university of groningen a potential strategy to treat ... · (kc), and hepatic stellate cells (hsc,...

University of Groningen

A potential strategy to treat liver fibrosisGonzalo Lázaro, Teresa

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2006

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Gonzalo Lázaro, T. (2006). A potential strategy to treat liver fibrosis: Drug targeting to hepatic stellate cellsapplying a novel linker technology s.n.

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 04-12-2018

https://www.rug.nl/research/portal/en/publications/a-potential-strategy-to-treat-liver-fibrosis(c5e8b0a8-e75e-45b6-adbf-e66c8bc2ffd4).html

A potential strategy to treat liver fibrosis:

Drug targeting to hepatic stellate cells applying a

novel linker technology

Teresa Gonzalo Lázaro

PhD Thesis, Groningen University, The Netherlands.

Cover art: Fermín Oliván Ahedo. Adapted from “The Starry night” by

Vincent Van Gogh (1889, located in the Museum of Modern Art, MoMA, New

York), and a fluorescent picture where it is illustrated the purpose of the

present thesis: targeting of drugs to the hepatic stellate cells.

Green/blue color corresponds to the target cell, Hepatic Stellate Cells, within

the fibrotic liver, red color corresponds to losartan-M6PHSA, a drug targeting

conjugate developed during the present thesis project.

Lay out: T. Gonzalo Lázaro

ISBN printed version: 90-367-2720-0 ISBN electronic version: 90-367-2754-5 © 2006 by T. Gonzalo Lázaro. All rights reserved. Neither this book nor its parts may be reproduced or transmitted in any form or by any means without permission of the author. Printed by Gildeprint D rukkerijen, Enschede, The Netherlands.

RIJKSUNIVERSITEIT GRONINGEN

A potential strategy to treat liver fibrosis:

Drug targeting to hepatic stellate cells applying a

novel linker technology

Proefschrift

ter verkrijging van het doctoraat in de Wiskunde en Natuurwetenschappen aan de Rijksuniversiteit Groningen

op gezag van de Rector Magnificus, dr. F. Zwarts, in het openbaar te verdedigen op

vrijdag 29 september 2006 om 13.15 uur

door

Teresa Gonzalo Lázaro

geboren op 29 oktober 1977

te Madrid, Spanje.

Promotores : Prof. dr. K. Poelstra

Prof. dr. D.K.F. Meijer

Copromotor: Dr. R.J. Kok Beoordelingscommissie : Prof. dr. J. Reedijk

Prof. dr. W. Hennink Prof. dr. P. Ginés

A mis padres, Manuel y Cecilia

The old King of Salem said: - “A mysterious force shows you how to realize your destiny.

It prepares your spirit and your will, because there is one great truth on this planet: whoever you are, or whatever it is that you do,

when you really want something, it's because that desire originated in the soul of the universe,

and the universe conspires to help that person to realize his dream. It's your mission on earth”

Paulo Coelho, The Alchemist, 1988.

The research described in this thesis was conducted at the Faculty of

Mathematics and Natural Sciences, Department of Pharmacokinetics and Drug

Delivery, University of Groningen, The Netherlands in collaboration with

Liver Unit (IDIBAPS institute) in the Hospital Clínic in Barcelona, Spain.

This research project was financially supported by SenterNovem (TSGE1083)

and NWO Science Netherlands (R 02-1719, 98-162).

The printing of this thesis was financially supported by grants of:

University of Groningen

Groningen University Institute for Drug Exploration (GUIDE).

Kreatech Biotechnology b.v, Amsterdam.

Paranimfen: Janja Plazar.

Aitana Peire Moráis.

Table of contents

Chapter 1. Aim of the thesis. 1

Chapter 2. General Introduction. 5

A potential strategy to treat liver fi brosis

Chapter 3. Selective targeting of pentoxifylline to hepatic stellate cells 35

using a novel platinum-based linker technology.

Chapter 4. Reduction of advanced liver fi brosis by targeted delivery of the 65

angiotensin II receptor antagonist losartan to hepatic stellate cells.

Chapter 5. Accumulation in hepatic stellate cells and antifi brotic eff ect 97

of losartan-M6PHSA in the CCl4 model of induced liver fi brosis.

Chapter 6. Local inhibition of liver fi brosis by specifi c delivery 125

of a PDGF kinase inhibitor to hepatic stellate cells.

Chapter 7. Summarizing discussion and future perspectives. 155

Chapter 8. Samenvatting. 169

Appendix.

Resumen 176

Abbreviations 182

Acknowledgements 183

Selected color fi gures 188

Curriculum Vitae and Publications 197

Bikes after snow in the garden at my house in Ubbo Emmiussingel,

Groningen, February 2004.

Chapter1Aim of the thesis

“Rest satisfi ed with doing well,

and leave others to talk of you as they please.”Pythagoras (582 BC - 507 BC).

2

Aim of the thesis

Liver fibrosis is the 9th leading cause of death in the world. This chronic disease cannot

be treated successfully with conventional antifibrotic and anti-inflammatory drugs

currently on the market, because they either lack efficacy or cause too many side-effects.

Targeting of antifibrotic agents to hepatic stellate cells is considered a promising strategy

to increase their therapeutic potential. This thesis will present a novel strategy to

synthesize drug targeting conjugates aimed at hepatic stellate cells. The core of our

invention is a novel platinum based a linker system, the so-called Universal Linkage

System (ULS), that allows us to couple a broad range of drugs.

Three different drugs have been employed in the present thesis. Pentoxifylline is an anti-

inflammatory drug that has been suggested as a potential antifibrotic drug once delivered

specifically to hepatic stellate cells (1). Losartan is an angiotensin II receptor antagonist

that is widely used for the treatment of hypertension and renal disease. Its beneficial

effects on the renin-angiotensin system can be applied to improve the liver function

during fibrosis (2). The third drug we have employed is a PDGF-R tyrosine kinase

inhibitor (PTKI), a gleevec-like compound. Due to the role of platelet derived growth

factor (PDGF-B) as the most potent mitogen to the HSC during liver fibrosis (3), PTKI is

regarded as a potential new drug to stop the fibrogenic process.

The aim of the present thesis is therefore to study the therapeutical approach of targeting

antifibrotic drugs specifically to the hepatic stellate cells to improve the liver injury. Three

different drug targeting conjugates are discussed in detailed, as well as the screening of its

efficacy in vitro and in vivo.

Chapter 1

3

Reference List

1. Raetsch,C., Jia,J.D., Boigk,G., Bauer,M., Hahn,E.G., Riecken,E.-O., and

Schuppan,D. 2002. Pentoxifylline downregulates profibrogenic cytokines and

procollagen I expression in rat secondary biliary fibrosis. Gut 50:241-247.

2. Bataller,R., Sancho-Bru,P., Gines,P., Lora,J.M., Al Garawi,A., Sole,M.,

Colmenero,J., Nicolas,J.M., Jimenez,W., Weich,N., Gutierrez-Ramos, J.C., Arroyo,V.,

and Rodes, J. 2003. Activated human hepatic stellate cells express the renin-

angiotensin system and synthesize angiotensin II. Gastroenterology 125:117-125.

3. Pinzani,M. 2002. PDGF and signal transduction in hepatic stellate cells. Front

Biosci. 7:d1720-d1726.

Chapter 1

Modesto, organizado amigo,

t

t

t

i

trabajador profundo, déjame darte el ala de mi canto, el golpe de aire, el salto de mi oda: ella nace de tu invisible máquina, ella vuela desde tu infatigable y encerrado molino, entraña delicada y poderosa, siempre viva y oscura. Mientras el corazón suena y atrae la partitura de la mandolina, allí adentro tú filtras y repartes, separas y divides, multiplicas y engrasas, subes y recoges los hilos y los gramos de la vida, los últimos licores, las ín imas esencias.

Víscera submarina, medidor de la sangre, vives lleno de manos y de ojos, midiendo y trasvasando en tu escondida cámara de alquimista. Amarillo es tu sistema de hidrografía roja, buzo de la más peligrosa profundidad del hombre, allí escondido siempre, sempiterno, en la usina, silencioso.Y todo sentimiento o estímulo creció en tu maquinaria,recibió alguna gota de tu elaboración infatigable, al amor agregaste fuego o melancolía, una pequeña célula equivocada o una fibra gastada en tu trabajo y el aviador se equivoca de cielo, el tenor se derrumba en un silbido, al astrónomo se le pierde un planeta.

Cómo brillan arriba los hechiceros ojos de la rosa, los labios del clavel matutino! Cómo ríe en el río la doncella! Y abajo el filtro y la balanza, la delicada química del hígado, la bodega de los cambios sutiles: nadie lo ve o lo canta, pero, cuando envejece o desgasta su mor ero, los ojos de la rosa se acabaron, el clavel marchitó su den adura y la doncella no cantó en el río. Austera parte o todo de mi mismo, abuelo del corazón, molino de energía: te canto y temo como si fueras juez, metro, fiel implacable, y si no puedo entregarme amarrado a la pureza, si el excesivo manjar o el vino hereditario de mi patria pretendieron perturbar mi salud o el equilibrio de mi poesía, de ti, monarca oscuro, distr buidor de mieles y venenos, regulador de sales, de ti espero justicia: Amo la vida: Cúmpleme! Trabaja! No detengas mi canto. Oda al Hígado. Pablo Neruda, Premio Nobel de Literatura 1971.

Chapter2General Introduction: Potential strategies to treat liver fi brosis

There, inside, you fi lter and apportionYou separate and divide,

You multiply and lubricateYou raise and gather

the threads and the grams of life…from you I hope for justice:

I love life: Do not betray me! Work on!Do not arrest my song.

Ode to the liver, Pablo Neruda, Nobel Prize for literature, 1971.

6

A potential strategy to treat liver fibrosis

Liver

In Greek mythology, Prometheus was punished by the gods for revealing fire to humans

and he was chained to a rock where an eagle, Ethon, pecked out parts of his liver, which

would grow to a complete organ again overnight. Curiously enough, the liver is the only

human internal organ that actually can regenerate itself, a characteristic which apparently

already was known to the Greeks. In fact, the liver is capable of natural regeneration of

lost tissue: as little as 25% of remaining liver can regenerate into a whole liver again (1).

Figure 1. Liver with the right and left lobe. (Obtained from Anatomy of the Human Body.

Fig. 1085 Henry Gray, 1918.)

The adult human liver normally weighs between 1.3 - 3.0 kilograms, and is a soft, pinkish-

brown "boomerang shaped" organ. It is the largest internal organ within the human body.

The liver is essential in keeping the body functioning properly. It plays an important role

in the clearance of compounds from the blood (metabolism, excretion), produces immune

proteins to control infections and directly removes germs and bacteria (innate immune

system) and synthesizes proteins that regulate blood clotting and various other

physiological processes. Furthermore, the liver produces and excretes bile fluid which is

required for food digestion and absorption of fats and fat-soluble vitamins (2). You

cannot live without a proper functioning liver. Due to this complex spectrum of functions

it is not yet possible to produce an artificial organ capable of replacing all functions of the

liver, and the attempts to do so are outside the reach of science in the foreseeable future.

http://en.wikipedia.org/wiki/Greek_mythology

http://en.wikipedia.org/wiki/Prometheus

http://en.wikipedia.org/wiki/Eagle

http://en.wikipedia.org/wiki/Ethon

http://en.wikipedia.org/wiki/Regeneration_%28biology%29

7

Chapter 2

Liver cells network

Classically, the liver was seen as being divided in hexagonal lobules formed by

parenchymal hepatocytes that constitute around 80% of the total liver volume, and also by

three different nonparenchymal cell types: sinusoidal endothelial cells (SEC), Kupffer cells

(KC), and hepatic stellate cells (HSC, formerly known as fat-storing cells, Ito cells,

lipocytes or vitamin A-rich cells). The hepatocytes are important for the high metabolic

activity of the liver and the secretion of compounds into the bile (3;4). The fenestrated

endothelium plays an important role in the filtration of compounds from the blood to the

hepatocyte surface. Like Kupffer cells, SECs have a huge endocytic capacity for many

ligands including glycoproteins and several components of the extracellular matrix (ECM).

SEC are also active in the secretion of cytokines and other mediators of cellular activity

(5;6).

Kupffer cells are local tissue macrophages located in the sinusoids space with a

pronounced endocytic and phagocytic capacity. Kupffer cells control the early phase of

liver inflammation, and thus play an important part in the innate immune defense system

(7). High exposure of Kupffer cells to bacterial products, especially endotoxin

(lipopolysaccharide, LPS), leads to the production of inflammatory mediators and

ultimately to liver injury. Moreover, during liver injury and inflammation, Kupffer cells

secrete enzymes and cytokines that may damage hepatocytes, and they are active in the

remodeling of extracellular matrix (8).

Hepatic stellate cells (HSC) reside in the perisinusoidal space. In the normal liver, HSC are

characterized by storing vitamin A and they control the turnover of extracellular matrix,

and the regulation of the contractility of sinusoids. Acute damage to hepatocytes induces

transformation of the quiescent HSC into activated myofibroblast-like cells and the latter

cells play a key role in the development of inflammatory fibrotic responses (9;10).

Activated HSC transdifferentiate into proliferative, fibrogenic, and contractile

myofibroblasts that initiate further cell proliferation and increased deposition of

extracellular matrix (ECM) components in the process of wound healing (2;11). During

chronic liver injury, the excessive ECM replaces the functional liver, influencing the

Chapter 2

8


function of remaining cells and forms a solid mechanical scaffold for cell adhesion and

migration. This matrix consists of collagens, glycoproteins, proteoglycans,

glycosaminoglycans and molecules that are bound specifically to the ECM, such as certain

growth factors/cytokines, matrix metalloproteinases (MMPs) and enzymes such as tissue

transglutaminase and procollagen propeptidases (12). It is a finely tuned ecosystem which

is dysbalanced during chronic liver injury.

Figure 2. Activation of Hepatic Stellate Cells during liver fibrogenesis.

A. Hepatic sinusoid with hepatocytes as parenchymal cells, and the non-parenchymal cells: the hepatic

stellate cells with the vitamin-A droplets (HSC) in the space of Disse, the endothelial cells (EC) and

the Kupffer cells (KC) in the sinusoid.

B. During liver injury, the activation of HSC leads to cell proliferation producing extracellular matrix

components (ECM). Figure adapted from Friedman, J Hepatol2003.

What is liver Fibrosis?

Liver fibrosis is a reaction to chronic liver injury, and it is characterized by an excessive

accumulation of extracellular matrix proteins including collagen. It is a common process

during the majority of chronic liver diseases (13). All liver cell types play their specific role

in liver fibrosis, and there is much evidence now of cross-talk between the different cell

types through the release of a wide variety of key mediators, e.g. nitric oxide, interleukins,

chemokines, growth factors and reactive oxygen species (ROS) (4). The cooperation

between liver cells is better understood due to the knowledge gained in the last decades on

liver fibrosis and other liver diseases.

9

Chapter 2

The fibrogenic process resembles a continuous wound-healing, yet accumulation of huge

amounts of extracellular matrix results in scarring of the tissue and disturbance of blood

supply. The progressive necrotic areas lead to even more inflammation and tissue damage

that needs to be repaired (12). If the liver injury persists, an exacerbation of fibrosis may

lead to the development of cirrhosis (14). Various etiological factors can be responsible

for a perpetuation of the fibrogenic process including alcohol consumption, exposure to

various drugs and toxic chemicals, viral hepatitis, metabolic syndrome, autoimmune

disease and hereditary disorders of metabolism (15). Chronic liver injury finally leads to

cirrhosis and all its complications, portal hypertension, and ultimately liver failure. Liver

transplantation, an extremely costly procedure, is currently the only remedy in this

condition (16).

Central to the liver fibrogenesis is the activation of HSC (17). HSCs are activated by

inflammatory and fibrogenic cytokines such as TGF-β, angiotensin II (18), and PDGF-BB

(19). Cellular changes accompanying HSC activation include morphological changes such

as the appearance of the cytoskeletal protein smooth muscle α -actin (α-SMA), a loss in

the cellular vitamin A stores, and an increase in the appearance of rough endoplasmic

reticulum. An increase in DNA synthesis and cellular proliferation also occurs following

HSC activation. The pattern of gene expression changes and a dramatic increase in types I

and III collagens production occurs (20). TGF-β is the most potent fibrogenic cytokine

described for the HSC activation (21) and the receptor expression for this cytokine is

largely increased following HSC activation. At the same time, HSC proliferate under the

influence of growth factors. Platelet derived growth factor (PDGF-BB) is regarded as the

most potent mitogen for HSCs. The PDGF receptor expression on HSC are also

increased during the liver injury (22;23), leading to a continuous proliferation of these

cells.

The perpetuation of the activated phenotype of HSC is caused by the ongoing cytokine

production and remodeling of extracellular matrix (ECM) (24;25). The collagen

production and the cytokines secreted by activated HSC as well as autocrine and paracrine

stimulation of other liver cell types (injured hepatocytes, Kupffer cells) contribute to the

Chapter 2

10


aggravation of the fibrotic process. After prolonged chronic injury, the liver contains high

levels of the matrix proteins collagen and elastin and of other structural glycoproteins,

proteoglycans and pure carbohydrates, i.e. hyaluronan (26).

In conclusion, two major features render the HSC the key fibrogenic cell. Firstly, a

dramatic increase in the synthesis and deposition of extracellular matrix proteins produced

by activated HSC and, secondly, the increased proliferation rate of HSCs which strongly

amplifies the number of fibrogenic cells (27).

Moreover, HSC activation is associated with an increase in cell contractility, which leads to

increased portal pressure via the constriction of individual sinusoids and contraction of

the cirrhotic liver as a whole (28).

Epidemiology of liver fibrosis

Chronic liver disease is responsible for over 1.4 million deaths annually according to data

from the World Health Organization Mortality Database (WHO, World Health Report

2005; http://www.who.int/en/) and in the western world this disease is among the top

ten of disease-related causes of death (CDC, National Center for Health Statistics, 2005).

Overall there has been reported a 13% increase in the death rate from liver-related disease

per year (29). Of the liver-related deaths, 77% were associated with viral hepatitis, 14%

with alcohol abuse, and 9% with hepatocellular carcinoma (30). Many etiological factors

cause fibrosis and eventually lead to cirrhosis. It has been estimated that excessive alcohol

consumption is a major contributor in 41-95 percent of deaths from cirrhosis in some

countries (31). The level and duration of alcohol consumption are important determinants

in the development of liver pathology. As the primary site for detoxification of alcohol

and its metabolites, the liver can go through the following pathological stages: fatty liver,

alcoholic hepatitis, fibrosis and cirrhosis.

Because of the high rates of liver disease, liver transplantation is now considered a

standard therapy for patients with end-stage liver disease, regardless of the cause.

Currently, about 5,000 liver transplants are performed yearly in the United States at more

than 120 medical centers. As a consequence of the limited supply of livers, there are more

11

Chapter 2

than 17,000 persons on the liver transplant waiting list and at least 1,500 will die annually

while waiting (http://liverplan.niddk.nih.gov.).

The concept of Liver fibrosis reversion

Centuries after the greeks suggested it in their mythology, the regeneration of the damaged

liver was finally catalogued by Perez-Tamayo in 1979 (32). In this study, the first evidence

for reversibility of fibrosis and cirrhosis in animal models and human was presented. This

has stimulated researchers to search for potential antifibrotic drugs that could definitely

reverse liver fibrosis. Emerging antifibrotic therapies aim at inhibiting the accumulation of

fibrogenic cells or preventing the deposition of extracellular matrix proteins. Although

various antifibrotic agents are effective in experimental models of liver fibrosis, to date

their efficacy and safety in humans have not been established (33-35). On the other hand,

evidence of fibrosis regression has been documented after treatment of patients with

antivirals for Hepatitis B (36) and Hepatitis C (37) in clinical trials. These studies and

studies in experimental animal models have improved the understanding of mechanisms

of extracellular matrix (ECM) production and degradation. It appeared that liver scar

tissue can be resorbed in fact (38). The accumulated ECM can be degraded through the

action of matrix metalloproteinases, enzymes that digest components of the ECM (39).

The existence of tissue inhibitors of these matrix metalloproteinases (TIMPs) partly

explains the excessive accumulation of ECM in fibrosis and influence the dynamic process

of synthesis and degradation. Interestingly, activated HSC also play a vital role in

orchestrating matrix degradation during liver fibrogenesis. Apart from their participation

in the synthesis of large amounts of extracellular matrix, simultaneously they increase

TIMP-1 levels resulting in decreased matrix degradation. When fibrosis regresses, TIMP-1

levels decline and degradation of ECM increases. This effect is associated with removal of

activated stellate cells through apoptosis (40;41). In contrast, sustained TIMP-1 expression

inhibits protease activity and blocks apoptosis of activated stellate cells (42). Thus, it is

implicit that fibrosis is associated with the massive deposition of extracellular matrix

(ECM), increased levels of inhibitors of matrix metalloproteinases and collagenases

Chapter 2

http://liverplan.niddk.nih.gov/

12


(TIMP), and also a significant collagen cross-linking by tisssue transglutaminase activity

(43).

In conclusion, the fibrogenic process can be viewed as a dynamic balance between matrix

degradation and production so that even advanced fibrosis or cirrhosis seem to be

reversible.

Need for antifibrotic therapies

Many studies in the past two decades have shed considerable light on the mechanisms of

liver fibrosis, with particular emphasis on stellate cell biology, and have led to an increased

enthusiasm for treating hepatic fibrosis (44). There is tremendous activity in the field of

drug development for this purpose and ongoing testing of potential antifibrotic agents

(45). Nevertheless, efficient and well-tolerated antifibrotic drugs are still lacking, and

current treatment of hepatic fibrosis is limited to the withdrawal of the harmful agent and

transplantation. In situations in which dealing with the underlying process is not possible,

interference with the liver fibrosis process is essential. A large number of these

approaches have been validated in cultured cells and in animal models, and clinical trials

are underway or anticipated for a growing number of molecules (46).

A successful antifibrotic strategy does not need to eradicate hepatic fibrosis entirely,

because the liver has an enormous functional reserve. Instead, any therapeutical approach

that sufficiently attenuates fibrosis progression to prevent the development of cirrhosis

and/or hepatocellular carcinoma will be viewed as a success (47).

Several antifibrotic therapies have been tried ending with poor or mediocre success (48).

The problems with many potentially antifibrogenic drugs are, among others, the lack of

cell specificity of the drugs in vivo with the occurrence of extrahepatic side effects. For

such drugs, a cell-specific delivery may prove beneficial. The acquired high specificity of a

locally delivered compound would permit the long-term treatment that is required for a

chronic liver disease.

During the past years, several projects concerning target-cell specific antifibrotic therapies

have been started in our department (Table 1). Several promising therapeutic approaches

13

Chapter 2

have been encompassed in our drug delivery strategies, either targeting hepatic

inflammation (dexamethasone, naproxen, losartan)(49) or intracellular signaling and

transcriptional pathways involved in stellate cell activation and ECM turnover

(Pentoxyfilline, gleevec, kinase inhibitors)(50;51), or provoking apoptosis of activated cells

(doxorubicin, gliotoxin)(52;53). Other strategies include the delivery of anti-inflammatory

agents like IL-10. The near future will learn which of the chosen drugs will be most

effective, or which other (combination of) targeted therapies can be envisioned. In the

next section, three drugs will be more extensively discussed: pentoxyfilline, losartan and

the PDGF receptor tyrosine kinase inhibitor (imatinib). These compounds have been

subject of drug targeting strategies in the present thesis.

Chapter 2

14


Table 1. Drugs in development for antifibrotic approaches in our group.

Main mechanism Agent Studies (Ref) In our department

Attenuate HSC activation

Pentoxifylline JCR 2006 (54) T. Gonzalo

Interleukin-10 Pharm Res. 2004 (55) H.Rachmawati

Losartan In preparation (56) T. Gonzalo

Reduce inflammation

Prostaglandin In preparation W.Hagens

Promoting apoptosis of HSC

Gliotoxin Liver Int. 2006 (60) W.Hagens

PDGF R inhibitor

Submitted (57) T. Gonzalo

Micophenolic acid

J Hepatol.2005 (58) R.Greupink

Antiproliferative to HSC

Doxorubicin JPET 2006 (59) R.Greupink

p38 MAP kinase inhibitor

JPET 2006 (61) J.Prakash Reduction

inflammation and epithelial-mesenchymal transformation TGF-b kinase

inhibitor In preparation

J.Prakash

15

Chapter 2

Antifibrotic drugs: Pentoxifylline, losartan and PDGF

Tyrosine Kinase Inhibitor (PTKI)

Pentoxifylline

Pentoxifylline (PTX) is a phosphodiesterase inhibitor that is clinically useful for the

treatment of disorders of vascular perfusion and cerebrovascular diseases due to its

favorable effect as a peripheral vasodilator (62). The antifibrogenic effect of PTX on

activated hepatic stellate cells has been extensively reported and demonstrated (63‐65).

Although its mechanism of action remains unclear, it has been suggested that PTX

reduces the transdifferentiation of HSC to myofibroblasts and inhibits HSC proliferation

(11;66;67).

Figure 3. Proposed antifibrotic mechanism of Pentoxifylline action in the cell.

Figure adapted from references (Raetsch,2002; Duncan 1995; Rodriguez-Barbero 2002; Chen 1999)

(11;68-70). Abbreviations: PTX, pentoxifylline; PKA, protein kinase A; cAMP, cyclic adenosine

monophosphate; CTGF, connective tissue growth factor; TGF-β, transforming growth factor β; ERK,

extracellular-regulated kinase; P38 MAP kinase, mitogen-activated kinase; ECM, extracellular matrix.

Chapter 2

16


PTX also may reduce the fibrogenic effect of TGF-β on HSC by interference with p38

MAPkinase and ERK1/2 pathways, thereby decreasing hepatic procollagen type 1 mRNA

expression (71). In addition, PTX interferes with cAMP involved in inflammatory

signaling (72). In another study it was shown that PTX blocks NF-kB, one of the

important mediators of HSC, thus preventing the activation and proliferation of HSC

induced by carbon tetrachloride, a rat model of liver fibrosis. In vitro studies with

fibroblasts have shown that PTX potently reduces cell proliferation, stimulates interstitial

collagenase activity, and suppresses the synthesis, secretion, and deposition fibrillar

collagens type I and III, proteoglycans, and fibronectin (73-75). Moreover, Lee et al

demonstrated that PTX downregulates hepatic procollagen type I expression in the bile

duct ligation model of liver fibrosis (76).

Yet, despite beneficial effects in HSC, profibrotic effects of PTX on Kupffer cells have

been reported (11), as well as many effects in other cell types (77;78). Cell-selective

targeting of PTX to HSC seems therefore required to create favorable effects in HSC,

while avoiding the profibrotic effects in Kupffer cells and effects in other organs (79).

Taking into account the antifibrotic properties attributed to PTX, we have developed a

drug targeting conjugate for the delivery of PTX to HSC. In chapter 2 we describe the

development of the novel HSC-directed conjugate PTX-M6PHSA.

Losartan

Losartan is an orally active, nonpeptide angiotensin II (Ang II) receptor antagonist. It was

the first of a new class of drugs introduced for the treatment of hypertension and renal

disease. These angiotensin receptor blockers bind competitively and selectively to the Ang

II type 1 (AT1) receptor, thereby blocking Ang II-induced physiological effects (80).

Systemic hypertension is a complex pathophysiological state that is primarily manifested as

chronic high blood pressure. It is a major risk factor for stroke, ischemic heart disease,

peripheral vascular disease, and progressive renal damage (81). It is well established that a

hyperactive renin angiotensin system (RAS) plays a key role in the development and

maintenance of human primary hypertension. This disorder contributes to at least 10% to

30% of all cases of hypertension by some estimation (82).

17

Chapter 2

RAS blockers are reliable and affordable, and their short duration of action makes them an

excellent drug of choice if reversal of their activity is required. On the other hand, as with

most antihypertensive drugs, their effects are short-lived having to be administered on a

frequent basis with a risk of significant side effects (83).

Recent experimental studies indicate that the RAS also plays an important role in liver

fibrogenesis (84;85). Hepatic stellate cells (HSC) are the main target cell type for the

pathogenic effects of Ang II in liver fibrosis. In the normal human liver, HSC do not

express AT1 receptors nor do they secrete Ang II. Following chronic liver injury however,

HSC transform into myofibroblast-like cells which express both AT1 receptors and

generate mature Ang II, which exerts an array of pro-inflammatory and profibrogenic

actions (86-89). These pathogenic effects can be prevented largely by AT1 receptor

antagonists, as has been demonstrated in different models of experimentally-induced liver

fibrosis (90-92). Based on these data, RAS inhibitors like Angiotensin Converting Enzyme

(ACE) inhibitors or Ang II receptor blockers are currently considered as novel antifibrotic

therapies to treat liver fibrosis. Preliminary clinical data suggest that AT1 receptor

blockers may attenuate the fibrogenic process (93). The use of AT1 receptor blockers

would be particularly useful in conditions characterized by a rapid progression of fibrosis

(i.e. acute alcoholic hepatitis and severe hepatitis C virus reinfection after liver

transplantation). However, in patients with advanced fibrosis, the use of angiotensin

antagonists may be hampered by undesirable effects on the arterial pressure, especially

since patients with cirrhosis are generally associated with low systemic blood pressure.

