vector systems xxvii - auro-scienceauroscience.hu/docs/mobitec-vector-systems-lowres.pdf ·...

VECTOR SYSTEMS

© MoBiTec GmbH, 2009

MoBiTec GmbH . Phone: +49 551 70722 0 . Fax: +49 551 70722 22 . E-mail: [email protected] . Internet: www.mobitec.com

Vector Systems from MoBiTec Page 1


Contents PageNICE® Expression System for Lactococcus lactis 2

Bacillus megaterium Expression Systems 3

Bacillus subtilis Expression Vectors 6

pBacTag Tagging Vectors 8

Yeast Expression Vectors 9

pORF-CLONE Vector System 10

pPICHOLI Shuttle Vector System 12

Mammalian Expression Vectors 13

CMV Expression Vectors 13a

Fusion Protein Cloning System PheBo 14

Fusion Protein Cloning System pAX 16

BRP Plasmids and Competent BRP Cells 18

PCR Cloning Vector p3T 20

Poly(His)-tag Cloning Vector pEG-His1 21

Exontrap Cloning Vector 22

ssDNA-Production and Expression in pMEX 24

Promoter-Trap Vector pBBR RESO (Broad-Host-Range) 25

Broad-Host-Range Vectors pBBR122 and pBHR1 26

Suicide Vector pCorrectClone 27

Multiple Cloning Site Vector pMCS5 28

Standard Cloning Vectors 30

EosFP - Green to Red Photoconvertible Fluorescent Protein 32

Related Products

Endoproteases, ideal for Removal of Fusion Tags

MobiTEV Protease 33

IgA Protease, HRV3C Protease 34

Kex2 Protease, Pro39 Protease 35

Factor Xa Protease, HS-Nuclease 36

MobiSpin Columns for DNA Purification 37 For detailed information: www.mobitec.com

MoBiTec GmbH . Phone: +49 551 70722 0 . Fax: +49 551 70722 22 . E-mail: [email protected] . Internet: www.mobitec.com MoBiTec GmbH . Phone: +49 551 70722 0 . Fax: +49 551 70722 22 . E-mail: [email protected] . Internet: www.mobitec.com

Order Information, Shipping & Storage Order No. Description Amount VS-ELV00100-01 NICE® pNZ8008 Reference plasmid with gusA gene 10 µg VS-ELV00200-01 NICE® pNZ8148 Lactococcus lactis expression vector, NcoI site 10 µg VS-ELV00250-01 NICE® pNZ8150 Lactococcus lactis expression vector, ScaI site 10 µg VS-ELV00300-01 NICE® pNZ8149 Lactococcus lactis expression vector, food grade, NcoI site 10 µg Shipped at RT, store at 4 °C VS-ELV00500-01 NICE® pNZ9530 Lactococcus lactis nisRnisK vector, in Stain NZ9000 1 ml VS-ELS09000-01 NICE® Lactococcus lactis expression Strain NZ9000 1 ml VS-ELS03900-01 NICE® Lactococcus lactis expression Strain NZ3900, food grade 1 ml VS-ELS10610-01 NICE® E. coli host Strain MC1061 1 ml Shipped on dry ice, store at -80 °C VS-ELK01000-02 NICE® Nisin kit, 1 g nisin, concentration: 2.5%, (balance sodium chloride and denatured milk solids), 1 ml 5% acetic acid 1 kit Shipped at RT, store at 4 °C

NICE® Expression System for Lactococcus lactis Page 2

The Effective & Easy-to-Operate NIsin Controlled Gene Expression System

The effective & easy-to-operate Nisin Controlled gene Expression system (NICE®) for Lactococcus lactis is perfectly suited for a food grade protein expression.

FeaturesExpression of membrane proteins Tightly controlled gene expression allows produc-tion of toxic proteins Secretion of proteins into the medium Less endogenous and no exogenous proteases No inclusion bodies Endotoxin-free food grade expression system Simple fermentation, scale-up and downstream processing

Product DescriptionL. lactis is increasingly used in modern biotechnology for the production of recombinant proteins for food, feed, pharma and biocatalysis applications. Essential is the easy genetic accessibility of L. lactis. Protein expression is controlled by Nisin.

Areas of applicationProduction of homologous and heterologous proteins for food, feed, pharma and biocatalysis applicationsProduction of prokaryotic and eukaryotic membrane proteinsProduction of exo-polysaccharidesProduction of ingredients through metabolic enginee-ring: e.g. alanine, folate, diacetylPreparation of L. lactis as a biocatalyst by expression of a suitable enzyme as e.g. dehydrogenases and in situ co-factor regenerationHigh throughput screening for enzyme evolution or en-zyme comparison.

The patented NICE® system was developed by NIZO food re-search BV. NICE® is a trademark of NIZO food research BV. Pa-tent EP0712935, EP0355036, EP0228726.

zyme comparison.

®

Electron microscope image of Lactococcus lactis


High Yield T7 RNA Polymerase Gene Expression System for Bacillus megaterium

Product DescriptionThis system combines the benefi ts of the tightly regulated and strong T7 RNA polymerase expression system and alkaline protease free Bacillus megaterium. Our system is based on two parallel-replicating plasmids: pT7-RNAP and pPT7 (Gamer et al. 2009). In addition to the t7 rnap gene under control of the strong xylA promoter pT7-RNAP con-tains the genes of ampicillin and chloramphenicol for easy selection in E. coli (AmpR) and B. megaterium (CmR). pPT7 is responsible for the T7 RNAP-dependent expressi-on of the target gene. Downstream of the T7 promoter it comprises a multiple cloning site with ten unique restriction enzyme cleaving sites. Additionally the plasmid carries two resistances to ampicillin (for E. coli) and tetracycline (for B. megaterium). For your convenience we offer B. megaterium protoplasts pretransformed with pT7-RNAP in the kit, so that you just have to insert your gene of interest into pPT7 and transform the pretransformed protoplasts with this plasmid. For control purposes the GFP-expressing vector pPT7-GFP is included in the kit.

FeaturesTightly regulated and effi ciently inducible xylA operon/T7 RNA polymeraseStrong T7 RNAP promoter with unique sequenceStable, high yield protein production up to 8-fold increased in comparison to common xylose indu-cible expressionEasy transformation by use of pretransformed B. megaterium protoplastsControl vector with GFP-sequence included in the kit

ReferenceGamer, M., Fröde, D., Biedendieck, R., Stammen, S., und Jahn, D. (2009). A T7 RNA polymerase-dependent gene expression system for Bacillus megaterium. Appl. Microbiol. Biotechnol 82, 1195-1203.

Bacillus megaterium Expression System Page 3

Order Information, Shipping & Storage Order No. Description Amount BMEGT702 Bacillus megaterium protoplasts, strain MS941, pretransformed with pT7-RNAP 5x500 µl BMEGT701 Bacillus megaterium high yield T7 gene expression kit, includes pretransformed protoplasts BMEGT702 (5x500µl), pPT7 cloning vector and pPT7-GFP control vector (vectors lyophilized, 10 µg each) 1 Kit BMEGT710 Bacillus megaterium pPT7 cloning vector, lyophilized 10 µg BMEG50 Bacillus megaterium protoplasts, strain MS941 5 x 500 µlShipped at RT, protoplasts and kit shipped on dry ice.Store lyophilized vectors at 4 °C, reconstituted vectors at -20 °C, protoplasts at -70 °C. Vectors are E. coli / B. megaterium shuttle vectors.


Expression Vectors for B. megaterium


FeaturesStable protein expression, high yield Xylose operon: tightly regulated and efficiently in-ducible by xylose (up to 350-fold)Polylinker downstream of promoter allows versa-tile cloningNo indication of proteolytic instability even up to 5 hours after induction, since alkaline proteases (such as e.g. in B. subtilis) are not produced Endotoxins are not found in the cell wall3

Suited for industrial large scale protein productionCompatible with all B. subtilis vectors

Product DescriptionOur Bacillus megaterium kit is a new easy-to-handle sys-tem for stable protein expression with high yield. It is not only suited for industrial large scale protein production, but offers also an interesting alternative to the standard host E. coli. The kit comes with the E. coli/Bacillus megaterium shuttle vector pWH1520 and B. megaterium protoplasts ready for transformation.B. megaterium has proven to be an excellent host for the expression of non-homologous DNA. Over other bacil-li strains it has the advantage, that none of the alkaline proteases are present. This fact enables cloning and ex-pression of foreign proteins without degradation. In additi-on, there are no endotoxins found in the cell wall. Protein yields are exceptionally good, also if inexpensive substra-tes are used. Mutarotase (Mro) and glucose dehydrogena-se (Gdh) e.g. were accumulated to 20% and 30% of the to-tal soluble protein, respectively. Using the tightly regulated xylose operon the genes were 130- to 350-fold induced without proteolysis. The illustration shows the time depen-dence of the induced protein expression in hours after in-duction versus enzyme activity. A polylinker downstream of the promoter allows versatile cloning in pWH1520. All B. subtilis vectors are compatible with B. megaterium as well.The B. megaterium system offers unique possibilities for the industrial production of proteins and is of great interest to manufacturers in the biomedical field. In a diagnostic test for AIDS e.g., the HIV coat protein is commercially produced by B. megaterium (Ginsburgh et al., 1989).

Time dependence of induced expression of the enzymes Gdh (glucose dehydrogenase) and Mro (mutarotase) in B. megateri-um. Enzymatic activity given in U/mg protein.

Protein YieldProtein yields vary depending on the protein expressed. Rygus and Hillen (1991) have observed, that e.g. Gdh and Mro accumulated to 20% and 30% of the total soluble protein, respectively. The time dependence of the induced expression of these enzymes is shown in the figure above.

ExamplesProteins successfully over-produced with this system are:

• catabolite control protein (ccpA)• xylose repressor (XylR)• trehalose repressor (TreR)• heat shock protein (HPr) from PTS (phosphotransferase • sugar transport system)• mutarotase (Mro)• glucose dehydrogenase (Gdh)• β-galactosidase• human single-chain urokinase-like plasminogen activa- • tor (rscuPA)• cellulase

»One of the most efficient expression systems described in any organism so far!«

Rygus and Hillen

A detailed handbook including all protocols is provided with the product. It is also available for download.Our special service for you:

B. megaterium protoplasts ready for transformation!


��I��I��I

SpeI SmaI BspMI SphI BglII

Map of pWH1520. Shuttle vector for E. coli/B. megaterium. TetR

(Bac), tetracycline resistance Bacillus; TetR’,TetR’’, tetracycline resistance, interrupted; AmpR, ampicillin resistance; xylR, xylo-se-dependent repressor; xylA’, xylose isomerase, gene incom-plete; PA, xylA promoter; MCS, multiple cloning site; ori pBC16, Bacillus origin of replication; pBR ori, ColE1 origin of replication.

Host StrainsThe protoplasts we supply are Bacillus megaterium strains WH320 and MS941.

The system has been developed by Prof. Dr. W. Hillen and co-workers at the Institute of Microbiology in Erlangen, Germany.

ReferencesRygus, T. and Hillen, W., Inducible high-level expression of heterologous genes in Bacillus megaterium using the regula-tory elements of the xylose-utilization operon, Appl. Microbiol. Biotechnol. (1991), 35: 594-599 Hueck, C. P. et al., Cloning, expression and functional analy-ses of the catabolite control protein ccpA from Bacillus mega-terium, Molecular Microbiology (1995), 16(5): 855-864Vary, P., Prime time for Bacillus megaterium, Microbiology (1994) 140: 1001-1013

Potential industrial & diagnostical applications:Vary, P., Development of genetic engineering in Bacillus me-gaterium: an example of the versatility and potential of in-dustrially important bacilli, Biology of bacilli: Applications to Industry, pp. (1992), 251-310. Ed. by Doi and McGloughlin. Boston: Butterworths-Heinemann Ginsburgh et al., Sporulation promoter spoVG controlled expression of PP42 gene of HIV-1 in Bacillus megaterium, Abstr. International Conf. on AIDS, Montreal (1989)

1.

2.

3.

4.

5.


