 4°K suggest that they are within the world average for soils. In most of the soil samples studied the activity levels measured are relatively lower than the worldwide average [9].

Table: 2 Activity concentrations of the samples (Bq kg-1).

HPGe Detector I Nal (TI) Detector

Activity (Bq kg- 1)

4UK n~u nLTh 4UK n~u nLTh

297.0±41.2 15.0±2.6 1 7.3±3.2 174.7±8.4 22.5±0.8 16.9±0.5 123.1±36.9 17.0±2.5 25.1±2.9 149.7±8.0 28.3±0.7 22.4±0.5

119.8±37.8 BDL BDL 104.8±6.1 6.6±0.5 7.5±0.4

192.0±39.6 21.2±2.6 25.2±2.8 191.1±8.5 32.7±0.8 27.2±0.5

270.8±43.3 39.3±3.1 56.2±3.7 187.0±9.1 48.8±0.9 42.0±0.6

221.6±36.4 36.4±2.6 4 7.8±3.4 178.9±9.9 48.1±1.1 50.8±0.7

325.6±40.9 27.6±2.5 39.2±3.2 203.6±12.0 43.2±1.2 37.5±0.8

328.4±42.9 26.0±2.8 41.3±3.6 206.8±11.0 36.8±1.1 32.5±0.7

98.8 ± 34.5 18.2±2.5 25.1 ±2.2 118.1±11.0 31.2±8.1 30.6±5.4

152.4±37.8 13.9±2.4 20.6±3.0 129.2±7.9 23.8±0.7 20.4±0.5

81.7±34.00 22.8±2.5 29.8±3.1 107.6±7.7 28.4±0.8 27.6±0.5

77.4±32.15 BDL BDL 81.03 ±5.5 5.65±0.5 BDL

366.0±37.0 24.7±5.7 45.6±2.2 463.2± 9.7 39.8±0.9 20.5±0.6

282.4±33.1 24.2±2.5 58.8 ±2.3 239.9±17.4 31.9±1.4 53.0±1.2

396.8±34.0 27 .2±2.5 114.4± 2.5 282.1±24.5 31.4±2.1 94.3±2.0 386.3±34.5 24.9 ±2.4 49.6 ± 3.1 401.8± 7.1 24.2±0.6 42.4±0.5

274.8±32.0 45.4± 4.1 47.1±3.1 481.4±15.2 55.6±1.7 56.8±1.1 339.7±35.3 23 .I ±2.4 49.2± 3.2 336.4± 9.6 23.0±0.8 64.6±1.0

274.8±32.3 30.7±2.2 40.5± 2.6 147.8±12.0 53.8±1.1 50.0±0.8

365.8±37.0 24.7±5.7 45.6 ±2.2 463 .2±9.7 39.8±0.9 20.5±0.6

so

"' -"' r::r aJ <= 0

~ " Q) ()

" 0 (.)

~ ·s: ~ ::;:)

~

6 0

50

4 0

3 0

2 0

1 0

r====J H P G e De tecto r lc::::::::J N a I(T I) De tecto r I

10 11 12 13 14 15 16 17 18

Sam pie Number

Fig 2 Activity comparison of 238U in Nal (TI) and HPGe detector

Table: 3 Minimum Detectable Activity (MDA) of the HPGe and Nal (TI) detector

Rad ion uc I ides Minimum Detectable Activity (Bq kg- 1)

HPGe Detector NaT (TI) Detector 23su 0.98 1_7

232Th L24 3.1 4UK 23.75 7.9

4. Conclusion

The natural radioactivity study in the sample using the high resolution gamma ray spectrometry as well as high efficiency gamma ray spectrometry was performed. It is found that both the results are in agreement, validating the method of analysis of environmental radioactivity using Nai(Tl) detector and subsequent analysis of spectral data by least squares method. The granite samples exhibit an enhanced activity of uranium and thorium compared to the very low abundance of these elements observed in the mantle and earth's crust [10] and also for using these soils for construction purpose. It is also important to note that Nai(TI) detector can be used instead ofHPGe detector, which is very costly and difficult to maintain in remote areas.

Acknowledgement

The authors express their deep sense of gratitude to Board of Research in Nuclear Sciences (BRNS) for providing the financial support to carry out this work. The authors are also thankful to Dr. D N Sharma, Director, HS&E Group and Dr. Pradeepkumar, Head, RSSD, BARC, Mumbai for the continuous guidance and encouragement for the work.

51

References

1. Ramola, R. C., Gusain, G. S., Manjari Badoni, Yogesh Prasad, Ganesh Prasad and

Ramachandran T. V, J. Radio!. Prot. 28: 379(2008).

2. Chougaonkar M.P., Eappen K.P., Ramachandran T.V, Shetty P.G, Mayya Y.S., Sadasivan

S., Venkat Raj V, Journal ofEnvironmental Radioactivity. 71: 275 (2004).

3. Karahan and Bayulken, Journal ofEnvironmental Radioactivity. 47: 213 (2000)

4. Perez-Andujar A., Pibida L, Applied Radiation and Isotopes, 60: 41 (2004).

5. Hossain I, Sharip Nand Viswanathan K. K. Scientific Research and Essays Efficiency and

resolution ofHPGe and Nai(TI) detectors using gamma-ray spectroscopy. 7: 86 (2012).

6. International Atomic Energy Agency (IAEA) Vienna, (1989).

7. Anil Kumar S., Narayani Krishnan., Sharma D N., Abani M C. Radiation Protection and Environment. 24: 1 (200 1 ).

8. Rangarajan. C, et.al. Analysis of complex Nal(Tl) gamma spectra from mixture of nuclides, BARC Report, 68. (1973).

9. Sources and effects of ionizing radiation, United Nations Scientific Committee on the

effects of atomic radiation, New York, UN. (UNSCEAR) (2000).

10. Basavaraj R. Kerur, Tanakanti Rajeshwari, Rajesh Siddanna, and Ani! S. Kumar Acta Geophysica, 61: 1046 (2013)

****

52

Ethno-veterinary practices for the treatment of mastitis disease of livestock in Uttara Kannada District, Karnataka, India

Shivanand Dhanapal Payamalle, Abhishek Ashok Madiwal, Kadanthottu Sebastian Joseph, Smita S. Shinde, Aditya Jeevan Lengade, Vijayalaxmi S. Daudin, and H.

Niranjana Murthy*

Department of Botany, Karnatak University, Dharwad-580 003, Karnataka, India

*CorrespondingAuthor: Email: nmurthy60@yahoo.co.in

Abstract

The present study involved the documentation of ethno-veterinary medicines used for the treatment of mastitis disease of livestock in Uttara Kannada district, Karnataka, India. The information was collected through interviews of elder members of different communities, traditional healers, livestock owners, herdsmen using a well-structured questionnaire. The study revealed that 20 plants including Allium cepa L., Aloe vera (L.), Artocarpus heterophyllus Lam., Asparagus racemosus Wild., Boswellia serrata Roxb. ex. Colebr., Calotropis procera (Aiton.) R. Br., Curcuma longa L., Musa paradisica L., and Zingiber o.fficinale Roscoe were used in combination with other plant parts and other locally available ingredients in the preparation of medicine used as decoction or applied as paste onto the diseased udder. The study has suggested that these cost effective remedies may serve as alternative for allopathic treatments to cure mastitis.

Key words: Ethno-veterinary medicine, mastitis, medicinal plants, traditional knowledge.

1. Introduction

It has been realized that traditional medicines are going to play a very significant role in ethno­veterinary practices. These medicines are affordable, more effective, easily available and also able to fulfill the social and cultural needs of the rural and tribal people. It has been found that many of the locally available plants are in use by the traditional healers, hakims, vaidyas and ethnic societies of the world for the preparation of traditional medicines; therefore, it is essential to document all these useful plants and traditional medicines scientifically.

Mastitis is a complex udder disease that occurs in clinical and subclinical forms in livestock including buffaloes and cows. It is a worldwide problem of the dairy industry and prevalent in developing countries. It globally leads to losses of 53 billion dollars annually [1]. Traditional veterinary medicinal practices have rich heritage and being used for centuries when there were no veterinarians and rational drugs. Herbal medicines are inexpensive and are prepared from locally available material. Various researchers have [2-1 OJ documented folk veterinary medicines from different parts oflndia. However, no work has been carried out to document traditional medicines in the treatment of mastitis which is a major cattle disease in India. The present study was carried out to document the use of ethno-veterinary medicines for the treatment of mastitis (Kechala Baavu) of livestock in the Uttara Kannada district of Karnataka.

53

2. Methodology

The study was carried out in 22 villages of Uttar Kannada district, Karnataka, India. Uttara Kannada district lies between 13 55'- 15 31' north latitudes and 74 09' -75 04' east longitudes (Fig. 1). With prior informed consent, a total of 50 informants from 45 to 58 years (the gender distribution was 85% men and 15% women) were interviewed during January to December 2012.

A transect walk method of the Participatory Rural Appraisal technique has been adopted in the present field studies [ 4]. The transect walk method involves walking with local people through an area and discussing different aspects of traditional medicines and collection of plants with field notes. It was based on discussion with key research participants like elder members of different communities, traditional healers, livestock owners and herdsmen. The medicinal plants, formulation preparation, doses, and method of administration have been documented. During the study plant specimens were collected by preparing field notes and preserved in the form of herbarium specimens. The plants were identified by referring relevant floras, followed by matching the specimens with the authentic herbaria.

Karnataka Slate

Fig. 1- Geographical location ofUttara Kannada district where the traditional remedies for mastitis was documented

54

3. Results and discussion

The results are presented in Table 1 in which the traditional medicines, plant part(s) used, preparation methods, local and botanical names of plants are given. In the present study, 20 plant species have been reported to be used as medicine in combating mastitis oflivestock by informants were recorded. A total of35 formulae used plant products and more than one plant in each formula were used very frequently. The ingredients like salt, safflower cake, sheep's urine, honey, honey comb wax, lime water, ground nut oil, sesame oil, mud of termite mound, butter and sugar have been also used in the preparation of medicines.

Leaves and bark are being used as ingredients in majority of formulae (21.21 %) followed by the roots ( 18.18% ), tuber, rhizome, bark and whole plants ( 6.06% ), oil, flowers, bulbs and resin (3.03%). It has been noticed that most preferred method of remedy preparation is as decoction or feed for oral administration (7 formulae) and as paste/ointment (28 formulae) for the application to mastitis affected udder. The plant species with the most preparations were Allium cepa L., Aloe vera (L.), Artocarpus heterophyllus Lam., Mimosa pudica, Momordica dioica Roxb. ex Willd., Vitex negundo L., Boswellia serrata Roxb. ex. Colebr., Asparagus racemosus Wild., Calotropis procera (Aiton.) R. Br., Curcuma longa L., Musa paradisica L., Zingiber oificinale Roscoe. The present study showed that the combination of oral administration as well as surface application proved to be effective for curing mastitis.