Indeed, the use of the AT1 receptor blocker losartan in patients with advanced fibrosis

was associated with the risk of hypotensive shock syndrome (94).

We hypothesized that targeting of losartan to HSC could be an effective strategy to

attenuate hepatic fibrosis. Therefore, we have coupled losartan to M6PHSA, a stellate cell-

selective carrier, resulting in losartan-M6PHSA. In addition, this strategy would overcome

side effects such as reduction of blood pressure. Details about this novel approach are

explained in chapters 3 and 4 in the present thesis.

Chapter 2

18


PDGF Receptor tyrosine kinase inhibitors

The fundamental role that protein tyrosine kinases appear to play in liver fibrogenesis and

many other diseases, has made them attractive therapeutic targets (95), and has provided

the rationale for the development of specific inhibitors of these enzymes.

PDGFR-β is a receptor tyrosine kinase that consists of an extracellular ligand binding

domain connected to a cytoplasmic domain, responsible for intracellular signal

transduction. Extracellularly, the PDGFRβ receptor binds via the beta subunits only the

isoform PDGF-B (96;97). The binding induces activation of the receptor kinases by

formation of receptor dimers that catalyze the transfer of the γ–phosphate of ATP to

tyrosine residues in protein substrates. This leads to a wide variety of cell responses, e.g,

differentiation, proliferation, migration, angiogenesis and survival (98).

Figure 4. Proposed mechanism of action of PDGFR-β kinase inhibitors interfering with a wide variety of cell

responses. (Adapted from Aaronson 1991).

19

Chapter 2

Activated HSC display high levels of PDGFR-β receptor and release PDGF-BB cytokines

during liver fibrosis (99). It has been demonstrated that PDGFR-β receptors are

upregulated on the cell surface of hepatic stellate cells during fibrosis (100-102). The

fibrogenic process is encouraged by platelet-derived growth factor (PDGF-BB), identified

as the most potent mitogen for HSC (103). Several isoforms of PDGF have been

described in activated HSC have been found. Dimers formed by disulphide bond are

PDGF-AA, AB, BB, CC, or DD polypeptide chains (104). The expression of the PDGF

isoforms is differentially regulated by PDGF-BB itself and by TGF-β1, two mediators that

are produced by HSC themselves during liver fibrogenesis (105;106). New drugs that

inhibit PDGF- β kinase activity have emerged in recent years.

Imatinib mesylate (Gleevec, STI571) was initially designed for use in chronic myeloid

leukemia (CML) as an anti-tumor drug. Imatinib is active against a number of related

tyrosine kinases that are mutated in cancer (107). Since imatinib also inhibits PDGFR-β

kinase activity, it may also be applied as a drug for liver fibrosis.

Other strategies targeting the PDGF pathway involve the use of antibodies against

PDGFR-β kinase or a soluble receptor blocking the natural binding of PDGF cytokine

(108). Blockade of PDGF-BB interaction with its tyrosine kinase receptor may represent a

promising approach for therapeutic intervention in hepatic fibrosis.

We have developed a new construct, PTKI-M6PHSA, in which a PDGF Tyrosine Kinase

Inhibitor (PTKI), related to imatinib mesylate, is coupled to our stellate cell-carrier

M6PHSA. In the present thesis, we tested the impact of PTKI-M6PHSA on liver

fibrogenesis in vitro and in vivo. Chapter 5 describes this approach.

Chapter 2

20


Drug targeting technology

The first idea of drug targeting was proposed by Ehrlich in the nineteenth century. He

presented the idea of “the magic bullet” that can bind selectively to specific types of cells

in a manner similar to that of the key and lock approach. Scientists have ever since

worked on the principle of drug targeting based on this idea of specifically delivering

drugs to diseased cells.

Classical drug molecules:

actions in whole body

Side-effects toxicity limits effect

Drug-carrier

no serious side-effects

improved therapeutic effect

Drug targeting approach: locally acting drugs

Drug

limited therapeutic effect

Figure 5. Classical drug administration versus the drug targeting approach.

Drug targeting is defined as selective drug delivery to specific physiological sites, organs,

tissues, or cells where the pharmacological activity of the chosen drug is required (109). In

principle, a drug that distributes throughout the whole body after its administration may

cause side effects at sites other than the pathological tissues. Although that may not create

a problem for the majority of drugs, side-toxicity is one of the limiting events for the

therapeutical use of, for example, cytotoxic agents. Due to these adverse reactions, dose

limitations may prevent effective treatment. Therefore, selective delivery into the target

21

Chapter 2

tissue may allow a higher drug concentration at or in the target cells or even in specific

compartments of the target cells, and thus improve the therapeutic index/safety of such

compounds.

Drug targeting may be classified into two general strategies: passive and active targeting.

Passive targeting is a strategy whereby the physicochemical properties of carrier systems

increase the target/nontarget ratio of the quantity of drug delivered to the target tissues,

organs, or cells. In this way, targeting of drugs would avoid side effects by preventing

major distribution to a particular organ or cell type.

Carriers included in this category are synthetic polymers, some natural polymers such as

albumin, liposomes, micro (or nano) particles, and polymeric micelles. Chemical factors

such as hydrophilicity and positive/negative charge and physical factors such as size and

mass greatly influence the passive targeting efficiency. For example, the cardiotoxicity of

doxorubicin can be decreased by including it in a liposomal formulation (110). However, it

should be stressed that drugs in such preparations should maintain their intrinsic anti-

tumor efficacy and also should not exhibit side effects specifically related to the liposomal

formulations such as liver (macrophage) toxicity.

Active targeting employs specific receptor interactions to increase the delivery of drugs to

a target site where the pharmacological effect of the drug is required. The incorporation of

a homing devices, or site-directed ligands, redirects the construct to specific binding sites

on cell membranes. These interactions include antigen-antibody and ligand-receptor

binding. The homing devices can be carbohydrate ligands, functional groups bearing

antibodies or other peptide ligands. These homing devices may be coupled to drug carriers

like antibodies, or other proteinaceous carriers like albumin or transferrin, polymers,

liposomes or nanoparticles.

Drug Targeting approach to Stellate cells

Targeting of drugs to hepatic stellate cells (HSC) currently represents a challenge for the

scientists involved in the design of a treatment for liver fibrosis. As explained in detail in

Chapter 2

22


the previous section, HSC are a crucial target for pharmacological intervention of liver

fibrosis. Various HSC-specific carriers have been developed in our group (79).

LOSARTAN

LOSARTAN

M6P R

M6P RHSA

LOSARTAN

LOSARTAN

HSA M6P

M6P

LOSARTAN

ULS

LOSARTANULS

2

3

4

1

5Stop fibrosis process

LOSARTAN

LOSARTAN

M6P R

M6P RHSA

LOSARTAN

LOSARTAN

HSA M6P

M6P

LOSARTAN

ULS

LOSARTANULS

2

3

4

1


LOSARTAN

LOSARTAN

M6P R

M6P RHSA

LOSARTAN

LOSARTAN

HSA M6P

M6P

LOSARTAN

ULS

LOSARTANULS

2

3

4

1

5

LOSARTAN

LOSARTAN

M6P R

M6P RHSA

LOSARTAN

LOSARTAN

HSA M6P

M6P

LOSARTAN

ULS

LOSARTANULS

LOSARTAN

LOSARTAN

M6P R

M6P RHSA

LOSARTAN

LOSARTAN

LOSARTAN

LOSARTAN

M6P R

M6P RHSA

LOSARTAN

LOSARTAN

LOSARTAN

LOSARTAN

M6P R

M6P RHSA

M6P R

M6P RHSA

M6P R

M6P R

M6P R

M6P R

M6P R

M6P R

M6P R

M6P RHSAHSA

LOSARTAN

LOSARTAN

HSA M6P

M6P

LOSARTAN

ULS

LOSARTANULS HSA M6PM6P

M6PM6P

LOSARTAN

ULS

LOSARTAN

ULSULS

LOSARTANULSLOSARTANULSULS

2

3

4

1

5

2

3

4

1 2

3

4

1


2

1Induction of M6P/IGFII R

(mannose-6-phosphate insulin growth factor II Receptor).

5

34

Binding of Losartan-M6PHSA

Target cell specific anti-fibrotic actions

Internalization and release of losartan

Liver damage leads to activation of Stellate Cells

2

1Induction of M6P/IGFII R

(mannose-6-phosphate insulin growth factor II Receptor).

5

34

5

34

Binding of Losartan-M6PHSA

Target cell specific anti-fibrotic actions

Internalization and release of losartan

Liver damage leads to activation of Stellate Cells

NKNN

NN

NCl

OH

drug carrierPt

NH2H2NULS=losartanNKNN

NN

NCl

OH

drug carrierPt

NH2H2NULS=NKNN

NN

NCl

OH

drug carrierPt

NH2H2NULS=NKNN

NN

NCl

OH

NKNN

NN

NCl

OH

drug carrierPt

NH2H2NULS=drug carrier

PtNH2H2NULS=

drug carrierPt

NH2H2NULS=losartan

Figure 6. Picture of Losartan-ULS-M6PHSA conjugate targeting to the

Hepatic Stellate cell (star-like cell) via the M6P/IGFII receptor upregulated

during liver injury.

The magic bullet concept can now be applied also for targeting of losartan, among other

drugs, as illustrated in figure 6. In this schematic model, the drug delivery preparation is

composed of three parts: drug, linker and carrier. The applied linkage system is ULS,

which will be explained later in this thesis, and the carrier is M6PHSA, which binds to the

M6P/IGFII-receptor on activated HSC.

Types of carrier

In figure 7 various types of drug carriers are depicted. The type of water-soluble polymeric

carrier also includes apart from the chemically prepared carriers, naturally occurring

23

Chapter 2

polymers. Emulsions comprise small oil droplets stabilized with a monolayer of an

amphiphilic substance on the surface. Nanospheres are solid small particles made from

natural or synthetic polymers. A major difference between droplets in emulsions and

nanospheres is the status of the interior: liquid for emulsions and solid for nanospheres. A

liposome is a vesicle made up with a lipid bilayer that mimics cellular membranes.

Polymeric micelles are an assembly of amphiphilic polymers (typically comprising

multiples, i.e. 10 to 100 of polymeric chains) with a spherical inner core and an outer shell.

Combination strategies are nowadays being employed, for example, antibody-targeted

liposomes, bispecific antibody-mediated viral vectors, ligand-peptide modified plasma

proteins, recombinant proteins, etc. In the present thesis, a modified human serum

albumin protein is being employed as a carrier.

carriers

Polymeric micelleLiposome

Water-soluble polymerProtein carriers

drug

Figure 7. Different types of carriers utilized for drug targeting.

It is generally known that nano-sized carriers are a prerequisite for efficient drug targeting.

Carrier systems of 200 nm diameter or smaller are used for drug targeting, and larger

systems are subjected to nonspecific capture in the reticuloendothelial system (111). On

the other hand, small drug carriers have a short circulation time in the blood stream due to

renal filtration. Therefore, drug carriers with a diameter from 10 nm to 200 nm are used in

drug targeting approaches. These carriers are not largely cleared by renal filtration or by

the reticulo-endothelial system which allows a large amount of delivery to the target sites.

Chapter 2

24


M6PHSA as a soluble carrier protein

Albumin is the most abundant plasma protein, and has a biological half-life of 19 days. It

consists of a single chain of 585 aminoacids organized in a tridimensional structure in a

helical conformation. The helices are bound by 17 disulfide bridges, leaving only one free

thiol (Cys34) (112).

Albumin is biodegradable and therefore biocompatible and contains many different

functional groups, i.e. -NH2 of the lysine residues or methionine, which can be used for

conjugation of the homing device, the linker, or the drug. In addition, due to its size and

charge, it is not cleared from the blood by renal filtration.

In our strategy, albumin was modified with sugar mannose-6-phosphate groups on its

surface resulting in M6PHSA (113). M6PHSA has been shown to specifically interact with

mannose 6-phosphate/insulin-like growth factor II (M6P/IGFII) receptors expressed on

the surface of hepatic stellate cells. Due to stellate cell proliferation during liver fibrosis

and a concomitant increase in M6P/IGF II receptor expression on this cell type (100), the

disease process itself may selectively direct the carriers to the diseased tissue. This

targeting strategy may largely contribute to the increased therapeutic concentration of

drug in the target tissue (114).

Linkage between drug and carrier

The concept of the “magic bullet” is very intuitive and appealing and looks as if it can be

easily realized through simply coupling a drug to a carrier. However, the development of

drug targeting constructs is a delicate process and several difficulties have to be overcome

during the synthesis of the conjugate. The linkage between the drug and the carrier system

is a crucial element of the conjugate, as it controls both the stability of the conjugate and

the efficiency of drug release or rate, and eventually, the final therapeutic effect (115). For

bioconjugates, the nature of the linker between the pharmacologic agent and the carrier

often dictates the degree of successful delivery and its outcome. Over decades,

investigators have therefore invested great efforts to find the appropriate linkage system.

25

Chapter 2

Linkages used in bioconjugation to proteins

The release of the drug from the carrier is decisive for its pharmacological activity.

Various types of biodegradable linkages have been developed for coupling drugs to

proteins. Amide linkages can be used to conjugate a drug containing carboxylic acid or

amino groups, like mycophenolic acid to M6PHSA (58).

Drugs

NKNN

NN

NCl

OH

Losartan

Pentoxifylline

N

N

N

N

O

O

O

ULS

Schiff

Drug N NH

Carrier

Linkage

Ester

Drug O C carrier

O

drug carrierPt

NH2H2N

M6PHSA carrier

Stellate cell- carrier

N

N

N

N

O

N

N

PTKI

Figure 8. Drugs used in the present thesis, linkers available for coupling these

drugs, and M6PHSA carrier utilized for Stellate cell-directed drug targe ing.

PTKI can be conjugated only via ULS linker. Losartan can be conjugated via Ester or ULS linkage

and Pentoxifylline can be coupled via ULS or Schiff base linkage. ULS reacts with aromatic nitrogens of

the depicted ring (PTKI), tetrazole ring (losartan) or xanthine moiety (pentoxifylline).

t

Chapter 2

26


The amide linkage however is not easily split within the target cell. In addition, the ester

linkers may be used to conjugate carboxylic acid groups and hydroxyl groups of drugs, like

in the case of losartan (figure 8). Also mycophenolic acid could be conjugated to

M6PHSA via an ester linkage. However this resulted in less drug molecules coupled to the

carrier as compared to the amide-based conjugate which allowed higher drug loading (58).

Yet, as anticipated, the conjugate synthesized via the ester linkage proved more effective

than with the amide linkage since active drug could be released from the ester linkage.

This example illustrates the crucial role that the linkage plays in drug targeting conjugates

efficiency. The Schiff base hydrazone linkers may form an imino bond between a carbonyl

group of the drug molecule and a hydrazine functionality of the spacer. Such linkages have

been employed with doxorubicin, streptomycin and chlorambucil (116-119). Pentoxifylline

could be also form a Schiff base linkage via its carbonyl group (figure 8). The disulfide

bond is a covalent linkage which arises as a result of the oxidation of two sulfhydryl (SH)

groups of cysteines or other SH-containing material (120). It can be formed with drug

molecules that contain free thiol groups or, alternatively, with drug derivatives in which a

free thiol group has been introduced. For instance, in liver-directed conjugates, gliotoxin

was conjugated to M6PHSA using a disulfide bond (121). A disadvantage of the disulfide

linkage is its relative instability in the bloodstream. Disulfide bonds can be degraded by

reducing enzymes or disrupted chemically by thiol-disulfide exchange with free thiol

compounds such as glutathione (122). Another type of linker is based on polymers.

Multiple drug molecules can be covalently attached to a single functional group of the

carrier when polymeric bridges are used.

The Universal Linkage System (ULS)

As can be appreciated, the finding of the appropriate linkage system is a critical step

during the synthesis of a promising drug carrier construct. Some of the linkers modalities

lack stability in plasma (ester linker), enzymes at non-targeted sites may cleave the linkage

or simply they are not able to react with the drug or the chosen carrier system (115).

A major problem in the synthesis of drug conjugates is that the majority of drugs cannot

be coupled using traditional linking procedures since they lack the appropriate functional

27

Chapter 2

groups (i.e, carbonyl, amino, hydroxyl or thiol groups). In the present thesis, we have

developed conjugates with a new linker technology that allows the coupling of a broader

spectrum of drugs. The ULS (Universal Linker System) is a platinum-based linker that has

been previously applied in Life Sciences for the conjugation of different types of reporter

molecules to DNA and proteins (123;124;128;129).

The ULS linker technology is based on platinum coordination and shows a cis geometry of

the coupled drug and carrier (Figure 8). The importance of this coordination chemistry is

based on the stability and kinetically slow release properties of platinum complexes to

nucleic acids and proteins (125). In general, platinum is found to react with S-donors such

as methionine and the Cys34 residues of albumin, the latter being the most abundant free

thiol group in blood plasma (126). Furthermore, it has been reported extensively that

platinum forms coordination bonds with aromatic Nitrogen groups in DNA, which is

kinetically favored over the reaction with Oxygen groups (127). The most important

feature of the ULS platinum linker in drug delivery derivatives is that the strength of the

drug-linker bond is stable enough to reach the target yet reversible enabling the release of

the drug in the target tissue or cells.

In the presently discussed drug targeting conjugates, different antifibrotic drugs were

linked to ULS and subsequently to the carrier protein M6PHSA. ULS linker bound to

aromatic nitrogens in the drug molecules. Furthermore, ULS may react with the

thiocarbonyl group between the M6P group and the albumin core protein, since it is

known that cisplatinum readily reacts with sulfur containing ligands. However, a reaction

of ULS with other functional groups in the protein like methionine or cysteine residues or

even hydroxyl or amine side chains may also occur. In chapter 2, the possible sites for a

reaction between ULS and M6PHSA are depicted. In the same chapter, characteristics of

drug release from ULS linker are explained in detail. In chapter 3, 4 and 5, we will present

data of drug targeting to HSC, employing the ULS linker during in vivo studies after

single or multiple administrations of the conjugates.

Chapter 2

28


Reference List

1. Fausto,N., Campbell,J.S., and Riehle,K.J. 2006. Liver regeneration. Hepatology 43:S45-S53.

2. Friedman,S.L. 2003. liver fibrosis - from bench to bedside. J. Hepatol. 38:S38-S53.

3. Meijer,D.K.F., and Molema,G. 1995. Targeting of drugs to the liver. Semin. Liver Dis. 15:202-256.

4. Kmiec,Z. 2001. Cooperation of liver cells in health and disease. Adv. Anat. Embryol. Cell Biol. 161:III-151.

5. Martinez,I., Sveinbjornsson,B., Vidal-Vanaclocha,F., Asumendi,A., and Smedsrod,B. 1995. Differential cytokine-mediated modulation of endocytosis in rat liver endothelial cells. Biochem. Biophys. Res. Commun. 212:235-241.

6. McGary,C.T., Yannariello-Brown,J., Kim,D.W., Stinson,T.C., and Weigel,P.H. 1993. Degradation and intracellular accumulation of a residualizing hyaluronan derivative by liver endothelial cells. Hepatology 18:1465-1476.

7. West,M.A., and Heaney,M.L. 1992. Regulation of Kupffer cell activation. In Hepatocyte and Kupffer cell interactions. T.R.Billiar, and Curran,R.D., editors. CRC Press. London Tokyo. 209-241.

8. Ramadori,G., and Armbrust,T. 2001. Cytokines in the liver. Eur. J. Gastroenterol. Hepatol. 13:777-784.

9. Rockey,D. 1996. Endothelin in hepatic fibrosis--friend or foe? Hepatol 23:1698-1700.

10. Friedman,S.L. 1999. The virtuosity of hepatic stellate cells. Gastro 117:1244-1246.

11. Raetsch,C., Jia,J.D., Boigk,G., Bauer,M., Hahn,E.G., Riecken,E.-O., and Schuppan,D. 2002. Pentoxifylline downregulates profibrogenic cytokines and procollagen I expression in rat secondary biliary fibrosis. Gut 50:241-247.

12. Schuppan,D., Ruehl,M., Somasundaram,R., and Hahn,E.G. 2001. Matrix as a modulator of hepatic fibrogenesis. Semin. Liver Dis. 21:351-372.

13. Bataller,R., and Brenner,D.A. 2005. Liver fibrosis. J. Clin. Invest 115:209-218.

14. Giannelli,G., Quaranta,V., and Antonaci,S. 2003. Tissue remodelling in liver diseases. Histol. Histopathol. 18:1267-1274.

15. Dufour,M.C., Stinson,F.S., and Caces,M.F. 1993. Trends in cirrhosis morbidity and

mortality: United States, 1979-1988. Semin. Liver Dis. 13:109-125.

16. Lotersztajn,S., Julien,B., Teixeira-Clerc,F., Grenard,P., and Mallat,A. 2005. Hepatic fibrosis: molecular mechanisms and drug targets. Annu. Rev. Pharmacol. Toxicol. 45:605-628.

17. Friedman,S.L. 1999. The virtuosity of hepatic stellate cells. Gastroenterology 117:1244-1246.

18. Diehl,A.M. 2000. Cytokine regulation of liver injury and repair. Immunol. Rev. 174:160-171.

19. Pinzani,M., Milani,S., Herbst,H., DeFranco,R., Grappone,C., Gentilini,A., Caligiuri,A., Pellegrini,G., Ngo,D.V., Romanelli,R.G., and Gentilini, P. 1996. Expression of platelet-derived growth factor and its receptors in normal human liver and during active hepatic fibrogenesis. Am. J. Pathol. 148:785-800.

20. Tsukada,S., Parsons,C.J., and Rippe,R.A. 2006. Mechanisms of liver fibrosis. Clin. Chim. Acta 364:33-60.

21. Gong,W.R., Roth,S., Michel,K., and Gressner,A.M. 1998. Isoforms and splice variant of transforming growth factor β- binding protein in rat hepatic stellate cells. Gastro 114:352-363.

22. Marra,F., Choudhury,G.G., Pinzani,M., and Abboud,H.E. 1994. Regulation of platelet-derived growth factor secretion and gene expression in human liver fat-storing cells. Gastro 107:1110-1117.

23. Pinzani,M., Gentilini,A., Caligiuri,A., De Franco,R., Pellegrini,G., Milani,S., Marra,F., and Gentilini,P. 1995. Transforming growth factor-β1 regulates platelet-derived growth factor receptor β subunit in human liver fat-storing cells. Hepatol 21:232-239.

24. Friedman,S.L. 2000. Molecular regulation of hepatic fibrosis, an integrated cellular response to tissue injury. J. Biol. Chem. 275:2247-2250.

25. Gressner,A.M., Weiskirchen,R., Breitkopf,K., and Dooley,S. 2002. Roles of TGF-beta in hepatic fibrosis. Front Biosci. 7:d793-d807.

26. Gressner,A.M., and Weiskirchen,R. 2006. Modern pathogenetic concepts of liver fibrosis suggest stellate cells and TGF-beta as major players and therapeutic targets. J. Cell Mol. Med. 10:76-99.


28. Rockey,D.C. 2001. Hepatic blood flow regulation by stellate cells in normal and injured liver. Semin. Liver Dis. 21:337-349.

29

Chapter 2

29. Lundgren J, Mocroft A, Soriano V, Rochstroh J, Reiss P, Kirk O, de Wit S, Gatell JM, Clotet B, and Phillips A 2005. Is there evidence for an increase in the death rate from liver-related disease in patients with HIV? The EuroSIDA study. European AIDS Clinical Society 10th European AIDS Conference (Abstr.)

30. Weber R, Friis-Moller N, and Sabin C 2005. Liver-related deaths among HIV-infected persons. European AIDS Clinical Society 10th European AIDS Conference (Abstr.)

31. Yoon Y-H, Yi H-Y, and Hilton ME 2005. Liver cirrhosis mortality in the united states, 1970-2002. National Institute on Alcohol abuse and Alcoholism (NIAAA).

32. Perez-Tamayo,R. 1979. Cirrhosis of the liver: a reversible disease? Pathol. Annu. 14 Pt 2:183-213.

33. Garcia,L., Hernandez,I., Sandoval,A., Salazar,A., Garcia,J., Vera,J., Grijalva,G., Muriel,P., Margolin,S., and rmendariz-Borunda,J. 2002. Pirfenidone effectively reverses experimental liver fibrosis. J. Hepatol. 37:797-805.

34. Shimizu,I., Ma,Y.R., Mizobuchi,Y., Liu,F., Miura,T., Nakai,Y., Yasuda,M., Shiba,M., Horie,T., Amagaya,S., and Kawada,N., Hori,H., and Ito,S. 1999. Effects of Sho-saiko-to, a Japanese herbal medicine, on hepatic fibrosis in rats. Hepatology 29:149-160.

35. Siller-Lopez,F., Sandoval,A., Salgado,S., Salazar,A., Bueno,M., Garcia,J., Vera,J., Galvez,J., Hernandez,I., Ramos,M., Aguilar-Cordova,E., and Armendariz-Borunda,J. 2004. Treatment with human metalloproteinase-8 gene delivery ameliorates experimental rat liver cirrhosis. Gastroenterology 126:1122-1133.

36. Kweon,Y.O., Goodman,Z.D., Dienstag,J.L., Schiff,E.R., Brown,N.A., Burchardt,E., Schoonhoven,R., Brenner,D.A., and Fried,M.W. 2001. Decreasing fibrogenesis: an immunohistochemical study of paired liver biopsies following lamivudine therapy for chronic hepatitis B. J. Hepatol. 35:749-755.

37. Poynard,T., McHutchison,J., Manns,M., Trepo,C., Lindsay,K., Goodman,Z., Ling,M.H., and Albrecht,J. 2002. Impact of pegylated interferon alfa-2b and ribavirin on liver fibrosis in patients with chronic hepatitis C. Gastroenterology 122:1303-1313.

38. Friedman,S.L., and Bansal,M.B. 2006. Reversal of hepatic fibrosis -- fact or fantasy? Hepatology 43:S82-S88.

39. Issa,R., Zhou,X., Trim,N., Millward-Sadler,H., Krane,S., Benyon,C., and Iredale,J. 2003.

Mutation in collagen-1 that confers resistance to the action of collagenase results in failure of recovery from CCl4-induced liver fibrosis, persistence of activated hepatic stellate cells, and diminished hepatocyte regeneration. FASEB J. 17:47-49.

40. Iredale,J.P., Benyon,R.C., Pickering,J., McCullen,M., Northrop,M., Pawley,S., Hovell,C., and Arthur,M.J.P. 1998. `Mechanisms of spontaneous resolution of rat liver fibrosis - Hepatic stellate cell apoptosis and reduced hepatic expression of metalloproteinase inhibitors. J. Clin. Invest. 102:538-549.

41. Murphy,F.R., Issa,R., Zhou,XRatnarajah,S., Nagase,H., Arthur,M.J., Benyon,C., and Iredale,J.P. 2002. Inhibition of apoptosis of activated hepatic stellate cells by tissue inhibitor of metalloproteinase-1 is mediated via effects on matrix metalloproteinase inhibition: implications for reversibility of liver fibrosis. J. Biol. Chem. 277:11069-11076.

42. Iredale,J.P. 2001. Hepatic stellate cell behavior during resolution of liver injury. Semin. Liver Dis. 21:427-436.

43. Issa,R., Zhou,X., Constandinou,C.M., Fallowfield,J., Millward-Sadler,H., Gaca,M.D., Sands,E., Suliman,I., Trim,N., Knorr,A., Arthur, M.J., Benyon, R.C., and Iredale,J.P. 2004. Spontaneous recovery from micronodular cirrhosis: evidence for incomplete resolution associated with matrix cross-linking. Gastroenterology 126:1795-1808.

44. Pinzani,M., Rombouts,K., and Colagrande,S. 2005. Fibrosis in chronic liver diseases: diagnosis and management. J. Hepatol. 42 Suppl:S22-S36.

45. Friedman,S.L. 2004. Mechanisms of disease: Mechanisms of hepatic fibrosis and therapeutic implications. Nat. Clin. Pract. Gastroenterol. Hepatol. 1:98-105.


47. Bonis,P.A., Friedman,S.L., and Kaplan,M.M. 2001. Is liver fibrosis reversible? N. Engl. J. Med. 344:452-454.

48. Albanis,E., Safadi,R., and Friedman,S.L. 2003. Treatment of hepatic fibrosis: almost there. Curr. Gastroenterol. Rep. 5:48-56.

49. Ramalho,L.N., Ramalho,F.S., Zucoloto,S., Castro-e-Silva Junior, Correa,F.M., Elias,J.J., and Magalhaes,J.F. 2002. Effect of losartan, an angiotensin II antagonist, on secondary biliary cirrhosis. Hepatogastroenterology 49:1499-1502.

Chapter 2

30


50. Hernandez,E., Correa,A., Bucio,L., Souza,V., Kershenobich,D., and Gutierrez-Ruiz,M.C. 2002. Pentoxifylline diminished acetaldehyde-induced collagen production in hepatic stellate cells by decreasing interleukin-6 expression. Pharmacol. Res. 46:435-443.