Shipped at RT, protoplasts shipped on dry iceStore lyophilized vectors at 4 °C, reconstituted vectors at -20 °C, protoplasts at -80 °CAll vectors are E. coli / B. megaterium shuttle vectors

Order Information, Shipping & Storage Order No. Description Amount BMEG02 Bacillus megaterium protoplasts ready for transformation (strain WH320) Material is sufficient for 4 transformations plus control experiment. 5 x 500 µl BMEG50 Bacillus megaterium protoplasts, strain MS941 5 x 500 µlShipped on dry ice; store at -80 °C

BMEG03 pWH1520 shuttle Vector, original; lyophilized DNA 5 µg BMEG10 pMM1522 shuttle Vector, improved; lyophilized DNA 10 µg BMEG11 pMM1525 shuttle Vector with signal sequence; lyophilized DNA 10 µg BMEG12 pHIS1522 shuttle Vector, 6xHis-tagged; lyophilized DNA precursor of BMEG20 10 µg BMEG13 pHIS1525 shuttle Vector with signal sequence; 6xHis-tagged; lyophilized DNA 10 µg BMEG14 pSTREP1525 shuttle Vector with signal sequence; Strep-tagged; lyophilized DNA 10 µg BMEG15 pSTREPHIS1525 shuttle Vector with signal sequence; Strep/6xHis double-tagged; lyophilized DNA 10 µg BMEG20 pC-His1622 shuttle vector, C-term. 6xHis-tag; lyophilized DNA 10 µg BMEG21 pC-Strep1622 shuttle vector, C-term. Strep-tag; lyophilized DNA 10 µg BMEG22 pN-His-TEV1622 shuttle vector, N-term. His-tag,TEV-site 10 µg Not available in the US BMEG23 pN-Strep-TEV1622 shuttle vector, N-term. Strep-tag,TEV-site 10 µg Not available in the US BMEG24 pN-StrepXa1622 shuttle vector, N-term. Strep-tag; Xa site; lyophilized DNA 10 µg BMEG25 pSTOP1622, shuttle vector, lyophilized DNA 10 µg


Bacillus subtilis Expression Vectors Page 6

Expression Vectors for B. subtilis

Product Description:Gram-positive bacteria are well known for their contribu-tions to agricultural, medical and food biotechnology and for the production of recombinant proteins.

Among them, Bacillus subtilis has been developed as an attractive host because of several reasons:

There are two obstacles reducing the use of B. subtilis: (i) production of a number of extracellular proteases which recognize and degrade heterologous proteins, and (ii) stable vector plasmids. The fi rst obstacle has been large-ly solved by the construction of protease-defi cient strains. And the second has been completely overcome by intro-ducing plasmids using the theta-mode of replication such as those derived from the natural plasmids pAMβ1 and pBS72.

Quite recently, the construction and use of four different expression vectors based on the E. coli - B. subtilis shut-tle vector pMTLBS72 exhibiting full structural stability was published.

The two vectors pHT01 and pHT43 allow high-level expres-sion of recombinant proteins within the cytoplasm, where pHT43 directs the recombinant proteins into the medium. Both vectors are based on the strong αA-dependent pro-moter preceding the groE operon of B. subtilis which has been converted into an effi ciently controllable (IPTG-indu-cible) promoter by addition of the lac operator.

Derivatives of pHT01 are available either with 8xHis tag (pHT08), Strep tag (pHT09) or c-Myc tag (pHT10).

It is non-pathogenic and is considered as a GRAS organism (generally regarded as safe)It has no signifi cant bias in codon usageIt is capable of secreting functional extracellular prote-ins directly into the culture medium (at present, about 60% of the commercially available enzymes are produ-ced by Bacillus species)A large body of information concerning transcription, translation, protein folding and secretion mechanisms, genetic manipulation and large-scale fermentation has been acquired

Pgrac promoter (consisting of the groE promoter; the lacO operator and the gsiB SD sequence)

ColE1 ori: ColE1 originAmpR : ampicillin resistancelacl: lacl gene (lac repressor)CmR: chloramphenicol resistanceSamyQ: amyQ signal sequence


Bacillus subtilis Expression Vectors Page 7

References1. Anagnostopoulos, C. and Spizizen, J. (1961). Requirements for transformation in Bacillus subtilis. J. Bacteriol. 81:741-746.

2. Jannière, L., Bruand, C. and Ehrlich, S.D. (1990). Structurally stable Bacillus subtilis cloning vectors, Gene 87:53-61.

3. Nguyen, D.H., Nguyen, Q.A., Ferreira, R.C., Ferreira, L.C.S., Tran, L.T. and Schumann, W. (2005). Construction of plasmid- based expression vectors for Bacillus subtilis. Plasmid; 2005 Nov; 54(3): 241-8. Epub 2005 Jul 11.

4. Phan, T.T.P., Nguyen, H.D. and Schumann, W. (2005). Novel plasmid-based expression vectors for intra- and extracellular production of recombinantproteins in Bacillus subtilis. Protein Expr. Purif.; 2006 Apr; 46(2): 189-95. Epub 2005 Aug 9.

5. Sambrook, J. and Russel, D.W. (2001) Molecular Cloning: A laboratory manual.

6. Titok, M.A., Chapuis, J., Selezneva, Y.V., Lagodich, A.V., Pro- kulevich, V.A., Ehrlich, S.D. and Jannière, L. (2003). Bacillus subtilis soil isolates: plasmid replicon analysis and construction of a new theta-replicating vector, Plasmid 49: 53-62.

Order Information, Shipping & Storage Order No. Description Amount PBS001 pHT01 vector, lyophilized plasmid DNA 10 µg PBS002 pHT43 vector, lyophilized plasmid DNA 10 µg PBS003 pHT08 vector, lyophilized plasmid DNA 10 µg PBS004 pHT09 vector, lyophilized plasmid DNA 10 µg PBS005 pHT10 vector, lyophilized plasmid DNA 10 µg PBS007 pAL12, Bacillus subtilis cold-inducible vector for intracellular expression 10 µg Shipped at room temperature (RT). Lyophilized plasmid DNA can be stored at 4 °C. Once the DNA has been dissolved in sterile water or buffer we recommend storage at -20 °C.

PBS020 Bacillus subtilis strain 1012wt 1 ml PBS021 Bacillus subtilis strain 168 Marburg 1 ml PBS022 Bacillus subtilis strain WB800N (for secretion vectors) 1 mlShipped on dry ice; store at -80 °C.

The pAL Vector – cold-inducible vectorOne further expression vector was constructed containingthe cold-inducible des promoter of Bacillus subtilis. pAL12 is suited for extracellular synthesis of recombinant prote-ins. When mid-exponential phase bacterial cells are ra-pidly transferred from 37 °C to 25 °C or even a lower tem-perature, the synthesis of most cellular proteins greatly decreases, while that of cold-shock proteins is transiently upregulated. In Bacillus subtilis, one of these cold-shock proteins is a membrane-bound desaturase (Δ5-Des) en-coded by the des gene. This enzyme catalyzes the intro-duction of a cis double bond at the Δ5 position of a wide variety of saturated fatty acids. It has been shown that the des gene is tightly regulated during cold shock. Production of recombinant proteins started within the fi rst 30 min after temperature downshock to 25 °C and continued for about 5 h.


pBacTag Tagging Vectors Page 8

Epitope- and GFP-tagging Integration Vectors for Bacillus subtilis FeaturesHelpful for localizing target proteins within specifi c cell compartmentsEasy purifi cation of fusion proteins produced in B. sub-tilis by metal affi nity chromatographyAllows detection of fusion proteins on immunoblots by commercially available antibodiesTags: FLAG, HA, c-Myc, GFP+, YFP and CFP

Product DescriptionThe six pBacTag vectors are based on the backbone of pMUTIN2 and allow for translational fusions of two different types of tagging sequences, epitope and localization tags, to the 3‘ end of any chromosomal gene of interest within the B. subtilis chromosome and of any other bacterial spe-cies not allowing for replication of pBacTag. Transcriptional fusion of the tagging sequences is accomplished by PCR amplifi cation of the 3‘ terminal part of the Gram-positive gene of interest (about 300 bp), insertion into the tagging vector’s multiple cloning site in such a way that (1) it is in frame with the tag sequence to create a fusion protein and (2) that this tagged fusion protein will be synthesized upon integration of the whole vector via homologous recombi-nation with the chromosomal gene. The construct is then introduced back into the Gram-positive organism that was the source of the gene and the plasmid will integrate into the chromosome by homology with the cloned gene. The pBacTag vectors are unable to replicate in B. sub-tilis independently, however upon insertion of about 300 bp derived from the coding region of the gene to be in-activated by PCR, they can integrate into the respective genes by homologous recombination. Integration of the recombinant pBacTag vector into the target gene tran-scriptionally fuses the different tags to that promoter of the gene, and downstream genes can be controlled by the iso-propyl-β-D-thiogalactopyranoside (IPTG)-inducible Pspac promoter. Selection for erythromycin resistance allows for recovery of these integrants. The six vector plasmids were primarily constructed for use in B. subtilis but can be ap-plied to any bacterial species not allowing replication of the pBR322-based plasmids. On the other hand, expressi-on of downstream genes depends on synthesis of the Lac I repressor protein and proper functioning of the Pspac promoter.The epitope sequences (FLAG, c-Myc, and HA) allow de-tection of tagged proteins within the cell using commer-cially available antibodies. Furthermore, the FLAG and HA tags can be used to purify the fusion proteins by affi nity chromatography. The Green Fluorescent Protein (GFP) localization tags GFP+ (which produces enhanced fl uore-scence), YFP and CFP can be used to localize a protein to a specifi c compartment within the cell.

A detailed handbook is provided with the product. It is also available for download on our website www.mobitec.com

Order Information, Shipping & Storage Order No. Description Amount PBT001 pBacTag-FLAG® vector DNA, lyophilized 5 µg PBT002 pBacTag-cMyc vector DNA. lyophylized 5 µg PBT003 pBacTag-HA vector DNA, lyophilized 5 µg PBT004 pBacTag-GFP+ vector DNA, lyophilized 5 µg PBT005 pBacTag-CFP vector DNA, lyophilized 5 µg PBT006 pBacTag-YFP vector DNA, lyophilized 5 µg Shipped at RT; store at 4 °CFLAG® is a registered trademark of Sigma-Aldrich Co.

The pBacTag tagging vectors: Pspac: Pspac promoter trpAt: TrpA terminator ColE1 ori: ColE1 origin Ampr: ampicillin resistance T1T2T0: Lambda t0 and rrnB t1, t2 terminators lacI: lacI gene (lac repressor) Emr: erythromycin resistance tag: tag sequence The complete DNA sequences are available on request.

Bacillus subtilis


pBacTag Tagging Vectors Page 8 Yeast Expression Vectors Page 9

Expression Vectors for Yeast (S. cerevisiae)

p427-TEFHigh copy yeast expression vector carrying the amino-glycoside phosphotransferase gene for selection in yeast using G418. Inserts are expressed from the strong TEF promoter.

Order Information, Shipping & Storage Order No. Description P03301DS p427-TEF Yeast Expression Vector P03302DS p417-CYC Yeast Expression Vector P03303DS pTEF-MF Yeast Expression Vector P03304DS pGAL-MF Yeast Expression VectorShipped at RT; store at -20 °C

pGAL-MFYeast expression vector for secreted proteins. A regulatab-le GAL-L promoter drives inducible expression of a cDNA fused to the pre-pro leader sequence of mating factor al-pha to ensure secretion of the protein product into the me-dium.

pTEF-MFYeast expression vector for secreted proteins. A strong TEF1 promoter drives constitutive expression of a cDNA fused to the pre-pro leader sequence of mating factor al-pha to ensure secretion of the protein product into the me-dium.

p417-CYCLow copy yeast expression vector carrying the aminogly-coside phosphotransferase gene for selection in yeast using G418. Inserts are expressed from the weak CYC1 promoter.

p427-TEF

pTEF-MF pGAL-MF


pORF-CLONE Vector System Page 10

Improved Cloning of Open Reading Frames for Yeast (S. cerevisiae)

Product DescriptionThe yeast shuttle/expression vector pORF-CLONE has been specifi cally developed for an improved and facilitated selection of cloned cDNA inserts containing open reading frames (ORFs) thus allowing an enriched growth of clones expressing authentic polypeptides. This vector system is particularly useful for the development of a high-through-put technique for the one-step generation of high-quality cDNA libraries in the yeast Saccharomyces cerevisiae and a direct, time-saving screening of random-primed cDNA libraries. In brief, the selection system is based on the HIS3 mar-ker gene fused to the C-terminus of the cDNA insert. The cDNAs cloned in-frame result in histidine-prototrophic yeast cells growing on minimal medium, whereas clones bearing the vector without insert or out-of-frame inserts should not grow on this medium.

Previously, E. coli vectors have been constructed on the basis of the ß-galactosidase coding sequence for the ge-neration of in-frame fusion libraries. However, only DNA fragments in the range of 100-1000 bp could be enriched using this system. Moreover, expression of the marker gene was also observed when the lacZ gene was not in frame with the cDNA because of the polycistronic mRNA in prokaryotes and the reinitiation of translation. Other vectors conferred kanamycin resistance to the host on translation of an insert in the correct reading frame but the libraries constructed with them only contained small cDNA fragments in the range of 100-300 bp which could be enri-ched to 60% - 80% for ORF clones.

