UPDATE ON ANTENATAL UPDATE ON ANTENATAL TESTINGCHARLOTTE CLAUSEN, MDCENTER FOR GENETICS AND MFMSEPTEMBER 7TH 2012SEPTEMBER 7TH, 2012

Disclosure

I have nothing to disclose I have nothing to disclose I have no affiliation with any company mentioned

during this presentationduring this presentation

Objectivesj

Describe the different techniques to evaluate fetal Describe the different techniques to evaluate fetal DNA

Distinguish between the different screening and Distinguish between the different screening and diagnostic options

Identify appropriate candidates for non invasive Identify appropriate candidates for non invasive prenatal testing(NIPT)

ACOG Practice Bulletin 2007

All pregnant women should be offered screening All pregnant women should be offered screening Invasive diagnostic testing for aneuploidy should be

available to all women, regardless of maternal available to all women, regardless of maternal age.

Pretest counseling should include a discussion of the Pretest counseling should include a discussion of the risks and benefits of invasive testing compared with screening tests.

Basic Molecular and Cytogeneticsy g

Karyotype Karyotype Chromosomal constitution

of an individual

Most common chromosomal b litiabnormalities

Chromosomal abnormality Incidence Rates

XXY, XXX, Turner Syndrome 1/500

Down Syndrome 1/700Down Syndrome 1/700

Cystic Fibrosis 1/2,500

Trisomy 18 1/5,000

Fragile X 1/8,000

SMA 1/10,000

Trisomy 13 1/16,000

Age-related risk at live birthg

Maternal age at delivery Risk of Down syndrome Risk of any chromosomal abnormality

25 1/1,200 1/476

30 1/1,000 1/385/ /

35 1/400 1/192

40 1/100 1/6640 1/100 1/66

45 1/35 1/21

So, what is a screening test?, g

Goal is to define risk for a disease in an asymptomatic y ppopulation

Ideal characteristics Identify common and important fetal disorders Cost-effective and easy to perform High detection rate High detection rate Reliable and reproducible Test for disorders that have a diagnostic test available Allow time to act on results if desired

History of antenatal testingy g

1966- amniocentesis 1970’s- age alone 1980’s

AFP Triple screen- 72% detection 5% False positive Quad screen- 79% detection 5% False positive Penta screen- 83% detection 5% False positive1980’ CVS 1980’s- CVS

1990’s – First Trimester screen- 80-85% 5% False positive First Trimester screen- 80-85% 5% False positive Sequential screen 90-94% detection 3-5% FP

2010’s- Non-invasive prenatal diagnosis(fetal DNA)

Current Methods of Aneuploidy D t tiDetection

Confirmation of Diagnosis Confirmation of Diagnosis Invasive detection methods Chorionic villous sampling – first trimesterp g Amniocentesis – second trimester Potential complications: procedure-related loss 1/200

Evans MI and Wapner RJ. Invasive Prenatal Diagnostic Procedures 2005. Sem in Perina

New kid on the block….

Non-invasive prenatal testing(NIPT) Non invasive prenatal testing(NIPT)

Non-invasive prenatal diagnosisp g

Intact fetal cells Intact fetal cells 1 in a million of total cell population Can persist for years Can persist for years

Cell-free DNA Cell-free mRNA Cell-free mRNA

Lo

Circulating Cell Free Fetal DNAg

1997 article by Lo in Lancet

Lo YM, Corbetta N, Chamberlin PF et al. Presence of fetal DNA in maternal plasma and serum. Lancet 1997;350: 485-487.