51. Buchdunger,E., Cioffi,C.L., Law,N., Stover,D., Ohno-Jones,S., Druker,B.J., and Lydon,N.B. 2000. Abl protein-tyrosine kinase inhibitor STI571 inhibits in vitro signal transduction mediated by c-kit and platelet-derived growth factor receptors. J. Pharmacol. Exp. Ther. 295:139-145.

52. Kweon,Y.-O., Paik,Y.-H., Schnabl,B., Qian,T., Lemasters,J.J., and Brenner,D.A. 2003. Gliotoxin-mediated apoptosis of activated human hepatic stellate cells. J. Hepatol. 39:38-46.

53. Suzuki,F., Hashimoto,K., Kikuchi,H., Nishikawa,H., Matsumoto,H., Shimada,J., Kawase,M., Sunaga,K., Tsuda,T., Satoh,K., and Sakagami, H. 2005. Induction of tumor-specific cytotoxicity and apoptosis by doxorubicin. Anticancer Res. 25:887-893.

54. Gonzalo,T., Talman,E.G., van,d., V, Temming,K., Greupink,R., Beljaars,L., Reker-Smit,C., Meijer,D.K.F., Molema,G., Poelstra,K., and Kok, R.J. 2006. Selective targeting of pentoxifylline to hepatic stellate cells using a novel platinum-based linker technology. J. Control Release 111:193-203.

55. Rachmawati,H., Beljaars,L., Reker-Smit,C., van Loenen-Weemaes,A.M., Hagens,W.I., Meijer,D.K.F., and Poelstra,K. 2004. Pharmacokinetic and biodistribution profile of recombinant human interleukin-10 following intravenous administration in rats with extensive liver fibrosis. Pharm. Res. 21:2072-2078.

56. Gonzalo,T., Bataller,R., Sancho-Bru,P., Fontdevilla,C., Swart,J., Beljaars,L., Arroyo,V., Poelstra,K., Gines,P., and Kok,R.J. 2005. Short-term treatment with losartan targeted to activated stellate cells reduces advanced liver fibrogenesis: A new strategy to treat liver fibrosis. Hepatology 42:604A.

57. Gonzalo,T., Poelstra,K., Beljaars,L., Keri,G., Orfi,L., and Kok,R.J. 2005. Specific targeting of a PDGFR tyrosine kinase inhibitor to activated hepatic stellate cells as a promising technology to reduce liver fibrosis. Hepatology 42:733A.

58. Greupink,R., Bakker,H.I., Reker-Smit,C., van Loenen-Weemaes,A.M., Kok,R.J., Meijer,D.K.F., Beljaars,L., and Poelstra,K. 2005. Studies on the targeted delivery of the antifibrogenic compound mycophenolic acid to the hepatic stellate cell. J. Hepatol. 43:884-892.

59. Greupink,R., Bakker,H.I., Bouma,W., Reker-Smit,C., Meijer,D.K., Beljaars,L., and Poelstra,K. 2006. The antiproliferative drug doxorubicin inhibits liver fibrosis in bile duct-ligated rats and can be selectively delivered to hepatic stellate cells in vivo. J. Pharmacol. Exp. Ther.

60. Hagens,W.I., Olinga,P., Meijer,D.K., Groothuis,G.M., Beljaars,L., and Poelstra,K. 2006. Gliotoxin non-selectively induces apoptosis in fibrotic and normal livers. Liver Int. 26:232-239.

61. Prakash,J., Sandovici,M., Saluja,V., Lacombe,M., Schaapveld,R.Q., de Borst,M., vanGoor,H., Henning,R.H., Proost,J.H., Moolenaar,F., Keri,G., Meijer,D.K.F., Poelstra,K., and Kok, R.J. 2006. Intracellular Delivery of the P38 MAPK Inhibitor SB202190 in Renal Tubular Cells: a Novel Strategy to Treat Renal Fibrosis. J. Pharmacol. Exp. Ther.

62. Ward,A., and Clissold,S.P. 1987. Pentoxifylline. A review of its pharmacodynamic and pharmacokinetic properties, and its therapeutic efficacy. Drugs 34:50-97.

63. Olaso,E., and Friedman,S.L. 1998. Molecular regulation of hepatic fibrogenesis. J. Hepatol. 29:836-847.

64. Windmeier,C., and Gressner,A.M. 1997. Pharmacological aspects of pentoxifylline with emphasis on its inhibitory actions on hepatic fibrogenesis. Gen. Pharmacol. 29:181-196.

65. Pinzani,M., Marra,F., Caligiuri,A., DeFranco,R., Gentilini,A., Failli,P., and Gentilini,P. 1996. Inhibition by pentoxifylline of extracellular signal-regulated kinase activation by platelet-derived growth factor in hepatic stellate cells. Br. J. Pharmacol. 119:1117-1124.

66. Windmeier,C., and Gressner,A.M. 1996. Effect of pentoxifylline on the fibrogenic functions of cultured rat liver fat-storing cells and myofibroblasts. Biochem. Pharmacol. 51:577-584.

67. Desmoulière,A., Xu,G., Costa,A.M.A., Yousef,I.M., Gabbiani,G., and Tuchweber,B. 1999. Effect of pentoxifylline on early proliferation and phenotypic modulation of fibrogenic cells in two rat models of liver fibrosis and on cultured hepatic stellate cells. J. Hepatol. 30:621-631.

68. Rodriguez-Barbero,A., Obreo,J., Yuste,L., Montero,J.C., Rodriguez-Pena,A., Pandiella,A., Bernabeu,C., and Lopez-Novoa,J.M. 2002. Transforming growth factor-beta1 induces collagen synthesis and accumulation via p38 mitogen-activated protein kinase (MAPK) pathway in cultured L(6)E(9) myoblasts. FEBS Lett. 513:282-288.

31

Chapter 2

69. Duncan,M.R., Hasan,A., and Berman,B. 1995. Pentoxifylline, pentifylline, and interferons decrease type I and III procollagen mRNA levels in dermal fibroblasts: evidence for mediation by nuclear factor 1 down-regulation. J. Invest Dermatol. 104:282-286.

70. Chen,Y.M., Wu,K.D., Tsai,T.J., and Hsieh,B.S. 1999. Pentoxifylline inhibits PDGF-induced proliferation of and TGF-beta-stimulated collagen synthesis by vascular smooth muscle cells. J. Mol. Cell Cardiol. 31:773-783.

71. Saati,N., Ravid,A., Liberman,U.A., and Koren,R. 1997. 1,25-dihydroxyvitamin D3 and agents that increase intracellular adenosine 3',5'-monophosphate synergistically inhibit fibroblast proliferation. In Vitro Cell Dev. Biol. Anim 33:310-314.

72. Chen,Y.M., Tu,C.J., Hung,K.Y., Wu,K.D., Tsai,T.J., and Hsieh,B.S. 2003. Inhibition by pentoxifylline of TNF-alpha-stimulated fractalkine production in vascular smooth muscle cells: evidence for mediation by NF-kappa B down-regulation. Br. J. Pharmacol. 138:950-958.

73. Duncan,M.R., Hasan,A., and Berman,B. 1995. Pentoxifylline, pentifylline, and interferons decrease type I and III procollagen mRNA levels in dermal fibroblasts: evidence for mediation by nuclear factor 1 down-regulation. J. Invest Dermatol. 104:282-286.

74. Berman,B., and Duncan,M.R. 1989. Pentoxifylline inhibits normal human dermal fibroblast in vitro proliferation, collagen, glycosaminoglycan, and fibronectin production, and increases collagenase activity. J. Invest Dermatol. 92:605-610.

75. Chang,C.C., Chang,T.C., Kao,S.C., Kuo,Y.F., and Chien,L.F. 1993. Pentoxifylline inhibits the proliferation and glycosaminoglycan synthesis of cultured fibroblasts derived from patients with Graves' ophthalmopathy and pretibial myxoedema. Acta Endocrinol. (Copenh) 129:322-327.

76. Lee,K.S., Cottam,H.B., Houglum,K., Wasson,D.B., Carson,D., and Chojkier,M. 1997. Pentoxifylline blocks hepatic stellate cell activation independently of phosphodiesterase inhibitory activity. Am. J. Physiol 273:G1094-G1100.

77. Gude,R.P., Binda,M.M., Boquete,A.L., and Bonfil,R.D. 2001. Inhibition of endothelial cell proliferation and tumor-induced angiogenesis by pentoxifylline. J. Cancer Res. Clin. Oncol. 127:625-630.

78. Krakauer,T. 2000. Pentoxifylline inhibits ICAM-1 expression and chemokine production induced by proinflammatory cytokines in human

pulmonary epithelial cells. Immunopharmacology 46:253-261.

79. Beljaars,L., Meijer,D.K.F., and Poelstra,K. 2002. Targeting hepatic stellate cells for cell-specific treatment of liver fibrosis. Front. Biosci. 7:E214-E223.

80. Goa,K.L., and Wagstaff,A.J. 1996. Losartan potassium: a review of its pharmacology, clinical efficacy and tolerability in the management of hypertension. Drugs 51:820-845.

81. Hall,W.D. 1999. Risk reduction associated with lowering systolic blood pressure: review of clinical trial data. Am. Heart J. 138:225-230.

82. Stroth,U., and Unger,T. 1999. The renin-angiotensin system and its receptors. J. Cardiovasc. Pharmacol. 33 Suppl 1:S21-S28.

83. Gardon,M.L., Gelband,C.H., Katovich,M.J., and Raizada,M.K. 1999. The potential use of gene therapy in the control of hypertension. Drugs Today (Barc. ) 35:925-930.

84. Wei,H.S., Lu,H.M., Li,D.G., Zhan,Y.T., Wang,Z.R., Huang,X., Cheng,J.L., and Xu,Q.F. 2000. The regulatory role of AT 1 receptor on activated HSCs in hepatic fibrogenesis:effects of RAS inhibitors on hepatic fibrosis induced by CCl(4). World J. Gastroenterol. 6:824-828.

85. Bataller,R., Sancho-Bru,P., Gines,P., Lora,J.M., Al Garawi,A., Sole,M., Colmenero,J., Nicolas,J.M., Jimenez,W., Weich,N., Gutierrez-Ramos, J.C., Arroyo,V., Rodes,J. 2003. Activated human hepatic stellate cells express the renin-angiotensin system and synthesize angiotensin II. Gastroenterology 125:117-125.

86. Croquet,V., Moal,F., Veal,N., Wang,J., Oberti,F., Roux,J., Vuillemin,E., Gallois,Y., Douay,O., Chappard,D., and Cales,P. 2002. Hemodynamic and antifibrotic effects of losartan in rats with liver fibrosis and/or portal hypertension. J. Hepatol. 37:773-780.

87. Paizis,G., Gilbert,R.E., Cooper,M.E., Murthi,P., Schembri,J.M., Wu,L.L., Rumble,J.R., Kelly,D.J., Tikellis,C., Cox,A., Smallwood,R.A., and Angus,P.W. 2001. Effect of angiotensin II type 1 receptor blockade on experimental hepatic fibrogenesis. J. Hepatol. 35:376-385.

88. Yoshiji,H., Kuriyama,S., Yoshii,J., Ikenaka,Y., Noguchi,R., Nakatani,T., Tsujinoue,H., and Fukui,H. 2001. Angiotensin-II type 1 receptor interaction is a major regulator for liver fibrosis development in rats. Hepatology 34:745-750.

89. Ramalho,L.N., Ramalho,F.S., Zucoloto,S., Castro-e-Silva Junior, Correa,F.M.,

Chapter 2

32


Elias,J.J., and Magalhaes,J.F. 2002. Effect of losartan, an angiotensin II antagonist, on secondary biliary cirrhosis. Hepatogastroenterology 49:1499-1502.

90. Rimola,A., Londono,M.C., Guevara,G., Bruguera,M., Navasa,M., Forns,X., Garcia-Retortillo,M., Garcia-Valdecasas,J.C., and Rodes,J. 2004. Beneficial effect of angiotensin-blocking agents on graft fibrosis in hepatitis C recurrence after liver transplantation. Transplantation 78:686-691.

91. Sookoian,S., Fernandez,M.A., and Castano,G. 2005. Effects of six months losartan administration on liver fibrosis in chronic hepatitis C patients: a pilot study. World J. Gastroenterol. 11:7560-7563.

92. Yokohama,S., Yoneda,M., Haneda,M., Okamoto,S., Okada,M., Aso,K., Hasegawa,T., Tokusashi,Y., Miyokawa,N., and Nakamura,K. 2004. Therapeutic efficacy of an angiotensin II receptor antagonist in patients with nonalcoholic steatohepatitis. Hepatology 40:1222-1225.

93. Gonzalez-Abraldes,J., Albillos,A., Banares,R., Del Arbol,L.R., Moitinho,E., Rodriguez,C., Gonzalez,M., Escorsell,A., Garcia-Pagan,J.C., and Bosch,J. 2001. Randomized comparison of long-term losartan versus propranolol in lowering portal pressure in cirrhosis. Gastroenterology 121:382-388.

94. 2001. Drug Targeting. Organ-Specific Strategies. WILEY-VCH Verlag GmbH. Weinheim.


96. Hart,C.E., Forstrom,J.W., Kelly,J.D., Seifert,R.A., Smith,R.A., Ross,R., Murray,M.J., and Bowen-Pope,D.F. 1988. Two classes of PDGF receptor recognize different isoforms of PDGF. Science 240:1529-1531.

97. Bergsten,E., Uutela,M., Li,X., Pietras,K., Ostman,A., Heldin,C.H., Alitalo,K., and Eriksson,U. 2001. PDGF-D is a specific, protease-activated ligand for the PDGF beta-receptor. Nat. Cell Biol. 3:512-516.

98. Heldin,C.H., Ostman,A., and Ronnstrand,L. 1998. Signal transduction via platelet-derived growth factor receptors. Biochim. Biophys. Acta 1378:F79-113.

99. Wong,L., Yamasaki,G., Johnson,R.J., and Friedman,S.L. 1994. Induction of β-platelet-derived growth factor receptor in rat hepatic lipocytes during cellular activation in vivo and in culture. J. Clin. Invest.1563-1569.

100. De Bleser,P.J., Jannes,P., Van Buul-Offers,S.C., Hoogerbrugge,C.M., Van

Schravendijk,C.F.H., Niki,T., Rogiers,V., Van den Brande,J.L., Wisse,E., and Geerts,A. 1995. Insulinlike growth factor-II/mannose 6-phosphate receptor is expressed on CCl4-exposed rat fat-storing cells and facilitates activation of latent transforming growth factor-β in cocultures with sinusoidal endothelial cells. Hepatol 21:1429-1437.

101. Weiner,J.A., Chen,A., and Davis,B.H. 2000. Platelet-derived growth factor is a principal inductive factormodulating mannose 6-phosphate/insulin-like growth factor-II receptorgene expression via a distal E-box in activated hepatic stellate cells. Biochem. J. 345 Pt 2:225-231.

102. Bachem,M.G., Meyer,D., Schäfer,W., Riess,U., Melchior,R., Sell,K.M., and Gressner,A.M. 1993. The response of rat liver perisinusoidal lipocytes to polypeptide growth regulator changes with their transdifferentiation into myofibroblast-like cells in culture. J. Hepatol. 18:40-52.

103. Pinzani,M. 2002. PDGF and signal transduction in hepatic stellate cells. Front Biosci. 7:d1720-d1726.

104. Breitkopf,K., Roeyen,C., Sawitza,I., Wickert,L., Floege,J., and Gressner,A.M. 2005. Expression patterns of PDGF-A, -B, -C and -D and the PDGF-receptors alpha and beta in activated rat hepatic stellate cells (HSC). Cytokine 31:349-357.


106. Breitkopf,K., Lahme,B., Tag,C.G., and Gressner,A.M. 2001. Expression and matrix deposition of latent transforming growth factor beta binding proteins in normal and fibrotic rat liver and transdifferentiating hepatic stellate cells in culture. Hepatology 33:387-396.

107. von Mehren, M. 2005. Targeted therapy with imatinib: hits and misses? J. Clin. Oncol. 23:8-10.

108. Borkham-Kamphorst,E., Herrmann,J., Stoll,D., Treptau,J., Gressner,A.M., and Weiskirchen,R. 2004. Dominant-negative soluble PDGF-beta receptor inhibits hepatic stellate cell activation and attenuates liver fibrosis. Lab Invest 84:766-777.

109. Yokoyama,M. 2005. Drug targeting with nano-sized carrier systems. J. Artif. Organs 8:77-84.

110. Batist,G., Harris,L., Azarnia,N., Lee,L.W., and za-Ramirez,P. 2006. Improved anti-tumor response rate with decreased cardiotoxicity of non-pegylated liposomal doxorubicin compared with conventional doxorubicin in first-line treatment of metastatic breast cancer in patients who had received

33

Chapter 2

prior adjuvant doxorubicin: results of a retrospective analysis. Anticancer Drugs 17:587-595.

111. Litzinger,D.C., Buiting,A.M., van,R.N., and Huang,L. 1994. Effect of liposome size on the circulation time and intraorgan distribution of amphipathic poly(ethylene glycol)-containing liposomes. Biochim. Biophys. Acta 1190:99-107.

112. Bal,W., Christodoulou,J., Sadler,P.J., and Tucker,A. 1998. Multi-metal binding site of serum albumin. J. Inorg. Biochem. 70:33-39.

113. Beljaars,L., Molema,G., Weert,B., Bonnema,H., Olinga,P., Groothuis,G.M.M., Meijer,D.K.F., and Poelstra,K. 1999. Albumin modified with mannose 6-phosphate: A potential carrier for selective delivery of antifibrotic drugs to rat and human hepatic stellate cells. Hepatol 29:1486-1493.

114. Beljaars,L., Poelstra,K., Weert,B., Bonnema,H., Molema,G., and Meijer,D.K.F. 1998. Mannose 6-phosphate modified albumin accumulates in hepatic stellate cells: potential application as an anti-fibrotic drug carrier. Hepatol 28:233A (Abstr.)

115. Kok,R.J., Ásgeirsdóttir,S.A., and Verweij,W.R. 2001. Development of proteinaceous drug targeting constructs using chemical and recombinant DNA approaches. In Drug Targeting. Organ-Specific Strategies. G.Molema, and Meijer,D.K.F., editors. WILEY-VCH Verlag GmbH. Weinheim. 275-308.

116. Mueller,E.J., Oh,S., Kavalerchik,E., Kappock,T.J., Meyer,E., Li,C., Ealick,S.E., and Stubbe,J. 1999. Investigation of the ATP binding site of Escherichia coli aminoimidazole ribonucleotide synthetase using affinity labeling and site-directed mutagenesis. Biochemistry 38:9831-9839.

117. Rodrigues,P.C., Beyer,U., Schumacher,P., Roth,T., Fiebig,H.H., Unger,C., Messori,L., Orioli,P., Paper,D.H., Mulhaupt,R., and Kratz, F. 1999. Acid-sensitive polyethylene glycol conjugates of doxorubicin: preparation, in vitro efficacy and intracellular distribution. Bioorg. Med. Chem. 7:2517-2524.

118. Di,S.G., Lanza,M., Kratz,F., Merina,L., and Fiume,L. 2004. A novel method for coupling doxorubicin to lactosaminated human albumin by an acid sensitive hydrazone bond: synthesis, characterization and preliminary biological properties of the conjugate. Eur. J. Pharm. Sci. 23:393-397.

119. Kratz,F., Beyer,U., Roth,T., Schutte,M.T., Unold,A., Fiebig,H.H., and Unger,C. 1998. Albumin conjugates of the anticancer drug chlorambucil:

synthesis, characterization, and in vitro efficacy. Arch. Pharm. (Weinheim) 331:47-53.

120. Saito,G., Swanson,J.A., and Lee,K.D. 2003. Drug delivery strategy utilizing conjugation via reversible disulfide linkages: role and site of cellular reducing activities. Adv. Drug Deliv. Rev. 55:199-215.

121. Hagens,W.I., Olinga,P., Meijer,D.K., Groothuis,G.M., Beljaars,L., and Poelstra,K. 2006. Gliotoxin non-selectively induces apoptosis in fibrotic and normal livers. Liver Int. 26:232-239.

122. Arunachalam,B., Phan,U.T., Geuze,H.J., and Cresswell,P. 2000. Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT). Proc. Natl. Acad. Sci. U. S. A 97:745-750.

123. Heetebrij,R.J., Talman,E.G., Velzen,M.A., van Gijlswijk,R.P., Snoeijers,S.S., Schalk,M., Wiegant,J., Rijke,F., Kerkhoven,R.M., Raap,A.K., Tanke,H.J., Reedijk,J., and Houthoff, H.J. 2003. Platinum(II)-based coordination compounds as nucleic acid labeling reagents: synthesis, reactivity, and applications in hybridization assays. Chembiochem. 4:573-583.

124. van Gijlswijk,R.P., Talman,E.G., Janssen,P.J., Snoeijers,S.S., Killian,J., Tanke,H.J., and Heetebrij,R.J. 2001. Universal Linkage System: versatile nucleic acid labeling technique. Expert. Rev. Mol. Diagn. 1:81-91.

125. Reedijk,J. 2003. New clues for platinum antitumor chemistry: kinetically controlled metal binding to DNA. Proc. Natl. Acad. Sci. U. S. A 100:3611-3616.

126. Esposito,B.P., Faljoni-Alario,A., de Menezes,J.F., de Brito,H.F., and Najjar,R. 1999. A circular dichroism and fluorescence quenching study of the interactions between rhodium(II) complexes and human serum albumin. J. Inorg. Biochem. 75:55-61.

127. Reedijk,J. 1999. Why does Cisplatin reach Guanine-n7 with competing s-donor ligands available in the cell? Chem. Rev. 99:2499-2510.

128. US 5,580,990; EP 0,539,466; US 5,714,327; US 5,985,566; US 6,133,038. Kreatech Biotechnology b.v.

129. van Gijlswijk,R.P., Talman,E.G., Peekel,I., Bloem, J., van Velzen,M., Heetebrij,R.J., and Tanke,H.J 2002. Use of horseradish peroxidase- and fluorescein-modified cisplatin derivatives for simultaneous labeling of nucleic acids and proteins. Clin. Chem.. 48:1352-9.

Chapter 2

Martini Tower in Groningen.

Chapter3Selective targeting of pentoxifylline to hepatic stellate cells using a novel platinum-based linker technology

Journal of Controlled Release 111: 193-203 (2006).

Teresa Gonzalo1, Eduard G. Talman2, Anke van de Ven1, Kai Temming 1,2,

Rick H.Greupink1, Leonie Beljaars1, Catharina Reker-Smit1 , Dirk K.F. Meijer1,

Grietje Molema3, Klaas Poelstra1 and Robbert J. Kok1

1 Department of Pharmacokinetics and Drug Delivery, Groningen University Institute for Drug Exploration, Groningen, The Netherlands.

2 Kreatech Biotechnology, Amsterdam, The Netherlands.

3 Department of Pathology and Laboratory Medicine, Medical Biology Section, Groningen University Institute for

Drug Exploration, The Netherlands.

36

Targeting Pentoxifylline to hepatic stellate cells

Abstract

Targeting of antifibrotic drugs to hepatic stellate cells (HSC) is a promising strategy to

block fibrotic processes leading to liver cirrhosis. For this purpose, we utilized the neo-

glycoprotein mannose-6-phosphate-albumin (M6PHSA) that accumulates efficiently in

HSC during liver fibrosis. Pentoxifylline (PTX), an antifibrotic compound that inhibits

HSC proliferation and activation in vitro, was conjugated to M6PHSA. We employed a new

type of platinum-based linker, which conjugates PTX via coordination chemistry rather

than via covalent linkage. When incubated in plasma or in the presence of thiol

compounds, free PTX was released from PTX-M6PHSA at a sustained slow rate.

PTX-M6PHSA displayed pharmacological activity in cultured HSC as evidenced by

changes in cell morphology and reduction of collagen I production. PTX-M6PHSA and

platinum coupled PTX did not induce platinum-related toxicity (Alamar Blue viability

assay) or apoptosis (caspase activation and TUNEL staining). In vivo distribution studies in

fibrotic rats demonstrated specific accumulation of the conjugate in nonparenchymal cells

in the fibrotic liver. In conclusion, we have developed PTX-M6PHSA employing a novel

type of platinum linker, which allows sustained delivery of the drug to HSC in the fibrotic

liver.

37

Chapter 3

Introduction

Liver cirrhosis is the end-stage of liver diseases such as viral hepatitis, alcohol abuse, non-

alcoholic steatohepatitis and other diseases in which acute liver damage leads to chronic

inflammation and fibrosis (1). Apart from liver transplantation, no appropriate treatment

is currently available for liver fibrosis. Unfortunately, donor organ shortage and high costs

remain a serious problem for transplantation and, when it occurs, hepatic failure after

transplantation is still burdened by a high mortality rate. Finding a proper

pharmacotherapeutic treatment for liver fibrosis is therefore considered a major challenge.

Selective targeting of antifibrotic drugs to hepatic stellate cells (HSC) has recently been

proposed as a potential new strategy to counteract liver fibrosis at the level of stellate cell

activation (2). HSC have been identified as the key fibrogenic cell type (3;4). During liver

fibrosis, different stimuli induce HSC proliferation, leading to large numbers of activated

HSC that regulate the increased production of extracellular matrix components such as

collagens (5).

We have developed mannose-6-phosphate modified albumin (M6PHSA), which binds

with high affinity to the insulin-like growth factor II/mannose-6-phosphate receptor on

activated HSC (2;6;7). Since the M6PHSA carrier is internalized via receptor-mediated-

endocytosis upon binding to HSC, potent anti-fibrotic compounds can be delivered

intracellularly within the diseased liver, and even within the desired cell-type (8).

Pentoxifylline (PTX) has been suggested for specific targeting to the fibrotic liver (9). Its

antifibrogenic and anti-inflammatory properties on activated HSC have been extensively

reported and demonstrated. PTX reduces the transdifferentiation of HSC to

myofibroblasts and inhibits HSC proliferation (10-12). PTX also reduces the fibrogenic

effect of TGF-β on HSC by interference with p38 MAPkinase and ERK1/2 pathways,

thereby decreasing hepatic procollagen type 1 mRNA expression (13). However, apart

from beneficial effects in HSC, profibrotic effects of PTX on Kupffer cells have been

reported (12), as well as many effects in other cell types (14;15).

Chapter 3

38


Cell-selective targeting of PTX to HSC is therefore required to create favorable effects in

HSC, while avoiding the profibrotic effects in Kupffer cells and effects in other organs.

SCH3

M6PHSA carrier (2) Methionine binding

S

NH

NH

M6P M6PHSA carrier

(1)Thiourea binding site:

N

N

N

N

CH3O

OCH3

O

PtNH22HN

S M6PHSA carrier

Schematic structure of PTX-M6PHSA:

Figure 1. General struc ure of PTX-M6PHSA. PTX is coupled via the platinum linker ULS

to thiol groups of the protein. Two possible binding sites in the protein are proposed, i.e. the thiol group of

the M6P homing devices on the modified HSA (1), and the sulfur atom in methionine groups of the

protein (2).

t

In the present paper we describe the development of the novel HSC-directed conjugate

PTX-M6PHSA. To conjugate PTX to M6PHSA, we employed a novel type of platinum

linker chemistry which allows stable coupling of drug molecules to proteins. The new

drug-linking approach is based on the formation of a platinum-ligand coordination bond

39

Chapter 3

with an aromatic nitrogen in PTX, after which the linker is further reacted to electron

donor sites in the carrier protein (Figure 1).

Since the nature of the organoplatinum bond is quite different from the linkages in

classical drug targeting conjugates, we investigated drug-release characteristics and linker-

related toxicity of the conjugates. In addition, we report on cell-specific binding to HSC

and in vitro pharmacological effects of PTX-M6PHSA, as well as its homing to HSC

during liver fibrosis in the rat.

Chapter 3

40


Materials and methods

Chemicals and biochemicals

Platinum (ethylenediamine) dichloride (Universal linker System, ULS) and fluorescein-

ULS (FLU-ULS) were prepared as previously described by Kreatech Biotechnology

(Amsterdam, The Netherlands) (16). PTX and cisplatin were obtained from Sigma.

Human Serum Albumin (HSA) was obtained from Sanquin (Amsterdam, The

Netherlands).

Synthesis of conjugates

- Preparation of M6PHSA

M6PHSA was prepared and characterized as described previously (6). Dimeric protein

products which often are present in starting material or formed during reactions were

removed by size-exclusion chromatography using a Hiload 16/60 Superdex 200 column

(Amersham Biosciences). The final monomeric product was extensively dialyzed against

water at 4°C, lyophilized and stored at -20°C until use. Typically, M6PHSA contains 28

M6P groups per albumin.