Kumar and Bharti [ 4, 5] and Shah et al. [1 OJ reported several remedies for curing mastitis but all differ from those enumerated in the present study. The comparative analysis of the present study of20 plants species with previous studies conducted by different authors in India revealed that none of the plant formulations have been used similarly as used in the present study. Ramachandra et al. [11] reported that a mixture of Mimosa pudica, Caralluma laciantha and Curcuma Zanga is used for curing the mastitis. The antibacterial activity of Tabernaemontana divericata L. and Punica granatum L. used in folk medicine against the pathogens causing bovine mastitis was evaluated [12, 13]. A program to revitalize the ethno­veterinary traditions was initiated in 2001 by the Foundation for Revitalization of Local Health Traditions (FRLHT), Bangalore in collaboration with National Dairy Development Board (NDDB) and tested 3 formulations prepared from Wattakaka volubilis, Commelina bengalensis, Andrographis serpyllifolia, Allium sativum and Piper nigrum. This study showed that two formulations have supportive literary evidence from Indian Systems of Medicine and Modern Pharmacology [9]. The formulations reported in the present study were based on community's opinion and such validations should be carried out to prove the efficacy or safety uses of these preparations.

Mastitis is a serious disease in dairy animals causing great economic losses due to reduction in milk yield as well as lowering its nutritive value. There is no permanent cure for this disease in the modern medicine as the use of antimicrobials for long period may trigger the development of multi drug resistant strains which results in the use of increasing doses of antimicrobials causing a potential biohazard by increasing the amounts of drug residues in milk [14]. The local people have developed remedies due to inmate relationship with nature over a long

55

period of time. People ofUttara Kannada district ofKarnataka effectively used 20 different plants in various formulations for curing mastitis, the traditional knowledge of the area documented will help to provide information for curing mastitis. Further investigation of these herbal formulations for veterinary healthcare management will require safety and efficacy testing.

Table 1. Traditional medicines used in the treatment of mastitis of livestock in the Uttara Kannada district ofKarnataka

Sl. Plant Species Vernacular

No. used names

Allium cepa L. Eerulli

1. Liliaceae (Kannada),

Iravengaaya m

(Malayalam), Palaandu (Sanskrit), Onion (English)

Aloe vera (L.) Lolesara

2. Burm. f (Kannada), Liliaceae Kattar vazha

(Malayalam), Kumaari (Sanskrit), Aloe

(English)

Parts used Mode of preparation

Bulb The bulbs of Allium cepa smashed and mixed with turmeric powder and

pinch of salt, and the luke warm paste is applied onto the udder till the

swelling ofthe udder is reduced this therapy is followed twice a day before spawning.

Leaf The jelly mucilage from the inner mucilage portion of the leaves is applied onto

the teat or udder.

56

Leaves of Aloe vera, turmeric powder and few pinches of lime is mixed thoroughly and applied to the

udder for 5 - 6 times per day till disease is cured.

Mixture prepared of Aloe vera mucilage, boiled rice and calcium carbonate in equal quantity is fed to

the cattle once a day.

The paste is prepared from leaf mucilage, lemon juice and ginger is applied onto the affected udder.

3.

4.

5.

Artocarpus heterophyllus Lam.

Moraceae

Asparagus racemosus Wild.

Asparagaceae

Boswellia serrata Roxb.

ex. Colebr.

Burseraceae

Halas ina

mara

(Kannada),

Pilaava

(Malayalam ),

Panas

(Sanskrit),

Jack fruit

(English)

Aashaadi

beru

(Kannada),

Shathavali

(Malayalam ),

Shataavari

(Sanskrit)

Butter mill(

root

(English)

Maddi mara,

doopa

(Kannada),

Mukundam

(Malayalam ),

Sallaki

(Sanskrit),

Leaves and

inner part

of fruits

Roots

Fruit, Resin

and Bark

57

The paste ofinner part (endocarp) of

the fruit is applied onto the affected

area.

100 g of Asparagus racemosus roots,

200 g fruits of Mesuaferea, 200 g of

ginger and 125 g of Trachyspermum

ammi are crushed together and orally

administered with Bambu Iota

(Bamboo glass) as well as applied on

the udder as an ointment

The paste prepared from the root IS

applied twice a day to treat mastitis.

Five to six fresh young fruits, same

amount of fresh Anona reticulata seeds and 2-3 fresh Azadirachta indica seeds are crushed in a cupful

of sheep's unne to obtain extract

which is fed to cattle once daily up to

5-8 days to cure mastitis.

50 g bolus of stem bark is fed twice

daily for 3 days to control infectious

diarrhea at the time of mastitis.

The teat 1s massaged with honey

comb wax and then the smoke of

Boswellia serrata extract (Resin) is

given to the teat till the inflammation

or the swelling of udder is reduced.

Calotropis

6. procera (Aiton) R. Br Asci ep iadacea e

Bili aekkad gida (Kannada), Bel-erikku (Malayalam), Alaark

(Sanskrit), Swallow root (English)

Coccinia Tonde balli

7. indica wight & (Kannada), Am Kovillam

Cucurbitaceae (Malayalam),

Cucurbita

8. maxima Ouch. Ex. Lam Cucurbitaceae

Bimbee (Sanskrit), Ivy gourd (English)

Seegumbala

(Kannada), Mattanga (Malayalam ), Gudayogaphal a (Sanskrti), Plllllpkin (English)

Stem, The young shoots of Calotropis

Root Bark procera burnt to ashes and mixed with Semi carpus anacardiwn seed oil and IS applied to the teat and massaged before and after milking.

Leaves, Fruits and

Roots

Whole

plant

58

Root bark powder is soaked in butter milk and applied on inflammatory part or swelling portion till cured.

The mixture of Calotropis procera

root ash, turmeric powder, castor oil and albumin of hen's egg kept overnight in an air tight container.

The paste is formed applied to the affected udder.

Leaves or fruits or roots of Coccinia

indica, Momordica charantia and turmeric powder IS mixed and

applied onto the teat ofthe cattle.

The ash prepared from the dried plant

of Cucurbita maxima is mixed with butter and applied onto the affected udder till the inflammation or swelling is reduced.

10.

11.

Curcuma Arisina

9. longa L. (Kannada),

Zingeberaceae Kundamanjali

Datura

stramonium L. Solanaceae

Jatropa curcus

L.

(Malayalam),

Aneshta

(Sanskrit),

Turmeric

(English)

Bi li ummatthi

(Kannada),

Ummam

(Malayalam ),

Dhotthoora

(Sanskrit),

Thorn apple

(English)

Dodda haralu

(Kannada),

Euphorbiaceae Kaatalaavanak

ku (Malayalam ),

Daravanthi

(Sanskrit),

Barbidos nut

(English)

Rhizome Turmeric powder 1s mixed with

Bra5sica campestris oil and rubbed

to cure mastitis.

Young

leaves

Leaves

and

Roots

59

Turmeric powder is mixed with

Butter and applied onto the udder

two times a day till the inflammation

is reduced

Paste is prepared from the turmeric

powder and lime water is applied to

the affected udder and washed after

few hours this treatment is carried

out till the inflammation is reduced.

The paste prepared from turmeric

powder and rice is applied onto the

mammary glands till the swelling or

inflammation is reduced.

Leaves are cooked in water with a

pinch of lemon juice and given orally

to the cattle at the time of lactation

for the prevention of mastitis.

Leaves of Jatropa curcus and

Coccinia indica is mixed and applied

to the affected area to treat mastitis.

12.

13.

14.

15.

Mimosa pudica (L.)

Mimosaceae

Laajwanthi Whole Two handfuls of Mimosa pudica, 500

g Caralluma laciantha, one spoon turmeric powder and little bit of lime water are mixed together. This IS

smeared on the affected parts for one week

(Kannada ), plant

Momordica dioica Roxb. ex Willd.

C ucurbitaceae

Momordica ahyadrica sp.nov.

Teattavati (Malayalam),

Lajjalu (Sanskrit),

Touch me not plant (English)

Ghatta haaglau (Kannada)

Kaatu paaval (Malayalam)

Karkotaki (Sanskrit)

Ghatta

haaglau

(Kannada)

Cucurbitaceae Kaatu paaval (Malayalam) Karkotaki (Sanskrit)

Mus a paradisica L

Musaceae

Baale (Kannada),

Ettakkaaya (Malayalam),

Alabu (Sanskrit), Banana (English)

Tuber and Tubers or fruits are smashed and Fruit paste is applied to the teat of the

affected cow twice a day before

milking and milk is spawned out of the teat this IS done till the

inflammation is reduced.

Tuber and Tuber or fruit paste of Momordica Fruit sahyadrica sp. nov. applied to the

udder to reduce inflammation and

swelling.

Young Leaves,

Fruits and Inflorescen

ce

60

Banana fruit or young leaves are smashed in coconut or ground nut oil

and is fed to the cattle in order to reduce heat.

The inflorescence is burnt to ashes and mixed with cow ghee and applied to the udders.

16.

17.

18.

19.

Sesamum indicum L. Pedaliaceae

Sorghum alepense (L.)

Pers

Poaceae

Tamar indus indicus L

Ellu

(Kannada),

Chi tra y ellu

(Malayalam),

Til

(Sanskrit),

Sesame

(English)

Huchhujola

(Kannada),

Veerakaanda

k (Sanskrit)

Hunase

(Kannada),

Cesalpinaceae Aamlam

Vitex negundo L.

Verbenaceae

(Malayalam),

Amlika

(Sanskrit),

Indian date

(English)

Karilakki

(Kannada),

Nochi

(Malayalam),

Nirgundi

(Sanskrit),

Five leaved

chaste

(English)

oil

Root

Fruit

The seeds of Sesamum indicum grinded with ginger and garlic, paste

is formed which is warmed a little and applied to the infected udder 2 -

3 times a day

The sesame oil IS mixed with

turmeric powder, Aloe vera, salt and

honey bees and applied liberally over

the affected area for 7 days.

Root decoction is mixed with mud of

pond and pasted on teats of cattle to

cure Mastitis.

Trichodesma indica is hung in the entrance of cattle-shed and when

buffalos and cows pass through the

entrance, it IS believed by the

traditional practitioners that when the

mud-paste and this plant dry, the

symptom of mastitis diminishes

subsequently.

Fruit pulp IS taken out and equal

volume of brown sugar is added till a

uniform paste is formed and applied

to the swollen udder till the

inflammation is reduced.

Leaves and The paste of the root or leaves IS

roots applied to the teat of the infected

udder.