For improving the selection effi ciency, especially of larger inserts, it is quite advantageous to use an eukaryotic host, which, in contrast to E. coli, has a codon usage homolo-gous to that of mammalian cells, thus avoiding frameshifts as well as translation and post-translational modifi cation problems. Therefore, the eukaryotic yeast Saccharomy-ces cerevisiae, which is able to produce soluble proteins in large amounts is a suitable host for expressing functional, correctly modifi ed proteins. With the pORF-CLONE vector a system has been deve-loped in which a C-terminally fused marker gene is ex-pressed only if the cloned insert carries no internal stop sequences, which may result from frameshifts or 5‘ and 3‘ untranslated regions. Consequently, the use of ran-dom-primed cDNAs is required in this system instead of oligo(dT)-tailed cDNAs that carry their own C-terminal ter-mination codon.

The pORF-CLONE E. coli/S. cerevisiae shuttle/expression vector offers an innovative approach for generating cDNA libraries which are signifi cantly enriched for ORFs and ex-press authentic polypeptides. Using the pORF-CLONE expression system, time-consuming and costly techniques for identifi cation of clones expressing protein by using an-tibody screening on high-density fi lters and subsequently rearraying the selected clones in a new “daughter” library can be avoided. The advantage of this vector is that, in a one-step screening procedure, it allows the generation of expression libraries enriched for clones with correct rea-ding frames as sources of recombinant proteins.

Plasmid map of pORF-CLONE.ColE1 ori: ColE1 origin; AmpR: ampicillin resistance; CUP1: CUP1 promoter; RGSHis(6): 6xHis-tag; HA: hemagglutinine epi-tope 6P: PreScission protease recognition sequence.

FeaturesEffi cient, cost-effective selection of cDNA clones con-taining correct ORFs

Signifi cantly reduced background of clones containing cDNA with incorrect reading frames resulting in expres-sion libraries enriched for clones expressing authentic polypeptides

S. cerevisiae host system allows expression of soluble, correctly folded and modifi ed eukaryotic target proteins in high yields

Improved selection of larger cDNA inserts in the euka-ryotic host system - translation problems and frame-shifts can be avoided

Fast generation of high-quality cDNA libraries by means of random priming

Average insert size of cDNA is approximately 1.2 kb

Easy, fast and reproducible purifi cation of recombinant proteins via metal chelate affi nity chromatography - de-tection of recombinant proteins by commercially avai-lable antibodies

Ideally suited for high-throughput cloning or the produc-tion of cDNA chips


pORF-Clone Vector System Page 11

The pORF-CLONE vector includes the Cu2+-inducib-le CUP1 promoter from the yeast metallothionein gene, which controls expression of genes inserted in the MCS. It also carries the HIS3 gene, coding imidazol-glycerol-phosphate-dehydrogenase, which enables the selection of ORFs based on histidine prototrophy. In addition, the vector contains the E. coli ampicillin resistance (AmpR) gene for selection in E. coli and the yeast selectable mar-kers URA3 and LEU2d. For the improved expression of randomly primed cDNAs, a translation initiation sequence (CAAAATGTCT) that was adapted to S. cerevisiae has been introduced allowing the translation of cDNAs without their own start codon. For the detection and purifi cation of expressed gene products, the plasmid includes a tandem epitope tag positioned N-terminal to the multiple cloning site (MCS), consisting of the hemagglutinine epitope (HA) and the oligo histidine domain (RGS-His6). The modi-fi ed MCS includes a stop codon in each reading frame and allows the directional cloning (SalI/NotI) of cDNAs. For the cleavage of HIS3p from the fusion protein, the recognition sequence (6P) of the PreScission protease

(CTGGAAGTTCTGTTCCAGGGGCCC) has been ad-ditionally inserted. The yeast HIS3 gene was introduced C-terminal to the MCS (Fig.). The translation of the DNA proceeds from the start codon ATG through the tag se-quences into the HIS3 gene. Only if an insert is cloned in the correct reading frame and if it does not contain any stop codon, a complete fusion protein will be produced (Fig.). In this case, expression of the gene product leads to histidine prototrophy in a his3 S. cerevisiae strain. Clones bearing the pORF-CLONE plasmid, but without inserts (Fig.), re-main auxotrophic, as no HIS3 gene is expressed because of translation stops in all three reading frames. The yeast cells are also expected to be auxotrophic if they contain a cDNA that is inserted in an incorrect reading frame, lea-ding to internal stop codons and resulting in the terminati-on of translation before reaching the HIS3 sequence (Fig.). In general, mRNA sequences carry many stop codons in reading frames other than the correct one. pORF-CLONE can be used for cloning of cDNAs with SalI/NotI overhangs and for the expression of randomly primed cDNAs.

Order Information, Shipping & Storage Order No. Description Amount PORF1* pORF-CLONE vector DNA, lyophilized 10 µg

*The vectors come with 500 pmol of 5’ and 3’ sequencing primers each.Shipped at RT; store at 4 °C

The DNA sequence of pORF-CLONE is available on request.


recognition sequence (6P) of the PreScission protease primed cDNAs.

BamHI CACATCAATCATCACATAAAATATTCAGCGAATTGGATCCAAAATGTCTGGCAGATCTCA

HA PstI 6xHIS CCCATACGACGTCCCAGACTACGCTCTGCAGAGAGGATCGCATCACCATCACCATCAC

SalI NotI PreScission protease recognition sequence (6P)GGGTCGACTGAGAGCTCATAGCTAAGCGGCCGCCTGGAAGTTCTGTTCCAGGGGCCC

HIS3 ACAGAGCAGAAAGCCCTAGTAAAGCGTATTACAAATGAAACCAAGATTCAGATTGC

GATCTCTTTAAAGGGTGGTCCCCTAGCGATAGAGCACTCGATCTTCCCAGAAAAAGA

Part of the pORF-CLONE sequence including the cloning sites, tag and protease sequences as well as the translation initiation sequence with the ATG start codon:


�

ColE1 Ori

pPICHOLI

�

AOX or CUP1-Promoter

�

T7-Promoter

AOX-Terminator

PARS1TEF1-PromoterEM7-Promoter

Zeocin

CYC1-Terminator Eco RIRGSHis(6)Bam HIBS/HA epitope*Sal INot IStop

pPICHOLI Shuttle Vector System Page 12

Expression Vectors for Yeast (P. pastoris) FeaturesEfficient, cost-effective and time-saving protein produc-tion in either E. coli or P. pastorisProblems like protein aggregation, denaturation or accumulation in inclusion bodies may be avoided by choosing the P. pastoris expression systemGene products toxic in E. coli may be easily expressed in P. pastorisEasy cloning and high transformation efficiencies Vectors can be used for in vitro transcription/translation of cloned genesConvenient affinity purification and detection of recom-binant proteins

Product DescriptionThe novel pPICHOLI vectors have been designed for he-terologous, inducible gene expression in two commonly used hosts: the yeast P. pastoris and the prokaryote E. coli. The vectors contain an inducible (yeast) alcohole de-hydrogenase (AOX) promoter (pPICHOLI-C: CUP1 pro-moter) and an E. coli T7 promoter as well as sequences allowing autonomous replication both in P. pastoris and E. coli. Small amounts of vector DNA are sufficient to suc-cessfully transform P. pastoris. Time-consuming, labor-in-tensive and costly subcloning into a number of expression vectors including testing for a successful gene expressi-on is no longer necessary. A multiple cloning site enables convenient ligation of DNA fragments into the vectors. The dual expression system offers many advantages: The pro-karyotic expression system (E. coli) is simple to handle and allows a cost-effective and high-level production of heterologous proteins. The P. pastoris/pPICHOLI system is a powerful eukaryotic expression system showing ra-pid growth at high cell densities. When combined with the strong AOX or CUP1 promoter, respectively, it can yield up to several grams of the heterologous protein per liter of culture. Moreover, it is ideally suited for expression of soluble proteins with post-translational modifications and those (eukaryotic) proteins causing problems when ex-pressed in E. coli (e.g. proteins toxic to E. coli).In P. pastoris 100% of the cloned genes could be ex-pressed as soluble proteins whereas in E. coli only 86% of the cloned genes were successfully expressed (27% of them as soluble proteins).The pPICHOLI dual expression vectors combine eukary-otic and prokaryotic promoter elements. Phage T7 pro-moter, including the ribosomal binding site of the major capsid protein, promotes the efficient bacterial expression and is placed downstream from the P. pastoris promoter. The strong alcohol oxidase promoter (AOX) is tightly re-gulated, since protein expression is completely repressed when transformed cells are grown on glucose and maxi-mally induced when grown on methanol.pPICHOLI-C carries the copper-inducible CUP1 promoter of Saccharomyces cerevisiae (instead of the AOX promo-ter) which has been shown to reduce the induction time greatly.

ColE1 ori: ColE1 origin; Zeocin: zeocin resistance; PARS1: P. pastoris autonomous replicating sequence; RGSHis(6): 6xHis-tag; BS: biotinylation sequence;Note: The BamHI site is not unique!* pPICHOLI-HA has an additional HA epitope tag but lacks the BS!

pPICHOLI is available with a multiple cloning site (MCS) in three different reading frames to simplify cloning in frame with the tags (pPICHOLI-1, pPICHOLI-2, pPICHOLI-3). pPICHOLI-1 (3579 bp) has two G bases directly upstream of the Sal I site. pPICHOLI-2 (3578) and pPICHOLI-3 (3577 bp), respectively, are lacking one or both of these G bases. pPICHOLI-C however is not available with a MCS in three different reading frames. Due to the use of a common selection marker (zeocin), the sizes of the shut-tle vectors remain small (~3.6 and 3.2 kb, respectively), hence they remain convenient for handling, cloning and transformation.By integration of a Pichia specific autonomous replicating sequence (PARS1) into the pPICHOLI vectors, linearizati-on is no longer required and the transformation efficiency is increased up to 105 transformants/µg DNA. Additionally, plasmids can be easily recovered from P. pastoris. The pPICHOLI dual expression vectors include a RGS(His)6 tag for sensitive detection and rapid purification of expressed proteins and an in vivo biotinylation sequence. Due to the strong affinity of biotin to avidin, capture and screening assays are greatly facilitated using these vectors. pPICHOLI-HA lacks the biotinylation sequence but pos-sesses instead of it an HA (hemagglutinin) epitope.

Order Information, Shipping & Storage Order No. Description Amount

PPICH1* pPICHOLI (1-3), pPICHOLI-C and pPICHOLI-HA vector DNA, lyophilized 5 x 10 µg

* The vectors come with 500 pmol of 5’ and 3’ sequencing primers each.Shipped at RT; store at 4 °C


CYC1-TerminatorEcoRIRGSHis(6)BamHIBS/HA epitope*SalINotIStop


Mammalian Expression Vectors Page 13

Expression Vectors for Mammalian CellsMammalian expression vectors for stable or transient ex-pression of cDNAs in mammalian cells:

Strong CMV promoter for high-level, constitutive ex-pressionHA epitope tag for convenient detection of expression productsSfi I sites for convenient, directional cloning of full-length cDNAs

Sfi I is a rare cutter enzyme which recognizes the sequence GGCCNNNNNGGCC. The variable core sequence allows the design of multiple Sfi I sites with incompatible over-hangs within the same vector.

These vectors feature two Sfi I sites with the sequences GGCCATTACGGCC and GGCCGCCTCGGCC, allowing directional cloning of cDNAs. Sfi I sequences are extreme-ly rare in eukaryotic genomes and therefore, the majority of eukaryotic cDNAs can be subcloned full-length using Sfi I.

pHA-MEXMammalian expression vector featuring a strong CMV promoter, an N-terminal HA epitope tag for detection of expressed proteins and a NeoR cassette for stable integra-tion of the expression vector into the genome of the host cell. pHA-MEX is suited for both transient overexpression and long-term, stable expression.

pMEX-HAMammalian expression vector featuring a strong CMV promoter, a C-terminal HA epitope tag for detection of ex-pressed proteins and a NeoR cassette for stable integra-tion of the expression vector into the genome of the host cell. pMEX-HA is suited for both transient overexpression and long-term, stable expression.

Order Information, Shipping & Storage Order No. Description P03401DS pHA-MEX mammalian expression vector P03402DS pMEX-HA mammalian expression vectorShipped at RT; store at 4 °C

EcoRIRGSHis(6)BamHIBS/HA epitope*SalINotIStop


CMV promoter-based constitutive Expression Vectors phCMV1, phCMV2, phCMV3

FeaturesModifi ed Human cytomegalovirus (CMV) immedi-ate – early promoter/enhancer/intron for high-le-vel expression in vitro and in vivoT7 promoter priming site in phCMV, phCMV3 for sequencing of the inserted DNA fragmentSV40 polyadenylation signal for effi cient transcrip-tion termination and polyadenylation of mRNApUC origin for high copy number replication of vector in E. coli cells

Product descriptionThe phCMV series of vectors are designed to achieve signifi cantly higher expression levels than traditional hu-man cytomegalovirus (CMV) promoter-based constitutive expression vectors. This makes the phCMV vectors ide-al tools for routine protein expression studies as well as animal injection experiments. The phCMV vectors consis-tently deliver superior expression levels when compared with other commercially available CMV promoter-based expression vectors. It is not unusual to obtain protein ex-pression levels from phCMV that are severalfold higher than those obtained from other popularly used vectors. In addition, because phCMV vectors use the Kan/Neo gene for selection in both bacteria and cultured cell lines, they offer smaller vector sizes and improved transfection effi -ciency.