Based on previous findings of tumor DNA present in patients Based on previous findings of tumor DNA present in patients with cancer

30 pregnant women with male fetuses Serum and plasma analyzed 70 – 80% detection rate

Lo et al. Presence of fetal DNA in maternal plasma and serum. Lancet 1997

Circulating Cell Free (ccf)Fetal (ccff) DNADNA Source of ccff is thought to be from placental cells

through breakdown of fetal cells in circulation Circulating fetal DNA thought to comprise 3 – 6% of all

DNA in circulating maternal plasma. Now it’s known to DNA in circulating maternal plasma. Now it s known to range from 3 – 40%, with an average of about 10%

Detection starting at as early as 5 weeks. Consistently seen at 10 weeks seen at 10 weeks

Little risk of interference of ccff from previous pregnancies

Half-life of ccff is 15 minutes and is undetectable within 2 hours postpartum

Ehrich et al. Noninvasive detection of fetal T21 by sequencing of DNA in maternal blood. AJOG 2011

Clinical uses of cffDNA

RhD Genotypingyp g Fetal DNA collected from maternal serum Used for women who with partners who are

heterozygous for RhD allele Assays used in RhD genotyping are reliable,

reproducible, and routinely used in Europe

Sex-determination For inherited disorders CAH, hemophilia, duchenne’s

Bianchi et al. Noninvasive prenatal diagnosis of fetal Rhesus D. Obstet Gynecol 2005.Queenan, JT. Noninvasive Fetal Rh Genotyping: The time has come. Obstet Gynecol 2005.

Noninvasive Aneuploidy Detectionp y

Aneuploidy detection is much more challenging Aneuploidy detection is much more challenging Single nucleotide polymorphisms DNA methylation DNA methylation Fetal mRNA

Cell-free fetal DNA

2007 Digital PCR

Lo YM, Lun F, Chan KC, et al. Digital PCR for the molecular detection of fetal chromosomal aneuploidy

2008 detection of Trisomy 21 2008 detection of Trisomy 21

Chiu RW, Chan KC, Gao Y, et al. Noninvasive prenatal diagnosis of fetal chromosomal aneuploidy by massively parallel genomic sequencing of DNA in maternal plasma Proc Natl Acad Sci USA 2008;105:20458-of DNA in maternal plasma. Proc Natl Acad Sci USA 2008;105:2045820463

Fan HC, Blumenfeld YJ, Chitkara U, Hudgins L, Quake SR. Noninvasive diagnosis of fetal aneuploidy by shotgun sequencing DNA from diagnosis of fetal aneuploidy by shotgun sequencing DNA from maternal blood. Proc Natl Acad Sci USA 2008;105:16266-16271

Massively Parallel Shotgun Sequencing (MPSS)(MPSS) Start with DNA fragments in maternal plasma Sequence and align the fragments (figure out if fragment is fetal or

maternal, and on which chromosome it belonged) Sequences that belong to potentially more than one chromosome are

h f h thrown out of the count Determine the % contribution of unique sequences mapped to each

chromosome (unique count for chrN/total unique count)C h % h N d i d d Compare the % chrN to a predetermined z-score to detect a potential aneuploid

Z-score of aneuploid chromosomes is expected to be higher (z-score >3 0) >3.0)

Chiu et al Noninvasive prenatal diagonsis by fetal chromosomalChiu et al. Noninvasive prenatal diagonsis by fetal chromosomal aneuploidy by MPGS of DNA in maternal plasma. PNAS 2008.

Principles of Fetal Trisomy 21 Testing From aMaternal Blood Sample Using DNA Sequencing

~10% of the DNA fragments in a pregnant woman’s blood are from the fetus ( ) 90% are from the mother ( )

Maternal Blood Sample Using DNA Sequencing

~90% are from the mother ( )

Schematic of DNA Fragments IsolatedFrom Maternal Plasma Containing MaternalDNA and Euploid Fetal DNA

Schematic of DNA Fragments IsolatedFrom Maternal Plasma Containing MaternalDNA, Fetal DNA and Extra Fragments of Chromosome 21Contributed by a Fetal Trisomy 21Contributed by a Fetal Trisomy 21

Euploid Fetus Fetus with Trisomy 21

Principles of Fetal Trisomy 21 Testing From aM t l Bl d S l U i DNA S i

GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10

Maternal Blood Sample Using DNA Sequencing

Sequencing tells you which chromosome the ccf fragment

TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21

ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14

chromosome the ccf fragment comes from

GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y

Principles of Fetal Trisomy 21 Testing From aMaternal Blood Sample Using DNA SequencingMaternal Blood Sample Using DNA Sequencing

The total number of ccf-fetal fragments vs. ccf-maternalfragments of any one chromosome is proportional to the g y p psize of the chromosome, and is consistent from sample to sample, and patient to patient.