61

Zingiber Shunti Rhizome 125 g of finely ground rhizome IS

20. officinale (Kannada), mixed with sugar and given orally for Roscoe Andrakam 5 day for the treatment of mastitis Zingiberaceae (Malayalam),

Aradhak (Sanskrit),

Ginger (Eng)

Acknowledgement

Authors are thankful to traditional healers, livestock owners, herdsmen helped in this survey. Financial assistance in the form of research project DBT-KUD-IPLS [No. BT/PR14555/ INF /22/126/2010 of Department ofBiotechnology, New Delhi, India is gratefully acknowledged.

References

1. Ratafia M, Biotechnology, 5: 1154 (1987).

2. Ali Z.A, Fitoterapia, 70, 342 (1999).

3. Kumar A, Pandey V.C and Tewari D.D, Tropical Animal Health and Production, 44: 863 (2012).

4. Kumar Rand Bharathi K.V, Indian Journal ofTraditional Knowledge, 11: 288 (2012).

5. Kumar Rand Bharathi K. V, Indian Journal ofTraditional Knowledge, 12: 40 (2013).

6. Pande P.C, Tiwari Land Pande H.C, Indian Journal of Traditional Knowledge, 6: 444 (2007).

7. Rajakumar Nand Shivanna M.B, Indian Journal of Traditional Knowledge, 11,283 (2012).

8. Raj an Sand Sethuraman M, Indigenous Knowledge and Development Monitor, 5: 7 (1997).

9. Samthanakrishnan R, HafeelA, Hariramamurthi B.A, and Unnikrishanan P.M, Indian Journal of Traditional Knowledge, 7: 360 (2008).

10. Shah R, Pande P.C, and Tiwari L, Indian Journal of Traditional Knowledge, 7: 355 (2008).

11. RamachandraN .M, Vaishnavi V, Preethi K and Krishnamurthy Y.L, Asian Pacific

Journal ofTropical Biomedicine, 2: S470 (2012).

12. Gopinath S.M, Sunitha T.B, Mruganka V.D and Ananda S, International Journal of Research in Phytochemistry and Pharmacology, 1:211 (2011).

13. Gopinath S.M, Suneetha T.B, Mruganka V.D and Ananda S, Journal of Chemical and Pharmaceutical Research, 3: 514 (20 11 ).

14. Dhanabalan R, Doss A, Jagadeeswari M, Balachandar Sand Kezia E, Ethnobotanical Leaflets, 12: 1090 (2008).

****

62

Structural and magnetic properties ofLi-Zn ferrites Vinod kumar Rathodi, VM JaJil* and V AHiremath2

1 Department of Physics, Gulbarga University, Gulbarga 585 106, India 2Department of Chemistry, PDA College of Engineering, Gulbarga, India

*Corresponding author email: vmjali@gmail.com

Abstract

The present paper reports the structural and magnetic properties oflithium zinc ferrites. The ferrites, in varying compositions were prepared by the combustion synthesis method. Structural analyses were carried out employing XRD, Differential Scanning Calorimetry, FTIR and Scanning Electron Microscopy techniques. Using the Pulse Field Magnetometer, the magnetic hysteresis study was carried out. The results indicate the decreasing magnetization due to the substitution of a non magnetic Zinc ion.

Key words: Li-Zn ferrites, magnetic properties, structure offerrites, combustion synthesis

1. Introduction

Pure and substituted lithium ferrites are low cost materials having important magnetic and electrical properties for technological applications. Lithium ferrites have been used in many electronic devices for high frequency applications because of their high electrical resistivity, high Curie temperature and low cost [ 1]. As a number of factors can affect the performance of these devices, lithium ferrite is heavily doped to optimize their properties of interest [2]. Non-magnetic ion substituted lithium ferrites of different compositions have been prepared using different methods, such as conventional double sintering [13], hydrothermal, sol-gel [6], solid-state reaction of inorganic precursor [5,7,12] etc. Synthesis of lithium ferrites using these methods are time consuming and often sintered at high temperatures. The high temperature used in the above techniques lowers the magnetization due to either precipitation of a-Fe20 3 or the formation ofFe30 4 • The reduction ofFe3+to Fe2+ due to formation ofFe30 4can lead to an increased electrical conductivity which limits the use of these materials in microwave applications where high resistivity and minimum dielectric loss are required [ 1]. The combustion synthesis of materials is an advanced approach in powder metallurgy. This method of synthesis is a flexible approach, where precursors are mixed on the molecular level following a unique condition of rapid high-temperature reactions. The reaction is initiated by heating the precursor materials to a lower temperature for e.g. 250°C, then the reaction self sustains due to its exothermic nature. In this technique, nanoscale powders of desired composition can be synthesized in one step, avoiding additional calcination procedure [3]. Mixed ferrite powders with small and uniformly sized particles were successfully synthesized by Fu and Lin using combustion synthesis method [4]. Thus, the combustion synthesis method is promising for the synthesis of a variety of powder with fine microstructures and tailored properties.

63

Here, we report the combustion synthesis ofLi05_x12Znx Fe25_x12 0 4 with x=O.O, 0.2, 0.4, 0.6, 0.8 and 1.0. The samples were characterized for their structure, morphology and magnetic properties.

2. Experimental

Lithium zinc ferrite with general formula Li05_x12Znx Fe25_xf2 Oix = 0, 0.2, 0.4, 0.6, 0.8 and 1.0) were successfully prepared using combustion synthesis method. The stoichiometric amount of precursor materials such as Li2C03, ZnO and Fe20 3 (AR grade) were mixed and then thoroughly ground in agate-mortar for~ 1h. The grinding process was further continued for about 2h after adding polyethylene glycol (PEG, mol. wt. 6000) to the precursor mixture with a precursor to PEG ratio of 1:2. The resulting mixture was kept in an Alumina crucible and heated slowly to about 450 ac for 4 h. PEG melt around 75-80 oc and at about 300-450 oc the exothermic reaction is initiated and the reaction progresses further, until completion, within few minutes which produces the required Li-Zn ferrite powder. The resulting powder was then used for further investigation.

In order to understand the reaction process, thermo-gravimetric analysis (TGA) and differential scanning calorimetry (DSC) of the precursor material used to produce Li03Zn04Fe230 4 was carried out using LINSEIS STAPT 1600 and are shown in Fig. 1a and Fig. 1b, respectively. For the measurement, the above powder mixture was taken in Alumina crucible and the measurement was carried out up to 1000 oc at a heating rate of 20 ac/min with flow of air. A small endothermic peak was observed in DSC at about 75 oc without any weight loss which corresponds to the melting point of PEG. According to TGA, the mixture starts to lose weight slowly at 180 oc and continues to lose weight up to~ 450 oc, above which there was no apparent weight loss. It is clear that in the temperature range 180 - 450 ac there are two different processes occurring as the rate of weight loss above~ 290 oc decreases. The flash point ofPEG is known to be between 180-290 oc, i.e, within this temperature range the PEG starts to evaporate and forms an ignitable gas phase. Hence, the weight loss in the temperature range180-290 oc is due to the evaporation of PEG from the precursor mixture. At higher temperatures(> 290°C) the ignition of the evaporated PEG ignites the molten PEG in the solid precursors in the crucible and the reaction progresses by evolution of C02• The excess amount of the fuel is already evaporated leaving only small amount of PEG which wet the precursor particles. The rate of weight loss was found to be slow in the temperature range 290-450 ac in comparison to the temperature range 180-290 ac as the PEG slowly burns as the reaction front moves. Similar to the observation in TGA, in DSC we have observed two exothermic peaks in the temperature range180-300 oc and 300-500 oc, where the first exothermic peak corresponds to the flash point of PEG and the second peak correspond to the combustion process. From 300 octo about 400 oc the reaction slowly progresses and suddenly the whole amount of precursor turns to products at about 425 oc by releasing higher amount of heat within very short time and the reaction completes at about 500 oc resulting in the required products. The XRD patterns were recorded using Regaku Minitlex2 diffractometer using nickel filtered CuKa radiations. To study the morphology of the ferrites the SEM micrographs of the final products were recorded using ZEISS microscope with EDAX attachment. The SEM

64

micrographs were carried out in the secondary electron imaging model operated at 15 K. The FTIR spectra were carried out at room temperature using a Bruker Tensor 27, Fourier Transform Infrared (FTIR) spectrometer using KBr disc technique in the range 250- 1000 cm-1• The magnetization parameters were recorded using MAGNETAPulse Field Magnetometer.

"Kil I TG'\- O-ZfO+PEG)f<lW I

ff) l

a l

~ ffl-

CmblSiicn flUOOSS Iii

il \ 4s:l oorrplete .,_ \,/ JJ

1m :m 3JO 4)0 sm ffD

TIM'

11 I

Exothemic 4~~~

3JO OOC- [LZFOt PEG] RAW I : ··· ...

b / /

23"2575

100 3XJ :m <'(() 9.XJ axJ

Terrp

Fig. 1: TGA (a) and DSC (b) plots for the precursor mixture. 2. Results and Discussion

3.1 X-ray diffraction studies The XRD patterns of all the samples in the present investigation have been compared with the corresponding standard pattern given in ICSD code 9972 file and confirmed that all the samples are in single phase with spinel structure. The X-ray diffraction patterns are shown in Fig. 2. The lattice constant of all the samples were calculated by using the formula,

a= dhkl.Jh2 + k2 + 12 where, dhkl is the observed inter planar distance for hkl planes. The lattice constant increases with increase in zn+2 content and obeys Vgard's law.

0 0 "' 0

0 "' ~ -.t -.t -.t It) -.t x= 1.0

40 ..

50 ----="=11F"" io--

I x=O .8 I >- 40 50 60 70 t:: (f) ... ~ /0 x=o.sl z 40 50 w f-

::': 0lx=0.4

~ 3~ d~ sii ...... i olx=0.2 20 60

I 3~ .A. '46 5& ' .... 66 .... x=O .0 I 2'6 lo

2e

Fig. 2: X-ray diffraction pattern of Li05_x12Znx Fe25_x12 0 4 for x= 0.0 to x= 1.0

65

From the elemental analysis data shown in Table 1, It can be seen that the measured atomic percent are in agreement with the ideal atomic percent.

Table 1: Ideal atomic% and EDAX atomic% data.