Benefi tsMaximized high-level expression with optimized CMV promoter

G418 resistance gene for the selection of stable cell lines

Optional N- or C-terminal HA fusion tags for simplifi ed protein detection and purifi cation with anti-HA antibo-dies and affi nity resins

Extensive multiple cloning region for convenient and easy cloning

Small vector sizes for effi cient transfection

ReferencesAusubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seid-man, J. G., Smith, J. A., and Struhl, K. (1994). Current Protocols in Molecular Biology (New York: Greene Publishing Associates and Wiley-Interscience).Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, Second Edition (Plainview, New York: Cold Spring Harbor Laboratory Press).

CMV Expression Vectors Page 13a


Order No. Description Amount VS-EXC00100-01 phCMV1 CMV-based constitutive Expression Vector for encoding recombinant proteins in their native form, without any tags 1 kit Kit contents • 25 µg supercoiled phCMV1 vector, 1 µg/µl solution. • 10 µg phCMV1/CAT positive control vector, 1 µg/µl solution

VS-EXC00200-01 phCMV2 CMV-based constitutive Expression Vector for encoding recombinant proteins with an N-terminal HA fusion tag 1 kit Kit contents • 25 µg supercoiled phCMV2 vector, 1 µg/µl solution. • 10 µg phCMV2/CAT positive control vector, 1 µg/µl solution

VS-EXC00300-01 phCMV3 CMV-based constitutive Expression Vector for encoding recombinant proteins with an C-terminal HA fusion tag 1 kit Kit contents • 25 µg supercoiled phCMV3 vector, 1 µg/µl solution. • 10 µg phCMV3/CAT positive control vector, 1 µg/µl solutionShipped at -20 °C. Stable for at least 6 months when stored properly.

Order Information, Shipping & Storage

CMV Expression Vectors Page 13b


Endoproteinase Pro-Pro-Y-Pro (Igase) cleavage of a REIV (an immunoglobulin) fusion protein produced with the PheBo sys-tem. Lane 1, ß-lactamase-REIV fusion protein after PheBo af-finity column; lane 2, after endoproteinase Pro-Pro-Y-Pro clea-vage; lane 3, REIV in the PheBo column eluate; lane 4, after washing the PheBo column with buffer; M, protein marker (kDa, kiloDalton, indicated on the right). Size ß-lactamase about: 31 kDa. See Ref.1, on the following page.

FeaturesProtein purification from the cytoplasm (pHKcyto)Preparative protein accumulation in the periplasm (pHKperi)Protein export into the periplasm for correct protein foldingEndoproteinase Pro-Pro-Y-Pro cleaves also inclusion bodies!Contamination with the endoproteinase Pro-Pro-Y-Pro avoidedIPTG inducibleConvenient protein purification via pre-packed affinity columns

Product DescriptionIn the PheBo-System for fusion protein cloning and purifi-cation, the protein of interest is cloned next to the leader protein ß-lactamase. The expressed fusion protein re-mains in the cytoplasm (vectors pHKcyto1 and pHKcyto2) or is released into the periplasm with the help of a signal sequence (vectors pHKperi1 and pHKperi2). ß-lactamase allows efficient protein purification under mild conditions on pre-packed re-usable phenylboronate- (Phe-Bo) affinity columns. The leader protein is removed by the site-specific endoproteinase Pro-Pro-Y-Pro (Igase), which also cleaves inclusion bodies. After a second passage through the same affinity column, the protein of interest can be obtained in pure form from the column flow-through, whereas ß-lactamase and the endoproteinase remain on the column.

Example

Fusion Protein Cloning System PheBo Page 14

E. Coli Expression Vectors with PheBo Purification System

-97 kDa-66 kDa

-45 kDa

-31 kDa

-21 kDa

-14 kDa

M 1 2 3 4 M

Schematic overview of IPTG induced fusion protein expression, purification via PheBo column, endoproteinase cleavage of fu-sion protein and final purification of the protein of interest with a second application of the same PheBo column; note, that the endoproteinase Pro-Pro-Y-Pro (Igase) remains on the column as well.

Fusion Protein Expression and Purification

Affinity purification with easy-to-handle, pre-packed and equilibrated phenylboronate (PheBo) columns (2.5 ml version on this photo, con-nected tightly to a syringe via Luer-lock connection).

A detailed handbook including all protocols is provided with the product. It is also availab-le for download.


pHKcyto1 and pHKperi1:

pHKcyto2 and pHKperi2:

Multiple cloning sites of pHK vectors. The endoproteinase Pro-Pro-Y-Pro (Igase) sites for fusion protein cleavage are indicated.

ori

Periplasmic protein production with signal sequence:

Map of pHKperi1. bla: ß-lactamase; S: signal sequence; Plac: lac promoter; catR: chloramphenicol acetyl transferase; ColE1 ori: pBR322-derived origin of replication; f1: origin of replication of filamentous phage f1; fdT: transcription terminator from bacteri-ophage fd, tandemly repeated; MCS: multiple cloning site. Origi-nal vector names: pHKperi1 = pHK5-11; size: 4188 bp; pHKperi2 = pHK5-21; size: 4175 bp. pHKperi2 differs from pHKperi1 in the mutiple cloning site as described above on this page.

Cytoplasmic protein production:

Map of pHKcyto1. bla: ß-lactamase; Plac: lac promoter; catR: chloramphenicol acetyl transferase; ColE1 ori: pBR322-derived origin of replication; f1 ori: origin of replication of filamentous phage f1; fdT: transcription terminator from bacteriophage fd, tandemly repeated; MCS: multiple cloning site. Original vector names: pHKcyto1 = pHK5-10; size: 4140 bp; pHKcyto2 = pHK5-20; size: 4120 bp. pHKcyto2 differs from pHKcyto1 in the mutiple cloning site as described above on this page.

Order Information, Shipping & Storage Order No. Description Amount PHKP01 pHKperi1 vector DNA, lyophilized 5 µg PHKP02 pHKperi2 vector DNA, lyophilized 5 µg PHKC01 cyto1 vector DNA, lyophilized 5 µg PHKC02 pHKcyto2 vector DNA, lyophilized 5 µg PHKP12 Kperi1 and pHKperi2 5 µg each PHKC12 pHKcyto1 and pHKcyto2 5 µg each PB0702 Phenylboronate column 2 ml PB0705 Phenylboronate column 5 mlShipped at RT; store at 4 °C EP0205 Endoproteinase Pro-Pro-Y-Pro (Igase) 50 µgShipped on dry ice; store at -20 °C

Host StrainsSince no lacI gene encoding the lac repressor is located on the pHK vectors, it is advisable to use an E. coli strain that contains a lacIq gene located on the F’ episome (e.g. BMH71-18, JM101, JM103, JM105) as expression host. A frequently used host strain is BMH71-18.

References1. Kolmar, K. et al., J. Mol. Biol. 228 (1992) 359-3652. Frisch, C. et al., Biol. Chem. Hoppe-Seyler 375 (1994) 353-3563. Kolmar, K. et al., J. Mol. Biol. 251 (1995) 471-476 4. Frisch, C. et al., Fold Des 1 (1996) 431-4405. Uson, I. et al., Fold Des 2 (1997) 357-361

The PheBo system has been developed by Prof. Dr. H.-J. Fritz and Dr. H. Kolmar, Institute of Molecular Genetics, University of Göttingen, Germany.

Fusion Protein Cloning System PheBo Page 15


Fusion Protein Cloning System pAX Page 16

E. coli Vector System for Cloning of N-terminal Authentic Proteins

FeaturesExpression of N-terminal authentic proteins without ad-ditional amino acids (pAX5)Cloning in three different reading frames (pAX4a, b, c)Production of both single DNA strands for sequencing the gene (f1 origin in + and - orientation)Purification of fusion proteins via APTG affinity cro-matographyCleavage of fusion protein with endoproteinase Ile-Glu-Gly-Arg (Xa) or collagenaseMutagenesis

Product DescriptionThe pAX vector system combines the advantages of opti-mal gene expression with those of simple protein purifica-tion via APTG affinity chromatography. The fusion protein contains a rigid collagen structure between the leader pro-tein ß-galactosidase and the foreign protein of interest, al-lowing both proteins to fold into their active forms indepen-dently. The protein hinge region also provides free access to the cleavage site of the endonuclease Ile-Glu-Gly-Arg (Factor Xa). After expression, the fusion protein is separa-ted from the cell lysate via APTG affinity chromatography. Proteolytic cleavage of the eluted fusion protein is perfor-med either by endoproteinase Ile-Glu-Gly-Arg or collage-nase. The former results in the release of a 5´ authentic foreign protein, if the gene is cloned into the Nru I site of pAX5. A second application of the same APTG column separates the leader sequence (consisting of ß-galactosi-dase and collagen) from the cloned protein. The purified protein of interest is collected in the flow-through.The pAX system can be used to clone, sequence, mu-tagenize and express foreign genes in E. coli and purify the gene product. Eight cloning vectors, which differ in the multiple cloning site, the reading frame and the orientation of the f1 origin, are available from MoBiTec, as well as sequencing primers and endoproteinase Ile-Glu-Gly-Arg (factor Xa).

Host Strains E. coli lacIq strains like JM109 are recommended, or strains which do not express ß-galactosidase. We suggest the helper phage M13K07.

SDS gel of different steps involved in the purification of E. coli histidyl-tRNA-synthetase (HisRS) expressed as a b-Gal fusion protein. Lane 1, E. coli crude extract after lysis; lane 2, eluate from DE52 column; lane 3, sodium borate elution from APTG column; lane 4, endoproteinase Ile-Glu-Gly-Arg treated fusion protein; lane 5, purified HisRS released from the fusion protein (the b-Gal/hinge region was eliminated by a second APTG affini-ty chromatography); lane 6, purified native HisRS; lane 7, protein molecular size marker. Lane 4 shows the b-galactosidase (116 kDa; upper strong band) and the synthetase (lower band). The endoproteinase is present in such a small amount (< 1% of the fusion protein) that it is not detected.

200

116 -βGal

97,4

66,2

HisRS

42,7

1 2 3 4 5 6 7

SDS gel of β-gal fusion protein

Schematic overview of fusion protein expression, purification via APTG column, endoproteinase Ile-Glu-Gly-Arg cleavage of fu-sion protein and final purification of the protein of interest with a second application of the same APTG column.

Example


Fusion Protein Cloning System pAX Page 17

Multiple cloning sites of the pAX DNA vectors. Please note that the XbaI site is methylated. If the XbaI site is to be used, the vector should be grown in a dam-strain. The amino acid sequence is listed below the DNA sequence. For pAX4a+/- the restriction enzyme recognition sites are indicated.

pAX5+ vector map. Plac: lac promoter; t0: l terminator t0; CS: collagen linker; Xa: re-cognition sequence for factor Xa protease; f1 ori: origin of bacte-riophage f1; AmpR: ampicillin resistance; lacZ: ß-galactosidase; MCS: multiple cloning site.

pAX Sequencing PrimersSequencing counter-clockwise in all pAX vectors:AXPRI1: 5´-CCTGGTCTTGCTGGCCAACAT-3´Sequencing counter-clockwise in all pAX vectors:AXPRI2: 3´-TCTTGCGAGCCAACGGCGGCCC-5´

With pAX5 it is possible to express N-terminal authen-tic proteins without additional amino acids!

Order Information, Shipping & Storage Order No. Description Amount PAX4AP pAX4a+ vector DNA, lyophilized 10 µg PAX4AM pAX4a- vector DNA, lyophilized 10 µg PAX4BP pAX4b+ vector DNA, lyophilized 10 µg PAX4BM pAX4b- vector DNA, lyophilized 10 µg PAX4CP pAX4c+ vector DNA, lyophilized 10 µg PAX4CM pAX4c- vector DNA, lyophilized 10 µg PAX5P pAX5+ vector DNA, lyophilized 10 µg PAX5M pAX5- vector DNA, lyophilized 10 µg AXPRI1 pAX 5´ sequencing primer, lyophilized 0.05 A260 AXPRI2 pAX 3´ sequencing primer, lyophilized 0.05 A260 EP0504* Endoproteinase IIe-Glu-Gly-Arg (Xa) 250 µgShipped at RT; store at 4 °C * not available in the US

ReferenceMarkmeyer, P. et al., Gene 93 (1990) 129-134

A detailed handbook including all protocols is provi-ded with the product. It is also available for download.