Sequencing tells you which chromosome the combinedSequencing tells you which chromosome the combined maternal and fetal fragments come from.

Chromosome 1 Chromosome 21

Principles of Fetal Trisomy 21 Detection Using DNA Sequencingq g

DNA MPS* does not differentiate which fragments come from the mother and which from the fetus.

The quantitative over-t ti f T i 21representation of Trisomy 21

fragments in an affected pregnancy is significant and can be measured with high

Unaffected Fetus Fetus with Trisomy 21

gprecision.

* MPS - Massively Parallel Sequencing

Schematic illustration of the procedural framework for using massively parallel genomic sequencing for the noninvasive prenatal detection of fetal chromosomal aneuploidy.seque c g o t e o as e p e ata detect o o eta c o oso a a eup o dy

Fetal or maternal?Which chromosomeDoes it belong to?

% Ch N% Chromosome N

Z-score

Chiu R W K et al. PNAS 2008;105:20458-20463

©2008 by National Academy of Sciences

Fetal aneuploidy is detectable by the overrepresentation of the affected chromosome in maternal blood.

Fan H C et al. PNAS 2008;105:16266-16271

©2008 by National Academy of Sciences

DANSR vs Massively Parallel Shotgun Sequencing Assay Comparison

Chr 18 and 21 cfDNAOth Ch fDNA

cfDNA in blood

Other Chr cfDNAUnmapped cfDNA

DANSR (Directed analysis) MPSS (Random analysis)

Same cfDNA fragments from select Random cfDNA fragments from all gchromosomes analyzed every timeOnly relevant cfDNA fragments go onto DNA sequencing96 patient samples analyzed

gchromosomes analyzed every timeAll cfDNA fragments go onto DNA sequencing regardless of relevance4-8 patient samples analyzed p p y

simultaneouslyp p y

simultaneously

25

Relative Chromosome Dosage (RCD)(RCD) Measures the total amount of a specific locus on a Measures the total amount of a specific locus on a

potentially aneuploid chromosome (ex: Chr21) Measures both maternal+ fetal total Measures both maternal+ fetal total Total dosage is compared to reference

Current NIPTs

Sequenom MaterniT21plus – launched 10/2011 Sequenom MaterniT21plus launched 10/2011

Verinata Verifi - launched 3/2012

Ariosa Harmony l h d 6/2012 Ariosa Harmony – launched 6/2012

Natera- no published clinical data

Technologygy

Sequenom Verinata Ariosa

Massively parallel shotgun sequencing

(MPSS)

Massively parallel shotgun sequencing

(MPSS)

Digital analysis of selected regions

(DANSR)

Risk Calculation

Z-score(Sequenom)

Total maternal and fetal/total reference

Mean chromosomal amount + 3 SD

>3 is positive <3 is negative >3 is positive, <3 is negative

Normalized chromosomal value(Verinata)

Total maternal and fetal/custom reference

>4SD is positive, 2.5-4 is no-call, <2.5 is negative

FORTE(Fetal-fraction optimized risk of Trisomy Evaluation) (Ariosa)

LR = cfDNA of specific chr/total cffDNA LR = cfDNA of specific chr/total cffDNA

Provides individualized risk score

Maternal age + GA x LR of result

Accounts for fetal fraction

Study Datay

Sequenom Verinata Ariosa

total n= 2,437 651 4097

# of published 4 3 4# of published studies

4 3 4

T21 249 102 205

T18 62 44 113

T13 12 15 -

XO ? 19 - 20 -

Sensitivity/Specificity - Totalsy/ p ySequenom Verinata Ariosa

T21 detection 249/251 102/102 205/205T21 detection 249/251(99.2%)

102/102(100%)

205/205(100%)

FPR 4/1880(0.2%)

0/438 3/3547(0.08%)

T18 detection 59/59(>99.9%)

43/44(97.7%)

111/113(98.2%)

FPR 5/1688(0.3%)

0/499 2/3547(0.05%)

T13 detection 11/12(91.7%)

11/15(73.3%)

-(91.7%) (73.3%)

FPR 16/1688(0.9%)

0/531 -

XO detection NA 15/16(93.8%)

NA

FPR NA 0/464 NA

MaterniT21plus (Sequenom) H R li bl i it i d t ti T21? How Reliable is it in detecting T21?