Sample Element Idial Atomic% ED AX Atomic %

Fe 38.46 35.58 LiosF~s04 0 61.50 64.42

Fe 36.36 40.28 Li04Zno2Fe2404 Zn 3.03 3.39

0 60.60 56.33 Fe 34.33 34.94

Li03Zn04Fe2304 Zn 5.97 6.39 0 59.70 58.68 Fe 32.35 32.12

Lio2Zno 6F e2204 Zn 8.82 9.68 0 58.82 58.19 Fe 30.43 33.01

Li0 1ZnosFe2104 Zn 11.59 12.37 0 57.97 54.62

Fe 28.57 25.54 ZnF~04 Zn 14.28 16.22

0 57.14 58.24

3.2 SEM

SEM images reveal the agglomerated foaming network structure of irregular shaped particles with a wide distribution of particle sizes as shown in fig. 3. It was hard to obtain the particle size distribution, however according to our estimation the particle sizes vary between 140 - 200 nm. The crystallite size obtained from X-ray diffraction analysis varies between 40- 80 nm. This indicates that the particles are having a disordered surface or an agglomeration of few grains. For further investigation, the as synthesized samples are thoroughly ground to break the network structure.

3.3 FTIR

In ferrites, the metal ions are situated in two different sub lattices designated as tetrahedral (A-site) and octahedral (8-site ), according to the geometrical configuration of the oxygen nearest neighbor. The band around 600 cm-1 is due to stretching vibrations of the tetrahedral group (v1) and that around 400 cm-1is due to the octahedral group(vJ [8]. The FTIR spectra at Fig. 4 shows first primary band (v1) (tetrahedral) in the range750-534 cm-1 and lower frequency band (v2) (octahedral) in the range 480-250 cm-1 • Similar behavior was observed by Ravinder [13] and Wolska et al. [9]. The absorption band (v1) is slightly shifted to lower frequency side because ofthe fact that substituted Zinc ion preferably occupy the A-site and that, the difference in the basic average ionic radius of A-site cations (Fe3+ and Zn2+) is much larger than that of the B-site cations [Fe3+ and Li+].

66

(a) (d)

(e)

(c) (f)

Fig. 3: SEM images of Li(os-osx)Znx Fe(2 s-osx) 0 4 (a) x= 0.0, (b) x=0.2, (c) x=0.4, (d) x=0.6, (e) x=0.8 and (f) x=l.O

67

The increase in x (Zn content) at tetrahedral site increases the site radius, which in turn decreases the fundamental frequency and the displacement ofFe3+ions to octahedral site leads to an increase in the fundamental frequency with octahedral site being occupied by Fe3+ and Li+.

14

12

10

~ 0 w u c

~ 6 E en c ~ 4 I-

2

1 000 900 800 700 600 500 400 300

Wave number(cm-1}

Fig. 4: FTIR Specta of Licos-osx)Znx Fe(ls-osx) 0 4 (a) x= 0.0, (b) x=0.2, (c) x=0.4, (d) x=0.6, (e) x=O.S and (f) x=l.O

3.4 Pulse Field Magnetometer

The magnetization parameters such as saturation magnetization (M), remnant magnetization (M) and coercivity (HJ are presented in Table 2. It is observed that the M value decreased with increase in Zn2+ content due to the fact that the Zn2+ ion, which

s

is a non magnetic ion replaces a magnetic Fe3+ ion [1 0]. The hysteresis loops show clear saturation at an applied field of± 5k0e as shown in fig. 5. The loops are highly symmetric in nature. The behavior of coercive force (HJ could be explained by Brown's relation [11] given by

where, k1 is the anisotropy constant and flo is the vacuum permeability. According to this relation He is inversely proportional to M5 , which is observed in present study. He and Mr of Zn2+ substituted ferrites are lower than un substituted ferrites.

68

4. Conclusions

Lithium-Zinc ferrites with varying composition were synthesized at lower temperatures compared to the conventional combustion synthesis usually done at higher temperatures. Single phase spinel structure was confirmed and surface morphology revealed disordered.

Table 2: Magnetization parameters ofLicos-osx)Znx Fe(ls-osx) 0 4

Sample Ms Mr He emu/gm emu/gm Oe

1 LiosFe2.s04 79.53 24.47 98.33

2 Lio4Zno2Fe2404 80.57 22.31 97.78

3 Lio.3Zno.4Fe2304 73.34 25.49 131.11

4 Lio 2Zno 6F e220 4 55.05 17.20 140.55

5 Lio1ZnosFe2104 36.60 10.86 147.78

6 ZnF~04 14.80 03.21 150.55

Fig. 5: Hysteresis loops for Licos-osx)Znx Fe(ls-osx) 0 4 (a) x= 0.0, (b) x=0.2, (c) x=0.4, (d) x=0.6, (e) x=0.8 and (f) x=l.O

surfaces with agglomeration of few grains. Increase in Zn content at tetrahedral site increased the site radius. The pulse field magnetometer measurements indicate the decrease in magnetization due to the substitution of a non magnetic Zinc ion.

Acknowledgment

One of the authors (VR) is grateful to the authorities of the Govt. College, Gulbarga.

69

References

1. Paul D Baba,Gil M. Argentina, William E. Courteney, Gerald F. Dionne and Donald H. Temme, lEE TRANS. MAG, MAG-8, No.1(1972)

2. Baijal J.S, Sumitra Phanjoubam and Deepika Kothari, Solid State Communications, 83, No. 9, (1992)

3. Arvind Varma and Alexander S. Mukasyan, Korean Journal of Chemical Engineering, 21(2), (2004)

4. Fu Y.P and Lin C.H, Journal of Applied Physics, 105, (2009)

5. Jovic N, Prekajski, Kremenovic A,Jancar B, Kahlenberg V and Antic B, Journal of applied Physics, 111, (20 12)

6. Sutradhar S, Patil S, Charya S.A, Das S, Das D, and Chkrabarti P.K, Journal of magnetism and magnetic materials, 324, (20 12)

7. Kotnala R,K, Rekha Gupta, Jyoti Shah and Abdullah Dar M, Journal of Sol-Gel Science Technology, 64, (20 12)

8. Waldron R.D, Physical Review. 99, (1955)

9. Wolska E, Piszora P, Nowicki W, Darul J, International Jl. Inorg.Chem. 3, (2001)

10. Sangshetty R.M , Hiremath V.A and J ali V.M Bull. Mater. Sci. 34, 5 (20 11 ).

11. Coey J.M.D, Rare earth Permanent Magnetism John wiley and Sons, Newyork, 220 (1996).

12. Ibetombi Soibam. Sumtra Phanjoubam, and H.B Sharm. Physica B, 404, (2009)

13. Ravinder D, Materials Letters, 40, (1999)

****

70

Molecular Cloning, Sequencing and Characterization of Human

GAPDHgene Rashmi GadwaP*, Vinod P. S1, Tathagat Waghmare1, Manika Pal B2, and Utpal B3

1Department of Post Graduate Studies and Research in Biotechnology, Gulbarga University

Gulbarga 585 106, Karnataka, India 2Indian Institute of Chemical technology, IICT, Hyderabad,

3Centre for Cellular and Molecular Biology, CCMB, Hyderabad

*Corresponding author email: rashugi@gmail.com

Abstract

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a key glycolytic enzyme that catalyzes the reaction and plays a pivotal role in energy yielding process called glycolysis. Increasing evidence supports the notion that GAPDH is a protein with multiple functions, known as housekeeping enzyme, including its surprising role in apoptosis. The objective of present study includes isolation, cloning, sequencing and characterization of human GAPDH using different molecular biology techniques and Bioinformatics tools. The results of this study suggest that human GAPDH gene isolated could be used for gene therapy and drug discovery to cure many neurodegenerative diseases like Alzheimer's disease, Huntington's disease etc.

Keywords: GAPDH, glycolysis, Alzheimer's disease, glyceraldehydes-3-phosphate,pGEMT

1. Introduction

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a housekeeping enzyme, which is expressed in all prokaryotic and eukaryotic cells [ 1]. It is a key enzyme involved in glycolysis, which is active in all human and other mammalian tissues. It is especially important for anaerobic energy production in skeletal muscle, high levels of activity is found and in which GAPDH is identified as a major protein [6, 22]. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a tetrameric protein with identical subunits, each containing two conserved functional domains: a NAD binding domain, and a highly conserved catalytic domain [5].GAPDH is encoded by a single locus on the short arm of chromosome 12 and is synthesized as a single 3 7 kDa protein without alternate splicing in almost all the cell types of the body [7, 17].

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) plays an important role in glycolysis and gluconeogenesis by reversibly catalysing the oxidation and phosphorylation of D­glyceraldehyde-3-phosphate to 1, 3-bisphosphoglycerate [9].It is considered as a classical glycolytic protein involved exclusively in cytosolic energy production. However, recent evidence suggests that it is a multifunctional protein displaying diverse activities such as membrane fusion, microtubule bundling, membrane transport, RNase activity, phosphotransferase activity, nuclear RNA export, DNA replication, and DNA repair[14, 18].It has been suggested that

71

GAPDH plays an important role in sperm motility and mutation that alters GAPDH activity could lead to male infertility[ 1 0].

The enzyme has been found to bind to actin and tropomyosin, and may thus have a role in cytoskeleton assembly. Alternatively, the cytoskeleton may provide a framework for precise positioning ofthe glycolytic enzymes, thus permitting efficient passage of metabolites from enzyme to enzyme [16].

GAPDH plays a surprising role in apoptosis, the translocation ofGAPDH to the nucleus acts as a signaling mechanism for programmed cell death, or apoptosis [ 12, 13]. The accumulation ofGAPDH within the nucleus is involved in the induction of apoptosis, where GAPDH functions in the activation of transcription. The presence ofGAPDH is associated with the synthesis of pro-apoptotic proteins [ 1].

GAPDH is a crucial enzyme for all animals, protists, fungi, bacteria and plants. Therefore, there are lots of opportunities to draw more connections between the molecular aspects of GAPDH and its biomedical and evolutionary significance. For instance, the human GAPDH gene has been found to be highly expressed in 21 different types of cancer and that the control of glycolysis plays an important role in future cancer therapies. GAPDH is also thought to have roles in DNA replication and repair, cytoskeletal organization, and phosphotransferase activity.

Glyceraldehyde 3-phosphate (GAP) is invaluable to the second part of glycolysis. One of the unique features of GAP is its ability to have another phosphate added to it without having to consume anATP. The phosphorylation of GAP by GAPDH does not consume another ATP as in the earlier steps of glycolysis. In fact, the product of GAPDH reaction, 1, 3 bisphosphoglycerate (BPG) is such a high energy molecule which eventually acts upon by other enzymes of glycolysis to yield two ATP molecules. After the loss of its two phosphates (for making ATP from ADP), and other structural alterations, that three-carbon molecule becomes pyruvate which can be actively transported into the mitochondria for the other three stages of aerobic respiration.