BRP Plasmids and Competent BRP Cells Page 18

E. coli Supplementary Vector for Protein SecretionFeaturesProtein excretion into E. coli culture medium without the need of a signal sequenceRelease of lethal proteinsPreventing protein degradation by cytoplasmic protei-nasesAvoiding inclusion bodiesRelease of periplasmic proteinsLarge-scale biotechnological production of proteins in a continuous cultureSimplified protein purification from culture mediumVectors can be co-transformed with ColE1 vectors, alternatively we offer competent BRP-transformed cellsVectors expressing the Bacteriocin Release Protein (BRP)

Product DescriptionThe plasmids pJL3 and pSW1 express the Bacteriocin Re-lease Protein (BRP), which initiates release of periplasmic and cytoplasmic E. coli proteins into the culture medium. Being compatible with most of the commonly used expres-sion vector systems (e.g. ColE1 vectors like pAX, PheBo, pBR322 derivatives), BRP vectors can be co-transformed with the vector producing the recombinant protein of inte-rest. Induction of the BR-Protein with IPTG (pJL3) or mito-mycin C (pSW1) will cause an activation of phospholipase A in the outer E. coli membrane. This results in the forma-tion of permeable zones in the cell membranes, through which proteins are released into the medium. A modera-te induction prevents lysis of producer cells, also making the system suitable for large-scale protein production in a continuous culture. Since cloned proteins are no longer accumulated in the cytoplasm, problems associated with lethality of recombinant proteins, their preferential degra-dation or inclusion body formation are avoided.For your convenience, we also provide competent cells already transformed with one of the vectors.

Example: α-Amylase Release

Effect of Mitomycin C concentration on the release of α-amylase from E. coli RR1. Extracellular α-amylase activity determined ac-cording to Ref. 6. Medium: YT with 100 µg/ml Amp (selection of pBR322-Amy) and 12.5 µg/ml tetracycline (selection of pSW1). Co-transformation in two steps using standard protocols. See Ref. 1 on the following page.

ExamplesProteins, which have already been successfully released by activity of BRP from the E. coli periplasm are: (see re-view article in Ref. 4)

protein size in kDa • Bacillus penicillinase 25 • Aeromonas xylanase L 135 • Human IgG Fc region 29 • Human chimeric IgE/IgG Fc 37 • Human calcitonin 27 • Guar α-galactosidase 40 • Bacillus α-amylase 55 • Bacillus cellulase (N-4 and 1139) 58/92 • Human growth hormone 21 • Human tumor necrosis factor-α 17 • β-lactamase 29 • FaeE 25

Protein release with the BRP vector system

1. 2. 3.Co-transformation Induction of BRP, Excretion of cytosolicof recombinant which then activates and periplasmic proteinsplasmid and BRP Phospholipase A into the cell cultureVector in one or two mediumsteps)


BRP Plasmids and Competent BRP Cells Page 19

Effect of induction with IPTG on the growth of E. coli harboring a BRP vector. IPTG was added at zero time. The various concen-trations of IPTG used (0-40 µM) are indicated in the figure. See Ref. 5. The optical density at 660 nm is a measure of the number of cells. At concentrations above 20 µM IPTG, the cells cease to grow 2 hours after induction.

Quasi-Lysis Test

pJL3; p15A1 ori, origin of replication; CmR, chloramphenicol re-sistance; lppp, E. coli lipoprotein promoter, lacpo, lac promoter operator system; lac I, lac repressor.

pSW1; p15A1 ori, origin of replication; TetR, tetracycline resis-tance; (CmR), part of chloramphenicol resistance gene, not func-tional; pClo, pCloDF13 promoter. BRP, Bacteriocin Release Pro-tein.

Host StrainsGenerally, any E. coli host which is not phopholipase A deficient, can be used. The host we use for preparing our pre-made competent cells is E. coli K12 N3406 (thr

_ leu

_

thi_ lacY tonA supE).

pSW1: The E. coli host strain has to be recA+, since the in-duction with mitomycin C is based on the recA-dependent cellular SOS-response (e.g. JM101, RR1, JM83).

pJL3: It is advisable to choose a recA deficient E. coli host strain to avoid unintended recombination (e.g. JM109, DH5a, XL1-Blue).

To increase protein yield, a protease-deficient strain might be helpful.

InductionSame inducer for recombinant protein and BRP: inducer concentration has to be selected which is appropriate for both vectors.Different inducers: time shifted induction is possible.

Note: Toxic or inclusion body forming proteins should be excreted immediately; i.e. time-shifted induction is not ad-visable.

CompatibilityBRP vectors are compatible with all vectors, which contain an origin of replication other than p15A1. Therefore, BRP vectors can be combined with all commonly used systems derived from pBR322 (i.e. with ColE1 origins), such as pUC, pAX, PheBo etc. Two different selection markers are advisable for the selection of double transformants.

References1. Yu, P. et al., Biotechnol. Prog. 8 (1992) 25-292. van der Wal, F. J. et al., Biotech. Letters 17, 8 (1995) 815-8203. van der Wal, F. J. et al., Appl. Microbiol. Biotechn. 44 (1995) 459-4654. van der Wal, F. J. et al., FEMS Micobiol. Reviews 17 (1995) 381-3995. Luirink, J. et al., Mol. Gen. Genet. 206 (1987) 126-1326. Fuwa, J. Biochem. Tokyo (1954) 41, 583-603

Order Information, Shipping & Storage Order No. Description Amount BRPJL3 pJL3 vector DNA, lyophilized 5 µg BRPSW1 pSW1 vector DNA, lyophilized 5 µgShipped at RT; store at 4 °C

COMJL3 Competent cells transformed with pJL3 5 x 200 µl COMSW1 Competent cells transformed with pSW 15 x 200 µlShipped on dry ice; store at -80 °C

IPTG inducible:

Mitomycin Cincucible:


PCR Cloning Vector p3T Page 20

E. coli Cloning Vector for PCR* Fragments

FeaturesCloning PCR products via multiple dA extensionsResults in higher efficiencies than with single dA/dT overhangs

Product DescriptionThe p3T vector provides a flexible system for the direct cloning of PCR products. It allows cloning of PCR products via multiple dT overhangs.Utilizing the restriction site PflMI, three dT overhangs are produced. After polyadenylating the PCR fragment with Terminal Deoxynucleotidyl Transferase, the PCR fragment can be cloned with high efficiency via a multiple dA exten-sion. Using p3T, less amplified DNA is required. A SmaI site is present to reduce vector background; MscI sites flank the insert for optimal excision. Blue/white selection by α-com-plementation is possible.

Vector map of p3T; AmpR, ampicillin resistance; M13 ori, origin of phage M13; lac Z, lac I, from lactose operon; ori, ColE1 origin; MCS, multiple cloning site.

The restriction enzyme PflMI produces three dT overhangs at both sides of the cloning site of p3T, enabling „TripleT/TripleA“-cloning of the PCR-fragment.

Triple T / Triple A-Cloning

Multiple Cloning Site of p3T

PflMI 5´ CCANNNNNTGG 3´3´ GGTNNNNNACC 5´ ∆

∆

Restriction Enzyme

The recognition sites of the restric-tion enzyme PflMI (available at New England Biolabs), which produces three dT overhangs in the cloning site of p3T.

A detailed handbook including all protocols is provided with the product. It is also available for download

The DNA sequence is available for download on our web site (address see below) and on the EMBL data base at accession number Z46733 (attention: vector is called p123T).

Host StrainsE. coli standard host, such as XL1-Blue (Stratagene). References1. Mitchell, D. B. PCR Meth. App. 2 (1992) 81-82. The vector called p123T in this publication is the same as p3T.

Order Information, Shipping & Storage Order No. Description Amount P123T p3T vector DNA, lyophilized 5 µgShipped at RT; store at 4 °C

* PCR is a process covered by patents owned by Hoff-mann-La Roche. Use of this process requires a licence.

PflMI PflMI


E. coli Expression Vector with His-tag for Easy Purifi cation FeaturesInserts can be expressed as C-terminal tagged 6xHis fusion proteins for effi cient and easy one-step purifi -cation of full length proteins by metal-chelate affi nity chromatographyAn RGS motive and the proximate His-tag allow detec-tion and/or immunoprecipitation of the expressed pro-tein with commercial anti-RGS and anti-His antibodies

Optimized promoter guarantees excellent expression levelsVery tight expression control due to overexpression of the LacI repressorA convenient MCS allows fl exible and easy cloning of the insert Start codon is provided by an NdeI site

Product DescriptionThe pEG-His1 vector harbors a promoter control which even allows the expression of toxic gene products in E. coli. To obtain its exceptional tightness prior induction with IPTG, the LacI repressor gene has been included in the vector and is overexpressed in plasmid bearing cells. Recombinant fusion proteins with a 6xHis tag can be ea-sily and selectively purifi ed using metal chelate affi nity chromatography. For example, immobilized nickel affi nity matrix shows an optimal binding capacity and a minimized non-specifi c binding resulting in highly purifi ed and repro-ducible 6xHis-tagged protein preparations.

Western blot of whole cell lysates from fi ve E. coli clones ex-pressing the toxic protein EBNA2. ni, not induced; i, induced.

Plasmid map of vector pEG-His1.

Order Information, Shipping & Storage Order No. Description Amount PEG01 pEG-His1 vector DNA, lyophilized 5 µgShipped at RT; store at 4 °C.The vector comes with 500 pmol of 5’ and 3’ sequencing primers each.

Cloning map of pEG-His1 (4339 bp).

The DNA sequence of pEG-His 1 is available for down-load.


Poly(His)-tag Cloning Vector pEG-His 1 Page 21

Plasmid map of vector pEG-His1.


E. coli Vector for Cloning of ExonsFeaturesSearch for new eukaryotic genesIdentification of genes which are not transcribed into RNA during certain life cycle stagesIntron/exon mapping2

Exon libraries for screening the genome with labeled cDNARemoving introns before sequencingExpression of eukaryotic genes

Product DescriptionThe Exontrap vector has an intrinsic splicing function, allowing selective cloning of exon sequences from large genomic eukaryotic DNA fragments. This new route for the identification of eukaryotic genes does not involve an initial isolation of cellular mRNA. Thus, genes, which are not transcribed during certain life cycle stages, can also be identified. Exon/intron mapping is greatly facilitated, since for the determination of exon boundaries only the trapped exons have to be sequenced and compared to the known gene. Also, an exon library can be derived and screened for cell type specific genes with labeled cDNA from a panel of differentiated cells. The Exontrap function is based on a shuttle vector con-taining prokaryotic and eukaryotic genetic elements for replication in both, bacteria and cell cultures. The vector contains a 5´ and 3´ exon separated by a 600 bp intron sequence, which contains a polylinker for cloning. The re-combinant vector is transfected into eukaryotic cells (e.g. COS cells) and transcribed. Whether the insert contains an exon in the correct orientation is determined by rest-riction or sequence analysis. The mRNA is processed, i.e. the intron sequences originating from the vector, as well as those being introduced, are removed. After total RNA iso-lation, the mature mRNA is reverse transcribed into cDNA using a specific primer complementary to a sequence of the bordering exon. The cDNA is amplified by PCR* using specific primers, which create restriction sites for further subcloning.

Map of Exontrap vector: RS virus LTR: Rous sarcoma virus long terminal repeat promoter; SV 40 ori, ColE1 ori: origins of replica-tion; poly A: 3’ poly A addition site; AmpR: ampicillin resistance.

Schematic overview: Eukaryotic DNA is cloned into Exontrap, propagated in E. coli. The RNA is then spliced in vivo in euka-ryotic cells leaving only exon sequences. The mature mRNA is then reverse transcribed into cDNA and amplified by PCR.

Multiple Cloning Site

E. coli K12 derivativesCOS cells (SV40 transformed African Green Monkey Kidney, ATCC CRL 1651)

Host Strains

* PCR is a process covered by patents owned by Hoffmann-La Roche. Use of this process requires a licence.

References1. Auch, D. and Reth, M., Nucl. Acids Res. 18 (1990) 6743-67442. Kwok, J. B., Oncogene, 8 (9) (1993) 2575-82

Exontrap Cloning Vector Page 22


Selective Exon Cloning

The Exontrap system has been developed by Prof. Dr. Reth at the Max-Planck-Institute for Immunology in Freiburg, Germany.