- Synthesis of PTX-ULS

ULS (82.5 mg, 0.25 mmol) was dissolved in 3 ml of dimethylformamide (DMF) and

converted into the more reactive Pt (en (NO3) Cl (ULS mononitrate) by adding small

aliquots of AgNO3 (38.5 mg, 0.22 mmol, dissolved in 1 ml of DMF) within a time period

of two hours. The precipitated AgCl was removed by centrifugation. PTX (43.2 mg, 0.155

mmol, dissolved in 1 ml of DMF) was added and the resulting mixture was stirred at 60°C

for 2 days. DMF was removed by rotary evaporation, after which the residue was

dissolved in 2 ml of water and again taken to dryness under reduced pressure. The crude

product was dissolved in water (2 ml) and stored overnight at -20°C to precipitate

unreacted ULS as yellow crystals, which were removed by centrifugation (10 minutes at

41

Chapter 3

14,000 rpm). The identity and purity of the final product was checked by HPLC (95%),

NMR and mass spectroscopy. PTX-ULS was stored at 4°C until further use.

Yield: 105 mg (0.166 mmol, 107% yield). Apart from PTX-ULS, the product contained

water and inorganic salts that did not interfere in the next reaction step.

PTX 1H NMR (D2O): δH 1.61 (m, 4H, CH2(CH2)2CH2), 2.24 (s, 3H, CH3CO), 2.64 (t, J =

6.41 Hz, 2H, COCH2), 3.53 (s, 3H, CONCH3), 3.95 (m, 5H, CH2N and CNCH3CH),

7.92 (s, 1H, CH) ppm.

PTX-ULS 1H NMR (D2O): δH 1.62 (m, 4H, CH2(CH2)2CH2), 2.25 (s, 3H, CH3CO), 2.58

(m, 6H, COCH2, H2N(CH2)2NH2), 3.99 (t, J = 6.56 Hz, 2H, CH2N), 4.02 (s, 3H,

CONCH3), 4.55 (s, 3H, CNCH3C), 5.59 (m, 4H, H2N(CH2)2NH2), 8.48 (s, 1H, CH)

ppm.

PTX-ULS 195Pt NMR (D2O): δPt -2471 ppm.

PTX-ULS ionspray MS: Observed product peaks corresponded to PTX-ULS

monochloride (MW = 568.1 Da) and to PTX-ULS in which chloride was replaced by a

hydroxyl anion (MW = 550.1 Da). The latter product is possibly formed during dilution or

ionization of the compound for mass analysis. Both PTX-ULS species will react similarly

in subsequent reaction steps.

- Synthesis of PTX-M6PHSA and other conjugates.

All PTX-ULS-protein and FLU-ULS-protein conjugates listed in Table 1 were prepared

according to the following general protocol, which employs a 10:1 molar ratio of drug-

ULS to protein. Typically, 10 mg of M6PHSA (143 nmol) was dissolved in 1 ml of 20 mM

tricine/NaNO3 buffer pH 8.3. PTX-ULS (1430 nmol, 28.6 µl from a 50 mM stock

solution in water) was added and the pH was checked and corrected if necessary. The

mixture was reacted overnight at 37°C, after which unreacted PTX-ULS was removed by

size-exclusion chromatography using disposable PD10 columns (Amersham Biosciences),

or by dialysis against PBS at 4°C. The final product was sterilized by 0.2 µm filtration and

stored at -20°C.

Chapter 3

42


Characterization of drug-protein conjugates

To determine the amount of PTX or FLU conjugated via ULS to the proteins, products

were subjected to various analyses related to either carrier, drug or linker, respectively.

- Protein determination.

The protein content of the conjugates was analyzed by different standard protein assays.

Both Lowry and Bradford assays yielded protein recoveries over 100%, indicating

interference of ULS modification with the protein determination. The bicinchoninic acid

(BCA) assay (Pierce, Rockford, IL, USA) resulted in adequate recovery of freeze-dried

amounts of the products.

- PTX determination.

The amount of PTX coupled to the carrier was analyzed by HPLC after competitive

displacement of the drug by excess of potassium thiocyanate (KSCN), a Pt-coordinating

ligand. In brief, appropriate dilutions of the conjugates corresponding to approximately 10

µM PTX were incubated overnight at 80°C in the presence of 0.5 M KSCN in PBS. After

cooling to room temperature, the samples were stored at -20°C until HPLC analysis. Free,

non-conjugated PTX was determined by HPLC analysis of samples that had not been

incubated with KSCN.

We analyzed PTX and PTX-ULS by reverse-phase HPLC on a Waters system (Waters,

Milford, MA, USA) equipped with an UV detector operated at 274 nm and a thermostated

column oven operated at 40°C. Elutions were performed on a µBondapak Guard-pak C18

precolumn in combination with a 5 µm Hypersil BDS C8 column (250x4.6 mm,

Thermoquest Runcorn, UK). Mobile phase consisted of acetonitrile/water/trifluoracetic

acid (25/75/0.1) at 1 ml/min. PTX and PTX-ULS eluted at 6 min and 5 min after

injection, respectively.

- Characterization of FLU-ULS modified proteins

FLU-ULS coupling ratios were determined spectrophotometrically without destruction of

the conjugates. Appropriate dilutions of the conjugates in PBS were analyzed at 500 nm

and related to a calibration curve of fluorescein sodium.

43

Chapter 3

- Determination of platinum content in conjugates

To assess the number of coupled ULS molecules, appropriate dilutions of the conjugates

corresponding to approximately 1 µM of platinum were analyzed by flameless atomic

absorption spectroscopy (FAAS), as described previously (17).

Table 1. Characterization o conjugates synthesized with PTX-ULS and FLU-ULS. f

Conjugate

Synthesis ratio

drug-ULS : protein

Coupling ratio

drug : protein¶

Coupling ratio

ULS : protein§

PTX-M6PHSA 10:1 6.7 : 1 (±0.7) 6.9 : 1 (±2.7)

PTX-HSA 10:1 1.5 : 1 (±1.0) 3.5 : 1 (±2.1)

FLU-M6PHSA 10:1 6.5 : 1 (±2.0) 6.2: 1 (±2.9)

FLU-HSA 10:1 4.3 : 1 (±2.0) 5.4 : 1 (±0.4)

¶ PTX coupling ratio was determined by HPLC after competitive displacement of the drug

with KSCN at 80°C for 24h. FLU coupling ratio was determined by its absorbance at 500

nm.§ ULS coupling ratio was determined by FAAS.

PTX release studies

The stability of PTX-M6PHSA in biological media was investigated by incubating the

conjugate in pH 7.4 at 37°C up to 7 days in a 1:1 dilution of normal rat serum and PBS.

Released PTX and conjugate bound drug were separated by treating aliquots with

acetonitrile (2:1 v/v) after which the samples were centrifuged at high speed to precipitate

proteins. The clear supernatant was stored at -20°C until HPLC analysis. Calibration

Chapter 3

44


curves were made by spiking biological media with free PTX and were treated similar to

PTX-M6PHSA samples.

Thiol-competitive displacement, rather than enzymatic release, most likely facilitates

intracellular release of PTX from the conjugates. We therefore performed drug release

studies by incubating PTX-M6PHSA for 24h at 37°C in PBS pH 7.4 containing 5 mM

glutathione (GSH) or 5 mM dithiothreitol (DTT). PTX release was compared to

incubations in PBS or HSC culture medium, and expressed as the percentage of total

bound PTX.

Isolation and culturing of HSC

HSC were isolated from livers of male Wistar rats (0.3 kg) according to standard

techniques (18). After digestion of the liver with collagenase P (Boehringer, Mannheim,

Germany), pronase (Merck, Darmstadt, Germany), and DNAse (Boehringer), HSC were

separated from other hepatic cells by density-gradient centrifugation and collected at the

top of an 11% Nycodenz-solution (Brunschwig Chemie, Amsterdam). Subsequently, HSC

were cultured in disposable plastic bottles (Nunc, USA), in DMEM (GIBCO) containing

10% fetal calf serum (Hyclone Laboratories Inc., Logan, UT, USA), 100 U/ml penicillin,

and 100 µg/ml streptomycin (Sigma). These culture conditions allow HSC to attach and

proliferate as confirmed by microscopical evaluation. Cells cultured for 2 days after

isolation exhibited the phenotype of quiescent HSC, a compact cell shape with many

cytoplasmic fat droplets, while cells cultured for 10 days after isolation displayed the more

elongated phenotype of activated HSC without the vitamin A containing fat droplets. All

experiments with conjugates were performed with the latter type of activated HSC.

Binding studies of PTX-M6PHSA to target cells

- M6P/IGFII receptor expression

We investigated the specific binding of PTX-M6PHSA to its target receptor in a cell line

that expresses M6P/IGFII receptor. First, immunohistochemical detection of the target

receptor was analyzed. For this purpose, NIH/3T3 cells (2500 cells/well seeded into 96

well-plates) were cultured for 24h at 37°C in DMEM medium (Cambrex, New Jersey)

45

Chapter 3

supplemented with 5% FCS. After washing and acetone-fixation of the cells, expression of

the M6P/IGFII receptor was visualized by immunohistochemical staining (Santa Cruz

Biotechnology,California).

- Radioactive binding studies

In addition, we studied the binding of 125I-radiolabeled PTX-M6PHSA to M6P/IGFII

receptor expressing NIH/3T3 fibroblasts. PTX-M6PHSA was radiolabeled to a specific

activity of 35x106 cpm/µg by a chloramine-T method. Prior to the experiment, the

radiolabeled PTX-M6PHSA was purified by gel filtration on a PD10 column (Amersham

Biosciences). After gel filtration, the radiolabeled PTX-M6PHSA contained less than 5%

free 125I, as determined by precipitation of the protein with 10% trichloroacetic acid.

Binding studies were performed by incubating NIH/3T3 cells (60,000 cells/well seeded in

12-well plates) with 100,000 cpm of radiolabeled PTX-M6PHSA for 4h at 37°C.

Competitive displacement was performed by adding 0.1mg/ml M6PHSA carrier. After

washing of the cells with ice-cold PBS containing 1% bovine serum albumin, cells were

lysed by adding 0.5 ml of 1 M NaOH for 30 min. 125I-radioactivity was counted in an LKB

multichannel counter (LKB, Bromma, Sweden).

- Immunohistochemical binding studies

In addition we performed studies in which binding of PTX-M6PHSA was detected by

immunohistochemical staining of the protein. For this purpose, NIH/3T3 cells were

incubated for 4h at 37°C in the presence of 1 mg/ml M6PHSA or PTX-M6PHSA. After

washing and acetone-fixation of the cells, the binding of the conjugates was detected

immunohistochemically using rabbit-anti-HSA antibody (Cappel ICN Biomedicals,

Zoetermeer, The Netherlands).

Binding/homing studies in BDL rats

Organ distribution studies were performed in BDL rats as described previously (2). All in

vivo experiments were approved by the Local Committee for Care and Use of Laboratory

Animals. Male Wistar rats weighing 250-350 g (Harlan, Zeist, The Netherlands) were

housed under a 12-hour dark/light cycle. Animals had free access to tap water and

Chapter 3

46


standard lab chow. Liver fibrosis was induced by ligation of the bile duct under isoflurane

anesthesia (2% isoflurane in 2:1 O2/N2O, 1 L/min) (Abbot Laboratories Ltd.,

Queensborough, UK). Three weeks after BDL, the liver showed severe fibrotic lesions

and excessive matrix deposition, as assessed by immunostaining for collagen III (2). At

this time point, the rats were used for biodistribution studies to determine homing to the

fibrotic liver and subcellular localization within the liver. During biodistribution studies,

rats were kept under isoflurane anesthesia and body temperature was maintained at 37-

38°C.

- Biodistribution of radiolabeled proteins

Rats were i.v. injected via the dorsal penis vein with tracer doses (106 cpm/rat) of either 125I-PTX-M6PHSA or 125I-radiolabeled M6PHSA. At 10 minutes after administration,

blood samples were taken by heart puncture and the organs were excised, washed in

saline, and weighed after which 125I-radioactivity was counted. Urine was recovered from

the bladder and measured. The total radioactivity per organ was calculated and corrected

for blood-derived radioactivity using BDL correction factors.

- Immunohistochemical detection of conjugates

In order to analyze intrahepatic distribution of the conjugates, BDL rats received one i.v.

injection of non-radiolabeled PTX-M6PHSA (2mg/kg). Tissue specimens were processed

for immunohistochemical analysis according to standard procedures. Cryostat sections

(4µm) of the liver were fixed in acetone and stained for the presence of conjugates by anti-

HSA immunodetection. Colocalization of PTX-M6PHSA with HSC was investigated by

double staining of HSA and desmin. To amplify anti-HSA staining, GARPO (peroxidase-

conjugated goat anti- rabbit immunoglobulin) and RAGPO (peroxidase-conjugated rabbit

anti-goat immunoglobulin) secondary antibodies were used in the double staining

protocol. Anti-desmin (Cappel ICN Biomedicals) was used in combination with RAM-AF

(alkaline phosphatase-conjugated rabbit anti-mouse) for detection of activated HSC.

47

Chapter 3

In vitro effec s of PTX-M6PHSA conjugates t

We tested the pharmacological efficacy of PTX-M6PHSA by incubating activated HSC

for 24h at 37°C with the conjugate or with control compounds relating to the experiments

described below.

- Cytotoxic effects

Cell viability was determined using the Alamar Blue viability assay occoridng to the

protocol of the supplier (Serotec Ltd). Activated HSC (10,000 cells/well seeded in 96 well-

plates, Corning Costar) were incubated for 24h in culture medium spiked with either

cisplatin (100 µM), PTX (100 µM), PTX-ULS (100 µM) or PTX-M6PHSA (1 mg/ml

based in protein concentration, 100uM in platinum concentration).

Induction of apoptosis was determined by caspase 3/7-activity measurement using the

apoptosis Caspase-Glo assay (Promega). Activated HSC (10,000 cells/well seeded in

white-walled 96 well-plates, Corning Costar) were incubated in culture medium spiked

during 24h with either cisplatin (100 µM), PTX (100 µM), PTX-ULS (100 µM) or PTX-

M6PHSA (1 mg/ml based in protein concentration, 100uM in platinum concentration).

Similar studies were performed with HSC (10,000 cells/well in Permanox LAB-TEK

chamber slides, Nalge Nunc Int.) which were subjected to TUNEL staining of fragmented

DNA as read-out parameter of apoptosis induction (19). Quantification per treatment was

performed after a minimum of 100 cells in at least 6 different microscopic fields per

section at magnification of 10x, under the fluorescence microscope. Analysis performed

by two independent observers.

- Antifibrotic effects

HSC (10.000 cells/well in Permanox LAB-TEK chamber slides) were incubated with

culture medium supplemented with either PTX-M6PHSA, PTX-HSA, or FLU-M6PHSA,

all at a concentration of 1 mg/ml. The applied concentration of PTX-M6PHSA

corresponded to 100 µM of conjugated PTX. In addition, HSC were incubated with 1 mM

free PTX. After 24h of incubation at 37°C, HSC were acetone-fixed and stained for the

presence of fibrosis markers according to standard methods using monoclonal antibody

Chapter 3

48


against α-smooth muscle actin (Sigma) or polyclonal antibody against collagen type I

(Southern Biotechnology, USA). HSC morphology was analyzed via direct optical

microscopy observation.

Statist cs i

Statistical significance of differences was tested using the two-tailed Student’s t-test,

assuming normal distribution and similar variances of the data. The differences were

considered significant at p-values lower than 0.05. The data are presented as the mean of a

triplicate ± S.D.

49

Chapter 3

Results

Synthesis & characterization

In the present study, we investigated platinum-based coordination chemistry for the

coupling PTX to the M6PHSA carrier protein. This new type of linker binds to aromatic

nitrogens in drug molecules (Figure 1), forming a bond of intermediate binding strength.

To quantify PTX loading onto M6PHSA, the complexed drug was displaced by an excess

of competing platinum-ligand (KSCN). The drug/carrier ratios as shown in Table 1 were

corroborated by determination of platinum/carrier ratios using FAAS. Using a 10:1 initial

synthesis ratio, an average of about 6 to 7 molecules of PTX-ULS was coupled to

M6PHSA. Interestingly, coupling ratios of both PTX-ULS and FLU-ULS with M6PHSA

exceeded those of conjugates prepared with unmodified HSA. Similarly, PTX-ULS

showed also higher drug:carier loading ratio's with other neoglycoproteins like mannose-

HSA (data not shown). Since platinum(II) readily reacts with sulfur containing ligands, we

hypothesized that ULS reacted to the thiocarbonyl group between the M6P ligand and the

albumin core protein, as illustrated in Figure 1. Thiourea reacted rapidly with PTX-ULS at

the applied reaction conditions of the conjugates, as was demonstrated by HPLC analysis

and mass spectrometry (data not shown). However, reaction of ULS to other functional

groups in the protein like methionine or cysteine residues or even hydroxyl or amine side

chains can not be excluded.

Drug release profile of PTX-M6PHSA conjugate

To study the stability of PTX-M6PHSA under physiological conditions, we incubated

PTX-M6PHSA in serum (pH 7.4) at 37°C. About 40% of the conjugated PTX was still

bound to the carrier after 7 days of incubation (Figure 2A). This result indicates that the

linkage between drug and carrier displays adequate stability in plasma, although the drug is

released at a slow rate. PTX-HSA showed similar stability as PTX-M6PHSA (data not

shown).

Chapter 3

50


A

Figure 2. Drug release profiles of PTX-M6PHSA.

Released drug was related to the total amount of coupled PTX as determined by KSCN displacement.

A) Drug release upon incubation of PTX-M6PHSA in serum/PBS (1:1) pH 7.4 at 37°C for 7 days.

B) Release of PTX after 24h of incubation at 37°C in PBS pH 7.4, HSC culture medium, or in the

presence of thiol-containing competitors (GSH and DTT). *: p<0.05 vs PBS.

0%

20%

40%

60%

80%

100%

120%

0 1 2 3 4 5 6 7

incubation time (days)

B

0

20

40

60

80

100

120

PBS culturemedium

GSH 5mM DTT 5 mM

% o

f re

leas

ed P

TX *

**

% o

f PTX

con

juga

ted

to p

rote

in

51

Chapter 3

Since the release of PTX from the platinum is most likely due to competitive displacement

by preferred platinum ligands, such as for instance thiols, we incubated the conjugate with

DTT or GSH. Incubation with the non-physiological molecule DTT resulted in complete

release of the drug from the conjugate (Figure 2B).

The concentration of 5 mM GSH reflects conditions within a cell’s interior. GSH clearly

accelerated the release of PTX from the carrier, as compared to incubation of the

conjugate in PBS or culture medium. This result indicates that free PTX can be generated

from the conjugate inside target cells.

We also incubated PTX-M6PHSA in different buffers at either cytosolic pH (PBS 7.4) or

lysosomal pH (0.1 M sodium acetate buffer, pH 5.0). No differences were observed

between pH5 and pH7 (data not shown). This result indicates that the drug release profile

will not be affected by lysosomal pH.

Binding of PTX-M6PHSA to target cells

Since our characterization reactions revealed that ULS reacted to the thiourea-part of the

M6P groups, binding properties of M6PHSA to M6P/IGFII receptor might be perturbed

after coupling of PTX-ULS.

A

M6P receptor staining Negative control

Figure 3. PTX-M6PHSA binding to target cells.

A) M6P/IGFII Receptor expressing NIH/3T3 fibroblasts were subjected to anti-M6P Receptor

staining (red color) and hematoxillin counterstained (blue color). Note the receptor presence next to cell

nuclei. Magnification 20x.

Chapter 3

52


Cel

l-b

oun

d r

adio

acti

vity

(cp

m)

0

50

100

150

200

250

300

350

*

B

125I PTX-M6PHSA + 0,1mg/ml

M6PHSA125I-PTX-M6PHSA + 0.1mg/ml M6PHSA

125I PTX-M6PHSA 125I-PTX-M6PHSA

B) NIH/3T3 cells were incubated with a tracer dose of 125I-PTX-M6PHSA (100.000 cpm/well) in

the absence or presence of excess M6PHSA (0.1 mg/ml) were incubated for 4h at 37°C. *: p<0.05.

C) NIH/3T3 fibroblasts were incubated with PTX-HSA or PTX-M6PHSA at 1 mg/ml for 4h at

37°C, after which the cells were stained for bound products using anti-HSA antibody (red color) and

hematoxillin counterstained (blue color) Magnification 20x.

Negative control PTX-HSA

C

PTX-M6PHSA

After establishing the presence of our target receptor in a NIH/3T3 fibroblast cell line

(figure 3A), we investigated binding of PTX-M6PHSA to these target cells. The observed

binding of 125I-PTX-M6PHSA to the cells could be displaced by competition with excess

of M6PHSA (figure 3B). We therefore concluded that PTX-M6PHSA bound specifically

to the cells via to M6P/IGFII receptor. In addition, non-radiolabeled PTX-M6PHSA was

53

Chapter 3

incubated with 3T3 fibroblasts, after which we visualized binding of PTX-M6PHSA to the

cell surface by anti-HSA immunodetection (Figure 3C). While PTX-M6PHSA showed

intense positive staining, PTX-HSA did not bind to the cells. Thus, binding of PTX-

M6PHSA to target cells was mediated via the M6P homing ligands in the conjugates

Biodistribution of PTX-M6PHSA in rats with liver fibrosis

In addition to experiments with in vitro cultured target cells, we studied the biodistribution

of PTX-M6PHSA in rats with liver fibrosis. Previous studies in our group have

demonstrated that M6PHSA accumulates rapidly and efficiently in HSC within the fibrotic

livers of BDL rats (2). The initial distribution of M6PHSA could be assessed at ten

minutes after injection. In the current experiment, we observed a rapid distribution of 125I-

radiolabeled PTX-M6PHSA and 125I-radiolabeled M6PHSA to the fibrotic liver (Figure 4).

No accumulation in other organs was observed.

0%

10%

20%

%

%

%

%

%

80%

90%

BloodLive

r

SpleenLungs

KidneysHea

rt

Pancreas

thymus

Bladder

Stomach

Small Intestin

e

Large Intestin

e

Coecu

mpenis

Testis Urine

Total reco

very

PTX-M6PHSAM6PHSA

30

40

50

60

70

%of

inje

cted

Figure 4. Organ dis ribution of t 125I-PTX-M6PHSA and 125I-M6PHSA in BDL rats.

Tissue distribution of radiolabeled proteins was determined 10 min after intravenous injection of a tracer

dose (1,000,000 cpm) of the radiolabeled proteins. Total radioactivity in the organs was corrected for

blood-associated radioactivity and expressed as % of the injected dose. white bars: 125I-M6PHSA, and

black bars: 125I-PTX-M6PHSA.

Chapter 3

54


Within the fibrotic liver, PTX-M6PHSA displayed an HSC-like distribution pattern, as

demonstrated by colocalization of carrier and desmin (Figure 5). From these results we

concluded that PTX-M6PHSA quickly distributed to the liver of BDL rats, where it

specifically binds to HSC.

A B

20µm 50µm

Figure 5. Colocalization of PTX-M6PHSA with HSC in fibrotic livers of BDL

rats.

Animals were intravenously injected with 2 mg/kg of PTX-M6PHSA and sacrificed 10 min after

administration. Picture A: Double staining for HSA (red) and the HSC marker desmin (blue). Arrows

indicate colocalization of HSA and HSC. Magnification 40x. Picture B: Enlargement of picture A

(100x).

trIn vitro pharmacology of PTX-M6PHSA and con ol compounds

The pharmacological effects of PTX-M6PHSA conjugates were evaluated on activated

HSC. Since cisplatin is a well-known antitumor agent, the use of platinum(II) as a linker

may infer platinum-related toxicity into the drug targeting construct. We therefore

investigated the effects of the conjugates on cell viability and apoptosis. Cell viability

studies did not show any toxicity to the target cells after 24h treatment with PTX, PTX-

ULS or PTX-M6PHSA, in contrast to cisplatin at the same concentration (Figure 6A).

Similarly, treatment of HSC with cisplatin for 24 h induced apoptosis, as reflected in

activation of caspases 3 and 7 (Figure 6B), and the occurrence of DNA strand breaks

assessed by TUNEL staining (Figure 6C). Again, PTX, PTX-ULS and PTX-M6PHSA did

55

Chapter 3

not induce direct activation of caspases or apoptosis (Figure 6B). Quantification of the

TUNEL positive nuclei versus DAPI stained nuclei of HSC showed a significant increase

after incubation with cisplatin, but no increase when cells were incubated with PTX-

M6PHSA (Figure 6D).

One of the hallmarks of liver fibrosis is the induced production of α-smooth muscle actin

(αSMA) and collagen type 1 by activated HSC. We therefore investigated the expression

of these proteins as read-out parameters for antifibrotic effects of PTX. As can be seen in

Figure 7, activated HSC express collagen type I in a granular staining pattern in the

cytoplasm, probably reflecting the presence of procollagen type I, while αSMA stained in

a fiber-like pattern. Treatment with PTX in a concentration of 1 mM reduced the intensity

of both fibrotic markers (Figure 7G,H). Incubation of the cells for 24h with 1 mg/ml

PTX-M6PHSA, which corresponds to 100 µM conjugated PTX, affected collagen type I

expression considerably (Figure 7E). Although the αSMA-staining intensity was not

affected by PTX-M6PHSA, pronounced changes in the morphology of HSC were

observed (figure 7F). HSC reacted to the treatment of PTX-M6PHSA with a loss of

cytoplasmic volume, rounded cell shape and detachment of the cells from the surface of

the plates. These effects were not observed after incubation with equivalent

concentrations of PTX-HSA (Figure 7C,D) or FLU-M6PHSA (data not shown),

indicating that the targeted drug induced these effects.

Chapter 3

56


Discussion

In the present paper, we report on a novel drug targeting preparation for the delivery of

the antifibrotic drug PTX to HSC. Considering the important role of HSC in liver fibrosis,

intervening with stellate cell activation seems an attractive approach to counteract liver

fibrosis. We demonstrated accumulation of PTX-M6PHSA in HSC and observed

promising in vitro antifibrotic activity. Furthermore, the novel platinum-linker afforded

straightforward synthesis of conjugates that display slow-release of the coupled drug.

Over the past decades, drug delivery research has invested great efforts to find appropriate

linkage systems for the preparation of drug-carrier conjugates (20;21). Many drug

candidates however lack the appropriate functional groups for commonly applied

conjugation strategies. Although the presently investigated drug, PTX, also offers other

options for conjugation (e.g. hydrazone linkage at its keto functional group), we believe

that the ULS linker has several properties that make it a valuable technology for drug

delivery. First, ULS can be applied for conjugation of drug molecules that contain

aromatic nitrogens. Such groups are present in the chemical structure of many drug

molecules. The ULS linker can therefore facilitate conjugation of drug molecules that can

not be coupled via existing concepts. Second, synthesis of drug-ULS adducts is

straightforward and can be performed at high yields. This may enable synthesis of drug-

carrier conjugates even at low quantities of the drug. An additional advantage of ULS is

that sulfur atoms are reacted readily with the ULS linker (16;17). This provided a

convenient approach for coupling PTX-ULS to M6PHSA, since high drug:carrier ratios

were found in the final product. Lastly, the slow drug release profile is different from

existing drug-carrier conjugates. This may afford continuous drug release during a period

of days, which is not possible with existing linkages.

57

Chapter 3

A

0

20

40

60

80

100

120

control CIS-PT100µM

PTX 100µM PTX-ULS100µM

PTX-M6PHSA100µM

(1mg/ml)

*

Stel

late

Cel

l St

ella

te C

ell

viab

ilit

viab

ility

(

Ala

mar

Blu

e)

B

0

20

40

60

80

100

120

control CIS-PT 100µM PTX 100µM PTX-ULS100µM

PTX-M6PHSA100µM

(1mg/ml)

*

Cas

pas

e 3/

7 ac

tivi

ty

in %

of

RL

U

Figure 6. Effect of PTX-M6PHSA on apoptosis. HSC were incubated for 24h with cisplatin,

PTX, PTX-ULS (100 µM) or PTX-M6PHSA at a concentration of 1 mg/ml, which is equivalent to

100µM cisplatin.

Figure 6. Effect of PTX-M6PHSA on apoptosis. HSC were incubated for 24h with cisplatin,

PTX, PTX-ULS (100 µM) or PTX-M6PHSA at a concentration of 1 mg/ml, which is equivalent to

100µM cisplatin.

A) Alamar Blue viability assay. Fluorescence was corrected for background fluorescence of Alamar Blue

reagent in medium without cells *: p<0.05 vs control HSC.

A) Alamar Blue viability assay. Fluorescence was corrected for background fluorescence of Alamar Blue

reagent in medium without cells *: p<0.05 vs control HSC.

B) Caspase 3/7 activity assay using a luminescent caspase substrate. Emitted light units were normalized

relative to the signal of cisplatin treated HSC. RLU: relative light units, *: p<0.05 vs basal levels.

B) Caspase 3/7 activity assay using a luminescent caspase substrate. Emitted light units were normalized

relative to the signal of cisplatin treated HSC. RLU: relative light units, *: p<0.05 vs basal levels.

Chapter 3

58


C) Activated HSC, cisplatin or PTX-M6PHSA induced apoptosis as assayed by TUNEL staining.

Activated Stellate cells (a,b) were incubated with 100 µM cisplatin (c,d) or PTX-M6PHSA at 100

µM (e,f). Nuclei were stained with DAPI (left column) to localize the nuclei of all cells, or for TUNEL

(right column) to visualize nuclei of apoptotic cells. Cisplatin treatment induced apoptosis in almost all

cells, while PTX-M6PHSA treatment is comparable with control HSC. Magnification 10x.