GAPDH Reaction :

Glyceraldehyde 3-phosphate + NAD++ Pi'! 1, 3-bisphosphoglycerate + NADH + H+

Another important feature of the GAPDH reaction is the generation of reducing power in the form ofNADH. This coenzyme provides reducing power to hundreds of different enzymes involved in catalyzing oxidation-reduction reactions in the cell. The DNA sequence for the GAPDH gene that results from this exercise is important for several reasons. The basic structure of the GAPDH gene can be examined by looking at the DNA sequence. For instance, the location of specific introns and exons can be predicted using readily-available software. The amino acid sequence ofthe GAPDH gene product can also be predicted. Evolutionary differences between organisms can be studied by comparing plant GAPDH genes isolated by researchers working with other species. The biochemical characteristics (e.g. the active site) can also be deduced by aligning the sequences from numerous species and looking for areas showing high levels of consensus.

72

2. Materials and methods

2.1 Isolation of genomic DNA from human blood by standardized protocol:

Around 3m! of blood was obtained intravenously by a sterile I Om! disposable syringe and was transferred into a vacutainer tube coated with EDTA (anticoagulant) and was gently shaken. Later, the blood sample was transferred to 15ml Falcon tube and about 9ml ofELB solution was added and incubated on ice (to facilitate haemolysis) for about 3 0 minutes. After incubation, blood sample was centrifuged at 5 OOOrpm for 1 Omins at room temperature. Then the pellet was resuspended in little volume ofELB solution by vortexing and the final volume was made to 9ml by adding ELB solution. Again the tube was centrifuged at 5000rpm for 10mins at room temperature. Further the tubes were centrifuged to remove the considerable amount of erythrocytes. Then, about 3ml ofELB solution was added to the pellet along with 15 fll of Proteinase K ( 1 OOfll/fll) and 300fll of SDS (10%) mixed gently by inverting and incubated at 55°C for 2 hours in water bath. Later, the pellet was added with equal volumes of phenol-chloroform: isoamylalcohol (25 :24: 1) and then centrifuged at 1 O,OOOrpm for 1 Omins.

The upper aqueous layer was taken into separate tube and added with equal volume of chloroform: isoamylalcohol (24: 1) followed by centrifugation at 1 O,OOOrpm for 1 Omins. Further the supernatant was collected in a fresh tube and added with 1110 volume of 3M sodium acetate and then mixed by inverting. Two equal volumes of absolute alcohol was added, mixed by inverting and then centrifuged at I O,OOOrpm for 2m ins. Lastly, the pellet was washed 2 to 3 times with 70% alcohol followed by centrifugation. The pellet was then air dried to remove the traces of alcohol and dissolved in 300fll ofTE buffer (pH- 8). Finally, the tube was incubated at 65° C for 15mins to dissolve the DNA and stored at 4° C.

2.2 Purity check of isolated DNA sample

When DNA is isolated from organisms, frequently there remains protein present in the DNA solution; protein is tightly bound to DNA and complete removal of protein is not always possible. To determine the purity and concentration of the DNA solution, the absorbance of UV light is measured in a spectrophotometer. Both protein and DNA absorb UV light, but they have different absorbance curves. The peak oflight absorption is at 260nm (A260) for DNA and at 280nm (A280) for protein. By dividing the two absorbance values, one can calculate the purity of the DNA solution. The A260/280 for pure DNA is 1.8.

2.3 PCR amplification using specific primer:

Primer sequence:

Forward primer TGAAGGTCGGAGTCAACGGATTTG 24 base pairs.

Reverse primer TGATGGCATGGACTGTGGTCATGA 24 base pairs.

73

Table 1. Preparation of reagents

Initial Concentration Volume required (f.ll) Final concentration I OX PCR Buffer 2.5 IX 25mM Magnesium chloride 1.0 2.5mM 2.5mM dNTP's 2.0 20011M 1 Opm/fll primer ---+ 1.0 1 Opm/reaction 1 Opm/ f!l primer +- 1.0 1 Opm/reaction 1 OOnm/ f!l ON A temp late 1.0 1 OOng/reaction 1 Unit Tag polymerase 1.0 1 unit/reaction Distilled water 15.5 15.5 fll

Table 2. PCR programming

Initial Denaturation 95°C 5minutes Denaturation 95°C 30seconds Annealing 55°C 1 minute Extension 68°C 1 minute Final Extension 68°C 10minutes Storage 4°C

Number of Cycles= 35

Solution a: Dilution of DNA solution was done in the ratio (1 :3) using distilled water (2 fll DNA and 6 fll distilled water) and mixed thoroughly by vortexing followed by centrifugation using splash spinner. Solution b: Reagents were prepared according to Table 1 for PCR amplification of the sample. Further, previously diluted DNA solution ( 1 fll) (Solution a) was added to the reagents prepared (Solution b) followed by allowing the initial denaturation step to begin. After 5mins of initial denaturation, the tube was immediately kept in ice for about 1 min followed by addition ofTaq DNA Polymerase (1 f!l). Replacing the tube into PCR machine and pressing the START button. All the remaining steps will be automatically carried out throughout the 35 cycles (Table 2). After completion of35 cycles the process will be automatically halted and the PCR product obtained was stored at 4°C.

2.4 Electrophoresis of PCR product

1% agarose gel was prepared in IX TAE Buffer followed by addition of 1.5 f!l of ethidium bromide and comb, and then the gel was allowed to solidty. After solidification, comb was removed and placed the gel in electrophoretic unit with 1 X TAE as tank Buffer. Then 5 f!l ofPCR product added with 3 f!l ofgelloading dye (Bromophenol blue), totally, 8 f!l of mixed sample was loaded into wells and finally the gel was allowed to run at 1 OOV for 30 minutes. After 30mins the gel was docked in the documentation unit for band visualization. The single band obtained is the conformation for the presence of the gene.

Finally, the PCR product obtained was once again allowed to run along with the standard molecular weight markers (1 Kb) to determine the length of the gene.

74

2.5 Gel elution technique

Table 3. Preparation of reagents for Gel elution

Solution A Sodium Iodide 600fll (Elution Buffer) Solution B Glass milk 10 fll Solution C I OOmM NaCI, I mM EDTA, 50% 500 fll (Wash Buffer)

Ethanol Solution D Distilled water or TE Buffer 20 fll

2.5.1 Excising gel slice containing DNA of interest

Place the previously electrophoresed gel with DNA of interest on a clean UV Transilluminator and then excise the DNA with sterile scalpel and collect the band into a pre-weighed eppendorfftube.

2.5.2 Melting of agarose gel pieces

Determine the weight of the agarose gel band slice and add 3 volumes of Solution A for each gram volume of gel for DNA fragments I 00bp-4kb (for 0.2gm of gel piece adding 0.6ml of solution A) and then incubate the tube at 55°C for about I Om ins, inverting the tube briefly every 2-3m ins during incubation.

Note: SolutionA is a Chaotropic salt that breaks Hydrogen bonds that hold solidified agarose together. Once the gel is melted it will not re-solidify.

2.5.3 Binding of DNA

Add 10fll of solution B (depending upon the concentration of DNA) and then incubating the tube at 50°C for 3-Smins.

[Imp: Mixing several times during these binding steps by flicking the tube for small volume or shaking and inverting for large volumes. Here, DNA binds to silica in the presence of salt. If the silica is kept suspended during the binding step, the DNA is more likely to find an available binding site].

After incubation, Centrifuge the samples at 12000rpm for I minutes and then the supernatant was removed carefully with a pipette [The DNA that is bound to the silica is pelleted, salt and melted agarose are then discarded].

2.5.4 Washing Steps

The pellet was resuspended with 500fll of solution A and then centrifuged the solution at 12000rpm for 3 Oseconds [This wash step removes residual agarose contaminants]. Then, the pellet was washed twice with 500fll of Solution C followed by centrifugation at 12000rpm for 1min and carefully the traces of supernatant was removed using a pipette. [This step removes all the residual salt contaminants]. Finally, the pellet was air dried for about 1 0-15mins.

75

2.5.5 Eluting of DNA

For the elution of DNA, the pellet was added with Solution D (20111) followed by incubating at room temperature for 15-20mins [During this step DNA will get unbound from the silica particles and gets suspended in the medium]. After incubation, the suspension was centrifuged at 12000rpm for 30seconds and carefully transfered the supernatant into a fresh eppendorfftube. The supernatant contains the purified DNA. [DNA will suspend in solution and silica pellets down by centrifugation].

2.6 Insertion of gene into vector and ligation

To S11l of PCR product, 1 111 ligation buffer, 1 111 of enzyme ligase, 1 111 of vector ( pGEMT) and 2 111 of distilled water was added (Total10 111). The mixture was incubated at 4°C for 2 hours prior to the process of transformation.

2. 7 Competent cell preparation and transformation

2.7.1 Preparation of Competent cells

E. coli (DH5alpha strain) was grown in a plate which was maintained for about 16-20 hrs at 37°C. A single colony of E. coli was picked from a freshly grown plate and transferred into 1 OOml ofLB broth. The culture was then incubated for about 3hrs at 37°C with vigorous shaking (300cycles/min in rotary shaker). For efficient transformation, it was essential that the number of viable cells should not exceed 108 cells/mi. Hence the growth of the culture was monitored by determining the OD of0.6. Aseptically transfer the cells to sterile, disposable ice cold 50ml polypropylene tubes. Then the cultures were cooled to 0°C by storing the tubes on ice for about 10mins. The cells were recovered by centrifugation at 4000rpm for 10mins at 4°C in a small GS3 rotor. Later the media was decanted from the cell pellets and then allowing the tubes to stand in an inverted position to drain away the traces of media.

Further, the pellet was resuspended in 1Om I of ice cold 0.1 M calcium chloride and storing on ice. The cells were recovered by centrifugation at 4000rpm for I Om ins at 4°C in a rotor. The pellet was again resuspended in 23ml of ice cold 0.1 M calcium chloride for each 50ml of original culture.

2.7.2 Transformation

The prepared competent cells were taken in a pre-chilled eppendorfftubes and then kept on ice for 1Om ins followed by mixing evenly to suspend the cells. After mixing, 2111 of ligation mix was added to the cells and mixed gently using pipette followed by incubating the tubes on ice bath for about 30mins. Then, the tubes were placed in water bath for heat shock at 42°C for 90seconds followed by incubating the tubes on ice bath for about 2mins. After incubation, 60011l ofLB medium was added to the tubes and incubated at 37°C for 1hour.

76

To a premade LB agar plate containing the ampicillin to a final concentration of 100flgm/ml, 20fll ofiPTG(lOOmM) and 35fll ofX-gal(50mg/ml) was added and spreaded over the whole surface using a sterile glass spreader until the fluid is absorbed in the agar. Further about 350fll of transformed E. coli cells (DH5alpha) were spreaded on the agar plate until the inoculum gets absorbed. Then the plates were incubated in upside down position for 12-16 hours at 3 7°C in an incubator. After incubation, the plates were kept in 4°C for several hours. This allows the blue colour to develop fully. Colonies containing active Beta Galactosidase appear pale blue in the center and dense blue at their periphery. White colonies indicate the presence of recombinant vector and appear pale white in colour.