Multicenter (27 international sites) trial funded by Multicenter (27 international sites) trial funded by Sequenom

Blinded nested case control of 1694 women (212 Blinded nested case control of 1694 women (212 DS/1484 controls) undergoing invasive testing

DS detection rate was 98.9% (209/212) DS detection rate was 98.9% (209/212) Detection rate improved to 210/212 after

accounting for GC content in DNAaccounting for GC content in DNA FP rate of 0.2% with testing failure in 0.8%

Palomacki et al. Genetics in Medicine; 13(11); 2011.

MaterniT21plus (Sequenom) How li bl i it f T18 T13?reliable is it for T18 or T13?

Nested case control of 62 women with T18 and 12 with T13 matched with euploid controls

T18 (62 samples) 3 with insufficient fetal DNA 59 sampled had z-scores >3.88 c/w T18 (DR 100%) FP rate of 0 3% (5/1688 euploid samples) FP rate of 0.3% (5/1688 euploid samples)

T13 (12 samples) 11/12 with z-scores > 7.17 (DR 91.7%)/ ( ) 1/12 with normal z-score (FN 8%). 16/1688 with abnormal z-score (FP rate 0.9%)

Palomacki et al. DNA sequencing of maternal plasma reliably identifies T13 and T18. Genetics in Medicine 2011.

MaterniT21plus (Sequenom)p ( q )

Results: “Positive” vs. “Negative” based on z-score. Results: Positive vs. Negative based on z score. 1% chance for no result Eventual/potential ability to give results on other Eventual/potential ability to give results on other

chromosomes including X and Y Will accept samples on twins and IVF/egg donor Will accept samples on twins and IVF/egg donor Long term potential for genome wide studies

MaterniT21 (Sequenom)( q )

Verifi (Verinata) MELISSA t dMELISSA study Prospective, blindedp , 532 samples

89/89 T21 100% 35/36 T18 97.2% 11/14 T13 78.6% 232/233 XX 99.6% 184/184 XY 100% 15/16 XO 93 8% 15/16 XO 93.8% Also reported on complex variations 3/3 translocation 21,

1/1 mosaic T18, mosaic 2/7 monosomy X/ , / y

Bianchi DW et al. Genome-wide fetal aneuploidy detection by maternal plasma DNA sequencing. Obstet Gynecol. 119;890-901 (2012)

Verifi (Verinata) ( )

Results: “Aneuploidy detected/Aneuploidy not detected”p y / p y Least amount of published data “no call” results for patients between 2.5-4 SD-2.6% Failure rate – 2.6% (2% could be re-run) Eventual/potential ability to give results on other chromosomes

including X and Y Will accept IVF/egg donor samples M X il bl h ti h i di d Monosomy X available when cystic hygroma is diagnosed Long term potential for genome wide studies

ANEUPLOIDY DETECTEDSee BelowSee Below

Aneuploidy detected Results consistent with aneuploidy for chromosome 21

Harmony (Ariosa) y ( )

P ti bli d d Prospective, blinded NICE trial 81/81 T21 1/2888 FP 0 03% 81/81 T21 1/2888 FP 0.03% 37/38 T18 2/2888 FP 0.07%

4.5% failure rate 4.5% failure rate 39% of abnormal karyotypes were other than T21/T18

Norton ME, Brar H, Weiss J, et al. Non-Invasive Chromosomal Evaluation(NICE) Study: results of a multicenter prospective cohort study

for detection of fetal trisomy 21 and trisomy 18. AJOG 137.e1-e8. Aug 2012.