C DAPI TUNEL

Apoptotic nuclei All cell nuclei

a

Control b

d CIS-PT

100 µM c

e f PTX-M6PHSA

100 µM

59

Chapter 3

D

0

20

40

60

80

100

Control CIS-PT 100µM PTX-M6PHSA100µM (1mg/ml)

*%

TU

NE

L p

osit

ive

cells

/D

AP

I

D) Quantification of TUNEL positive cells per treatment *: p<0.05 vs control HSC.

Our in vitro stability/drug-release studies indicated that the release of PTX was driven by

chemical displacement by coordinating ligands for Pt(II). Within a biological matrix, such

ligands are for instance glutathione and ligands containing sulfur atoms (e.g. methionine)

or aromatic nitrogens (nucleotides, histidines). Since platinum reacts fast with thiols but

slower with aromatic nitrogens, we think that competitive displacement by glutathione is a

very likely mechanism for drug release. At present we can only hypothesize on the fate of

the conjugate after internalization. Drug release may occur in the lysosomes, the

compartment to which M6PHSA is routed after internalization (6). Another possibility is

that drug release will occur in multiple steps, in which the albumin is degraded by

lysosomal enzymes first, followed by competitive drug release by thiols in other

intracellular compartments. Although intracellular drug release will be most likely slow,

the rapid uptake of M6PHSA by target cells within the fibrotic liver (Figure 4) will favors

intracellular release of the conjugated PTX from PTX-M6PHSA.An important concern

raised in relation to the use of platinum-derivatives is their potential cisplatin-related

toxicity. Many different platinum compounds have been investigated for their cell-killing

properties in vitro as well as in vivo (22). One generally accepted mechanism of cisplatin

toxicity involves cross-linking of DNA, leading to cell death via apoptotic or necrotic

Chapter 3

60


pathways (23). Hence, the toxicity of cisplatin and other platinum(II) compounds is

closely related to the availability of reactive ligand sites at the platina atom. Since in PTX-

M6PHSA the platinum-is fully coordinated, it can only react with endogenous compounds

after release of the drug or carrier. The platinum-ethylendiammine bridge in ULS is

considered very stable. As the release of drug (or carrier) is slow, only low concentrations

of reactive platinum are present in the target cells. Furthermore, cisplatin is readily

detoxified by binding to low-molecular weight thiols and thiol groups in proteins,

especially at lower concentrations. We expect that glutathione adducts will be the major

metabolites resulting from the linker, and we will investigate this more extensively in

future studies. Our present results demonstrate that both PTX-ULS and PTX-M6PHSA

do not produce toxic metabolites and we conclude that novel ULS linker is safe, despite

the cisplatin related structure.

PTX-M6PHSA reduced the production of collagen I notably, an effect that must be

attributed to the delivery of PTX into the HSC, since no effect was observed after

treatment with either PTX-HSA or FLU-M6PHSA. In addition, we observed striking

changes on the morphology of the cells, which were not observed after treatment with

free PTX. Although the observed changes in morphology suggest that the cells may

detach and die (anoikis), we did not observe this in our apoptosis or viability assays.

Moreover, the elimination of fibrogenic HSC by PTX-M6PHSA may be a beneficial effect

in the treatment of liver fibrosis, apart from antifibrotic effects by reducing collagen

deposition. We therefore concluded that PTX-M6PHSA is a promising candidate for

further evaluation as antifibrotic therapy.

Apart from the presently investigated conjugate, PTX-M6PHSA, ULS allows coupling of

many other antifibrotic drug candidates that contain aromatic nitrogen donor groups. In

this respect, we have investigated the delivery of the angiotensin II antagonist losartan,

which shows promising results in animal models of fibrosis and is tested clinically in

cirrhotic patients (24;25). Losartan was coupled to M6PHSA according to similar

protocols as described for PTX (Gonzalo, manuscript in preparation).

61

Chapter 3

α-SMA Collagen type I

D

G H

FE

BA

C

Figure 7. Effects of

PTX-M6PHSA on

fibrosis markers

collagen I and

α-SMA.

HSC were incubated for

24h with PTX-HSA,

PTX-M6PHSA (both at 1

mg/ml, equivalent to 100

µM PTX,) or 1 mM non-

targeted PTX. Cells were

stained for collagen type I or

α-SMA and counterstained

with hematoxillin.

A,B) Stellate cells incubated

with:

C,D) PTX-HSA;

E,F) PTX-M6PHSA;

G,H) non-targeted PTX.

Magnification 10x.

Preliminary results indicate that daily injections with losartan-M6PHSA attenuated BDL

liver fibrosis, while no toxicity was observed. Together with the presently discussed results

on PTX-M6PHSA, this indicates the potential of platinum-coordination chemistry as a

novel modality to prepare drug targeting preparations.

Chapter 3

62


Acknowledgements

We kindly acknowledge Anne-Miek van Loenen, Jan Visser, Chantal Pottgens, Hans Pol

and Jan Willem Kok for assistance in different experimental procedures. Marie Lacombe,

Jan Reedijk, Elena Pantoja, and Anne Kalayda are thanked for valuable scientific

discussions relating to the experiments.

Financial support for this project has been granted by SenterNovem (grant TSGE1083)

and by the EU Marie Curie fellowship program (grant HPMI-CT-2002-00218).

Reference List



3. Bataller,R., and Brenner,D.A. 2001. Hepatic stellate cells as a target for the treatment of liver fibrosis. Semin. Liver Dis. 21:437-451.


5. Friedman,S.L. 2003. Liver fibrosis -- from bench to bedside. J. Hepatol. 38 Suppl 1:S38-S53.

6. Beljaars,L., Olinga,P., Molema,G., De Bleser,P., Geerts,A., Groothuis,G.M.M., Meijer,D.K.F., and Poelstra,K. 2001. Characteristics of the hepatic stellate cell-selective carrier mannose 6-phosphate modified albumin (M6P28-HSA). Liver 21:320-328.

7. Beljaars,L., Molema,G., Schuppan,D., Geerts,A., De Bleser,P.J., Weert,B., Meijer,D.K.F.,

and Poelstra,K. 2000. Successful targeting of albumin to rat hepatic stellate cells using albumin modified with cyclic peptides that recognize the collagen type VI receptor. J. Biol Chem. 275:12743-12751.

8. Greupink,R., Bakker,H.I., Reker-Smit,C., van Loenen-Weemaes,A., Kok,R.J., Meijer,D.K.F., Beljaars,L., and Poelstra,K. 2005. Studies on the targeted delivery of the antifibrogenic compound mycophenolic acid to the hepatic stellate cell. J. Hepatol. x:x.


10. Windmeier,C., and Gressner,A.M. 1996. Effect of pentoxifylline on the fibrogenic functions of cultured rat liver fat-storing cells and myofibroblasts. Biochem. Pharmacol. 51:577-584.

11. Desmoulière,A., Xu,G., Costa,A.M.A., Yousef,I.M., Gabbiani,G., and Tuchweber,B. 1999. Effect of pentoxifylline on early proliferation and phenotypic modulation of fibrogenic cells in two rat models of liver fibrosis and on cultured hepatic stellate cells. J. Hepatol. 30:621-631.

12. Raetsch,C., Jia,J.D., Boigk,G., Bauer,M., Hahn,E.G., Riecken,E.-O., and Schuppan,D. 2002. Pentoxifylline downregulates profibrogenic cytokines and procollagen I expression in rat secondary biliary fibrosis. Gut 50:241-247.

63

Chapter 3

13. Chen,Y.M., Wu,K.D., Tsai,T.J., and Hsieh,B.S. 1999. Pentoxifylline inhibits PDGF-induced proliferation of and TGF-beta-stimulated collagen synthesis by vascular smooth muscle cells. J. Mol. Cell Cardiol. 31:773-783.

14. Gude,R.P., Binda,M.M., Boquete,A.L., and Bonfil,R.D. 2001. Inhibition of endothelial cell proliferation and tumor-induced angiogenesis by pentoxifylline. J. Cancer Res. Clin. Oncol. 127:625-630.

15. Krakauer,T. 2000. Pentoxifylline inhibits ICAM-1 expression and chemokine production induced by proinflammatory cytokines in human pulmonary epithelial cells. Immunopharmacology 46:253-261.

16. van Gijlswijk,R.P., Talman,E.G., Peekel,I., Bloem,J., van Velzen,M.A., Heetebrij,R.J., and Tanke,H.J. 2002. Use of horseradish peroxidase- and fluorescein-modified cisplatin derivatives for simultaneous labeling of nucleic acids and proteins. Clin. Chem. 48:1352-1359.

17. Heetebrij,R.J., Talman,E.G., Velzen,M.A., van Gijlswijk,R.P., Snoeijers,S.S., Schalk,M., Wiegant,J., Rijke,F., Kerkhoven,R.M., Raap,A.K. et al 2003. Platinum(II)-based coordination compounds as nucleic acid labeling reagents: synthesis, reactivity, and applications in hybridization assays. Chembiochem. 4:573-583.

18. Geerts,A., Niki,T., Hellemans,K., De Craemer,D., Van den Berg,K., Lazou,J.-M., Stange,G., Van de Winkel,M., and De Bleser,P.J. 1998. Purification of rat hepatic stellate cells by side scatter-activated cell sorting. Hepatol 27:590-598.

19. Gavrieli,Y., Sherman,Y., and Ben Sasson,S.A. 1992. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol. 119:493-501.

20. Soyez,H., Schacht,E., and Van Der Kerken,S. 1996. The crucial role of spacer groups in macromolecular prodrug design. Adv. Drug Deliv. Rev. 21:81-106.


22. Ho,Y.P., Au-Yeung,S.C., and To,K.K. 2003. Platinum-based anticancer agents: innovative design strategies and biological perspectives. Med. Res. Rev. 23:633-655.

23. Fuertes,M.A., Castilla,J., Alonso,C., and Perez,J.M. 2002. Novel concepts in the development f platinum antitumor drugs. Curr. Med. Chem. Anti. -Canc. Agents 2:539-551.


25. Castano,G., Viudez,P., Riccitelli,M., and Sookoian,S. 2003. A randomized study of losartan vs propranolol: Effects on hepatic and systemic hemodynamics in cirrhotic patients. Ann. Hepatol. 2:36-40.

Chapter 3

Sunset at the Golden Gate

Conference by the American Association of Study of the Liver (ASan Francisco, USA, 2005

ASLD),

Chapter4Reduction of advanced liver fi brosis by targeted delivery of the angiotensin II receptor antagonist losartan to hepatic stellate cells

Submitted for publication.

Teresa Gonzalo1, Ramón Bataller2, Pau Sancho-Bru2, Josine Swart1, Jai Prakash1, Constantino Fondevila2, Dirk K.F. Meijer1, Leonie Beljaars1, Marie Lacombe3, Paul vd Hoeven3,4, Vicente Arroyo2, Klaas Poelstra1, Pere Ginès2, Robbert J. Kok1.

1Department of Pharmacokinetics and Drug Delivery, University of Groningen, The Netherlands;

2Liver Unit, Hospital Clínic, IDIBAPS, Barcelona, Catalonia, Spain;

3Kreatech Biotechnology B.V., Amsterdam, The Netherlands; and

4Future Diagnostics BV, Wijchen, The Netherlands

66

Reduction of liver fibrosis by targeted losartan

Abstract

Liver fibrosis often progresses to cirrhosis. To date, no effective therapy

attenuates fibrosis progression in patients with chronic liver diseases. Renin-

angiotensin system inhibitors have been proposed, yet their use in patients with

advanced fibrosis may be hampered by side effects. To improve the balance

between antifibrotic and systemic effects of losartan, we have developed the liver

directed conjugate losartan-M6PHSA (M6PHSA: mannose-6-phosphate modified

human serum albumin), which accumulates in hepatic stellate cells (HSC), the

major fibrogenic cell type in liver fibrosis. Losartan was coupled to M6PHSA via

a platinum-based linker. Cell viability studies revealed that losartan-M6PHSA did

not affect the viability of the hepatic stellate cells. We evaluated the liver homing

and antifibrotic effects of losartan-M6PHSA in rats with liver fibrosis induced by

prolonged bile-duct ligation (BDL) and CCl4 inhalation model. Rats received a

total of four doses of losartan-M6PHSA, M6PHSA alone or oral losartan and

were sacrificed 10 min after the last dose to examine drug distribution. Losartan-

M6PHSA was shown to accumulate in activated HSC in fibrotic rat livers,

amounting 20% of the last administered dose. Losartan-M6PHSA, but not oral

losartan, markedly reduced hepatic collagen and TGFβ1 expression and accumulation of

myofibroblasts and inflammatory cells in the liver, as compared to saline-injected BDL

rats. We conclude that short-term treatment with losartan-M6PHSA targeted to HSC

reduces advanced liver fibrosis and may provide novel means to treat patients with

chronic liver fibrosis.

67

Chapter 4

Introduction

Hepatic fibrosis is a clinical problem for which no adequate therapy is available.

Advanced fibrosis may result in cirrhosis, which is a major cause of death in virtually all

countries(1). Recent experimental studies indicate that the renin-angiotensin system (RAS)

plays an important role in liver fibrogenesis (2). Hepatic stellate cells (HSC) are the main

fibrogenic cell type in the injured liver and are also the main target cell type for the

pathogenic effects of angiotensin II (Ang II) in liver fibrosis. In the normal human liver,

HSC do not express Ang II type 1 (AT1) receptors nor do they secrete Ang II. Following

chronic liver injury, however, HSC transform into myofibroblast-like cells and express

both AT1 receptors and generate mature Ang II, which exerts an array of pro-

inflammatory and profibrogenic actions (3;4). These pathogenic effects can be prevented

largely by AT1 receptor antagonists, as has been demonstrated in different models of

experimentally-induced liver fibrosis (5-8). Based on these data, RAS inhibitors like

Angiotensin Converting Enzyme inhibitors or Ang II receptor blockers are currently

considered as novel antifibrotic therapies to treat liver fibrosis.

AT1 receptor blockers are widely used in patients with arterial hypertension and type II

diabetes to lower blood pressure and prevent the development of cardiac and renal

fibrosis (9;10). Preliminary clinical data suggests that AT1 receptor blockers may also

attenuate liver fibrosis (11-13). The use of AT1 receptor blockers would be particularly

useful in conditions characterized by rapid fibrosis progression (i.e. acute alcoholic

hepatitis and severe hepatitis C virus reinfection after liver transplantation). However, in

these conditions, the use of angiotensin antagonists may be hampered by undesirable

effects on the arterial pressure, especially since patients with cirrhosis are generally

associated with low systemic blood pressure. Indeed, the use of the AT1 receptor blocker

losartan in patients with advanced fibrosis was associated with the development of arterial

hypotension and renal impairment (14). To overcome these limitations, we now propose

an innovative drug delivery approach. This will avoid general effects such as reduction of

blood pressure by lowering systemic drug levels and will increase the efficacy of losartan

Chapter 4

68


by achieving high concentrations in the liver. The drug delivery system applied in this

study is based on mannose 6-phosphate modified human serum albumin (M6PHSA), a

carrier that specifically delivers losartan to activated HSC (15),(16). M6PHSA binds to the

mannose-6-phosphate/insulin growth factor type II receptor (M6P/IGII-R), a surface

exposed receptor that is de novo expressed in activated HSC during liver fibrogenesis

(17). Previous studies in our group have demonstrated that drug-M6PHSA conjugates

accumulate rapidly and extensively in the fibrotic liver (18),(19).

To conjugate losartan to M6PHSA, we employed a novel type of platinum linker

chemistry called ULS (Universal Linker System) (20), which can binds losartan via a

coordinative bond at one of the aromatic nitrogen atoms in the tetrazole group of the

drug (figure 1). Application of this novel linker technology was essential for several

reasons. First, coordination chemistry proved straightforward and reliable for linking drug

molecules to the carrier, allowing high synthesis yields in a relative simple approach.

Second, the resulting drug-ULS-carrier conjugates display a unique behavior, in which

drug molecules are released slowly, during a period of days, within the designated target

cells(18). In the present paper, we now describe the pharmacokinetics of losartan-

M6PHSA and its accumulation in fibrotic livers. Furthermore, we report on the

antifibrotic effects of losartan-M6PHSA in rats subjected to bile duct ligation, a well-

characterized model of liver fibrogenesis (21). In addition, we have also evaluated

losartan-M6PHSA efficacy in the CCl4 model of liver fibrosis. Short-term treatment with

losartan-M6PHSA, but not free losartan given orally, reduced inflammation and collagen

deposition in the liver. These promising results suggest that this approach may also be

useful to treat patients with chronic liver diseases.

69

Chapter 4

Experimental protocols

Synthesis of losartan-M6PHSA

Losartan and human serum albumin (HSA) were obtained from Synfine (Ontario,

Canada) and Sanquin (Amsterdam, The Netherlands), respectively. Losartan was first

coupled to Universal Linker System (ULS, Kreatech b.v, The Netherlands), a platinum

complex that forms a co-ordinative bond with the target. Briefly,

platinum(ethylenediamine)dichloride (Pt(en)Cl2; 82.5 mg, 0.253 mmol, dissolved in 3 ml

of dimethylformamide (DMF) was converted into the more reactive Cis-

[Pt(ethylenediamine)nitrate-chloride] Pt(en(NO3)Cl by adding small aliquots of AgNO3

(38.5 mg, 0.227 mmol, dissolved in 1 ml of DMF). The precipitated silver chloride was

removed by centrifugation. The resulting cis-[Pt(ethylenediamine)nitrate-chloride]

solution (32 µmol) or ULS was added to a solution of losartan (32 µmol, 10 mg/ml of the

potassium salt of losartan in DMF). The resulting solution was heated at 60°C for 3 days

during which consumption of the starting material was monitored by analytical HPLC.

Mass spectrometry analysis confirmed the presence of the 1:1 losartan-cisULS species

after completion of the reaction.

Analysis of the product, losartan-ULS, using mass spectrometry, yielded the following

data:

1H NMR of Losartan-cisULS (CD3OD): δH 0.79 (m, 3H, CH3), 1.25 (m, 2H, CH2CH3),

1.48 (m, 2H, CH2CH2CH3), 2.50 (m, 6H, CH2CH2C and CH2NH2), 4.43 (m, 1.8H,

NCH2C), 5.18 (m, 2.2H, CH2OH and remaining NCH2C), 5.42 (m, 4H, NH2); cyclic Hs:

6.82 (m, 0.2 H), 6.87 (m, 1.8 H), 7.04 (t, J = 8.06 Hz, 1H, CHCHCH), 7.18 (m, 0.5H),

7.28 (m, 1H), 7.38 (m, 3H), 7.88 (m, 0.5 H).

195Pt NMR of Losartan-cisULS (CD3OD): Pt -2491 and -2658 ppm.

MS (ESI+) m/z: 695 [M-K+-OH--H]+, 677 [M-K+-Cl--H+]+, 659 [M-K+-Cl--H+-Cl-+OH-

]+.

Chapter 4

7


Figure 1. Characterization of losartan-M6PHSA.

(A) Synthesis of losartan-M6PHSA. Presence of Losartan-ULS was confirmed by HPLC analysis

and ion-spray mass spectrometry, which demonstrated the typical isotopic pattern of platinum compounds.

Conjugation of losartan-ULS to M6PHSA was confirmed by HPLC analysis after release of the drug

from the carrier. MonoQ anion exchange chromatography confirmed that the charge of M6PHSA

protein was not affected by losartan coupling. Size exclusion Chromatography showed the monomeric

composition of Losartan-M6PHSA at a retention time of 27 minutes. M6PHSA: mannose-6-

phosphate modified human serum albumin; ULS: Universal Linkage System.

A

N OHCl

N OHCl NH2H2N

Pt

0

NHNN

NN

NH2H2NPt

ClO3N

NHNN

NN Cl

Losartan ULS

Losartan-ULS

NHNN

NN

N OHCl NH2H2N

Pt

M6PHSAcarrier

NHNN

NN

N OHCl NH2H2N

Pt

M6PHSAcarrier

M6PHSAcarrier

Losartan-M6PHSA

M6PHSALosartan-ULS

B Ionspray MS of losartan-ULS

0

100

200

300

400

500

600

700

700 720 740 760

Sign

al (

x103

AU

)

Mass/charge ratio (m/z)

71

Chapter 4

Time (min)

0

20

40

60

80

100

0 10 20 30 40

M6PHSALosartan-M6PHSA

Size exclusion chromatography

0

500

1000

1500

2000

2500

3000

3500

9 10 11 12 13

HSAM6PHSA Losartan-M6PHSA

MonoQ anion exchange

UV

280

nm

(m

AU

)

UV

280

nm

(m

AU

)

Time (min)

(B) Effect of Losartan-M6PHSA on HSC viability. HSC were incubated for 24h with cisplatin (100

µM), M6PHSA (100 µM), Losartan (100 µM) or Losartan-M6PHSA at a concentration of 1

mg/ml, which is equivalent to 100 µM cisplatin, and cell number was determined by Alamar Blue

viability assay. Fluorescence was corrected for background fluorescence of the reagent in medium without

cells *: p<0.001 vs control HSC and losartan-M6PHSA.

0

20

40

60

80

100

120

140

HSC CIS-PT100uM

M6PHSA100uM

Losartan100uM

Losartan-M6PHSA100uM

Stel

late

cel

l via

bilit

y (A

lam

ar B

lue)

*

M6PHSA was prepared and characterized as described previously (22) and losartan-

M6PHSA was analyzed simultaneously to check that M6PHSA properties were not

modified after losartan conjugation with an anion-exchange and size exclusion analysis.

To conjugate M6PHSA to losartan-ULS, 10 mg of M6PHSA (14.3 nmol) were dissolved

in 1 ml of 20 mM tricine/NaNO3 buffer pH 8.5. Losartan-cisULS (143 nmol) was added

Chapter 4

72


in 10-fold molar excess at pH 8. The mixture was reacted overnight at 37°C, and purified

by dialysis against PBS at 4°C. The final product was sterilized by filtration and stored at -

20°C. Protein content of the conjugates was assessed by the BCA assay (Pierce, Rockford,

IL). ULS content per losartan-M6PHSA was evaluated by inductive coupled plasma –

atomic emission spectroscopy (ICP-AES) at 214.424nm and at 265.945nm with a VISTA

AX CCD Simultaneous ICP-AES (Varian, Palo Alto, USA). Standards (cisPlatinum) and

unknown samples were spiked with Yttrium as an internal standard (360.074nm). The

amount of losartan coupled to the carrier was analyzed by HPLC after competitive

displacement of the drug from the conjugate by excess of potassium thiocyanate (KSCN).

Free losartan and losartan-ULS were analyzed by reverse-phase HPLC on a Waters

system (Waters, Milford, MA, USA) equipped with an UV detector operated at 269 nm

and a thermostated column oven operated at 40°C. Elutions were performed on a

µBondapak Guard-pak C18 precolumn in combination with a 5 µm Hypersil BDS C8

column (250x4.6 mm, Thermoquest Runcorn, UK) using a mobile phase consisting of

acetonitrile/water/trifluoracetic acid (40/60/0.1, pH 2).

Cytotoxic effects of Losartan-M6PHSA on HSC

HSC were freshly isolated from rat liver and purified with 12% nycodenz gradient

centrifugation. After ten days of culture, HSC are fully activated as detected via αSMA

immunostaining (10,000 cells/well seeded in 96 well-plates, Corning Costar) and were

then incubated for 24h at 37°C in culture medium spiked with either cisplatin (100 µM),

Losartan (100 µM) or Losartan-M6PHSA (1 mg/ml based in protein concentration, 100

µM in platinum concentration). Cell viability was determined using the Alamar Blue

viability assay according to the protocol of the supplier (Serotec Ltd).

Induction of liver fibrosis in rats

BDL model

Common bile duct ligation was used to induce liver inflammation and fibrosis as

described previously (23). Either bile duct ligation or sham-operation was performed in

250 g Male Wistar rats (Harlan, Zeist, The Netherlands). Rats were anesthesized with

73

Chapter 4

isoflurane (2% isoflurane in 2:1 O2/N2O, 1 L/min) (Abbot Laboratories Ltd.,

Queensborough, UK). After midline laparotomy, the common bile duct was doubly

ligated with 4-0 silk and transsected between the two ligations. Sham operation was

performed similarly with exception of ligating and transecting the bile duct.

At days 12-15 after bile duct ligation, rats received intravenous injection of saline,

losartan-M6PHSA (3.3 mg/kg/day, corresponding to 125 µg losartan/kg), M6PHSA

alone (3.3 mg/kg/day), or orally administrated losartan (5 mg/kg/day). Ten rats were

included per group. Animals were sacrificed 10 minutes after the last injection and blood

and organ liver samples were obtained. Animal procedures were approved by the

Committee for Care and Use of Laboratory Animals of the Hospital Clínic, Barcelona.

CCl4 model

Rats (250 g, Male Wistar rats, Harlan) were subjected to CCl4 inhalation during a time

period of 8 weeks as described previously (24). At the beginning of week 9, rats received

four consecutive intravenous injections of saline or losartan-M6PHSA (8 mg/kg,

corresponding to 300 µg losartan/kg). 10 minutes after the fourth injection, animals were

sacrificed and blood and liver samples were obtained. Animal procedures were approved

by the Committee for Care and Use of Laboratory Animals of the Hospital Clínic,

Barcelona.

Serum b ochemical measurements i

i

Serum alanine aminotransferase (ALT), aspartate aminotransferase (AST) and bilirubin

levels were measured using standard enzymatic procedures by the Hospital Clinic,

Barcelona.

Analysis of losartan-M6PHSA b odistribution

The presence of losartan-M6PHSA or M6PHSA in tissue cryosections was demonstrated

by immunostaining using an anti-HSA antibody (Cappel ICN Biomedicals, Zoetermeer,

The Netherlands), as described elsewhere (37). The co-localization of losartan-M6PHSA

with HSC was assessed by double immunostaining of anti-HSA and anti-desmin (Cappel

Chapter 4

74


ICN Biomedicals, Zoetermeer, The Netherlands), a specific marker for rat HSC, as

described previously (16) and the pictures were taking by optical microscope.

For colocalization studies of losartan-M6PHSA and HSC and posterior analysis in the

confocal laser scanning microscope, the mixture of the primary antibodies rabbit anti-

HSA and mouse anti-DESMIN were detected with a mixture of FITC anti-mouse IgG

(1:100) and TRITC anti-rabbit IgG. Images were taken with a confocal laser scanning

microscopy (Leica TCS SP2 AOBS confocal laserscan microscope, Heidelberg, Germany)

equipped with an argon/krypton laser and coupled to a Leitz DM IRB inverted

microscope (Leica). Single-label images were taken sequentially at 488 and 562 nm with

the 40x objetive. Colocalization pictures were obtained by use of Adobe Photoshop.

The amount of losartan in liver tissue homogenates was analyzed by HPLC after a

liquid/liquid extraction with (HPLC)-UV method. Two different procedures were

employed to isolate losartan from tissue homogenates. The first method consisted of

direct extraction from the livers, whereas the second method comprised an additional

incubation of tissues overnight with KSCN 80ºC, in order to release losartan from the

conjugate(18), and subsequent extraction the following day. Liquid–liquid extraction of

losartan from the samples was performed using methyl butyl ether (Riedel-de Haen,

Netherlands). The extraction was performed by adding 3 ml of methyl butyl ether to

200 µl of liver homogenate sample (0.3 g liver/ml of PBS) and vortexing for 5 min. The

mixture was then centrifuged at 900 × g for 5 min and the aqueous layer was frozen in

liquid nitrogen. The upper organic layer was transferred to another borosilicate glass tube

and evaporated completely at 60 °C. The extraction procedure was repeated twice and the

total residue was reconstituted in 200 µl of mobile phase. A 10µl of the reconstituted

sample was injected into the HPLC system.

The liver homogenate samples were estimated at the sensitivity of 0.01 AUFS.

Chromatography was carried out using a C18 (C18, 5µm, 4.6x150mm) reversed-phase

column (Sunfire, Waters Inc., Milford, MA, USA) at 40ºC with an isocratic mobile phase

consisting of acetonitrile–water–trifluoroacetic acid (30:70:0.1, v/v/v; pH 2.0) at a flow

rate of 1ml/min. Drug from liver tissue was measured at 225 nm and evaluated after first

75

Chapter 4

and second method, eluting at 7.4 min. Peak-height ratios of the drug plotted in a

calibration curve were used for the quantification of losartan from the different matrixes.

E

Figure 2. Analysis of biodistribution of losartan-M6PHSA in bile duct ligated rats.

Liver sections were processed for immunohistochemistry and then stained with anti-HSA antibody (see

Experimental procedures). HSA staining was not detected in the lung (A), spleen (B), heart (C) or

kidney (D) (magnification 4x). HSA staining was absent in rats treated with saline (not shown), while it

was detected in the liver within the non-parenchymal cells of rats treated with losartan-M6PHSA (E)

(magnification 4x). Five rats were studied per group.