2.8 Isolation of recombinant plasmid

Around 3ml of overnight grown culture was collected in 1.5ml eppendorff tube and centrifuged at 1 O,OOOrpm for 2mins. After centrifugation, 1 OOfll of nuclease free water was added to the pellet and then vortexed to resuspend the pellet followed by the addition of 100fll of Lysis solution [10% SDS, 0.5M EDTA, 10N NaOH] to the tube, mixed by inverting and boiled the sample for 2mins in boiling water bath. Then about 50fll of magnesium chloride (1M) was added, mixed gently by inverting the tubes and incubated on ice for 2mins followed by centrifugation at 10,000 rpm for 2mins.

After centrifugation, 50fll of potassium acetate (3M) was added and without disturbing the pellet the tubes were mixed gently followed by centrifuging the tube at 1 O,OOOrpm for 2mins. The supernatant was transferred to a fresh tube containing 600fll of ice cold isopropanol, mixed by inverting and then the tubes were placed on ice bath for about 2mins followed by centrifuging the tube at 1 O,OOOrpm for 1 Omins. Now, the pellet was taken in an eppendorfftube and added with 1ml of 70% alcohol. Again, the tubes were centrifuged at 1 O,OOOrpm for 1 Omins. Finally, air dry the pellet followed by addition of 20fll ofTE buffer.

2.9 Sequencing and characterization:

The gene was sequenced in an automated sequencer by Sanger's method and was characterized using Bioinformatics tools like BLAST, multiple alignment and finally with the construction of phylogenetic tree.

3. Results

The genomic DNA was isolated from human blood sample and confirmed the presence of gene in the gel by electrophoresis. The bands in the gel picture (Fig 1) represent the presence of genomic DNA which has been isolated from the human blood.

The purity was checked using UV-Vis spectrophotometer and the Optical density (OD) at 260nm was 0.136 and at 280nm was 0.076; the corresponding concentrations are 0.680flg/ml and 0.380flg/ml, the value of 0.680/0.380 was 1. 78 and hence the purity.

77

Genomic DNA Genomic DNA

Fig 1. Gel Picture of isolation of genomic DNA from Human Blood

GAPDH gene

Fig 2. Gel Picture ofPCR product (single band obtained is the GAPD gene)

The length of the gene was determined as 500bp (Fig 3) by running the PCR product along with the standard molecular weight markers ( 1 Kb ).

78

--

[ Ladder lKb

-++-- [ GAPDH gene (SOObp)

Fig 3. Gel Picture indicating the length of GAPDH gene corresponding to the standard molecular weight marker (ladder lkb)

After determining the length of GAPDH gene, the gene was further purified by the technique or process called gel elution. And the gel picture (Fig 4) represents the confirmation of purified GAPDH gene by electrophoresis.

( GAPDH gene

Fig 4. Gel Picture of Gel Eluted sample containing purified GAPDH gene

After purification of the sample, the gene of interest (GAPDH gene) was inserted into pGEMT vector (3000bp) (Fig 5) and the transformation of the gene was confirmed by blue white screening method. The blue colonies obtained in the plate indicate the absence of gene of interest and white colonies obtained confirmed the transformation of gene (GAPDH) (Fig 6).

79

1 StM 14 20 26 31 37 46

;_~:====::; ss

Fig 5. Picture ofpGEMT Vector

62 62 73 75 82 94

100 ~ 112 ~' 126 ~

~

Fig 6. Plate showing transformed colonies of

E.coli (DH5 alpha cells)

After obtaining the transformed E.coli cell, the presence of the recombinant plasmid was confirmed by presence of bands in the gel (Fig 7).

Fig 7. Gel picture showing recombinant plasmid from transformed E. coli cells

Further the gene was sequenced using automated sequencer and the sequence was obtained (Fig 8) along with the chroma of the gene (Fig 9).

80

Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH), mRNA

ATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTC ACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCT TCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAA ATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCC CATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGG CGCTGAGT ACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTT GCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATG TTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCATCAGC AATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACA ACTTTGGTATCGTGGAAGGACTCATGACCACAGTCCATGCCATCACTGCCACCCA GAAGAC TGTGGATGGCCCCTCCGGGAAACTGTGGCGTGATGGCCGCGGGGCTCTCCAGAA CATCATCCCTGCCTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAG CTGAACGGGAAGCTCACTGGCATGGCCTTCCGTGTCCCCACTGCCAACGTGTCAG TGGTGGACCTGACCTGCCGTCTAGAAAAACCTGCCAAATATGATGACATCAAGA AGGTGGTGAAGCAGGCGTCGGAGGGCCCCCTCAAGGGCATCCTGGGCTACACTG AGCACCAG GTGGTCTCCTCTGACTTCAACAGCGACACCCACTCCTCCACCTTTGACGCTGGGG CTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGGTATGACAACGA ATTTGGCTACAGCAACAGGGTGGTGGACCTCATGGCCCACATGGCCTCCAAGGA GTAA

Fig 8. Sequence of Gene

10 110 120 lSO ' G A A G G '! G C: C: k A '! G G C: G G C G T C: G A. T C: C: G A. A C: G C: A G G C: 'I' I< 'I' G G C: G C C A A C: A. G (

Fig 9. Chroma of Gene Sequence

The characterization of the gene was further done by using BLAST, Multiple alignment and phylogenetic tree and the results are shown in figure 10, 11 and 12.

81

BLASTN 2.2.14 [May-07-2006] Reference:

Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST~ a new generation of protein database search programs", Nucleic Acids Res. 25 :3389-3402.

RID: 1148645360-28741-89060844375.BLASTQ4

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)

3,905,807 sequences; 17,248,126,248 tota l letters

If you have any problems or questions with the results of this searc h please refer to the BLAST FAQs

Taxonomy reports

Query= MYSQ

Length=974

r gil53734501 1gb i BC08 3511. 1 1 Homo sapiens glyceraldehyde-3-phosphate dehydrogenase, mRNA (eDNA clone MGC :88685 IMAGE: 3536969) , comple te cds Length=1290

Score= 1931 bits (974), Expect= 0.0 Identities = 974 / 974 (100%), Gaps = 0/974 (0%) Strand=Plus/Plus

Query 60

Sbj ct 146

Query 120

Sbjct 206

1

87

61

147

GTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTG

11111 1 I ll 111111111 11111 I I I Il l I 1111 1111111 11111 1 1111 111111 111 GTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTG

CCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCA

1111 111 Il l I I 1111 1111111 I I 1111 111111 111 11 1 I I I I ll I 11 111111 1 I ll CCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCA

Query 121 CCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAA 180

I I I I 1111111 1 111 1 111 1 1 1111 11 I I I 1 1 111 1 1 1 II I I Ill I 11 11 1 1111 11111

Sbjct 207 CCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAA 266

Query 181 ATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCG 240

1 111 1 111 11 11 I I Ill II I I I II I II I I I I I Il l II 11 1111 I ll I 1 11 111 1 1 I II II

Sbjct 267 ATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCG 326

Query 241 CTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATT 300

1 1 1111 1 1111111 1 111 1 111 1 11 11 II 111 1 111 1 1 1 11111 11111111 1 111 I Ill

Sbjct 327 CTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATT 386

Query 301 TGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCG 360

111 1 1111111 I I I II I II I I II I I II II I I II I I I I 111 11 1 11 1 1 II I I II II IIIII

Sbj ct 387 TGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCG 44 6

Query 361 TCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCATCAGCAATGCCTCCT 420

1 11111111 1 111 1 1111111 1 11 11 11111 1 111 1 1111 11111111 1 1 1111 111111

Sbjct 447 TCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCATCAGCAATGCCTCCT 506

Query 421 GCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGG 480

11 1 111 1 11 1 11111 1 1111111 11 1111111 1 111 111 11 1 111 1 11111 1111 11111

Sbjct 507 GCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGG 566

Query 481 AAGGACTCATGACCACAGTCCATGCCATCACTGCCACCCAGAAGACTGTGGATGGCCCCT 540

II II I II I I 111 1 111 I I 1 1 11 1 1 I I I Ill I I I I I 111 1 1 1 I I I II I I II 1 11 1 1 111 1 1

Sbjct 567 AAGGACTCATGACCACAGTCCATGCCATCACTGCCACCCAGAAGACTGTGGATGGCCCCT 626

Query 541 CCGGGAAACTGTGGCGTGATGGCCGCGGGGCTCTCCAGAACATCATCCCTGCCTCTACTG 600

I I III 1 1 1 1 1 11111111 1 1111 1 111 I I II I 1111 1 1 1 1 1 11111111 1 1 1 11 1 1 1 111

Sbjct 627 CCGGGAAACTGTGGCGTGATGGCCGCGGGGCTCTCCAGAACATCATCCCTGCCTCTACTG 686

Query 601 GCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAACGGGAAGCTCACTGGCATGG 660

11 1 11111111111111111111 11 11 I I 1 1111111 1 1 1 1 II I 11 1 111 1 11 1 111 1 11

Sbjct 687 GCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAACGGGAAGCTCACTGGCATGG 746

Query 661 CCTTCCGTGTCCCCACTGCCAACGTGTCAGTGGTGGACCTGACCTGCCGTCTAGAAAAAC 720

Sbjct 806

Query 780

Sbjct 866

Query 840

Sbjct 926

Query 900

Sbjct 986

Query 960

Sbjct 1046

747

721

807

781

867

841

927

901

987

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I ~ I I I I I I I I I I I I I I I I I I I I I I I