Order Information, Shipping & Storage Order No. Description Amount K2010 Exontrap Kit: pET01 vector DNA, lyophilized 5 µg cDNA primer 1, lyophilized 0.05 A260 5´ PCR primer 2, lyophilized 0.05 A260

3´ PCR primer 3, lyophilized 0.05 A260

PET01 pET01 vector DNA, lyophilized 5 µg ETPR04 5´ sequencing primer 4, lyophilized 0.05 A260 ETPR05 3´ sequencing primer 5, lyophilized 0.05 A260 ETPR06 5´ PCR primer 6, lyophilized 0.05 A260 ETPR07 3´ PCR primer 7, lyophilized 0.05 A260 Shipped at RT; store at 4 °C

Primer Application

cDNA primer 1 cDNA synthesisPCR primer 2 primer for in vitro(5´, containing a BamHI site) amplificationPCR primer 3 primer for in vitro(3´, containing a SmaI site) amplification5´ sequencing primer 4 primer for sequencing3´ sequencing primer 5 primer for sequencingPCR 5‘ primer 6 primer for exon amplificationcontaining a BamHI site without additional 5´ and 3´ sequences PCR 3‘ primer 7 primer for exon amplificationcontaining a BamHI site without additional 5´ and 3´ sequences

A detailed handbook including all protocols is provided with the product. It is also available for download on our website www.mobitec.com

The DNA sequence is available for download on our web site (address see below). Please note, that 440 bp are unknown.

Exontrap Cloning Vector Page 23


ssDNA-Production and Expression in pMEX Page 24

E. coli Vector System for Easy Sequencing, Mutagenesis and ExpressionFeaturesCloningStrong gene expressionSequencingUnidirectional deletion

Product DescriptionThe pMEX DNA cloning vectors combine the cloning and expression advantages of DNA plasmid (or cosmid) sys-tems with the sequencing and mutagenesis advantages of single-strand phage systems. The pMEX vectors contain the ColE1 origin of replication and the phage f1 intergenic region. Thus, genes and gene banks can be cloned, se-quenced, mutagenized, and expressed in the same vector system. To optimize gene expression, the distance be-tween the promoter and the ribosomal binding site (Shine-Dalgarno sequence) can be easily shortened to the opti-mal length of 5 to 20 base pairs using the easy access to site directed mutagenesis. With the strong promoter, this results in strong expression of the cloned gene product.The MCS is constructed such that the cloned gene can be sequenced easily by nested deletions from both sides (5´ and 3´) whilst the framing genetic elements (operator, promoter, start and stop codons, terminators) and both sequencing primer sequences remain unchanged. This also enables protein engineering by truncation from both sides with stable gene expression. The pMEX DNA vec-tor system is easy to handle. E. coli lacIq strains can be used, which have advantages for the expression of toxic proteins. The strong promoter does not require heat shock activation; thus, no SOS response will interfere with the protein expression.

�

pMEX8 map. AmpR: ampicillin resistance; Ptac: tac promoter; MCS: multiple cloning site; t1, t2: terminators of the rrnB operon; f1 IG: intergenic region of the phage f1; ColE1: origin of replica-tion.

ExampleThe gene of the Valyl-tRNA-syn-thetase was cloned into the vector pMEX6 yielding the vector pVB38. The protein synthesis of this vec-tor pVB38 in E. coli after induction with 1 mM IPTG was analyzed on 7.5% SDS-PAGE. Lane 1 and 6: molecular weight marker; lane 2: crude extract of E. coli TG1 trans-formed with pMEX6, induced; lane 3: valyl-tRNA-synthetase from yeast; lane 4: crude extract from E. coli TG1 transformed with pVB38, not induced; lane 5: crude extract from E. coli TG1 transformed with pVB38, induced. See ref. 1.

200

116

97

66

1 2 3 4 5 6 kDa

Multiple cloning sites of the pMEX vectors. Please note, that the BamH I site in pMEX5 and pMEX6 is not unique.

pMEX Sequencing PrimerspMEX 5´ Primer: 5´-CGGCTCGTATAATGTGTGG-3´(for pMEX5 and pMEX7)pMEX 3´ Primer: 3´-CCGCCTACTCTCTTCT-5´(for pMEX6 and pMEX8)

Order Information, Shipping & Storage Order No. Description Amount PMEX5 pMEX5 vector (f1 ori in - orientation) 10 µg PMEX6 pMEX6 vector (f1 ori in + orientation) 10 µg PMEX7 pMEX7 vector (f1 ori in - orientation) 10 µg PMEX8 pMEX8 vector (f1 ori in + orientation) 10 µg MEXPR5 PMEX 5´ sequencing primer, lyophilized 0.05 A260

MEXPR6 PMEX 3´ sequencing primer, lyophilized 0.05 A260

Shipped at RT; store at 4 °CA detailed handbook including all protocols is provided with the product. It is also available for download.

Multiple Cloning Sites of pMEX5 and pMEX6:

Multiple Cloning Sites of pMEX7 and pMEX8:


pBBR RESO Page 25

Broad-Host-Range Vectors for Promotor Identification in Gram-negative Bacteria

Product DescriptionThe plasmid pBBR RESO is a broad-host-range promoter cloning vector. In contrast to other known broad-host-ran-ge vectors, it is maintained at a medium copy number and has a reasonable size of about 6.8 kb. It stably replicates in any Gram-negative bacterium studied, and is therefore particularly interesting for the isolation and genetic ana-lysis of DNA sequences with promoter activity in the ho-mologous organism. The reporter system used employs the resolvase-mediated excision of a kanamycin (Kan) re-sistance gene flanked by two res sequences. Cloning an active promoter results in Kan-sensitive clones.pBBR RESO was derived from pBBR1MCS3, which itself is a modification of the broad-host-range plasmid pBBR1CM1. It contains a chloramphenicol resistance gene (CmR) and a unique BglII cloning site immediately upstream the promoterless reporter gene tnpR, encoding the resolva-se from transposon Tn34. Two directly repeated res se-quences flanking the Kan gene are located downstream of tnpR2. A transcriptional fusion between a DNA fragment cloned into BglII and tnpR results in expression of the latter, and resolvase-mediated strand exchange occurs between the res sites. This leads to the irreversible shift from a Kan-resistant to a Kan-sensitive phenotype of the host bacterium. Clones should be plated on Cm-contai-ning agar and assayed for kanamycin resistance/sensiti-vity. The only requirement for the use of this system is a resolvase-free background, i.e. the Gram-negative strains should not contain any transposon potentially coding for resolvase. Besides BglII the DNA of interest can also be digested with Sau3A or BamHI, since the overhangs are compatible.

FeaturesIdentification of the promoter sequence of a cloned gene or operonIdentification of promoter sequences in random tnpR-gene fusion librariesIdentification of genes induced under harsh environ-mental conditions, such as various stresses, under which other reporter genes and selection systems (cat, bla) cannot be used

Promoter cloning vector pBBR RESO. Cloning a promoter se-quence into the BglII site causes resolvase mediated kanamycin (KanR) excision (pBBR RESO*) and, thus, irreversible Kan sen-sitivity. Mob is involved in mobilization, Rep in replication. tnpR: resolvase. CmR: chloramphenicol resistance.

AdvantagesNot only constitutively but also transiently induced promo-ters can be detected. Further, the screening for promoter-containing clones does not necessitate a selection pressu-re onto the reporter gene product.

Host strains Plasmid propagation: transposase-free E. coli strains, such as DH5 or JM109 Expression: a transposase-free Gram-negative host (see pBBR122 on the following page for strains tried so far with pBBR derivatives)

References1. Antoine, R. and C. Locht, Mol. Microbiol. 6 (1992) 1785-17992. Blake, D. G. et al., Current Biology 5 (1995) 1036-10463. Kovach, M. E. et al., BioTechniques 16 (1994) 800-8024. Stark, W. M. et al., Cell 58 (1989) 779-790

The vector pBBR RESO has been developed by S. Köhler, J. Teyssier, and J. P. Liautard at the INSERM laboratory U-431, Montpellier, France (unpublished).

Order Information, Shipping & Storage Order No. Description Amount RESO01 pBBR RESO vector DNA, lyophilized 5 µgShipped at RT; store at 4 °C

The DNA sequence of pBBR RESO is available for download.A detailed handbook is also available for download on our website www.mobitec.com

BglII


Broad-Host-Range Vectors pBBR122 and pBHR1 Page 26

Broad-Host-Range Vectors for Gram-negative Bacteria

FeaturesChange of bacterial host, expression in bacteria other than E. coli (mainly Gram-negative) Studies of broad-host-range repliconsStudies of Gram-negative bacteria

Product DescriptionpBBR122 is a cloning vector with very broad host-range maintenance. As opposed to other known broad-host-ran-ge vectors, it replicates at medium copy numbers and has a small size (5304 bp). This greatly facilitates genetic stu-dies of a wide variety of Gram-negative bacteria and makes pBBR122 particularly interesting for studies of broad-host-range replicons. It stably replicates in all Gram-negative organisms tried so far under standard growth conditions using the appropriate selective pressure. pBBR122 was derived from pBBR1, which was isolated from Bordetel-la bronchiseptica S875. It is compatible with other broad-host-range vectors, since it does not belong to any of the broad-host-range incompatibility groups IncP, IncQ or IncW. Genetic information: pBBR122 is neither mobilizab-le nor conjugative. Rep is the gene involved in replication. By removing a frame shift in the Mob gene of pBBR122, pBHR1 was created. This mobilizable vector is available as well.

Replicate in• Aeromonas caviae• Aeromonas hydrophila• Acetobacter xylinum• Aeromonas veronii • biovar sobria• Agrobacterium tumefaciens• Alcaligenes eutrophus• Azorizobium caulinodans• Bartonella bacillifonis• Bordetella spp• Brucella spp• Caulobacter crescentus• Escherichia coli• Hyphomicrobium denitrificans• Hyphomicrobium facilis• Methylobacillus glyocogenes

Note: The organisms which have been used in combinati-on with pBBR122, are listed on this page. We assume that pBBR122 and pBHR1 replicate in many more organisms than tested so far. If you have tested pBBR122 in an or-ganism which is not on the list, we would appreciate your feedback. Thank you!

• Methylbacterium extorquens• Methylophilus• methylotrophus• Pseudomonas syringae• Pseudomonas (Burkholderia) • solanacearum• Paracoccus denitrificans• Pseudomonas fluorescens• Pseudomonas putida• Rhizobium meliloti• Rhizobium leguminosarum• Rhodobacter sphaeroides• Salmonella typhimurium• Vibrio cholerae• Xanthomonas campestris• and potentially many more!

Map of pBBR122. CmR, chloramphenicol resistance; KanR, ka-namycin resistance; Rep, replication. Restriction sites within the marker genes are indicated.

Map of pBHR1. CmR, chloramphenicol resistance; KanR, kana-mycin resistance; Rep, replication. Mob, mobilization. Restriction sites within the marker genes are indicated.

The vector pBBR122 has been developed by Dr. Camille Locht, Inst. Pasteur, France. The vector pBHR1 has been developed by the Laboratoire de Génétique des Procaryotes - Dr. Michael Faelen, Phi-lippe Gabant, Cédric Szpirer. It is commercialized under non-exclusive license granted by the Université Libre de Bruxelles, Belgium.

A detailed handbook is available for download

Order Information, Shipping & Storage Order No. Description Amount PBBR01 pBBR122 vector DNA (not mobilizable), lyophilized 5 µg PBBR02 pBHR1 vector DNA (mobilizable), lyophilized 5 µgShipped at RT; store at 4 °C

References1. Renauld-Mongénie, G. et al., J. Bacteriol. 178 (1996) 1053-1060 2. Elzer, P. H. et al., Plasmid 33 (1995) 51-573. Kovach, M. E. et al., Gene 166 (1995) 175-1764. Kovach, M. E. et al., BioTechniques 16, 5 (1994) 800-8025. Antoine, R. and Locht, C., Mol. Microbiol. 6, 13 (1992) 1785-17996. Szpirer, C. Y. et al., J. Bacterial. 183 (2001) 2101-21107. Szpirer, C. Y. et al., Mol. Microbiol. 37 (2000) 1283-1292


Suicide Vector pCorrectClone Page 27

E. coli Cloning Suicide VectorFeatures95% cloning efficiency!** Low copy vector reduces copy number of potentially to-xic genes (important e.g. for cloning B. subtilis genes)Dephosphorylation of vector becomes superfluous9 unique restriction sites (in MCS) available which can be combined with five other sites outside gvpA for di-rected cloningNo expensive chemicals like X-Gal are necessary for selective mediumHigh-level production of mRNA and protein is achieved by the strong lambda promoter

**of a 2.1 kb Kpn l DNA fragment (sticky ends); of a 2.0 kb PCR product into the vector’s Sma l site (blunt ends)

Product DescriptionThe pCorrectClone cloning vector is a tool for high-effi-cient cloning of DNA fragments and high-level expression of proteins in E. coli. The positive selection that makes cloning so easy is based on the plasmid-located conditi-onal lethal gvpA gene coding for the gas vesicle protein from Anabaena flos-aquae. Overexpression of this protein is toxic for E. coli and leads to cell death of bacteria car-rying gvpA. When a DNA fragment is cloned into the MCS within gvpA, the lethal gene is disrupted. Thus, only the AmpR transformants with insert-containing plasmids will grow. The system has particularly useful aspects for the construction of gene banks, sequencing projects and clo-ning of PCR products. The vector can be used with your E. coli strain of choice.