Quantification of collagen accumulation and infiltration by myofibroblastic

and inflammatory cells

The degree of hepatic fibrosis was estimated as the percentage of area stained with picro

Sirius Red (Sirius Red F3B, Gurr-BDH Lab Supplies, Poole, England). The amount of

Chapter 4

76


fibrogenic myofibroblasts was estimated by measuring the percentage of area stained with

anti-smooth muscle α actin (αSMA, DAKO, Carpinteria, CA). Finally, the amount of

inflammatory cells was estimated by measuring the number of cells stained with anti-

CD43 (Serotec, Oxford, United Kingdom) in 10 randomly selected high power fields per

sample. For morphometric assessment of percentage of area with positive staining, an

optic microscope (Nikon Eclipse E600) connected to a high-resolution camera (CC12

Soft-Imaging System, Münster, Germany) was used. Images were analyzed in an

automated image-analysis system (AnalySIS, Soft-Imaging System, Münster, Germany).

Images were captured following automatic white balance and light intensity equilibration

with a 40 × magnification objective and digitized as RGB 24-bit. Each optical image size

at 40x was 88752 µm2 for a 250 x 250 square pixel image, resulting in an optical

resolution of 1,42 µm2/pixel. Image reconstruction was performed using the Multiple

Image Alignment. After shading correction and interactive thresholding, the selected

positive pixels were measured. The positive area was the sum of the area of positive

pixels. The ratio was calculated as the area of positive pixels divided by the total area of

the biopsy. Results are given as percentage of positive area.

Analysis of hepatic gene expression

RNA was isolated from frozen liver samples using Trizol (Life Technologies Inc.,

Rockville, MD). Quantitative PCR was performed with pre-designed Assays-on-Demand

TaqMan probes and primer pairs for rat collagen α1 (II), transforming growth factor β1

(TGFβ1), tissue inhibitor metalloproteinase type 1 (TIMP-1) and ribosome subunit 18s

(Applied Biosystems, Foster City, CA).

Information on these Assay-on-Demand is available at:

http://myscience.appliedbiosystems.com/cdsEntry/Form/gene_expression_keyword.jsp.

TaqMan reactions were carried out in duplicate on an ABI PRISM 7900 machine (Applied

Biosystems).

77

Chapter 4

Statistical analysis

Results are expressed as the mean±s.e.m. Significance was established using t-test, two-

way ANOVA with Bonferroni's post hoc test and Mann-Whitney assay. Differences were

considered significant if P<0.05.

BA

Figure 3. Analysis of colocalization of losartan-M6PHSA within hepatic stellate

cells.

Liver sections were processed for immunohistochemistry and then stained with anti-HSA antibody (see

Experimental procedures). Losartan-M6PHSA co-localized with stellate cells in rat livers (arrows), as

assessed with double immunostaining with anti-HSA and anti-desmin (A). Analysis performed with

confocal laser microscopy verified the colocalization of anti-HSA (red fluorescence color) and anti-desmin

(green fluorescence color) in the regions colored in yellow (arrows) (magnification 40x). Five rats were

studied per group.

Chapter 4

78


Results

Synthesis and characterization of losartan-M6PHSA conjugate

i i

Losartan was conjugated to M6PHSA in two synthesis steps. After its reaction to the ULS

linker, the losartan-ULS adduct was conjugated to M6PHSA and the final high-molecular

weight product was extensively purified by dialysis (Fig. 1A). An average of seven

losartan-ULS molecules were coupled per M6PHSA, as assessed by HPLC studies and

confirmed by inductive coupled plasma – atomic emission spectroscopy (ICP-AES) (data

not shown). Conjugation of losartan to M6PHSA did not change the charge or size

features of M6PHSA, as assessed by anion-exchange chromatography and size exclusion

chromatography, respectively (Fig. 1A).

ULS is a derivative of cisplatin and since cisplatin is a well-known antitumor agent, the

use of platinum (II) as a linker may infer unwanted toxicity associated with the drug

targeting construct. We therefore studied the effect of Losartan-M6PHSA on rat HSC

that were cultured and activated in vitro. Cell viability studies did not show toxicity to the

target cells after 24h treatment with Losartan-M6PHSA, in contrast to cisplatin at the

same concentration (Figure 1B).

Pharmacok netics of losartan-M6PHSA in b le-duct ligated rats

We have previously shown that M6PHSA binds to M6P/IGFII-R, which is

predominantly expressed in activated HSC in the fibrotic liver(22). M6PHSA clearly does

not interact with hepatocytes and binds minimally other non-parenchymal cell types, such

as Kupffer cells and sinusoidal endothelial cells. In the current study, we have used this

approach to selectively deliver losartan to HSC in rats with advanced liver fibrosis

induced by bile duct ligation. The animals were administered four consecutive doses of

losartan-M6PHSA (3.3 mg/kg, corresponding to 125 µg losartan/kg) from day 12 to day

15. Control groups were treated with equivalent doses of M6PHSA (3.3 mg/kg), saline, or

free losartan orally at a dosage (5 mg/kg) that has been reported to be effective against

liver fibrosis when given for a prolonged period of time(5-8).

79

Chapter 4

We first assessed whether losartan-M6PHSA preferentially accumulates in the fibrotic rat

liver. Livers as well as other organs (lung, heart, spleen, and kidney) were stained for anti-

HSA to detect the presence of the core protein. As shown in Fig. 2A-2E, losartan-

M6PHSA was only detected in the liver, while it was not present in other organs.

Injection of the carrier alone (M6PHSA) followed a similar distribution pattern (not

shown). Since the animals had been injected with a last dose of the conjugate 10 minutes

prior to their killing, this result clearly illustrates the rapid and selective accumulation of

the product in the liver. Importantly, losartan-M6PHSA co-localized with activated HSC,

as assessed by double immunostaining with anti-HSA and anti-desmin antibodies and

verified after colocalization using fluorescence antibodies anti-HSA and anti-desmin and

detected via confocal laser microscopy (Fig. 3A-3B).

To further demonstrate the selective homing of losartan-M6PHSA to the liver, we

quantified tissue levels of losartan by HPLC. Of note, a 40-fold higher dosage was

administrated in the case of losartan itself compared to losartan-M6PHSA. The dosage of

orally administered losartan was based in previous studies referring to efficacy of

losartan(5), whereas a minor dose of losartan-M6PHSA conjugate was needed after the

efficient delivery of losartan to the HSC. Two different procedures were followed to

isolate losartan from tissue homogenates, either providing free losartan levels or detecting

the presence of conjugated losartan. Following the oral administration of losartan per se,

both analyses yielded an average tissue concentration of 12.1 µg/g liver, which

corresponded to 4% of the cumulative dose (15% of the last dose administered). In

contrast, animals that were given losartan-M6PHSA, exhibited losartan levels of 1.5 µg/g,

corresponding to at least 20% of the cumulative dose (81% of the last injected dose). As

can be appreciated from these results, losartan-M6PHSA demonstrated a preferential liver

distribution. Due to the accumulation of losartan-M6PHSA in the stellate cell, which only

constitutes a small fraction of the whole liver, drug levels in HSC are most likely even

much higher. Oral administered losartan does not show this preferential homing to HSC.

Chapter 4

80


t

Saline M6PHSA losartan-M6PHSA Oral losartanSaline M6PHSA losartan-M6PHSA Oral losartan

0

2

4

6

8

10

12

14

16

18

Sham Saline M6PHSA M6PHSA-losartan

Orallosartan

Siriu

s re

d st

aini

ng(%

pos

itive

are

a)

F

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

1.6

1.8


Oral losartan

Proc

olla

gen α1

mR

NA

(2

-∆∆

Ct ) *

#

E

#

*

Figure 4. Effect of differen treatments on the degree of liver fibrosis.

Liver sections were processed for immunohistochemistry and then processed for Sirius Red staining. Severe

bridging was observed in rats receiving saline (A), M6PHSA (B) and oral losartan (D). However, rats

treated with losartan-M6PHSA (C) showed fewer areas with collagen accumulation (magnification 4x).

(E). Quantification of the area with Sirius Red staining in liver specimens (n=10, mean± s.e.m.,

81

Chapter 4

statistical analysis: *P<0.05 vs sham; #P<0.05 vs saline, MP6PHSA and oral losartan). (F).

Quantification of the expression of procollagen α1(II) in rat livers, as assessed by quantitative RT-PCR.

(n = 10, mean±s.e.m., Mann-Whitney test between saline and drug treated groups: *P < 0.05 vs sham; #P<0.05 vs saline, MP6PHSA and oral losartan).

I J Saline 6PHSA Losartan-M

0

1

2

3

4

5

Saline M6PHSA-Losartan

Pro

colla

gen

α1

mR

NA

(2-∆∆

Ct )

0.0

0.5

1.0

1.5


*

Siri

us

Red

Sta

inin

g

( %

pos

itiv

e ar

ea)

CCl4 administration CCl4 administration

Comparing with the CCL4 model, in pictures (G) and (H) Sirius Red staining on liver sections from

CCL4 treated animals with losartan-M6PHSA showed reduction in collagen deposition compared to

control (reconstruction of liver biopsy, 16 areas, 4x magnification). (I). Quantification of the area with

Sirius Red staining in liver specimens (n=3, mean± s.e.m., statistical analysis: *P<0.05 vs saline); and

(J) quantification of the expression of procollagen α1(II) in rat livers, as assessed by quantitative RT-

PCR. (n=3, mean± s.e.m., statistical analysis: *P<0.05 vs saline).

Chapter 4

82


Short-term t eatment w th losartan M6PHSA but not oral losartan reduces

advanced liver fibrosis

r i -

Although the dosage of losartan-M6PHSA was much lower than of losartan itself, we

hypothesized that the targeting to activated HSC would render the drug more effective in

attenuating advanced liver fibrosis in rats. Previous studies have shown that after 2 weeks,

bile duct ligated rats develop profound changes in the hepatic architecture including

bridging fibrosis (23). As expected, BDL for 15 days resulted in a marked increase in

serum bilirubin and serum levels of enzymes AST and ALT, which was similar in all

treated groups (data not shown). The liver/body weight ratio increased in bile duct ligated

rats and this aspect was not affected by any treatment. These results indicated that short-

term treatment with losartan-M6PHSA or oral losartan did not protect livers from BDL-

induced hepatocellular injury.

We next investigated the degree of liver fibrosis. Following bile duct ligation, rats treated

with saline or M6PHSA alone showed severe septal fibrosis with a marked disruption of

the hepatic architecture (Fig. 4A-3B). Hepatic collagen content, as assessed by

morphometric analysis of Sirius red staining, was markedly increased in these rats as

compared to the sham group (Fig. 4E). In contrast, bile duct ligated rats treated with

losartan-M6PHSA displayed a remarkably decreased collagen deposition with less

frequent formation of bridging fibrosis (Fig. 4C). Importantly, short-term treatment with

oral losartan did not reduce histological fibrosis or the amount of collagen content (Fig.

4D). To confirm these results, hepatic procollagen α1(II) gene expression was quantified.

Procollagen α1(II) was upregulated 10-fold in bile duct ligated rats treated with saline

compared with sham-operated animals (Fig. 4F). Losartan-M6PHSA, but not oral losartan

or M6PHSA alone, reduced procollagen α1(II) by 60% in bile duct ligated rats. These

results strongly indicate that short-term treatment with losartan-M6PHSA, but not oral

losartan, is capable to reduce advanced liver fibrosis in rats with chronic cholestasis.

To further demonstrate that the antifibrotic effect of losartan-M6PHSA was not an

experimental model specific phenomenon, we tested losartan-M6PHSA in the well-

established model of CCl4-induced liver fibrosis (24). After 8 weeks of CCl4 inhalation

83

Chapter 4

initial stages of hepatic fibrosis were reached, at which stage we administered four

consecutive daily doses of losartan-M6PHSA. Both hepatic collagen content, as assessed

by morphometric analysis of Sirius red staining, and hepatic procollagen α1(II) gene

expression were reduced in rats treated with losartan-M6PHSA as compared to saline-

treated rats (Fig. 4G-H).

Mechanisms of reduced liver fibrosis in rats treated with losartan-M6PHSA

To explore the mechanisms involved in the potent therapeutic effect of losartan-

M6PHSA, we first assessed the accumulation of fibrogenic myofibroblasts in bile duct

ligated livers. These cells mostly originate from activated HSC, yet other cell types such as

portal myofibroblasts are also a source of fibrogenic cells in the bile duct ligated livers

(25). We have previously shown that Ang II induces activation and proliferation of HSC

(26). To test whether losartan-M6HSA treatment reduces the accumulation of such cells,

the number of myofibroblasts was assessed in liver specimens by morphometric

quantification of αSMA-positive cells. As shown in Figure 5A, BDL was associated with

the accumulation of abundant αSMA-positive cells in the hepatic parenchyma. These cells

accumulated around proliferating bile ducts as well as in the hepatic sinusoids (Fig. 5E).

Treatment with losartan-M6HSA, but not oral losartan or M6HSA alone, was associated

with a reduction in the accumulation of myofibroblasts (Fig. 5B-5D). Morphometric

analysis of the positive area with αSMA staining confirmed that losartan-M6PHSA

decreased the number of αSMA-positive cells (Fig. 5F). Similar results were obtained after

administration of losartan-M6PHSA to CCl4 fibrotic rats, as shown in figure 5 G-H, and

confirmed after morphometric quantification of αSMA positive cells per liver area (Fig.

5I).

Chapter 4

84



t

0

2

4

6

8

10

12

14

16


Oral losartan

αSM

A s

tain

ing

(% p

ositi

ve a

rea)

F *

#

Figure 5. Effect of different treatments on the accumula ion of myofibroblasts and

activated hepatic stellate cells, as assessed by smooth muscle α-actin expression

(αSMA).

Liver sections were processed for immunohistochemistry and then stained with anti-αSMA antibody. Rats

receiving saline (A), M6PHSA (B) or oral losartan (D) showed a marked accumulation of αSMA-

positive cells, which co-localized with areas with active fibrogenesis. However, rats treated with losartan-

M6PHSA (C) showed less quantity of αSMA-positive cells (magnification 4x). (E). High

magnification (400x) photomicrograph of a liver from a bile duct ligated rat treated with saline. αSMA

staining was detected in cells located in the sinusoids corresponding to activated hepatic stellate cells (upper

arrow) as well as in myofibroblasts around proliferating bile ducts (lower arrow).

85

Chapter 4

(F). Quantification of the area with αSMA staining in rat liver specimens (n = 10, mean±s.e.m.,

Mann-Whitney test between saline and drug treated groups:*P<0.05 vs sham; #P<0.05 vs saline,

MP6PHSA and oral losartan).

0

1

2

3

4

5

6

7


*

I

CCl4 administration

αSMA staining on liver sections from CCL4 treated animals with losartan-M6PHSA showed less

accumulation of αSMA-positive cells (H) compared to diseased animals treated with saline (G)

(reconstruction of liver biopsy, 16 areas, 4x magnification). (I). Quantification of the area with αSMA

staining in liver specimens (n=3, mean± s.e.m., statistical analysis: *P<0.05 vs saline).

Because TIMP-1 is a survival factor for activated HSC and regulates collagen degradation,

we next explored TIMP-1 hepatic gene expression by quantitative PCR. As shown in Fig.

6A, BDL resulted in approximately 10-fold increase in TIMP-1 hepatic gene expression,

which was not reduced by losartan-M6HSA nor oral losartan. Also, we explored the

hepatic expression of TGFβ1, which is a major fibrogenic cytokine that largely mediates

the fibrogenic actions of Ang II in many organs including the liver (27). Compared to

sham-operated rats, bile duct ligated rats showed a 5-fold increase in TGFβ1 gene

expression, which was reduced by 30% in rats treated with losartan-M6HSA (Fig. 6B).

Chapter 4

86


Finally, we explored whether losartan treatment diminished hepatic inflammation, which

is a major event leading to hepatic fibrosis in rats with secondary biliary cirrhosis.

Previous studies have shown that Ang II exerts pro-inflammatory effects in the liver and

that AT1 blockade reduces hepatic inflammation (28) (29). To test this hypothesis, we

quantified the infiltration of inflammatory cells (CD43-positive) in the hepatic

parenchyma by immunohistochemistry. Compared to sham-operated rats, bile duct ligated

rats showed a marked increase in the infiltration of CD43-positive inflammatory cells

(Fig. 7). This effect was blunted by treatment with losartan-M6HSA and, in to lesser

extent, by oral losartan. Overall, these results suggest that the antifibrotic effect of short-

term treatment with losartan-M6HSA may be due to removal of activated HSC, decreased

expression of TGFβ1, and attenuated hepatic inflammation.

t

0.00.20.40.60.81.01.21.41.61.82.0


Oral losartan

TIM

P-1

mR

NA

(2

-∆∆

Ct ) *

A

Figure 6. Effect of different treatments on hepatic gene expression from bile duc

ligated rats, as assessed by quantitative RT-PCR.

Rats subjected to bile duct ligation received different treatments, as specified in the figure (n = 10,

mean±s.e.m., Mann-Whitney test between saline and drug treated groups: *P<0.05 vs sham).

A. Effect of different treatments on TIMP-1 hepatic gene expression in livers from bile duct ligated rats

(n=10, mean±s.e.m., Mann-Whitney test between saline and drug treated groups: *P<0.05 vs sham).

87

Chapter 4

B

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4


Orallosartan

TGF β

1 m

RN

A

(2-∆∆

Ct ) # * #

B. Effect of different treatments on TGFβ1 hepatic gene expression in livers from bile duct ligated rats

(n=10, mean±s.e.m., Mann-Whitney test between saline and drug treated groups: *P<0.05 vs sham; #P<0.05 vs saline and M6PHSA).

Chapter 4

88


Discussion

The present study demonstrates that advanced liver fibrosis can be successfully treated by

short-term administration of an antifibrotic drug that is selectively targeted to the main

fibrogenic cell type in the liver (i.e. activated HSC). We provide evidence that the delivery

of the AT1 receptor blocker losartan to HSC reduces inflammation and collagen

deposition in two different rat models of liver fibrosis. Importantly, this novel approach

appears to be much more effective than losartan given orally, suggesting that it may be

useful for treating patients with advanced chronic liver diseases. Our data also confirm a

major role for the RAS in the pathogenesis of liver fibrosis.

To date, there is no effective therapy to treat liver fibrosis (1). In view of the high

prevalence of hepatic fibrosis and its potential lethal consequences (i.e. cirrhosis), the

development of safe and effective antifibrotic therapies is an urgent and unmet medical

need in hepatology. Such therapies should be capable of reducing the hepatic fibrogenic

response to injury, even when the causative agent cannot be removed (e.g. chronic hepatic

C not responding to antiviral therapy). Moreover, antifibrotic therapies should be well

tolerated in patients with advanced cirrhosis when used for prolonged periods of time.

Most of the antifibrotic compounds that reduce experimental liver fibrosis do not meet

these requirements (e.g. TGFβ and/or PDGF inhibitors), as they generally display serious

side-effects. The selective delivery of antifibrotic drugs to HSC may theoretically reduce

the undesirable extrahepatic effects while increasing the antifibrotic effect of a given drug.

Macromolecular carriers, such as for instance the presently applied M6PHSA, render such

an approach feasible (16). To test the efficacy of this approach, the antifibrotic compound

chosen to target HSC was an AT1 antagonist. We chose this family of drugs because there

is overwhelming evidence supporting a role for AT1 receptors in the pathogenesis of liver

fibrosis and because AT1 receptors blockers are known to reduce tissue fibrosis in organs

such the kidney and the heart (1) (30) .

The new drug conjugate Losartan-M6PHSA was successfully synthesized by first applying

a novel linker system that binds losartan via a transition-metal coordination bond at the

89

Chapter 4

platinum center to one of the nitrogens in the tetrazole ring of losartan structure. The

resulted Losartan-ULS adduct was subsequently reacted to M6PHSA carrier in a

straightforward reaction, affording an overall reaction efficiency of 70%. Traditionally, the

art of linking drugs to carrier moieties represents a complex issue to deal with (31). A key

property of our platinum linker, ULS, is that it can be applied for conjugation of many

valuable drug molecules containing aromatic nitrogens, forming a bond of intermediate

binding strength (32). The ligand-exchange behaviour of Pt compounds is quite slow,

giving them a high kinetic stability (33). Once in the target cell, ULS does have a strong

thermodynamic preference for binding to S-donor ligands, such as for instance

glutathione or sulphur containing amino acids. As the concentrations platinum in our

conjugates are orders of magnitude lower than applied in cisplatin cancer therapy, one

would predict rapid detoxification of ULS by binding to cytosolic platinophilic

ligands(18). The present HSC viability studies with losartan-M6PHSA (Fig 1B) are in

good agreement with the safety data of other drug-M6PHSA conjugates prepared with the

ULS linker(18).

The main result of the current study is that a short-term treatment with a drug selectively

targeted to HSC is capable of reducing advanced liver fibrosis. In contrast, short-term

treatment with the same drug but given orally only has minor effects. These results

suggest that the selective delivery of drugs to fibrogenic cells may increase the efficacy of

antifibrotic therapy. In previous studies assessing the antifibrotic effect of losartan in rats

with experimentally-induced fibrosis, the drug was given for long periods of time, usually

concomitantly with the initiation of liver injury (5;28;29). Although these studies yielded

positive results, the particular approach used does not really mimic the scenario in

humans. In patients with chronic diseases (e.g. chronic hepatitis C), the onset of liver

fibrosis is a slow process. In most cases, antifibrotic therapies will be initiated when the

liver fibrosis is manifest and the causative stimulus cannot be removed. It is likely that the

efficacy of antifibrotic drugs in this setting is not optimal.

Different mechanisms may explain the strong antifibrotic effect achieved with our drug-

targeting construct. First, targeting losartan to the HSC via the modified albumin,

M6PHSA, increases the fraction of the dose that accumulates within the fibrogenic cells.

Chapter 4

90


M6PHSA distributes rapidly and extensively (about 60% of the injected dose) to the liver.

After four administrations of losartan-M6PHSA, losartan levels in the liver accounted for

20% of the cumulative dose, revealing the efficiency of the targeting strategy. We also

showed that M6PHSA mainly distributes to activated HSC located around the hepatic

sinusoid. In contrast, we found 4% of the total dose in the liver after orally administration

of losartan per se, which is in agreement with its distribution over the total body. On the

other hand, the concentrations of losartan in the liver after conventional oral treatment,

which was given in a 40-fold higher dose were higher than after the targeted treatment.

Yet, the antifibrogenic effect of the oral treatment was much lower. Thus, the observed

effects of losartan-M6PHSA cannot be attributed to higher concentrations of losartan per

se, but must be due to the sustained release of the drug in time, or to the subcellular

accumulation within the liver.

Secondly, the activity of losartan-M6PHSA may be enhanced by the specific interaction

that M6PHSA provides. The M6P/IGFII receptor participates in the activation of latent

TGFβ1, which may be affected by M6PHSA (17). The finding that treatment with

M6PHSA alone did not affect fibrosis or inflammation in bile duct ligated rats however,

does not support this hypothesis. Thirdly, we show that targeted losartan rapidly reduces

the accumulation of activated HSC in the fibrotic liver, which is considered a main driven

force in liver fibrogenesis. This is consistent with previous reports showing that Ang II is

a powerful mitogenic agonist for HSC (4). In addition, targeted losartan decreased the

expression of TGFβ1, which is considered the main fibrogenic factor in the liver (34).

This result suggests that locally generated Ang II stimulates TGFβ1 expression in the

liver, similarly to what occurs in other organs such as the kidney (35).

And finally, targeted losartan strongly attenuated infiltration of inflammatory cells in the

liver. This effect was also observed in rats treated with oral losartan, yet to a lesser extent.

This finding may be relevant, since inflammatory cells play a major role in liver

fibrogenesis by releasing fibrogenic cytokines and by directly interacting with HSC (36).

This latter effect is consistent with previous reports showing that Ang II exerts pro-

inflammatory actions both in cultured cells and in vivo (4;23).

91

Chapter 4


i

E

0

5

10

15

20

25


Orallosartan

CD

43 s

tain

ing

(pos

itive

cel

ls/fi

eld)

**

Figure 7. Effect of different treatments on the infiltration of inflammatory cells in

the hepatic parenchyma, as assessed by CD43 express on.

Rats subjected to bile duct ligation received different treatments, as specified in the figure. Liver sections

were processed for immunohistochemistry and then stained with anti-CD43. Rats receiving saline (A) or

M6PHSA (B) showed intense infiltration by CD43-positive cells (arrows). Treatment with losartan-

M6PHSA (C), an in a lesser extent, or oral losartan (D), induced a reduction in the number of CD43

infiltrating leukocytes (magnification 4x). E. Quantification of the number of positive cells in 20

randomly chosen high power fields (n=20, mean±s.e.m., Mann-Whitney test between saline and drug

treated groups: *P<0.05 vs saline and M6PHSA)

Chapter 4

92


Our results potentially have implications for the treatment of liver fibrosis. Firstly, we

provide evidence that short-term treatment with a highly active oral compound -losartan-

is capable to attenuate the inflammatory response but it is not strong enough to reduce

liver fibrosis. Therefore, the current assumption that Ang II blockers are highly effective

in attenuating experimental liver fibrosis should be tempered. Second, our results support

the current research to develop innovative systems to deliver fibrogenic drugs to HSC.

This approach would be particularly useful in conditions with rapidly aggressive hepatic

fibrosis (e.g. acute alcoholic hepatitis) in which the use of AT1 receptors blockers may

induce undesirable side effects. Finally, our results indicate the possibility to use drugs

known to attenuate portal pressure in the treatment of patients with acute complications

due to portal hypertension (e.g. acute variceal bleeding). In these patients, the use of oral

losartan is precluded by the development of arterial hypotension, or even hypotensive

shock syndrome (14). Further studies should investigate whether the use of losartan

targeted to HSC lowers portal pressure without reducing systemic arterial pressure.

In conclusion, by using a new platinum-based linker, we successfully coupled losartan to

M6PHSA, a carrier capable to deliver drugs to activated HSC in the fibrotic rat liver. We

provide evidence that the beneficial effects of losartan in liver fibrosis are greatly

enhanced when the drug is selectively targeted to HSC. Importantly, losartan-M6PHSA

was effective in reducing liver fibrosis in two independent experimental models of liver

fibrosis. Further studies should explore whether this novel biopharmaceutical approach is

feasible and safe in patients with liver fibrosis.

93

Chapter 4

Acknowledgements

This study was supported by grants from SenterNovem (TSGE1083), NWO Science

Netherlands (R 02-1719, 98-162), the Ministerio de Ciencia y Tecnología, Dirección

General de Investigación (SAF2005), and from the Instituto de Salud Carlos III

(CO3/02). We thank Montserrat Moreno and Anna Planagumà for their kind help in

animal handling and Elena Juez and Cristina Millan (Hospital Clínic, Barcelona, Spain) for

their excellent technical support. We also thank the department of Pharmaceutical

Analysis (University of Groningen, The Netherlands) for the losartan-ULS mass

spectrometry analysis. Jan Visser (University of Groningen, The Netherlands) is kindly

acknowledged for assistance in HPLC analysis. Klaas Sjollema and Michel Meijer are also

acknowledged for their kind assistance with the confocal pictures at the UMCG

Microscopy and Imaging Center.

Chapter 4

94


Reference list


2. Bataller,R., Sancho-Bru,P., Gines,P., and Brenner,D.A. 2005. Liver fibrogenesis: a new role for the renin-angiotensin system. Antioxid. Redox. Signal. 7:1346-1355.


4. Bataller,R., Sancho-Bru,P., Gines,P., Lora,J.M., Al Garawi,A., Sole,M., Colmenero,J., Nicolas,J.M., Jimenez,W., Weich,N., Gutierrez-Ramos, J.C., Arroyo, V., and Rodes, J. 2003. Activated human hepatic stellate cells express the renin-angiotensin system and synthesize angiotensin II. Gastroenterology 125:117-125.

5. Croquet,V., Moal,F., Veal,N., Wang,J., Oberti,F., Roux,J., Vuillemin,E., Gallois,Y., Douay,O., Chappard,D. et al 2002. Hemodynamic and antifibrotic effects of losartan in rats with liver fibrosis and/or portal hypertension. J. Hepatol. 37:773-780.

6. Paizis,G., Gilbert,R.E., Cooper,M.E., Murthi,P., Schembri,J.M., Wu,L.L., Rumble,J.R., Kelly,D.J., Tikellis,C., Cox,A. et al 2001. Effect of angiotensin II type 1 receptor blockade on experimental hepatic fibrogenesis. J. Hepatol. 35:376-385.



9. Burnier,M., and Zanchi,A. 2006. Blockade of the renin-angiotensin-aldosterone system: a key therapeutic strategy to reduce renal and cardiovascular events in patients with diabetes. J. Hypertens. 24:11-25.

10. Sica,D.A., Gehr,T.W., and Ghosh,S. 2005. Clinical pharmacokinetics of losartan. Clin. Pharmacokinet. 44:797-814.

11. Rimola,A., Londono,M.C., Guevara,G., Bruguera,M., Navasa,M., Forns,X., Garcia-

Retortillo,M., Garcia-Valdecasas,J.C., and Rodes,J. 2004. Beneficial effect of angiotensin-blocking agents on graft fibrosis in hepatitis C recurrence after liver transplantation. Transplantation 78:686-691.