Harmony (Ariosa) y ( )

Up to 4 6% chance for no result Up to 4.6% chance for no result

Can’t do on twins or IVF with egg donor at this time

Technology may be limiting in the future

Offering to the general population

Results predict PPV and NPV allowing providers to counsel patients appropriately

Largest published data set

Inclusion of clinical information in risk assessment

Targeted sequencing means decreased cost

Future studies Future studies

T13 validation

NITE- 500 subjects. European eval of T21 and T18

NEXT 25 000 bj t i H t t 1st t i t i f NEXT- 25,000 subjects comparing Harmony to current 1st trimester screening for T21

Harmony (Ariosa)y ( )

Natera

Technology based on Parental SupportTM

Targeted sequencing approach measuring SNP’s, then incorporates high fidelity parental allelic information and crossover frequency data to model a set of hypothesis(monosomy, disomy and trisomy). Gives maximum likelihood estimation.

Abstract data

166 samples 166 samples >99% detection for euploid, T21, T18, T13, X and Y 10% failure rate requiring redraw then <1% failure

PreNatus trial- enrolling 1,000 pts.

No NIPT published

Has used technology for Paternity and preimplantation genetics for some as used ec o ogy o a e y a d p e p a a o ge e cs o so e time

Still a screening testg

Positive results need to be taken in the context of disease prevalence The less prevalent a disease, the more likely a positive test is a false positive

1,000 womenTest accuracy:

100% detection

0.2% false positive

1,000 women

1 T21 999 non-T21

T21 prevalence:

1 in 1,000

1 2 9970

Test + Test +Test - Test -

Positive test result is truly right only 1/3 of the time fat extreme test performance

Probability of Trisomy 21y y

Maternal Pretest Prob at 12 Positive test result Negative test resultage(years) weeks

20 1 in 1068 1 in 23 1 in infinity

25 1 in 946 1 in 21 1 in infinity

30 1 in 626 1 in 14 1 in infinity

32 1 in 461 1 in 11 1 in infinity

34 1 in 196 1 in 8 1 in infinity34 1 in 196 1 in 8 1 in infinity

36 1 in 196 1 in 5 1 in infinity

38 1 in 117 1 in 3 1 in infinity

40 1 in 68 1 in 2 1 in infinity

Chiu RW, Akolekar R, et al. Non-invasive prenatal assessment of trisomy 21 by multiplexed maternal plasma DNA sequencing: large scale validity

study. BMJ. 342, e7401. 2011

Impact of using MPSS as a secondary test among high risk patientsamong high risk patients

2.8 million screening testsCurrently:

T21: 4362/5156 85% T18: 722/888 87%

Euploid: 148,079/2.8 mil 5.3%

114,307 invasive tests

Euploid: 148,079/2.8 mil 5.3%

,

548 procedure related losses

Palomacki et al. DNA sequencing of maternal plasma reliably identifies T13 and T18. Genetics in Medicine 2011.

NIPT as a secondary test y

MPSS will be offered to those with a screen POSITIVE test

T 21 4340/4384 98 9% T 21: 4340/4384 98.9%

T 18: 763/772

6,792 women who undergo

invasive testing

1,386 with failed testing

0.2% of 148,000 women with FP results = 296

23 – 34 procedure

related losses

Palomacki et al. DNA sequencing of maternal plasma reliably identifies T13 and T18. Genetics in Medicine 2011.

Cost and TAT

Sequenom Verinata AriosaSequenom Verinata Ariosa

List price $2400 $1,200 $795

Cash pay $475 up front $495 pt billed $795 pt billed

PPO $235 t bill d $200 t bill d $0 $795 t PPO $235 pt billed $200 pt billed $0 or $795 pt billed depending

on insurance

$ $ $OHP $475or sliding scale

$0 $0

DSHS $0 $0 $0DSHS $0 $0 $0

Medical and Financial Costs with NIPT

100,000Screen positive womenScreen positive women

3,000Down syndrome

97,000Euploid

2 9582,958NIPT +

42NIPT -

198NIPT +

96,026NIPT -

776Failure

Palomaki et al. Genetics in Medicine 2011

Medical and Financial Costs with NIPT

DS +/MPSS +(TP)

DS+/MPSS negative (FN)

MPSS positive(FP)

MPSS negative(TN)