CCTTCCGTGTCCCCACTGCCAACGTGTCAGTGGTGGACCTGACCTGCCGTCTAGAAAAAC

CTGCCAAATATGATGACATCAAGAAGGTGGTGAAGCAGGCGTCGGAGGGCCCCCTCAAGG

1 11111111 Ill 1111111111111 I I l l I I I 1111111111111111111111111111

CTGCCAAATATGATGACATCAAGAAGGTGGTGAAGCAGGCGTCGGAGGGCCCCCTCAAGG

GCATCCTGGGCTACACTGAGCACCAGGTGGTCTCCTCTGACTTCAACAGCGACACCCACT

1111 1 1 1 1 II II 1111111111111111 1 1 1 11111111111111111111111111111

GCATCCTGGGCTACACTGAGCACCAGGTGGTCTCCTCTGACTTCAACAGCGACACCCACT

CCTCCACCTTTGACGCTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTT

111111 1 1 1 1 11 1111111111111111 I I I I 1111111111111111111111111111

CCTCCACCTTTGACGCTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTT

CCTGGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTGGACCTCATGGCCCACATGG

1111 1 1 1 1 111 11 1 1 1 11111111111111 1 11111111111111111111111111111

CCTGGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTGGACCTCATGGCCCACATGG

Query 961 CCTCCAAGGAGTAA 974 II II II I I I I l l II

Sbjct 1047 CCTCCAAGGAGTAA 1060

Fig 10. BLAST sequence

84

00 Ul

.a•api~• Cl:603857 Cll623921 0.623528 Cll62H76 Cll619H2 CII6112U CJt6102'2 ••••••••••• -------.----.-.-------------------------.------------ . ---.---.--.--------------.--------------------.--------------------- •• ----- •• ---.----aco2,21o ===u= =g· QOJJUr-vonrrrner· ·-=·e••••gwrri"or · - -cret·-·Tw-r·v-=z- •~· me ·w • CIIU3037 -------------------------- - --- -- ------- -- - ------------------------- ------ __ -------- ----- ---------- -- - - ------------ - ---------- _______ -- -- - - ----

OUery CR6:111806 CR596322

ruler •.... . . 610 ....... 620 .. . . . . . 630 •.....• 640 •• • .... 650 .. . .•.. 660 ... . . • . 610 • . . .•.• 680 . ..••.• 690 •.. .. .. 700 • . .. .•. 710 ...•••. 720 ••.. . .. 730 . ...•.. 7'0 •.. .• . . 750

IDOaapiana CR603857 CR6l3921 CR623528 CR62H76 CR61974.2 CRU12·U CRU02•2 ------- - -- - ----------------------------------- -- --------------------------------------------------------- ----------------------BCOl4llO ~ll .... ...-~~ ...... :::MMNft('(ttry;='J" 4 a ·az• ·-.,Jl"Wf......,--t='"•••MU?"'T..-,..,.,-~­CilU3037

OUery CR621806 CR596322

ruler .. .. . .• 760 • ... . • . 770. , . . ... 780 . • .. . .• 790 •... . . . 800 . . . •.. . 810 •...•.• 820 .• •• . • . 830 •. ... . . 840 •...... 850 • .... . . 860 • ... .• • 870 ....• .. 880 ..•.. •. 890 .. . . .. , 900

7 50

tOO

-.oaapiena C7 CR603857 C7 CR623921 56 CR623528 ..56 CR62C476 56 CR6197'2 105 CR6112U 47 CR610242 56 BC02t210 10t9 CR613037 25

Query ------- -· --------------.----- - -- -- - ---- ----- --------- •• ------ -·- ------------ - --- - -- .------------- - ---- - ---------- - --- --------------------- --- ---------

~::!!~~~ ======================:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: ~ ~ ~ ...... ~ .. -~~ ~-.:: ~ ~ ~ ~: ruler . ... . . . 910 ••• • . • . 920 •...• • . 930 ....... 940 ••..•• . 950 ••• . . . • 960 •. . ••. . 970 • ••..•. 980 • ..•... SISIO ...... 1000 • . . •. • 1010 •• • • •• 1020 • ••. • • 1030 . . • . •• 10t0 . •••. • 1050

.......................................................................................................................

moaapiena ~·~~~-~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~iilllllll CR603857 CR623921 CJUi23528 CR62H76 CR61974.l CR611246 CRUOH2 BCO:ilt210 CR613037

g::m~ ~--- -------- -- ---- - - -- - - ---- ----- - ---

ruler • ....... • ...... • ...... ....... • ..... • • •" ....... • • 'Sft • • .. I\ 1 • eft 11 J!'l\ 1 1'1ft 1181\

197 197 206 206 206 255 197 206

1199 175 111 186 186

00 0'1

moaapiana C:R60385'1 CR623921 CR623528 C:R6~4476 CR6UH2 C:R611.l46 CR610.l42 BC024210 C:R61J037

Query CR621806 CR596l22

ruler

......................................................................................................................................................

5 .. "!181\ •"it""' • ., ...... - • .,. ... ,.,..... , ..... • ....... , .~ ...

......................................................................................................................................................

... ........ , ........ ......... ....... ....... ........ ..... ..... ..,.. ··-.. ...... ~ ...... ~ ....... . . . • . : f37o~: . • .•• •• ..... . ltoo~ . . ... t4i0 ..... ir. ... . i73o ~ •• :-• • i44o:~45o . ••• . • 1460 • •.• • • 1470 . ..•.. 14~.--:':'f4go : : • . : . 1.!561

······················································································································································

347 347 356 356 356 405 347 356

1349 325 261 336 336

U7 U7 506 506 506 555 U7 506

1499 475 411 486 486

moaapiana 647 CR6038S7 647 CR623921 656 CR623528 656 CR624476 656 CR61974~ 7 05 CR611246 U7 CR61024~ 656 BC024210 1649 CR61303 7 6~5

Query 561 C.R621806 CC& 636

CRS!~~!~ ...• • • 1510. -~~0 .. ... • 1530 .• .• .. 1540 ..... • 1550 .. •.•• 1560 . . .•.• 1570 .•. . •. 1580 . ~- . 1590 •. . ••. 1600 . . ••. ~- .1620 .•.. . . 1630 . •. . . • 1UO . ... . . li SO 636

.., .. piono~~--~~ CR603857 CR623921 CR6~35~8 CR624476 CR6UH2 CR611~46 CR61024 l BC024ll0 CR613037

Query CR621806 CR596322

ruler .... . . 1660 ..... . 1670 . .. ~ .. 1680 . . .. . . 1690 ..... . 1700 ... .. . 1710 ... ... 1720 .. . ... 1730 .. . .. . 1740 ...... 1750 ...... 1760 ...... 177 0 ...... 1780 . . .. . . 1790 . . . . .. 1800

797 797 806 806 806 855 7 97 806

17 99 775 711 786 786

~ II'Q. .... :""'

~ -....... -s· ;:r 2::

QO -...)

ciQ ' ::l s (t)

::l ....... 'JJ (t)

..c .: (t)

::l 0 (t)

0 >-+,

0 (t)

::l (t)

······················································································································································ .a•Qi~ CR5031S7 0623921 0623521 062447, CJt.5U142 ca.atl2Ui CIC10242 8C024210 0.513037

Query CR521105 ca.5t5322

ruler

ao•apien. CR603857 CRI!i2lt:U Ct6235U CJt52447C C.R511742 caC11245 CRC102t2 8C024.210 CR513037

II ''il.I""•II'Piil 11111111118 llllll·l:l·;i-1.:1· ·:l·::::;;~,.· .. l:::l::l::i

................................................................................................................. .....:.

. ......;..

.....;..

~ . . . . -. ' ·~ . . ~ ~ . -. -. ._ . . . . ... . . . . -. 2116 . ~~==:. : :: = =: ~3 =r~: ~ ~:; :~ ··::z· =,= E:·:::: ·::: ~~ ~~: :~ :t :: =~- :::~±--~ ·.:: ~~~: =-i :.: ~:.ti.:. :.Z :::~: .~ ±··;::::.. ±::::, :: ~~~ ~ :=::-=~-- ~:: :~r-~-,~ ": :.:.:: i, ::±: :it:: . ...:... ...... ~.,;-~ ~-· ,;... - ..... -i-. ...... . ~...:. ... ~ ....... ~-- ..... .. .. .._.. ;. .............. ~;... ·---- ... '" .. ·-···

,-~ ·~· · ... -~-- ... : .. -~~ ...... _,._,;;.,;.,;.,.:. ..-,;.,:...,..._,..:.:.:..;.. ...... t -- • -~' ~,.,....~~-~-·.:-~ ..,.,..~-~- ........ . . ., .. .......:..:-:. ..... .,.;.:.~.~..:..-.. ..,,..~--~~...:.:.--" ... •·r......:.;.;. ... ...;,.;....,;..;,.. .. _.~ .;.; .-..... ~ ,~+-~---F ~ .. ·. -or~·_:_~~~".:\'' ··"':"'~V'~"'f'

Query CJ.521106 CR5Ul22

ruler I ~~ :§~ ~~~:~~ §~~¥§.~~~~~~;

I ll I I I 0 0 0 I I ''* , a w=; **'*''*'* l7 ... ... 2080 ...... 20,0 .. . ... 2100

lll~l :_· Tl~~~~ t [i !H~ IF If~~;~=~; [ ,: Que.ry - . ..... .... ... ·-- -··. · · · -- ----- ••••• - -· ............ ·-· •• ••• • ------- ..... ------- - -- ... ------ -- ----- - --- - - · - •• ----.- - - -· ···- --- -- • ••• ·- ·-- ••.

caomo•;q~v;:·~! -:z:9~ · 11~ · · · w-· ·- ""--·--casum£1+5' E*¥= MUd 4 --------·------------------------·---------- ......... ruler 1n .,, n .,, n .&n ., en .,,.:n ., , n .,, an .,, an .,.,nn .,.,, n .,.,.,n .,.,,n

IIO•apien• cr._,, ' 'Ci"''UUVOIJ"TJUP-.-·n'fPIOD 12.90 CR503157 ·---·-- · -- ··· ·· · - ----- -···- -··--- -- -··-·--- 1230 C'R623921 ·-------····· ····-·-··· ··· ··--·-·····--- - -- 1252 Cl62l528 ·-·-·--·- - · -·--·······-·· · ·- ······ ··· -·· · -· 1252 CR52447S .............................................................. 1237 0519742 --- .... --- -- - .... --- ....... - --------- --- ---- ---- -- 1215 CR511246 --- -·- ------··········· - -·--··-------··---- 1224 CR610242 --- - ·------·---· -· ·--·· ··· ---- --- -········- 1245 BC024210 ' P'MP'!~?IJJfWI!W- -- 22U CR,l3037 ·- .... - ·- • ...... • • • ·-- - --- • • .... ·-- ------ --- ------ 1212

Query ·- ----- •• -· ------- -- ----------------------.. 974. CR621106 ..................................................... . .... 1211

C'R5!J6322 ------··-·-····-·-----·········-------··· · - 1161 ruler .... . . 2260 •...•. 2270 •...•• 2280 •• • ... 2290 .. .