12. Sookoian,S., Fernandez,M.A., and Castano,G. 2005. Effects of six months losartan administration on liver fibrosis in chronic hepatitis C patients: a pilot study. World J. Gastroenterol. 11:7560-7563.

13. Yokohama,S., Yoneda,M., Haneda,M., Okamoto,S., Okada,M., Aso,K., Hasegawa,T., Tokusashi,Y., Miyokawa,N., and Nakamura,K. 2004. Therapeutic efficacy of an angiotensin II receptor antagonist in patients with nonalcoholic steatohepatitis. Hepatology 40:1222-1225.


15. Beljaars,L., Meijer,D.K., and Poelstra,K. 2002. Targeting hepatic stellate cells for cell-specific treatment of liver fibrosis. Front Biosci. 7:e214-e222.

16. Beljaars,L., Molema,G., Weert,B., Bonnema,H., Olinga,P., Groothuis,G.M.M., Meijer,D.K.F., and Poelstra,K. 1999. Albumin modified with mannose 6-phosphate: A potential carrier for selective delivery of antifibrotic drugs to rat and human hepatic stellate cells. Hepatology 29:1486-1493.

17. De Bleser,P.J., Jannes,P., Van Buul-Offers,S.C., Hoogerbrugge,C.M., Van Schravendijk,C.F.H., Niki,T., Rogiers,V., Van den Brande,J.L., Wisse,E., and Geerts,A. 1995. Insulinlike growth factor-II/mannose 6-phosphate receptor is expressed on CCl4-exposed rat fat-storing cells and facilitates activation of latent transforming growth factor-b in cocultures with sinusoidal endothelial cells. Hepatology 21:1429-1437.

18. Gonzalo,T., Talman,E.G., van,d., V, Temming,K., Greupink,R., Beljaars,L., Reker-Smit,C., Meijer,D.K., Molema,G., Poelstra,K., and Kok,R.J. 2006. Selective targeting of pentoxifylline to hepatic stellate cells using a novel platinum-based linker technology. J. Control Release 111:193-203.

19. Greupink,R., Bakker,H.I., Reker-Smit,C., van Loenen-Weemaes,A.M., Kok,R.J., Meijer,D.K., Beljaars,L., and Poelstra,K. 2005. Studies on the targeted delivery of the antifibrogenic compound mycophenolic acid to the hepatic stellate cell. J. Hepatol. 43:884-892.

95

Chapter 4


21. Paizis,G., Cooper,M.E., Schembri,J.M., Tikellis,C., Burrell,L.M., and Angus,P.W. 2002. Up-regulation of components of the renin-angiotensin system in the bile duct-ligated rat liver. Gastroenterology 123:1667-1676.


23. Bataller,R., Gabele,E., Parsons,C.J., Morris,T., Yang,L., Schoonhoven,R., Brenner,D.A., and Rippe,R.A. 2005. Systemic infusion of angiotensin II exacerbates liver fibrosis in bile duct-ligated rats. Hepatology 41:1046-1055.

24. Claria J, and Jimenez,W. 1999. Renal dysfunction and ascites in carbon tetrachloride-induced liver cirrhosis in rats. Pathogenesis, diagnosis and treatment. V.Arroyo, Gines,P., Rodes,J., and Schrier,R., editors. Blackwell Science Inc. Malden.M; USA. USA. 379-396.

25. Magness,S.T., Bataller,R., Yang,L., and Brenner,D.A. 2004. A dual reporter gene transgenic mouse demonstrates heterogeneity in hepatic fibrogenic cell populations. Hepatology 40:1151-1159.

26. Bataller,R., Gabele,E., Schoonhoven,R., Morris,T., Lehnert,M., Yang,L., Brenner,D.A., and Rippe,R.A. 2003. Prolonged infusion of angiotensin II into normal rats induces stellate cell activation and proinflammatory events in liver. Am. J. Physiol Gastrointest. Liver Physiol 285:G642-G651.

27. Ishizaka,N., Saito,K., Noiri,E., Sata,M., Ikeda,H., Ohno,A., Ando,J., Mori,I., Ohno,M., and Nagai,R. 2005. Administration of ANG II induces iron deposition and upregulation of TGF-beta1 mRNA in the rat liver. Am. J. Physiol Regul. Integr. Comp Physiol 288:R1063-R1070.

28. Wei,Y.H., Jun,L., and Qiang,C.J. 2004. Effect of losartan, an angiotensin II antagonist, on hepatic fibrosis induced by CCl4 in rats. Dig. Dis. Sci. 49:1589-1594.

29. Yang,Y.Y., Lin,H.C., Huang,Y.T., Lee,T.Y., Hou,M.C., Lee,F.Y., Liu,R.S., Chang,F.Y., and Lee,S.D. 2002. Effect of 1-week losartan

administration on bile duct-ligated cirrhotic rats with portal hypertension. J. Hepatol. 36:600-606.

30. Gross,O., Schulze-Lohoff,E., Koepke,M.L., Beirowski,B., Addicks,K., Bloch,W., Smyth,N., and Weber,M. 2004. Antifibrotic, nephroprotective potential of ACE inhibitor vs AT1 antagonist in a murine model of renal fibrosis. Nephrol. Dial. Transplant. 19:1716-1723.


32. Heetebrij,R.J., Talman,E.G., Velzen,M.A., van Gijlswijk,R.P., Snoeijers,S.S., Schalk,M., Wiegant,J., Rijke,F., Kerkhoven,R.M., Raap,A.K., Tanke, H.J., Reedijk, J., and Houthoff, H.J. 2003. Platinum(II)-based coordination compounds as nucleic acid labeling reagents: synthesis, reactivity, and applications in hybridization assays. Chembiochem. 4:573-583.


34. Qi,Z., Atsuchi,N., Ooshima,A., Takeshita,A., and Ueno,H. 1999. Blockade of type beta transforming growth factor signaling prevents liver fibrosis and dysfunction in the rat. Proc. Natl. Acad. Sci. U. S. A 96:2345-2349.

35. Huang,Y., Wongamorntham,S., Kasting,J., McQuillan,D., Owens,R.T., Yu,L., Noble,N.A., and Border,W. 2006. Renin increases mesangial cell transforming growth factor-beta1 and matrix proteins through receptor-mediated, angiotensin II-independent mechanisms. Kidney Int. 69:105-113.

36. Marra,F. 2002. Chemokines in liver inflammation and fibrosis. Front Biosci. 7:d1899-d1914.

37. Beljaars,L., Poelstra,K., Molema,G., and Meijer,D.K.F. 1998. Targeting of sugar- and charge-modified albumins to fibrotic rat livers: the accessibility of hepatic cells after chronic bile duct ligation. J. Hepatol. 29:579-588

Chapter 4

Koh Pha Ngan

Thailand, September 2004

Chapter5Accumulation in hepatic stellate cells and antifi brotic eff ect of losartan-M6PHSA in the CCL4 model of induced liver fi brosis

Manuscript in preparation.

Teresa Gonzalo1, Ramón Bataller2, Pau Sancho-Bru2, Dirk K.F. Meijer1, Leonie Beljaars1, Marie Lacombe3, Frank Opdam3, Vicente Arroyo2, Klaas Poelstra1, Pere Ginès2, Robbert J. Kok1,4.

1Department of Pharmacokinetics and Drug Delivery, University of Groningen, The Netherlands.

2Liver Unit, Hospital Clínic, IDIBAPS, Barcelona, Catalonia, Spain.

3Kreatech Biotechnology B.V., Amsterdam, The Netherlands.

and 4Department of Pharmaceutics, Utrecht University, The Netherlands.

98

Losartan-M6PHSA in CCL4 model of liver fibrosis

Abstract

The renin-angiotensin system (RAS) plays a fundamental role in liver fibrogenesis and

hence the use of losartan is proposed as an attractive antifibrotic strategy. However, the

use of RAS blockers can worsen the development of systemic hypotension associated with

liver fibrosis. To avoid the systemic interactions of losartan and improve its liver

accumulation, we have developed losartan-M6PHSA, a drug targeting preparation that

selectively accumulates in hepatic stellate cells (HSC), the main fibrogenic cell type in liver

fibrosis. We investigated the liver accumulation of losartan-M6PHSA and its antifibrotic

effects in the carbon tetrachloride (CCL4) model of rat liver fibrosis. After 9 weeks of

CCL4 inhalation, rats were treated with four daily doses of losartan-M6PHSA (8mg/kg,

containing 0.3 mg losartan/kg), free losartan (0.3mg/kg) or M6PHSA carrier alone

(8mg/kg). Expression of M6P/IGF II target receptors and accumulation of losartan-

M6PHSA in the fibrotic liver were confirmed immunohistochemically. We determined

losartan levels in the liver by HPLC, demonstrating a liver accumulation of 13.2 ±6.4% vs.

5.4±0.2% of the cumulative dose for losartan-MPHSA and free losartan, respectively, at

10 minutes after the last dose. Hepatic collagen deposition, as assessed by morphometric

analysis of Sirius red staining, was markedly lower in rats treated with losartan-M6PHSA

whereas treatment with losartan alone had no effect (p<0.05) Accumulation of α-smooth

muscle actin-positive cells was reduced in rats treated with M6PHSA-losartan or losartan

(p<0.05), but not after treatment with M6PHSA carrier. Finally, losartan-M6PHSA and

losartan reduced procollagen α1(II) gene expression by 80% and 70%, respectively. We

conclude that losartan acts as a potent antifibrogenic drug in the CCL4 model of liver

fibrosis, and that targeting of losartan to HSC strongly potentiates its effects.

99

Chapter 5

Introduction

Hepatic fibrosis is a dynamic process caused by chronic liver injury due to various inciting

stimuli including viral hepatitis (especially hepatitis B and C), alcohol abuse, obesity,

toxins, autoimmune attack of hepatocytes or bile duct epithelium, metabolic disease, or

congenital abnormalities (1;2). Advanced liver fibrosis eventually results in cirrhosis, which

represent a huge and global healthcare burden and a major cause of death (3).

Consequently, there is an urgent need for antifibrotic therapies that can retard or reverse

the ongoing fibrogenic processes in the liver.

Hepatic stellate cells (HSC) are considered as the main collagen-producing cells in the

injured liver, and key fibrogenic factors have been identified in HSC (4). In recent years

the renin-angiotensin system (RAS) was found to play a major role. Angiotensin II (Ang

II) mediated myofibroblast proliferation, infiltration of inflammatory cells, and

extracellular matrix (ECM) deposition (5-7). Neither in the normal human liver, HSC do

not express Angiotensin II type 1 (AT1) receptors nor secrete angiotensin II (Ang II).

During chronic liver injury, however, activated HSC express functional angiotensin

receptors and generate mature Ang II, which can activate the profibrogenic processes in

an autocrine or paracrine manner (8;9). The biological effects of Ang II in cultured human

and rodent HSC can be prevented by preincubation of HSC with angiotensin receptor

antagonists (8). Several studies in different models of liver fibrosis have established that

treatment with compounds that block RAS activity ameliorate experimentally induced

liver fibrosis (10-12). Therefore, inhibition of RAS system may be a relevant strategy to

prevent fibrosis progression during chronic liver diseases (13). The angiotensin receptor

antagonist Losartan has been proposed as a potential candidate to be tested in clinical

trials in patients suffering rapid progression of liver fibrosis (i.e. acute alcoholic hepatitis

and severe hepatitis C virus reinfection after liver transplantation) (14). However, patients

with advanced cirrhosis and activation of the systemic RAS show hypotension or reduced

systemic blood pressure. In this situation, it is dangerous to apply antihypertensive agents

because it can cause a further decrease in arterial pressure and renal impairment. Specific

Chapter 5

100


targeting of losartan to activated HSC in the fibrotic liver might circumvent this

compromised situation. Such a liver-selective therapeutic drug would increase losartan

concentrations locally in the fibrotic liver, especially in activated HSC, whereas the low

drug concentrations in other organs may not elicit adverse systemic effects such as

reduction of blood pressure.

Table 1. Characterization and structure of losartan-M6PHSA.

Conjugate

synthesis ratio

losartan-ULS : protein

coupling ratio

losartan : protein¶

coupling ratio

ULS : protein§

losartan-M6PHSA

10:1

7 : 1 (±1.9)

7 : 1 (±2.7)

¶ Losartan coupling ratio was determined by HPLC after competitive displacement of the drug by excess of

potassium thiocyanate with KSCN at 80°C for 24h. § Universal Linkage System (ULS) coupling ratio

was determined by atomic emission spectroscopy (ICT-AES). These values were obtained from three

independent losartan-M6PHSA synthesized conjugates. M6P: mannose-6-phosphate; HSA: human

serum albumin; ULS: Universal linkage system.

Schematic structure of losartan-M6PHSA.

NKNN

NN

N OHCl

PtNH2H2N

M6PHSA carrier

101

Chapter 5

In recent years, the HSC-selective drug carrier mannose 6-phosphate modified human

serum albumin (M6PHSA) was developed (15). After systemic administration, M6PHSA

binds to surface-exposed M6P/IGFII receptors, which are de novo expressed in activated

HSC during liver fibrosis. In the present study, we investigated the expression of the

M6P/IGFII target receptors in the CCL4 inhalation model of rat liver fibrosis. Expression

of the M6P/IGFII receptor has been described in the first stages (hours) during acute

liver injury (16), but little is known about its expression during the slow and ongoing

disease progression. Furthermore, we assessed the accumulation of losartan-M6PHSA in

the CCL4-fibrotic livers and studied whether losartan-M6PHSA is more effective than

non-targeted losartan in attenuating the fibrogenic process.

Chapter 5

102



Synthesis of osartan-M6PHSA l

Losartan and human serum albumin (HSA) were obtained from Synfine (Ontario, Canada)

and Sanquin (Amsterdam, The Netherlands), respectively. Losartan was first coupled to

Universal Linker System (ULS™) (Kreatech Biotechnology, Amsterdam, The

Netherlands), a platinum complex that forms a co-coordinative bond with the protein

backbone (17). Briefly, cis-platinum(ethylenediamine)nitrate-chloride (cis-Pt(en)NO3Cl,

from now on referred to as ULS) was prepared by treating cis-Pt(en)dichloride with 0.9

equivalent of AgNO3 (18). The resulting solution of ULS (32 µmol in DMF) was added to

a solution of losartan (32 µmol, 10 mg/ml of the potassium salt of losartan in DMF), and

the mixture was heated at 60°C for 3 days during which consumption of the starting drug

was monitored by analytical HPLC. Mass spectrometry analysis confirmed the presence of

the 1:1 losartan-ULS adducts after completion of the reaction.

Analysis of the product, losartan-ULS, using mass spectrometry, yielded the following

data:

1H NMR of Losartan-ULS (CD3OD): δH 0.79 (m, 3H, CH3), 1.25 (m, 2H, CH2CH3), 1.48

(m, 2H, CH2CH2CH3), 2.50 (m, 6H, CH2CH2C and CH2NH2), 4.43 (m, 1.8H, NCH2C),

5.18 (m, 2.2H, CH2OH and remaining NCH2C), 5.42 (m, 4H, NH2); cyclic Hs: 6.82 (m,

0.2 H), 6.87 (m, 1.8 H), 7.04 (t, J = 8.06 Hz, 1H, CHCHCH), 7.18 (m, 0.5H), 7.28 (m,

1H), 7.38 (m, 3H), 7.88 (m, 0.5 H).

195Pt NMR of Losartan-ULS (CD3OD): -2491 and -2658 ppm.

MS (ESI+) m/z: 695 [M-K+-OH--H]+, 677 [M-K+-Cl--H+]+, 659 [M-K+-Cl--H+-Cl-+OH-

]+.

M6PHSA was prepared and characterized as described previously (19). To conjugate

M6PHSA to losartan-ULS, 10 mg M6PHSA (14.3 nmol) was dissolved in 1 ml of 20 mM

tricine/NaNO3 buffer pH 8.5.

103

Chapter 5

SHAM

group

CCL4

+ control

saline

CCL4

+losartan-

M6PHSA

CCL4

+ IV

losartan

CCL4

+M6PHSA

Number of rats 5 3 3 3 3

Body weight (g) 472.17± 17.8 375.3 ± 29.8 379.7 ± 4.5 367.3 ± 28.4 396.7 ± 48.6

Administration route

----- IV IV IV IV

Equivalent

losartan

----- ----- 0.3 mg/kg 0.3 mg/kg ----- Dosage

Equivalent protein

----- ------ 8 mg/kg ----- 8 mg/kg

Liver/body ratio

(g/g)

0.037 ±

0.003

0.034 ±

0.001

0.036 ±

0.004

0.037 ±

0.002

0.038 ±

0.004

Bilirubin (umol/l)

0.1 ± 0.06 0.2 ± 0.01 0.3 ± 0.2 0.2 ± 0.01 0.2 ± 0.01

AST (U/l) 67.8 ± 12.28 122.3 ± 8.4 117.3 ± 24.5 121.0 ± 11.4 97.3 ± 10.1

ALT (U/l) 54.5 ± 10.0 94.3 ± 8.5 75.0 ± 14.0* 101.0 ± 12.7 67.3 ± 8.0

Table 2. Dosage regimens, animal data and fibrotic parameters

Data are shown as mean ± SD.CCL4, carbon tetrachloride ; AST, aspartate aminotransferase. ALT, Alanin aminotransferase. * p< 0.05 vs Losartan.

Chapter 5

104


Losartan-ULS (143 nmol) was added in 10-fold molar excess at pH 8. The mixture was

reacted overnight at 37°C, and purified by dialysis against PBS at 4°C. The final product

was sterilized by filtration and stored at -20°C. Protein content of the conjugates was

assessed by the BCA assay (Pierce, Rockford, IL). The amount of losartan coupled to the

carrier was analyzed by HPLC after competitive displacement of the drug from the

conjugate by excess of potassium thiocyanate (KSCN) as described before (20). ULS

content per losartan-M6PHSA conjugate was evaluated by inductive coupled plasma –

atomic emission spectroscopy (ICP-AES) at 214.424nm and at 265.945 nm with a VISTA

AX CCD Simultaneous ICP-AES (Varian, Palo Alto, USA). Standards (cisPlatinum) and

unknown samples were spiked with Yttrium as an internal standard (360.074 nm).

Free losartan and losartan-ULS were analyzed by reverse-phase HPLC on a Waters system

(Waters, Milford, MA, USA) equipped with an UV detector operated at 269 nm and a

thermostated column oven operated at 40°C. Elutions were performed on a µBondapak

Guard-pak C18 precolumn in combination with a 5 µm Hypersil BDS C8 column

(250x4.6 mm, Thermoquest Runcorn, UK) using a mobile phase consisting of

acetonitrile/water/trifluoracetic acid (40/60/0.1, pH 2).

Evaluation of losartan-M6PHSA in the CCL4 inhalation model of liver fibrosis

The liver fibrosis model of CCL4 inhalation was used to induce liver inflammation and

fibrosis as described previously (21) in 250 g Male Wistar rats (Harlan, Zeist, The

Netherlands). Rats were subjected to CCl4 inhalation during 8 weeks and and

phenobarbital administration in drinking water (0.3g/l).

In the 9th week, rats were treated with four consecutive daily intravenous injections of

saline, losartan-M6PHSA (8 mg/kg, corresponding to 0.3 mg losartan/kg), M6PHSA

alone (8 mg/kg), or free of losartan (0.3 mg losartan/kg). Compounds were administered

under anesthesia with isoflurane (2% isoflurane in 2:1 O2/N2O, 1 L/min) (Abbot

Laboratories Ltd., Queensborough, UK). Ten minutes after the last injection, animals

were sacrificed and blood and liver samples were obtained. Animal procedures were

approved by the Committee for Care and Use of Laboratory Animals of the Hospital

Clínic, Barcelona.

105

Chapter 5

Serum b ochemical measurements i

i

Serum alanine aminotransferase (ALT), aspartate aminotransferase (AST) and bilirubin

levels were measured using standard enzymatic procedures by the Hospital Clinic,

Barcelona.

Presence of M6P/IGFII receptor in CCL4 induced fibrotic livers

The presence of M6P/IGFII receptor was demonstrated by immunostaining on frozen

liver sections (4µM) using an anti-M6P/IGFII antibody (K-21, sc-14413, IGF-II R, Goat

polyclonal IgG, Santa Cruz Biotechnology) (19).

Analysis of losartan-M6PHSA b odistribution

The presence of losartan-M6PHSA or M6PHSA was demonstrated by immunostaining

using an anti-HSA antibody (Cappel ICN Biomedicals, Zoetermeer, The Netherlands), as

described elsewhere (22). The co-localization of losartan-M6PHSA with HSC was

assessed by double immunostaining of anti-HSA and anti-desmin (Sigma), a specific

marker for rat HSC, as described previously (23).

Figure 1. Detection of M6P/IGF II receptor in rat liver with hepatic fibrosis

induced by CCl4 inhalation. A. General view, magnification of 20x, B. M6P/IFGII receptor

staining in a sinusoidal pattern, magnification of 40x.

Chapter 5

106


The amount of losartan in liver tissue homogenates (0.3 g liver/ml of PBS, prepared by

Turrax homogenization) was analyzed by HPLC-UV methods. Two different procedures

were employed to extract losartan from tissue homogenates. The first method consisted in

direct extraction of losartan from liver homogenates, whereas with the second method the

extraction of losartan was preceded by the incubation of tissues overnight with KSCN

80ºC, in order to release losartan from the conjugate (24), and subsequent liquid–liquid

extraction of losartan using methyl butyl ether (Riedel-de Haen, Netherlands). The

extraction was performed by adding 3 ml of methyl butyl ether to 200 µl of liver

homogenate and vortexing for 5 min. Layers were separated by centrifugation at 900 × g

for 5 min and the aqueous layer was frozen in liquid nitrogen. The upper organic layer was

transferred to another borosilicate glass tube and evaporated completely at 60 °C. The

extraction procedure was repeated twice and the total residue was reconstituted in 200 µl

of mobile phase. Ten µl of the reconstituted sample was injected into the HPLC system.

The liver homogenate samples were analyzed at the sensitivity of 0.01 AUFS.

Chromatography was carried out using a C18 (C18, 5µm, 4.6x150mm) reversed-phase

column (Sunfire, Waters Inc., Milford, MA, USA) at 40ºC with an isocratic mobile phase

consisting of acetonitrile–water–trifluoroacetic acid (30:70:0.1, v/v/v; pH 2.0) at a flow

rate of 1ml/min. Losartan concentration in liver tissue was measured at 225 nm at a

retention time of 7.4 min. Peak-height ratios of the drug plotted in a standard calibration

curve were used for the quantification of losartan from the different matrixes.

Quantification of collagen accumulation and detec ion of activated

myofibroblast cells

t

Hepatic collagen deposition was estimated by assessment of the percentage of area stained

with picro Sirius Red on paraffin-embedded liver sections (Sirius Red F3B, Gurr-BDH

Lab Supplies, Poole, England). The amount of fibrogenic myofibroblasts was estimated by

measuring the percentage of area stained with anti-smooth muscle-α actin on paraffin-

embedded liver sections (αSMA, DAKO, Carpinteria, CA). For morphometric assessment

of percentage of area with positive staining, an optic microscope (Nikon Eclipse E600)

connected to a high-resolution camera (CC12 Soft-Imaging System, Münster, Germany)

107

Chapter 5

was used. Images were analyzed with an automated image-analysis system (AnalySIS, Soft-

Imaging System, Münster, Germany). Images were captured following automatic white

balance and light intensity equilibration with a 40 × magnification objective and digitized

as RGB 24-bit. Each optical image size at 40x was 88752 µm2 for a 250 x 250 square pixel

image, resulting in an optical resolution of 1,42 µm2/pixel. Image reconstruction was

performed using the Multiple Image Alignment. After shading correction and interactive

thresholding, the selected positive pixels were measured. The positive area was the sum of

the area of positive pixels. The ratio was calculated as the area of positive pixels divided by

the total area of the biopsy. Results are given as percentage of positive area.


RNA was isolated from frozen liver samples using Trizol (Life Technologies Inc.,

Rockville, MD). Quantitative PCR was performed with pre-designed Assays-on-Demand

TaqMan probes and primer pairs for rat collagen α1 (II), tissue inhibitor of

metalloproteinase 1 (TIMP-1) and ribosome subunit 18s (Applied Biosystems, Foster City,

CA). Information on these Assays-on-Demands is available at:

http://myscience.appliedbiosystems.com/cdsEntry/Form/gene_expression_keyword.jsp.

TaqMan reactions were carried out in duplicate on an ABI PRISM 7900 machine (Applied

Biosystems).


Results are expressed as the mean±sd. Significance was established using t-test.

Differences were considered significant if P<0.05.

Chapter 5

108


Results

Synthesis of Losartan-M6PHSA conjugate

Losartan-M6PHSA was successfully synthesized in a straightforward protocol that did not

require extensive purification steps of intermediate products. An average of seven

molecules of losartan were coupled to M6PHSA as assessed by HPLC studies and

confirmed by FAAS analysis of the ULS linker (Table 1). The net negative charge of the

modified protein, reflected by the increased retention time after anion exchange

chromatography, was not changed in Losartan-M6PHSA in comparison with M6PHSA.

Moreover, the size exclusion chromatography showed the existence of a monomeric

preparation of losartan-M6PHSA with absence of protein aggregations (Table 1).

tFigure 2. Organ distribution of losar an-M6PHSA.

Localization of Losartan-M6PHSA in different organs was demonstrated by anti-HSA

immunostaining. Colocalization of losartan-M6PHSA and HSC was detected by anti-HSA/ anti-

DESMIN double immunostaining.

A. Anti-HSA immunostaining in rat liver. B. Colocalization of losartan-M6PHSA with HSC within

a fibrotic liver. Arrows indicate the colocalization of red color, presence of carrier, with blue color, desmin,

a marker of activated HSC. 40x magnification.

109

Chapter 5

Lung (C), heart (D), spleen (E) and kidney (F) sections stained with anti-HSA after Losartan-

M6PHSA injection in CCl4 treated animals. Images were obtained at 20x magnification per organ

tissue.

Clinical and biochemical parameters

The induction of hepatic fibrosis by administration of CCl4 together with oral

phenobarbital was associated with increases in body weight and serum liver enzymes (AST

and ALT), as compared with the sham group. ALT was significantly decreased by the

treatment with losartan-M6PHSA in comparison with losartan alone (Table 2). Plasma

bilirrubin levels indicated normal levels in all groups and there were no changes in the

liver/body ratio.

M6P/IGF II receptor expression in fibrotic liver induced by CCl4

First, we investigated the presence of M6P/IGFII receptor in liver sections at 9 weeks of

inhalation of CCL4. We observed the staining for the receptor throughout the fibrotic

liver, mainly associated extracellularly with hepatic stellate cells in a non-parenchymal

distribution pattern (Figure 1). Receptor expression was also observed in hepatocytes, but

this receptor was present intracellularly. Previous studies showed that this cell type did not

bind the carrier M6PHSA (19).

Chapter 5

110


Accumulation and distribution of losartan-M6PHSA in the fibrotic liver

Previous studies in our group have demonstrated that M6PHSA accumulated rapidly and

efficiently in various stages of liver fibrosis induced by bile duct ligation (22;25). The

fibrotic process in the CCl4 inhalation model has completely different characteristics from

the BDL model, both in underlying pathophysiology and speed of progression. Since this

may affect the extent of M6PHSA accumulation in the liver, we investigated the organ

distribution of losartan-M6PHSA by immunohistochemical techniques and by HPLC

analysis of losartan. To be able to detect the cellular distribution of losartan-M6PHSA in

tissue sections of the organs, rats were sacrificed 10 minutes after the last administration

of the conjugate. We observed a preferential distribution of losartan-M6PHSA to the

fibrotic liver (Figure 2A), whereas the staining in the other organs was negative (Figure

2C-F). Within the fibrotic liver, losartan-M6PHSA displayed an HSC-like distribution

pattern, as demonstrated by colocalization of carrier (anti-HSA staining) and the stellate

cell marker desmin (Figure 2B). From these results we concluded that losartan-M6PHSA

rapidly distributed to the liver 9 weeks after the induction of fibrosis in the CCl4 model,

where it selectively binds and is taken up into HSC.

Quantification of losartan in liver tissue by HPLC

After demonstrating that Losartan-M6PHSA distributed in the CCL4 fibrotic liver, we

evaluated the accumulation of the drug in the liver tissue. For this purpose, tissue levels of

losartan were analyzed by HPLC (Figure 3). The measured losartan levels in livers of rats

treated with losartan-M6PHSA corresponded to 13.2%±6.4% of the cumulative dose.

In contrast, animals that were given free losartan did not show such a preferential liver

accumulation, as only 5.4%±0.2% of the total administrated dose was found in the liver

(P<0.05). These data indicate the efficiency of the drug targeting approach. Since a 25-

fold higher dose of free losartan was administered, higher levels of losartan in the liver

tissue were found compared to losartan-M6PHSA. However, losartan targeted results in a

higher percentage of accumulation after administration, avoiding the body distribution of

the free losartan non-targeted.

111

Chapter 5

0%

5%

10%

15%

20%

25%

Losartan-M6PHSA0,3mg/kg

losartan 8 mg/kg

% o

f los

arta

n of

the

cum

ulat

ive

dose

Figure 3. Quantitation of losartan levels in the livers of CCL4 rats.