MPSSFailure

Cost

Diagnostic test costs with full uptake

2958 42 198 96,026 776 100,000,000

NIPT reduced diagnostic test costs

2958 0 198 0 776 3,932,000

costs

Potential savings 0 42 0 96,026 0 96,068,000

Cases not 0 42 42Cases not detected

0 42 42

International Society for Prenatal Di iDiagnosis October 2011 October 2011

Women need detailed pretest counseling Not fully diagnostic and is an advanced screening test Not fully diagnostic and is an advanced screening test Confirmation of results through invasive testing is

required Cautioned that before routine population screening for

fetal Down syndrome is introduced, additional trials are d d i l l i l i k l ineeded, particularly in low-risk populations.

Benn PA, Borrell A, Crossley J, et al. Aneuploidy screening: a position statement on behalf of the Board of the International Society for Prenatal

Diagnosis. Prenat Diagn 2011;31: 519-22.

Genetic counselingg

General discussion of NIPT (not lab specific)( p ) Specific chromosomes evaluated Detection rate, false positive and false negative rate Not a diagnostic test Failed specimen possibilities

Ad t i t th f NIPT i t i i til Advocate against the use of NIPT in twin pregnancies until more data is published

Will facilitate testing if requested after informed consentg q

Test Restrictions

Sequenom Verinata Ariosa

Gestational age 10+ wks 10+ wks 10+ wks

Multiple gestation? Yes No No

Assisted Reproduction?

Yes Yes No egg donor pregnanciesReproduction? pregnancies

Intended for- AMA, abnormal serum screen

AMA, abnormal serum screen

General population data not validatedserum screen,

abnormal US, fam hx

serum screen, abnormal US, fam

hx

– data not validated

Points to consider

Case by case challenges Case by case challenges Discomfort/legalities of not offering test How to implement for the general population How to implement for the general population

Await low-risk studies Build infrastructure Build infrastructure Decrease cost

Rapidly moving target Rapidly moving target Social and ethical concerns (ie universal disclosure

of gender)of gender)

Future

Monitor results of test introduced into practicep Study performance in low-risk population Further testing in multiple gestation Further testing in mosaic conditions Detection of subchromosomal abnormality, single gene

disorders Complete fetal genome sequencing

Implications for in utero therapy Implications for in utero therapy Transcriptomic evaluation of gene activity

Prediction of pregnancy-associated complications Prediction of pregnancy associated complications

Thank you for your attention Thank you for your attention Questions?

Points to consider

Only validated for high-risk population - ? Ariosa Lack of large scale clinical trials/data – data starting to come in but not much DNA is placental in origin

Maternal DNA not separated from fetal DNA

Mosaicism Multiples Egg donors Unable to distinguish trisomy vs translocation Diagnostic testing recommended for confirmation Increased detection rate and increased power to excludep Decrease in losses due to fewer procedures Positive result = very high risk for aneuploidy Cost - $795 - $1900$ $ Routine screening and diagnostic testing still indicated for other issues

Nuchal translucency ultrasoundy

Correct gestation age Correct gestation age Early diagnosis of fetal malformation Diagnosis of multifetal gestation and chorionicity Diagnosis of multifetal gestation and chorionicity Can see cystic hygroma: 50% aneuploidy

M t T21 M X b t b th Most are T21 or Monosomy X, but can be others

Screening for low risk populations

FORTE vs. Z-score Comparison p

FORTE Z‐Score Provides individualized

risk score• Groups all trisomies into

one category

Accounts for fetal fraction

C i t th

• Does not factor in fetal fraction

Can incorporate other clinical risk factors

FORTETM (Fetal-fraction Optimized Risk of Trisomy Evaluation) – refers to the algorithm that incorporates DANSR assay results (chromosome counts, fetal fraction), and other clinical information to provide a individualized risk score

Normalized chromosomal value vs. Z th dZ-score method NCV Z-score NCV

#counts Chr 21/Counts on Custom reference Chr

Z score # counts Chr 21/# counts

all Chr High precision, removes

variation M i i d i

GC correction Z-score result

Maximizes dynamic range Sample to sample variability

Reduces dynamic range Reduces dynamic range