,., ,., tSf tsl n•

1005 U7 ,..

194.9 025 IU

'" Oll

10t7 10.97 1100 1106 1101 115!5 1097 1101 20.99 1075 ,,. lOIS 1016

1247 1230 1252 1252 1237 1215 1224. 1246 2269 1212 ,,. 1211 1163

I Homosap1.ens

I CR603857

BC024210

l CR6 l3037

Query

I CR621806

CR596322

CR611 2 46

CR624476

L-- ------------ CR6l9742

CR610242

CR62 392l

CR623528 - - - - - - ------ - ------------ 0.01

Fig.12. Showing dendogram of GAPDH GENE

4. Discussion

During the last decade, many findings have been made concerning the role of GAPDH in

different pathologies including prostate cancer progression, programmed neuronal cell death

and age-related neuronal diseases such as Alzheimer's and Huntington's. GAPDH is expressed

in all cells. It is constitutively expressed in almost all tissues at high levels. There are however

some physiological factors such as hypoxia and diabetes that increase GAPDH expression in

certain cell types. GAPDH molecule is composed of four 36kD subunits. The molecular

weight for GAPDH is 146kD.

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) functions as a glycolytic enzyme within

the cytoplasm, but beside its metabolic function it is involved in early steps of apoptosis, which

trigger the translocation of GAPDH into the nucleus. As apoptosis can be induced by serum

withdrawal, which otherwise causes cell cycle arrest, the linkage between serum deprivation,

cell cycle and nuclear transport of GAPDH has been investigated. The intracellular distribution

of GAPDH was monitored by confocal laser scanning microscopy. In contrast to investigations

published so far, this nuclear translocation was a reversible process: cytoplasmic location of

endogenous GAPDH could be recovered upon serum addition to arrested cells and was not

88

inhibited by cycloheximide treatment. In addition, the nuclear import upon serum depletion

had no influence neither on the catalytic activity nor on the expression level ofGAPDH [20].

The regulation of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has been implicated

both in age-related neurodegenerative disease and in apoptosis. Previous in vitro studies suggest

an interaction between GAPDH and the beta-amyloid precursor protein (beta-APP), a protein

directly involved in Alzheimer's disease (Accordingly, beta-APP-GAPDH interactions, altering

GAPDH structure in vivo, may affect energy generation, inducing hypo metabolism, a

characteristic AD phenotype. Because GAPDH is a multifunctional protein, pleiotropic effects

may also occur in a variety of fundamental cellular pathways in AD cells) [14].

Induction of apoptosis by staurosporine or MG 132 and oxidative stress by Hp2 or FeCN

enhanced the nuclear translocation of endogenous GAPDH in all cell types as detected by

immunocytochemistry. In apoptotic cells, GAPDH expression is three times higher as compared

to non-apoptotic cells [23].

GAPDH is a redox-sensitive glycolytic enzyme that also promotes apoptosis when translocated

to the nucleus and associates with aggregate-prone proteins involved in neurodegenerative

disorders. Recent evidence indicates that polymorphic variation within GAPDH genes is

associated with an elevated risk of developing Alzheimer's disease (AD). We previously

demonstrated that GAPDH readily undergoes disulfide bonding following oxidant exposure,

although the consequence of disulfide bonding on GAPDH activity or function is unknown

[3].

The topology of the interfaces between actin monomers in microfilaments and three glycolytic

enzymes (glyceraldehyde-3-phosphate dehydrogenase, aldolase and phosphofructokinase) was

investigated using several specific antibodies directed against precisely located sequences in

actin. A major contact area for glyceraldehyde-3-phosphate dehydrogenase was characterized

in a region near residue 103. This interaction altered, by long-range conformational changes,

the reactivity of antigenic epitopes in the C-terminal part of actin [15].

Alzheimer's disease (AD) is a debilitating neurodegenerative condition characterized by the

loss of cognitive skills and severe behavioral changes (dementia). The principle protein

implicated in the development of Alzheimer's disease is the amyloid precursor Protein (APP).

Indeed, a small subset of patients exhibiting familial AD exhibitAPP mutations; this was the

first genetic link to AD identified. Cleavage of APP by proteases known as secretases gives

rise to a group of peptide fragments known as Amyloid p (Ap). Ap, which forms dense

extracellular aggregates called amyloid plaques, has been demonstrated to induce neuronal

death, which may ultimately lead to disease [ 11].

89

The potential involvement of GAPDH in neurodegeneration is based on the demonstration

that proteins important to the pathogenesis of several neuronal disorders strongly bind GAPDH

with high affinity in vitro. GAPDH strongly interacted with the P-amyloid precursor protein

CP-APP). The latter is a protein directly implicated in Alzheimer's disease (AD). Furthermore,

several of the proteins mutated in the CAG trinucleotide repeat neurodegenerative disorders

have been shown to bind selectively to GAPDH. These mutated proteins include the

Huntington's disease (HD) protein, huntingtin; ataxin 1, altered in spinocerebellar ataxia type

1; the androgen receptor, defective in spinobulbar muscular atrophy; and atrophin, mutated in

dentatorubalpallidolusian atrophy. The mutant CAG expansion is located in the coding region

and, upon translation, forms a protein with anN -terminal polyglutamine domain. Polyglutamine

stretches are postulated to attribute a gaAin of function, which causes the disease. Thus, it

was suggested that binding to GAPDH may serve as the new function. Consistent with the

notion of a GAPDH: neuronal protein complex in vivo is the finding that P-APP and GAPDH

are both localized within the cytoplasm and the plasma membrane. Huntington, SCA 1 and

GAPDH are each located in the nucleus and the cytoplasm [2].

In the postnuclear fraction, GAPDH was 27% less glycolytically active in Alzheimer's cells

as compared with age-matched controls. In the nuclear fraction, deficits of27% and 33% in

GAPDH function were observed in Alzheimer's and Huntington's disease, respectively. This

evidence supports a functional role for GAPDH in neurodegenerative diseases. The possibility

is considered that GAPDH: neuronal protein interaction may affect its functional diversity

including energy production and as well as its role in apoptosis [1 0].

GAPDH is of particular interest because it interacts strongly with proteins implicated in the

pathogenesis of Alzheimer's disease, Huntington's disease, and spinocerebellar ataxia; this

suggests that alterations in GAPDH function may be important in various neurodegenerative

conditions. Understanding how GAPDH can be damaging is therefore of great interest to

neurobiology [19].

In solution, GAPDH can take a monomeric, dimeric, or tetrameric form but greatly favors the

tetramer. Molecular modeling of the GAPDH tetramer revealed a central channel at the

interface between the four monomers. GAPDH largely exists as a tetramer with minor

populations of dimers and monomers. Our data indicate that CGP3466 and DES increase the

stability ofGAPDH as a dimer. We therefore propose that agents that stabilize GAPDH as a

dimer, rather than a tetramer, prevent the early apoptotic GAPDH increase and nuclear

accumulation and thereby induces a decrease in apoptosis. Conversion ofGAPDH from a

tetramer to a dimer is known to increase its glycolytic capacity [8].

90

5. Conclusion

We report the successful completion of all the experiments mentioned above. The genomic

DNA was isolated from the blood and the GAPDH gene was sorted out by PCR using gene

specific primer sequences. The gene length was determined by electrophoresing the PCR

product on the agarose gel along with 1 kb ladder (standard molecular weight marker).The

gene was extracted by gel elution technique. The gene was then inserted into pGEMT vector

by ligation, transformed into E.coli cells (DH5alpha strain) and screening of positive cells was

done by Blue-White colony assay. The recombinant plasmid was isolated from the positive

cells; the gene was sequenced in an automated sequencer by using the recombinant plasmid

and was characterized using Bioinformatics tool.

Acknowledgement

Authors are thankful to CCMB and IICT for providing support, guidance and the lab facilities

to conduct this research work.

References

1. Berry M.D, BoultonA.A, J. Neurosci. Res, 60: 150 (2000).

2. Burke J. R., Enghild J. J., Martin M. E., Jou Y.-S., Myers R. M., Roses A. D., Vance J. M.

and Strittmatter W. J. Huntingtin, Nature Med, 2:347 (1996).

3. Cumming R C, Schubert D, FASEB J, 9: 2060 (2005).

4. Dayhoff, M.O. Atlas of protein sequence and structure Dehydrogenases Washington. National

Biomedical Research Foundation, 5: 141 (1972).

5. Dugaioczyk A, Haran J K, Stone E.M, Dennison O.E; Rothblum K.N., Schwartz R.J,

J.Biochemistry. 22: 1605 (1983).

6. Fabry S, Lang J, Niermann T, Vingeon M, Hensel K, 179, 405 (1989).

7. Gianni Carrara, GiovannaAlbertin, Myriam Forneris & Gastone G Nussdorfer, Molecular &

Cellular Probes. 19: 181 (2005).

8. Graeme W. Carlile, Ruth ME, Chalmers Redman, Nadine A. Tatton, Amanda Poug, Katherine

L.B.Bordan & William G Tatton, Molecular Pharmacology, 57: 2 (2000).

9. Haung X.Y .Barrios LAM,Von Khorpom P,Hondas,Aibertson D.G,Hecht R.M,J. Molecular

Biology .L, 206: 411 (1989).

10. Jennifer L, Mazzola & Michael A.Sirover, Journal ofNeurochemistry, 76: 442 (2001 ).

11. Joseph D Buxdaum, Ph.D Amyloid Precursor Protein &Amyloid beta. Web-info@upstate.com.

12. Katsumi, Tsuchiya, Hisao Tajima, Mitsunori Yamada, Life Sciences. 74: 3245 (2004).

91

13. Lehninger, A.1, Nelson, D.L. and Cox, M.M. Principles of Biochemistry, II edition, Worth Publishers, New York ( 1993).

14. Mazzalo JL and Sirover MA, J NeuroSci Res, 71: 279 (2003).

15. Mejean C, Pons F, Benyamin Y, Roustan C, Biochem J. 264: 671 (1989).

16. MikiK, Quw, GouldingEH,Willis.W.D, Bunch.D.O, Strader.L.F,Perreault.S.D, Eddy.E.M, O'Brien DA, Proc Nat I Acad Sci. 101: 16501 (2004).

1 7. N asima Rahman Mansur, Katherine Meyer-Siegler, J. C. Wurzer,& MA Sirover, Nucleic Acids Research, 21: 993 (1993).

18. Nelson Smetal, Chern. Research Toxicology, 18: 239 (2005).

19. Paul A, Saunders, Ren-Wu Chen & De-Maw Chamg, Journal of Neuroscience. 72: 925 (1999).

20. Schmitz HD, Eur J Cell bio, 80: 419 (200 1 ).

21. Wilder Goldin, Audrey Mamesster, Marie J anne Staquet, Daniel Schmitt, & Odile Berthier­Vergnes. Ribosomal 18s RNA Prevails over GAPDH & b-actin genes as internal standard for quantitative comparison of mRNA level in invasive & non-invasive human melanoma cell

sub-populations (2001).

22. Y.H Edwards, JC Lloyd, SL Me Millan & F J Benam, Molecular & Cellular Biology, 5: 214 7 (1985).

23. Z. Dastoor & JL Dreyer, J. Cell Science, 114: 1643 (2001).

****

92