Order Information, Shipping & Storage Order No. Description Amount PCC001 pCorrectClone Vector Vector DNA 10 µg Sequencing primers 500 pmoleshipped at RT; store at 4 °C

PCC002 pCorrectClone Cloning Kit Vector DNA 10 µg Sequencing primers 500 pmole T4 DNA ligase 50 U 10x ligase buffer 100 µl restriction endonuclease Sma I 50 U SmaI 10x reaction buffer 100 µl sterile water 1 ml TE-buffer 1 ml

PCC003 pCorrectClone Cloning Kit plus components as in No. PCC002 plus as above competent E. coli cells 10 x 100 µlShipped on blue ice (PCC002) or dry ice (PCC003); vector, primers and buffers store at 4 °C; enzymes at -20 °C; cells at -80 °C

Applications Positve selection of recombinant clones (only recombinants will grow!) Cloning of PCR products, cDNA or any other DNA High-level mRNA production

Strategy for high-efficient selection of recombinant clones.

*Restriction site is not unique

The DNA sequence of pCorrectClone is available for download.A detailed handbook is also available for download on our website www.mobitec.com

More than 95% recombinant clones –an efficient tool to help you avoid wasting

time on false positives!


Multiple Cloning Side Vector pMCS5 Page 28

E. coli Cloning Vector with Largest MCS for Versatile Cloning Strategies

Restriction Enzyme Recognition sites in the 259-bp MCS cassette

Recognition Sequences Enzymes Properties

Heptamer sequences BaeI, RSrII

Octamer sequences AscI, FseI, NotI, SrfI only GC pairs PacI, SwaI only AT pairs PmeI, SgrAI, Sse8387I, SfiI

Hexamer sequences MluI, NruI, SplI, ClaI very infrequent in human DNA AccI, Acc65I, AgeI, ApaI, AvrII, BamHI, BbeI, BglII, Bsp120I, BspDI, BspMI, BssHII, BstBI, Ecl136II, EcoRI, EcoRV, EheI, HindIII , HpaI, KasI, KpnI, MunI, NarI, NcoI, NdeI, NheI, NsiI, Nsp7524V, PmlI, Ppu10I, PstI, SacI, SacII, SalI, SmaI, SnaBI, SpeI, SphI, XbaI, XhoI, XmaI, XmaIII

18-mer sequence I-SceI2 highly unlikely in any DNA

since the plasmid was produced in the dam+ strain DH5α, the ClaI site is methylated and cannot be cleaved

FeaturesStandard cloning into a site upstream from a T7 RNA polymerase promoterEnd-cloningLabelingLinearization of recombinant clonesBlue/white selectionGeneration of single-stranded DNA (using the f1 origin)

Product DescriptionThe cloning vector pMCS5 contains the ultimate mul-tiple cloning site (MCS) with 59 unique restriction sites. In-cluded are the recognition sites for many commonly used restriction enzymes, providing a suitable cloning site for almost any application. The scientist can choose between 46 unique hexamer sites, two heptamer sites and the re-cognition sites of all ten octanucleotide-specific endonu-cleases. In addition, the well-defined 18-mer sequence of the extremely rarely cutting enzyme I-SceI2 is located at one terminus of the MCS, enabling the linearization of recombinant clones. I-SceI does not recognize a palind-rome and can thus be used for labeling and end-cloning. Further it can be utilized for strand protection in unidirec-tional deletion experiments. Included in the MCS are also restriction sites which occur very infrequently in human DNA such as MluI, NruI and SplI.

Our DNA vector systems are supplied in convenient storage boxes.

59 unique restriction sites!

The DNA sequence as well as a detailed handbook are available for download on our web site


Multiple Cloning Side Vector pMCS5 Page 29

Multiple Cloning Site and Vector Map

Order Information, Shipping & Storage Order No. Description Amount PMCS5 pMCS5 vector DNA, lyophilized 5 µgShipped at RT; store at 4 °C

Note: Depending on the DNA vector program used, the number of restriction enzyme cleavage sites may vary. We have determined the number of sites with DNA Strider 1.2.

The vector has been developed by Dr. Jörg Hoheisel, Ger-man Cancer Research Center (DKFZ), Heidelberg, Ger-many.

Map and multiple cloning site of vector pMCS5; AmpR: ampicillin resis-tance, f1 ori: filamentous phage f1 origin, lacZ´: ß-galactosidase, pBR322 ori: plasmid pBR322 origin (ColE1), T7 promoter: RNA polymerase T7 promoter, polylinker: from pUC18, new MCS inserted; sequence and re-striction sites listed above.

References1. Hoheisel, J., BioTechniques 17, 3 (1994) 456-4592. Thierry et al., Nucl Acid Res. 19 (1991) 189-190

With the 18-merrecognition sequence I- Sce I


E. coli Standard Cloning VectorsFeaturesHighest quality DNA prepared by ion-exchange chro-matography, cesium chloride density centrifugation and gel filtrationPreparations with over 80% supercoilingOf special interest: pUC118 and pUC119Ready-to-use for transformations and enzymatic reac-tions

Vector Resistance Origin SpecialitypBR322 Tc, Amp ColE1 reading frame shift gives AmpR, TcS transformantspBR325 Tc, Amp, Cm ColE1 Cm resistant pBR322pBR328 Tc, Amp, Cm ColE1 non-mobilizable pBR325pACYC184 Tc, Cm p15A1 double-transformants with ColE1 vectorspAT153 Tc, Amp ColE1 non-mobilizable; higher copy than pBR322pUC18 Amp ColE1 MCS within lacZ: blue/white selectionpUC118 Amp ColE1 M13 origin for ssDNA productionpUC19 Amp ColE1 MCS within lacZ: blue/white selectionpUC119 Amp ColE1 M13 origin for ssDNA production

� � �

DNA extraction

Standard Cloning Vectors Page 30

pBR322 is an ampicillin and tetracycline resistant, general purpose cloning vector. Several inactivating cloning sites are present in the antibiotics resistance genes, which, if a reading frame shift occurs, will give rise to AmpR / TcS or, alternatively, AmpS / TcR transformants. Cloning sites are indicated on the data sheet.

pBR325 is an ampicillin, tetracycline and chloramphenicol resistant, general purpose cloning vector. It is derived from pBR322 by insertion (into its EcoRI site) of the chloram-phenicol acetyltransferase gene.

pBR328 is an ampicillin, tetracycline and chlorampheni-col resistant, general purpose cloning vector. This vector, derived from pBR325, has the bom site (basis of mobili-ty) deleted and therefore is non-mobilizable; this makes pBR328 suitable where more stringent biological contain-ment is required. This deletion also creates extra unique cloning sites in the chloramphenicol acetyltransferase gene: PvuII, BspMII and BalI.


Standard Cloning Vectors Page 31

�

��

�

Quality Control/Technical Details:Protein contamination is monitored by measuring the ratio of ab-sorbance at 260 and 280 nm. All preparations must have A260/A280 greater than 1.8, indicating essentially protein-free DNA. The absence of nuclease activity is measured by incubating plasmid DNA in restriction buffer for 16 hours. No DNA degra-dation should be observed. The DNA‘s suitability for enzymatic manipulation is tested by restriction with a variety of endonucle-ases. The correct banding pattern is confirmed by agarose gel electrophoresis. The transformation efficiency of the plasmid DNA is measured and antibiotic resistance and blue/white selec-tion is also confirmed. During storage at 4°C, plasmid DNA will slowly convert from supercoiled to relaxed circles. Although this will not affect restriction, transformation efficiency will drop. For long-term storage keep at -20°C. If multiple freeze-thawing cyc-les are likely to occur, dispense small volumes into sterile tubes and store at -20°C. All plasmids are supplied in TE buffer (10 mM Tris-HCI, pH 8.0, 1 mM EDTA).

Thr Met Ile Thr Asn Ser Ser Ser Val Pro Gly Asp Pro Leu Glu Ser Thr Cys Arg His Ala Ser Leu Ala Leu Ala

ATG ACC ATG ATT ACG AAT TCG AGC TCG GTA CCC GGG GAT CCT CTA GAG TCG ACC TGC AGG CAT GCA AGC TTG GCA CTG GCC��

Thr Met Ile Thr Pro Ser Leu His Ala Cys Arg Ser Thr Leu Glu Asp Pro Arg Val Pro Ser Ser Asn Ser Leu Ala

ATG ACC ATG ATT ACG CCA AGC TTG CAT GCC TGC AGG TCG ACT CTA GAG GAT CCC CGG GTA CCG AGC TCG AAT TCA CTG GCC��

��

��

Multiple cloning sites of pUC18/pUC118 (top) and pUC19/pUC119 (bottom).

Order Information, Shipping & Storage Order No. Description Amount* V30302 pBR322 vector DNA 25 µg V30402 pBR325 vector DNA 25 µg V32802 pBR328 vector DNA 25 µg V32402 pACYC184 vector DNA 25 µg V32602 pAT153 vector DNA 25 µg V33002 pUC18 vector DNA 25 µg V33302 pUC118 vector DNA 25 µg V33202 pUC19 vector DNA 25 µg V33402 pUC119 vector DNA 25 µg

Shipped on blue ice; store at -20 °C *DNA is in solution

pUC18/19 and pUC118/119The plasmids have a multiple cloning site within the lacZ α-fragment. Inserts cloned into this site disrupt ß-galacto-sidase activity and give rise to white colonies on X-Gal/IPTG plates. The plasmids encode resistance to ampicil-lin. Foreign DNA inserted in-frame with the lacZ gene will be expressed as a fusion protein (containing a portion of the ß-galactosidase) under control of the lac promoter. The promoter is inducible with IPTG and followed by an initiation codon as well as a ribosome binding site. pUC18 and pUC19 differ in their multiple cloning site orientation. pUC118 and pUC119 contain an additional M13 phage ori-gin for single strand production.

pACYC184pACYC184 encodes tetracycline and chloramphenicol re-sistance. Unlike most cloning vectors, which have ColE1 origins of replication, pACYC184 has an origin derived from p15A1. This allows pACYC184 to be maintained in a pBR322 or pUC18 transformant, for example. Such a double transformant is necessary where two recombinant proteins need to be expressed simultaneously.

pAT153pAT153 is a derivative of pBR322 where the bom (basis of mobility) site has been deleted. Thus pAT153 is non-mo-bilizable and is more readily contained than pBR322. Also present in this 703 bp deletion was the region involved in copy number control; loss of this region gives pAT153 a 1.5 to 3-fold higher copy number. pAT153 encodes ampi-cillin and tetracycline resistance.


EosFP was isolated from the stony coral Lobophyllia hemprichii 1. Initially, the protein matures in a green fluore-scent state with an emission maximum at 516 nm. Upon ir-radiation with violet-blue light the chromophore undergoes an irreversible photoconversion to a red state emitting at 581 nm2. The wavelengths required for photoconversion and detection of the green and red fluorescent states can be easily separated, making EosFP an excellent choice for regional optical marking.

References1. Wiedenmann et al. (2004). Proc. Natl. Acad. Sci. U.S.A. 101, 15905-15910.2. Nienhaus et al. (2005). Proc. Natl. Acad. Sci. U.S.A. 102, 9156-9159.3. Wiedenmann et al. (2007) BIOforum 30/5, 20-22.4. Nienhaus et al. (2006) Photochem. Photobiol. 82, 351- 358.

EosFP Page 32

Green to Red Photoconvertible Fluorescent Protein for Local Marking

FeaturesGreen to red photoconversion: UV/blue-inducible, per-manent, bright and fastSuperb marker for tracking of cells, compartments, pro-teins in live cellsNanoscopy marker using photoactivated localization microscopy (PALM)

ApplicationsTracking of cells, e.g. cell fate mapping, tracking of me-tastasesTracking of subcellular compartmentsTracking of proteinsFluorescence nanoscopy

Order Information, Shipping & Storage Order No. Description Amount VS-FLP10010 pcDNA3-vector, wt-EosFP, with mitochondrial targeting signal, lyophilized DNA 10 µg Not available in the US VS-FLP10020 pcDNA3-vector, wt-EosFP, FLAG®-tagged, lyophilized DNA 10 µg Not available in the US VS-FLP10030 pcDNA3-vector, td-EosFP, FLAG®-tagged, lyophilized DNA 10 µg Not available in the US FLAG® is a registered trademark of Sigma-Aldrich Co. Shipped at RT; store at 4 °C

Protein wt-EosFP td-EosFP Excitation before/after photoconversion (nm) 506/571 506/569 Emission before/after photoconversion (nm) 516/581 516/582 Extinction coefficient before/after photoconversion (M-1 cm-1) 72,000/41,000 84,000/33,000 Fluorescence Quantum Yield 0.70/0.55 0.66/0.60 Oligomerization tetramer tandem dimer, functional monomer

Two variants of EosFP are available from MoBiTec:The tetrameric wildtype protein (wt-EosFP) and a pseudo-monomeric variant in which two copies of an engineered EosFP variant are fused to form a tandem dimer (td-Eos-FP). Both variants express functionally in a wide range ofpro- and eukarotic cells at a temperature of 37 °C or below. For the labeling of cells or tissues, tetrameric wt-EosFP is the construct of choice. For labeling of subcellular compar-tements using short oligopeptide signals attached to the

marker, both wt-EosFP and td-EosFP can be considered. Although some fusion proteins with tetrameric wt-EosFP are possible, the pseudomonomeric variant td-EosFP is the recommended construct for protein labeling. Fusions to the N-terminus of td-EosFP usually work well. Fusions to the C-terminus are also possible, however, some fusi-ons might fail with proteins requiring a strictly monomeric marker, for instance tubulin.


MobiTEV Protease Page 33

Tobacco Etch Virus (TEV) Protease is used to remove fusion tags - solubility, secre-tion, detection, and purification tags - and release the ,native, protein of interest. Mo-biTEV Protease is an improved version of TEV Protease that is highly site-specific, highly active, and significantly more stable than native TEV Protease, resulting in enhanced long-term activity. MobiTEV Protease specifically recognizes the seven amino acid sequence Glu-Asn-Leu-Tyr-Phe-Gln/-Gly, cleaving between Gln and Gly.

Features Highly specific cleavage activity Robust activity over a broad temperature (4 °C to 37 °C) and pH (7 to 9) range Enhanced enzyme stability for prolonged protease activity Greater than 85% single-band purity with no non-specific protease contamination Easy removal of TEV Protease from the digested protein sample using the His- or GST-tag

Unit DefinitionOne unit of MobiTEV Protease cleaves 3 µg of the control substrate at >85% in 1 hour in 30 µl reaction buffer (50 mM Tris/HCl, 0.5 mM EDTA and 1 mM DTT) at pH 8.0 and 30 °C.

ReferenceKapust et al. (2001) Tobacco etch virus protease: mechanism of autolysis and rational de-sign of stable mutants with wildtype catalytic proficiency. Protein Eng. 14, 993-1000.

Improved TEV Proteases

Order Information, Shipping & Storage Order No. Description Amount PR-ETA10010-01 MobiTEV, recombinant, His-tag 1,000 U PR-ETA10010-05 MobiTEV, recombinant, His-tag 10x 1,000 UShipped on dry ice; store at -80 °C

TEV Protease with additional GST-tag: PR-ETA10050-01 TEV Protease, recombinant, GST- & His-tag 100 U PR-ETA10050-02 TEV Protease, recombinant, GST- & His-tag 500 U PR-ETA10050-03 TEV Protease, recombinant, GST- & His-tag 1,000 UShipped on blue ice; store at -20 °C Not available in the US


IgA Protease, also referred to as Igase or Endoprotease Pro-Pro-Y-Pro, is an endo-protease with a MW of 106 kDa that cleaves the proline-rich hinge region of IgA1. The enzyme recognizes the amino acid sequence N-X-Z-Pro-Pro/-Y-Pro-C (X = pre-ferred Pro or Ser; Y = Thr, Ser or Ala; Z = preferred Arg or Thr). IgA Protease pro-cesses polypeptides at authentic or engineered sites. Highly specific proteolysis can be obtained not only with soluble and purified protein fusions but also with insoluble aggregates derived from cytoplasmic inclusion bodies.

Features Highly specific recognition of N-X-Z-Pro-Pro/-Y-Pro-C sequence Especially useful for cleavage of insoluble aggregates derived from inclusion bodies Used in the PheBo Fusion Protein System for cloning, expression, cleavage and affinity purification of fusion proteins.

IgA Protease Page 34

Human rhinovirus 3C (HRV3C) Protease is a cysteine protease that recognizes the cleavage site of Leu-Glu-Val-Leu-Phe-Gln/-Gly-Pro, commonly referred to as the ,PreScission, site. It cleaves between Gln and Gly. The recombinant form of the HRV3C Protease is a restriction grade protease that has robust activity at 4 °C with high specific activity and great stability. It does not require any special buffer for its activity and can be used in a buffer most suitable for the target protein. This HRV3C Protease is a 47 kDa protein with both GST- and His-tags, so it can be removed by either Ni-chelating or Glutathione (GSH) resin.

Features Highly specific, e.g. more specific than thrombin protease Cost effective compared to GE’s

,PreScission

, Protease

Easy removal of HRV3C using GST- or His-tag No buffer restrictions; use the suitable buffer for your target protein Freeze resistant and functional even after multiple freeze-thaws

Unit DefinitionOne unit of HRV3C Protease cleaves >95% of 100 µg of control target protein at 4 °C in 16 hours. No non-specific activity has been observed under the same condition with HRV3C Protease to control target protein ratio of 1:10. Prolonged incubation (several days) under the same condition does not show any non-specific cleavage.

Highly Active Protease for the ‘PreScission’ Site

ReferenceCordingley et al. (1989) Cleavage of small peptides in vitro by human rhinovirus 14 3C prote-ase expressed in Escherichia coli. J Virol. 63(12), 5037-45.


Order No. Description Amount

PR-ETA20010-01 HRV3C Protease, recombinant, GST- & His-tag 1,000 U

Shipped on blue ice; store at -20 °C Not available in the US

HRV3C Protease

Order Information, Shipping & Storage Order No. Description Amount EP0205 IgA Protease (Igase Pro-Pro-Y-Pro), recombinant 50 µgShipped on dry ice; store at -20 °C

Especially Useful for Cleavage of Fusion Protein in Inclusion Bodies


Kex2 is a specifi c serine endoprotease from yeast with a MW of 68 kDa. It cleaves at the carboxyl end of the recognition sequences: Arg-Arg/-X and Lys-Arg/-X and thus provides new possibilities for e.g. the development of fusion protein systems with alternative cleavage sites.

Features Cleaves amino acid sequences N-Arg-Arg/-X and N-Lys-Arg/-X at the carboxyl end Suited for protein sequencing and cleavage of fusion proteins

Order Information, Shipping & Storage Order No. Description Amount EP0410 Kex2 Protease (Lys/Arg-Arg), recombinant 10 U EP0450 Kex2 Protease (Lys/Arg-Arg), recombinant 50 UShipped on dry ice; store at -80 °C

Kex2 Proteases Page 35

Features

Pro39 cleaves its substrates in a wide temperature and pH range, as well as in most commonly used buffers

The cleavage of the substrates can be reversibly inhibited by the addition of Zn2+ ions and reactivated by the addition of EDTA

Pro39 cleaves substrates containing the recognition site both in liquid as well as in a resin-bound state

Pro39 is the Semliki Forest Virus (SFV) non-structural protein nsP2 C-terminal protease domain, in a truncated, modifi ed and His-tagged form. Pro39 protease specifi cally recognizes and cleaves the amino acid sequence DVLRLGRAGA/YIFSS or DVLRLGRAGA/G. The cleavage is highly specifi c and active.The molecular weight of Pro39 is approximately 39 kDa. Since the protease has a His-tag, it can be easily removed from cleavage reactions.The reaction conditions for cleaving of fusion proteins have to be determined em-pirically. During cleavage reactions, it is recommended that samples be removed from the reaction mixture at various points in time and analyzed by SDS-PAGE to estimate the yield and extent of digestion, and the purity of the product. Typical parameters that should be varied in pilot experiments include enzyme/substrate ratio, substrate concentration, temperature, reaction time, pH.

Pro39 Protease



PR-ENP00010-01 Pro39 Protease, recombinant, His-tag 500 U

PR-ENP00010-02 Pro39 Protease, recombinant, His-tag 2,500 UShipped on dry ice; store at -80 °C

Protease for Alternative Cleavage Sites

Very Specifi c and Tuneable Protease


Factor Xa Protease Page 36

Factor Xa is a specific serine endoprotease with an extended, substrate-binding region matching the Ile-Glu-Gly-Arg tetrapep-tide segment. Following purification, the fusion protein is treated with Factor Xa to release the desired protein with a precise N-ter-minal sequence determined by the vector construction, which is particular useful for structural work and for any other application requiring substantial amounts of authentic recombinant protein product.

The Endoprotease that Creates Authentic Recombinant Proteins

Features Highly active cleavage of N-Ile-Glu-Gly-Arg/-C sequence at the carboxyl end Creates N-terminal authentic recombinant protein if cloned into the NruI site of the pAX5+ vector



EP0504 Factor Xa Protease (Ile-Glu-Gly-Arg) 250 µg

Shipped at RT; store at 4 °C Not available in the US and Canada

Fast Digestion of Nucleic Acids with a highly purified Endonuclease

Features High speed endonuclease Digests single- and double-stranded nucleic acids Highly purified, no protease activity Fast digestion of nucleic acids during protein purification Removes nucleic acid contamination from sample preparation

HS-Nuclease is a recombinant form of Serratia marcescens extracellular endonuclease (encoded by the same gene as Be-zonase®) produced in E. coli using a proprietary process. This nonspecific endonuclease hydrolyzes both single- and double-stranded nucleic acids (DNA and RNA) to 5’-phosphorylated oli-gonucleotides of 1-4 bases in length. HS-Nuclease is a highly purified homodimer of 27 kDa subunits that has exceptional high specific activity and is free of protease activity. HS-Nuclease is ideal to digest nucleic acids and to reduce viscosity during prote-in purification and sample preparation.

50 mg of salmon sperm DNA was incubated with the indicated units of HS-Nuclease and another brand of nuclease at 37 °C for 30 min in a buffer of 50 mM Tris-HCl, pH 8.0 and 1 mM MgCl2. DNA digestion was monitored by agarose gel.

HS-Nuclease

Order Information, Shipping & Storage Order No. Description Amount GE-NUC10700-01 HS-Nuclease (recombinant Endonuclease, encoded by the same gene of Benzonase®) 50,000 U GE-NUC10700-02 HS-Nuclease (recombinant Endonuclease, encoded by the same gene of Benzonase®) 100,000 UShipped on blue ice; store at -20 °C Benzonase® is a trademark of Merck KGaA


MobiSpin Columns for DNA Purification Page 37

Equilibrated and Ready-to-Use; now also for Removal of Unincorporated Dyes!

Features Compatible with laboratory standard Column comes pre-packed and equilibrated Easy handling: spin, load sample, spin, and collect the purified product No sample dilution Reproducible results with simplified protocols One sample in less than 4 minutes Numerous samples can be processed simultaneously Large number of applications

Non-specific binding:The MobiSpin columns exhibit only insignificant non-spe-cific binding, allowing purification of samples in the nano-gram range. For each resin type there is a uniform propor-tional loss of sample due to the nature of the process.Retention:For a given sample volume, product retention inversely correlates to molecular size. As the size of the product in-creases, its relative retention decreases.

MobiSpin columns with different matrices. Scale: reduced.

Product DescriptionThe MobiSpin columns are designed for a wide variety of nucleic acid purification applications. Next to our MobiSpin columns with Sephadex® G-50 resin three different Se-phacryl® resins are available: S-200, S-300 and S-400. A sample volume guide for the selection of the matrix suited best for your specific needs is available at: mobitec.com.® Trademarks are registered by Pharmacia.

Applications of S-200, S-300 and S-400 matrices Buffer exchange between enzyme reactions DNA purification prior to sequencing Oligonucleotide purification after synthesis Removal of free nucleotides Low cost plasmid purification

Application of G-50 matrix Removal of unincorporated dyes or dye terminators for purification of DNA after labeling reactions

Order Information, Shipping & Storage Order No. Description Amount SCO200 MobiSpin S-200 20 columns SCO210 MobiSpin S-200 100 columns SCO300 MobiSpin S-300 20 columns SCO310 MobiSpin S-300 100 columns SCO400 MobiSpin S-400 20 columns SCO410 MobiSpin S-400 100 columns SCO234 MobiSpin S-200, S-300, S-400 3 x 10 columns SCO500 MobiSpin G-50 20 columns SCO510 MobiSpin G-50 100 columnsShipped at RT; store at 4 °C

MoBiTec GmbHLotzestrasse 22a37083 Göttingen, GermanyPhone: +49 5 51-707 22-0Fax: +49 5 51-707 22-22E-mail: [email protected]: www.mobitec.com

Distributed by:

VECTOR SYSTEMS

vector systems xxvii - auro-scienceauroscience.hu/docs/mobitec-vector-systems-lowres.pdf ·...

Documents