Losartan levels in the liver were determined by HPLC as described in the materials and methods section.

The accumulation was related to the cumulative doses administered to the animal.

Losartan-M6PHSA effect on liver fibrosis

Morphometric analysis of hepatic collagen deposition is considered to be the gold

standard for quantification of liver fibrosis (26). We employed Sirius Red staining on liver

tissues for the assessment of fibrous collagen deposition. CCl4 rats treated with either

saline, M6PHSA or losartan showed similar levels of collagen deposition, as shown in

Figure 4-A, C, D. In contrast, rats treated with losartan-M6PHSA displayed a reduction in

the amount of fibrotic area (Figure 4B). Morphometric analysis of the Sirius red staining

showed a significant reduction of the fibrotic area in rats treated with losartan-M6PHSA

compared those treated with saline, losartan or M6PHSA (1.8±0.5%, 3.3±1.3%, 3.2±0.9%

and 3.5±0.1% of positive area, respectively; p<0.05) (Figure 4E).

M6PHSA (2.5±1.1%, positive area per liver area) or losartan (2.6±0.6%), compared to

saline treated (4.9±1.0%) or M6PHSA-treated (3.5±0.1%) fibrotic rats. (p<0.05, Figure 5).

Chapter 5

112


losartan Saline M6PHSAlosartan-M6PHSA

E

*

0

20

40

60

80

100

120

140

CCL4 (9w eeks)control

CCl4 L

Siriu

s R

ed s

tain

ing

(%

pos

itive

are

a)

Figure 4. Liver fibrosis histology af

treated with: A. Saline, B. M6PHSA, C.

stained with Sirius Red. Images represent reco

performed with AnalySIS Image Processing

deposition was analysed per liver area of rat l

M6PHSA and losartan. Quantification

magnification per liver biopsy performed with

losartan-M6PHSA versus CCL4 control, los

OS-M6PHSAIV

CCl4 M6PHSA IV CCl4 losartan IV

ter losartan-M6PHSA treatment. CCL4 rats were

losartan-M6PHSA and D. losartan. Liver sections were

nstruction of 16 images of 4x magnification per liver biopsy

. E. Quantification of Sirius Red positive area. Collagen

iver tissue treated with: control saline, losartan-M6PHSA,

is performed over reconstruction of 16 images of 4x

AnalySIS Image Processing. *p<0.05 significant values of

artan and M6PHSA groups.

113

Chapter 5

Since the fibrogenic process is correlated with transformation of hepatic stellate cells into

myofibroblasts, we investigated the expression of the myofibroblast marker alfa-smooth

muscle actin (SMA) in livers. SMA staining was reduced in rats treated with losartan-

Hepatic gene expression analysis via quantitative RT-PCR

In addition to the protein expression of fibrotic markers, we studied gene expression

levels in treated and untreated fibrotic rats. Analysis of procollagen type 1α2, and TIMP-1

gene expression was conducted to elucidate the antifibrotic mechanism utilized by

losartan-M6PHSA. Procollagen type 1α2 gene expression was reduced by 80% in CCl4

rats treated with losartan-M6PHSA (p<0.001), (Figure 6A) and 70% after losartan

treatment. No effect was observed after free losartan treatment on TIMP-1 gene

expression while an upregulation of TIMP-1 expression after targeted losartan treatment

was observed (Figure 6B).

Chapter 5

114


Discussion

Many studies have demonstrated the antifibrotic effects of RAS blockers during

experimental liver fibrosis. Interference with the renin-angiotensin system may therefore

become a new tool to stop the fibrotic process (27-30). By antagonizing the angiotensin

AT-1 receptor in the fibrotic liver, losartan can prevent the production of fibrogenic

mediators whose expression is enhanced by the activated RAS system (31). During these

studies, losartan was administered during 9 to 12 weeks starting at the time of the

induction of liver injury in the CCL4 animal model (32;33). Such prolonged administration

of losartan was needed in order to achieve a reduction of experimentally induced liver

fibrosis.

We now report on a new preparation, losartan-M6PHSA, which delivers the angiotensin

antagonist losartan selectively to HSC in the fibrotic liver. The potential benefit of such a

conjugate is the increased liver selectivity, thereby lowering systemic side actions of the

drug, which enhances its effect at a relatively low dose. The delivery of losartan to HSC

thus leads to an improved safety and improved efficacy towards the resolution of liver

fibrosis. In the present study we demonstrate that a pronounced effect can be achieved by

losartan-M6PHSA after only 4 days of treatment, in a model in which fibrosis has

progressed for already 9 weeks.

Drug targeting of antifibrotic agents to the liver has been often investigated in the BDL

model. The extrahepatic obstruction of the bile duct leads to an accumulation of excessive

bile salts and other molecules that provoke an inflammatory and fibrogenic process in the

liver and bile duct proliferation (34). The CCL4 model of liver fibrosis is induced by

administration of CCl4 and phenobarbital and is pathogenically completely different from

the BDL model. CCl4 requires bioactivation by cytochrome p450, yielding the reactive

metabolite, the trichloromethyl radical, which initiates lipid peroxidation, resulting in

toxin-induced liver damage provoking extensive liver fibrosis (35). BDL is a rapid and

progressive model (36), while CCL4 model is relatively slow.

115

Chapter 5

Saline losartan-M6PHSA M6PHSA osartan l

E

**

0

1

2

3

4

5

6

7

CCL4 (9w eeks)control

CCl4 LOS-M6PHSA IV

CCl4 M6PHSA IV CCl4 losartan IV

S

MA

Sta

inin

g

( %

pos

itive

are

a)

Figure 5. SMA immunostaining of rat livers.

A. SMA positive cells on rat liver. CCL4 rats were treated with: A. Saline, B. M6PHSA, C. losartan-

M6PHSA and D. losartan and immunostained for α-SMA. Images represent one area of 4x

magnification per liver biopsy performed with AnalySIS Image Processing.

E. Quantification of SMA positive cells per liver area. CCL4 rats were treated with: control (saline),

losartan-M6PHSA, M6PHSA and losartan. Quantification is performed by reconstruction of 16

images of 4x magnification per liver biopsy performed with AnalySIS Image Processing. *p<0.05

significant values of losartan-M6PHSA versus losartan and M6PHSA groups.

Chapter 5

116


Consequently, CCL4 may reflect the human situation better, in which the slow fibrogenic

process can be ongoing for several years before treatment is initiated. The demonstration

of the efficacy of losartan-M6PHSA in the CCL4 model of liver fibrosis thus strengthens

its potential as a new antifibrotic modality.

M6PHSA carriers bind to the M6P/IGII receptor on activated HSC (19). Bleser et al (37)

have demonstrated the expression of the M6P/IGII receptor during the early phases of

the CCL4 model. We have now identified the presence of our target receptor at later

stages, i.e. at week 9 after the onset of liver fibrosis. Subsequent targeting of losartan-

M6PHSA confirmed the cell-selective delivery, showing a rapid accumulation in the CCl4-

fibrotic liver. Furthermore, the association of losartan-M6PHSA with activated HSC

verified the specific delivery of our construct to the key fibrogenic cell during disease.

Specific targeting to the liver is desired during the fibrotic process caused by a disturbed

balance between the portal pressure and the systemic blood pressure in patients, which

eventually may be lethal. There is an enhanced portal pressure while at the same time the

splanchnic blood pressure is reduced. This excludes the use of systemic vasoactive agents

because the reduction of portal pressure should be achieved strictly locally. Losartan acts

locally on the angiotensin AT-1 receptors and has also direct anti-fibrotic effects on HSC,

the most important cell during liver fibrosis (1). These actions render losartan as an ideal

antifibrotic agent, but its systemic vasoactive effects and renal effects probably will

compromise its chronic administration in patients with liver fibrosis.

Drug targeting to specific target cells will increase the fraction of the drug that distributes

to the target cells (38), optimizing drug concentrations in the liver. Our results reveal the

efficacy of the targeting strategy of losartan-M6PHSA to activated HSC during the

experimental fibrosis condition. It has been shown that, apart from the HSC, other

sinusoidal liver cell types, such as Kupffer and endothelial cells, also take up M6PHSA

conjugates (39). As has been previously described, those cells also express the AT-1

receptor and are actively involved during liver fibrosis (40;41). Partial delivery to these

sinusoidal cells might be additionally beneficial.

117

Chapter 5

The most striking result of the present study was the efficiency of losartan-M6PHSA in

preventing extracellular matrix deposition after only 3 days of losartan-M6PHSA

administration in rats with developed fibrosis. Since collagen deposition constitutes the

major component of the extracellular matrix (ECM) (42), the reduction of scar liver tissue

after treatment with losartan-M6PHSA was remarkable. Similar results with losartan-

M6PHSA in BDL rats have been observed (Gonzalo, manuscript in preparation).

A

0.0

0.5

1.0

1.5

CCL4 (9 weeks)control

M6PHSA-Losartan

M6PHSA Losartan

* *

*

Proc

olla

gen α1

mR

NA

(2-∆∆

Ct )

B

TIM

P-1

mR

NA

(2

-∆∆

Ct )

0.0

5

1.0

1.5

2.0

2.5

CCL4 (9w eeks) control

M6PHSA-Losartan

M6PHSA Losartan

*

0.

Figure 6. Hepatic gene expression.

A. Quantification of procollagen α1(II) gene expression. Procollagen α1(II) expression was analyzed in

RT-PCR from rat liver tissues treated with control saline, losartan-M6PHSA, M6PHSA and losartan.

*p< 0.05, vs CCL4 treated animals.

Chapter 5

118


Furthermore, Losartan-M6PHSA treated fibrotic animals showed significant reduction in

mRNA expression of procollagen. This may represent a major aspect of the antifibrotic

effect of losartan in the fibrotic liver. Once present in the liver tissue, losartan acts as an

effective antifibrogenic drug, blocking the proliferation of activated HSC (43). In addition,

the antagonism of AT-1 receptor may prevent the upregulation of the procollagen gene

(44;45) a gene crucial in the fibrogenic process.

Although procollagen gene expression was also downregulated by non-targeted losartan,

collagen protein accumulation was not reduced after this treatment. This contradictory

result may underline the difficulty to generally correlate expression of certain genes with

post-regulation and protein assembly events. However, this may also be explained by

losartan concentration patterns that may largely differ between the losartan-M6PHSA and

non-targeted losartan treatment. As previously hypothesized for pentoxifylline-M6PHSA

conjugates (46), losartan-M6PHSA could act as a depot, intracellularly releasing losartan in

a slow-release manner, thereby providing sustained drug levels during a prolonged period

of time. In contrast, after administration of losartan non-targeted, drug concentrations are

only shortly elevated.

Following oral administration, systemic bioavailability of losartan is limited to 33% (47).

In our previous studies, after oral administration of losartan we did not detect any effect

on procollagen gene expression (Gonzalo, manuscript in preparation). In contrast, we

now observe a reduction of procollagen gene expression after intravenous administration

of losartan, probably due to higher bioavailability of the drug.

Administration of M6PHSA itself also produced a reduction of procollagen gene

expression. By interacting with M6P/IGII receptor, M6PHSA may prevent the processing

of latent TGF-β, locally present in the liver tissue. Thus, the action of TGF-β on its HSC

receptors may also be impeded and procollagen gene activation via this pathway may be

reduced within the stellate cell (48). On the other hand, we observed an opposite effect of

losartan-M6PHSA on TIMP-1 gene expression. Thus, the antifibrotic effect observed by

losartan-M6PHSA in reducing collagen production does not employ TIMP-1 inhibition.

119

Chapter 5

Liver fibrosis is in principle a reversible process in which the stellate cells have been

identified as the key fibrogenic cells (1). Exposed to toxicants, HSC undergo

morphological transition and activation and leading to the production of large amounts of

ECM components (49). Consequently, resolution of stellate cell activation represents an

essential step towards reversion of liver fibrosis. In the present study, losartan-M6PHSA

and non-targeted losartan treatment both led to a significant reduction of activated HSC.

The effects observed in this study by losartan-M6PHSA and non-targeted losartan

indicate a similar effect of both compounds in vivo. However, the efficiency of losartan-

M6PHSA is superior considering the large amount of free losartan administered versus

the low dose of losartan-M6PHSA.

In conclusion, we have demonstrated the homing of losartan-M6PHSA to the CCl4

induced fibrotic liver and clear therapeutic effects during only 3 days of treatment, where

losartan-M6PHSA was superior to non-targeted losartan. The observed effects might

reflect an actual reversion of the fibrosis process. This novel drug delivery concept is

consistent with previous results in another model of liver fibrosis, and in our opinion

warrants further dose-regimen efficacy studies in animal models and humans.

Acknowledgements


Netherlands (R 02-1719, 98-162), the Ministerio de Ciencia y Tecnología, Dirección

General de Investigación (SAF2005), and from the Instituto de Salud Carlos III

(CO3/02). We thank Montserrat Moreno and Elena Juez for their kind help in animal

handling and Annemiek van Loenen, Catharina Reker-Smit, Jan Visser and Cristina for

their excellent technical support. Colleagues at Kreatech are acknowledged for critical

reading of the manuscript.

Chapter 5

120


Reference List


2. Pinzani,M. 1999. Liver fibrosis. Springer Semin. Immunopathol. 21:475-490.

3. Fallowfield,J.A., and Iredale,J.P. 2004. Targeted treatments for cirrhosis. Expert. Opin. Ther. Targets. 8:423-435.

4. Reeves,H.L., and Friedman,S.L. 2002. Activation of hepatic stellate cells--A key issue in liver fibrosis. Front. Biosci. 7:D808-D826.

5. Bataller,R., Gines,P., Nicolas,J.M., Gorbig,M.N., Garcia-Ramallo,E., Gasull,X., Bosch,J., Arroyo,V., and Rodes,J. 2000. Angiotensin II induces contraction and proliferation of human hepatic stellate cells. Gastroenterology 118:1149-1156.

6. Bataller,R., Gabele,E., Parsons,C.J., Morris,T., Yang,L., Schoonhoven,R., Brenner,D.A., and Rippe,R.A. 2005. Systemic infusion of angiotensin II exacerbates liver fibrosis in bile duct-ligated rats. Hepatology 41:1046-1055.

7. Yoshiji,H., Kuriyama,S., Yoshii,J., Ikenaka,Y., Noguchi,R., Yanase,K., Namisaki,T., Yamazaki,M., Tsujinoue,H., Imazu,H. et al 2003. Angiotensin-II induces the tissue inhibitor of metalloproteinases-1 through the protein kinase-C signaling pathway in rat liver fibrosis development. Hepatol. Res. 27:51-56.

8. Wei,H.S., Li,D.G., Lu,H.M., Zhan,Y.T., Wang,Z.R., Huang,X., Zhang,J., Cheng,J.L., and Xu,Q.F. 2000. Effects of AT1 receptor antagonist, losartan, on rat hepatic fibrosis induced by CCl4. World J. Gastroenterol. 6:540-545.

9. Bataller,R., Sancho-Bru,P., Gines,P., Lora,J.M., Al Garawi,A., Sole,M., Colmenero,J., Nicolas,J.M., Jimenez,W., Weich,N. et al 2003. Activated human hepatic stellate cells express the renin-angiotensin system and synthesize angiotensin II. Gastroenterology 125:117-125.


11. Paizis,G., Gilbert,R.E., Cooper,M.E., Murthi,P., Schembri,J.M., Wu,L.L., Rumble,J.R., Kelly,D.J., Tikellis,C., Cox,A. et al 2001. Effect of angiotensin II type 1 receptor blockade on

experimental hepatic fibrogenesis. J. Hepatol. 35:376-385.


13. Bataller,R., Sancho-Bru,P., Gines,P., and Brenner,D.A. 2005. Liver fibrogenesis: a new role for the renin-angiotensin system. Antioxid. Redox. Signal. 7:1346-1355.


15. Beljaars,L., Geerts,A., De Bleser,P.J., Molema,G., Meijer,D.K.F., and Poelstra,K. 1999. The binding and uptake of hepatic stellate cell-selective drug carriers. Hepatology 30:556A (Abstr.)

16. De Bleser,P.J., Scott,C.D., Niki,T., Xu,G., Wisse,E., and Geerts,A. 1996. Insulin-like growth factor II/mannose 6-phosphate-receptor expression in liver and serum during acute CCl4 intoxication in the rat. Hepatology 23:1530-1537.

17. Gonzalo,T., Talman,E.G., van,d., V, Temming,K., Greupink,R., Beljaars,L., Reker-Smit,C., Meijer,D.K., Molema,G., Poelstra,K. et al 2006. Selective targeting of pentoxifylline to hepatic stellate cells using a novel platinum-based linker technology. J. Control Release 111:193-203.




121

Chapter 5

21. Claria J, and Jimenez,W. 1999. Renal dysfunction and ascites in carbon tetrachloride-induced liver cirrhosis in rats. Pathogenesis, diagnosis and treatment. V.Arroyo, Gines,P., Rodes,J., and Schrier,R., editors. Blackwell Science Inc. Malden.M; USA. USA. 379-396.

22. Beljaars,L., Poelstra,K., Molema,G., and Meijer,D.K.F. 1998. Targeting of sugar- and charge-modified albumins to fibrotic rat livers: the accessibility of hepatic cells after chronic bile duct ligation. J. Hepatol. 29:579-588.

23. Beljaars,L., Molema,G., Weert,B., Bonnema,H., Olinga,P., Groothuis,G.M.M., Meijer,D.K.F., and Poelstra,K. 1999. Albumin modified with mannose 6-phosphate: A potential carrier for selective delivery of antifibrotic drugs to rat and human hepatic stellate cells. Hepatology 29:1486-1493.


25. Greupink,R., Bakker,H.I., Reker-Smit,C., van Loenen-Weemaes,A., Kok,R.J., Meijer,D.K.F., Beljaars,L., and Poelstra,K. 2005. Studies on the targeted delivery of the antifibrogenic compound mycophenolic acid to the hepatic stellate cell. J. Hepatol. x:x.

26. Lin,X.Z., Horng,M.H., Sun,Y.N., Shiesh,S.C., Chow,N.H., and Guo,X.Z. 1998. Computer morphometry for quantitative measurement of liver fibrosis: comparison with Knodell's score, colorimetry and conventional description reports. J. Gastroenterol. Hepatol. 13:75-80.




30. Paizis,G., Gilbert,R.E., Cooper,M.E., Murthi,P., Schembri,J.M., Wu,L.L., Rumble,J.R.,

Kelly,D.J., Tikellis,C., Cox,A. et al 2001. Effect of angiotensin II type 1 receptor blockade on experimental hepatic fibrogenesis. J. Hepatol. 35:376-385.



33. Ishizaka,N., Saito,K., Noiri,E., Sata,M., Ikeda,H., Ohno,A., Ando,J., Mori,I., Ohno,M., and Nagai,R. 2005. Administration of ANG II induces iron deposition and upregulation of TGF-beta1 mRNA in the rat liver. Am. J. Physiol Regul. Integr. Comp Physiol 288:R1063-R1070.

34. Nan,J.X., Park,E.J., Lee,S.H., Park,P.H., Kim,J.Y., Ko,G.N., and Sohn,D.H. 2000. Antifibrotic effect of Stephania tetrandra on experimental liver fibrosis induced by bile duct ligation and scission in rats. Arch. Pharm. Research 23:501-506.

35. Chapman,K., Prabhudesai,M., and Erdman,J.W., Jr. 1992. Effects of ethanol and carbon tetrachloride upon vitamin A status of rats. Alcohol Clin. Exp. Res. 16:764-768.

36. Kountouras,J., Billing,B.H., and Scheuer,P.J. 1984. Prolonged bile duct obstruction: a new experimental model for cirrhosis in the rat. Br. J. Exp. Pathol. 65:305-311.

37. De Bleser,P.J., Jannes,P., Van Buul-Offers,S.C., Hoogerbrugge,C.M., Van Schravendijk,C.F.H., Niki,T., Rogiers,V., Van den Brande,J.L., Wisse,E., and Geerts,A. 1995. Insulinlike growth factor-II/mannose 6-phosphate receptor is expressed on CCl4-exposed rat fat-storing cells and facilitates activation of latent transforming growth factor-b in cocultures with sinusoidal endothelial cells. Hepatology 21:1429-1437.


39. Greupink,R., Bakker,H.I., Reker-Smit,C., van Loenen-Weemaes,A.M., Kok,R.J., Meijer,D.K.,

Chapter 5

122


Beljaars,L., and Poelstra,K. 2005. Studies on the targeted delivery of the antifibrogenic compound mycophenolic acid to the hepatic stellate cell. J. Hepatol. 43:884-892.

40. Wei,Y.H., Jun,L., and Qiang,C.J. 2004. Effect of losartan, an angiotensin II antagonist, on hepatic fibrosis induced by CCl4 in rats. Dig. Dis. Sci. 49:1589-1594.

41. Leung,P.S., Suen,P.M., Ip,S.P., Yip,C.K., Chen,G., and Lai,P.B. 2003. Expression and localization of AT1 receptors in hepatic Kupffer cells: its potential role in regulating a fibrogenic response. Regul. Pept. 116:61-69.

42. Pinzani,M., Rombouts,K., and Colagrande,S. 2005. Fibrosis in chronic liver diseases: diagnosis and management. J. Hepatol. 42 Suppl:S22-S36.

43. Gross,O., Schulze-Lohoff,E., Koepke,M.L., Beirowski,B., Addicks,K., Bloch,W., Smyth,N., and Weber,M. 2004. Antifibrotic, nephroprotective potential of ACE inhibitor vs AT1 antagonist in a murine model of renal fibrosis. Nephrol. Dial. Transplant. 19:1716-1723.

44. Bataller,R., Gabele,E., Schoonhoven,R., Morris,T., Lehnert,M., Yang,L., Brenner,D.A., and Rippe,R.A. 2003. Prolonged infusion of angiotensin II into normal rats induces stellate cell activation and proinflammatory events in liver. Am. J. Physiol Gastrointest. Liver Physiol 285:G642-G651.

45. Qi,Z., Atsuchi,N., Ooshima,A., Takeshita,A., and Ueno,H. 1999. Blockade of type beta transforming growth factor signaling prevents liver fibrosis and dysfunction in the rat. Proc. Natl. Acad. Sci. U. S. A 96:2345-2349.


47. Oparil,S. 2000. Newly emerging pharmacologic differences in angiotensin II receptor blockers. Am. J. Hypertens. 13:18S-24S.

48. Rodriguez-Barbero,A., Obreo,J., Yuste,L., Montero,J.C., Rodriguez-Pena,A., Pandiella,A., Bernabeu,C., and Lopez-Novoa,J.M. 2002. Transforming growth factor-beta1 induces collagen synthesis and accumulation via p38 mitogen-activated protein kinase (MAPK) pathway in cultured L(6)E(9) myoblasts. FEBS Lett. 513:282-288.

49. Gressner,A.M., Weiskirchen,R., Breitkopf,K., and Dooley,S. 2002. Roles of TGF-beta in hepatic fibrosis. Front Biosci. 7:d793-d807.

2

agra fort with extra anterior page

Diwan-i-Am (Hall of Public Audience), Red Fort of Agra

India, December 2005.

Chapter6Local inhibition of liver fi brosis by specifi c delivery of a PDGF kinase inhibitor to hepatic stellate cells

Submitted for publication.

1,Teresa Gonzalo, 1Leonie Beljaars, 1Marja van de Bovenkamp, 1Anne-Miek van Loenen, 1Catharina Reker-Smit, 1Dirk K.F. Meijer, 2Marie Lacombe, 2Frank Opdam, 3György Kéri, 3László Orfi , 1Klaas Poelstra, 1,4Robbert J Kok.

1Department of Pharmacokinetics and Drug Delivery, Groningen University Institute for Drug Exploration, University of Groningen, The Netherlands;

2Kreatech Biotechnology B.V., Amsterdam;

3Department of Medical and Pharmaceutical Chemistry, Semmelweis University, Budapest, Hungary;

4Department of Pharmaceutics, Utrecht University, The Netherlands.

126

Local inhibition of liver fibrosis by targeting a PDGF kinase inhibitor to stellate cells

Abstract

Liver fibrosis is characterized by an excessive proliferation and activation of Hepatic

Stellate Cells (HSC). Platelet-derived growth factor (PDGF-BB) is the most potent

mitogen for HSC and inhibition of PDGF signalling via specific delivery of a PDGF

kinase inhibitor to HSC might therefore be an attractive strategy to counteract the

progression of liver fibrosis. The HSC-selective carrier M6PHSA was equipped with a

PDGF receptor tyrosine kinase inhibitor (PTKI, an imatinib derivative) by means of a

novel platinum-based linker (ULSTM).

Culture-activated rat HSC and precision-cut liver slices from fibrotic rats were incubated

with PTKI-M6PHSA and fibrosis markers were evaluated by quantitative RT-PCR. The

gene expression of α-smooth muscle actin and α1-(I)-procollagen were reduced by 50%

in both in vitro systems after treatment with PTKI-M6PHSA (0.1 mg/ml, corresponding to

10µM of PTKI) and free PTKI showed similar effects.

Next, we examined the homing and antifibrotic effects of PTKI-M6PHSA in bile duct

ligated (BDL) rats. Male Wistar rats at day 10 after BDL were injected intravenously with a

single dose of 3.3 mg/kg of PTKI-M6PHSA and compared with non-treated BDL rats.

PTKI-M6PHSA was detected in the liver 2h after administration in a non-parenchymal

distribution pattern. The antifibrotic effects of PTKI-M6PHSA were analysed by Sirius

Red and α-smooth muscle actin stainings. Both parameters were reduced 24h and 48h

after the single dose of PTKI-M6PHSA (p<0.01, p<0.05. resp), in comparison with non-

treated rats. We subsequently conducted a multiple dose study administering PTKI-

M6PHSA to BDL rats and untargeted PTKI, where we found no effect of either

treatment.

In summary, PTKI-M6PHSA showed an antifibrogenic effect in cultured HSC and

fibrotic liver slices. This effect was also demonstrated in vivo after direct targeting of the

PDGFR kinase inhibitor to activated HSC during liver fibrosis after single administration.

Upon longer treatment however, PDGF kinase inhibition can not block the fibrotic

Chapter 6

process. We therefore conclude that delivery of a PDGF-kinase inhibitor to HSC is a

promising technology to attenuate liver fibrogenesis, although other activating pathways

may need to be inhibited in parallel.

Theoretical

synthesis ratio Coupling ratio Yield of synthesis#

A

NHl

O
C
127

PTKI-ULS: protein

PTKI : protein¶

PTKI-M6PHSA

10:1

8 : 1 (±1.9)

84%

0

100

200

300

400

500

600

700

800

900

10 15 20 25 30

PTKI-M 6PHSA

M 6PHSA

NH

N NCH3

NPt

2+M6PHSA carrier

UV

280

nm

(m

AU

)

MonoQ anion exchange

UV

280

nm

(m

AU

)

0

200

400

600

800

00

1200

1400

00

9 10 11 12 13

HSAM6PHSAPTKI-M6PHSA

16B

10

Size exclusion chromatography

Time (min) Time (min)

Figure 1. Characteristics of PTKI-M6PHSA drug targeting conjugate.

A. Synthesis of PTKI-M6PHSA. PTKI was conjugated via the platinum based linker ULS to the

stellate cell selective carrier M6PHSA. Coordination bonds between drug-linker and linker-carrier are

depicted as dotted lines. ¶ PTKI/M6PHSA coupling ratio was determined by HPLC after competitive

displacement of the drug with potassium thiocyanate (KSCN) at 80°C for 24h. # Based in the BCA

assay or protein concentration. Values obtained from three independent PTKI-M6PHSA synthesized

conjugates. B. MonoQ anion exchange chromatography confirmed that the charge of the protein was not

affected. Size exclusion chromatography showed the monomeric composition of PTKI-M6PHSA.

M6PHSA: mannose-6-phosphate modified human serum albumin; ULS: Universal Linkage System.

Chapter 6

128


Introduction

Liver fibrosis is a proliferative disease that may be initiated by a variety of factors

including chronic hepatitis, virus infections, alcohol drinking, and drug abuse. It has been

extensively documented that activated hepatic stellate cells (HSC) play a fundamental role

in the development of liver fibrosis (1;2). During liver fibrosis, activated HSC proliferate

and deposit extracellular matrix proteins, a process that is driven by an array of cytokines

and growth factors. Among these, platelet-derived growth factor (PDGF-BB) has been

identified as the most potent mitogen for HSC (3). Activated HSC produce PDGF (4) and

PDGFR-β receptors are highly upregulated on the cell surface of hepatic stellate cells

during fibrosis (5-7).

Imatinib (STI 571, Gleevec) is employed in the treatment of chronic myelogenous

leukaemia (CML) and gastrointestinal stromal tumors (GISTs) (8). It inhibits several

tyrosine kinases that are mutated during cancer development. In addition, imitanib is a

potent inhibitor of PDGF-B kinase. Consequently, imatinib has been tested for its

antifibrotic effect in cultured HSC (9) and has recently been evaluated in different animal

models of liver fibrosis (10-13). The fundamental role that PDGF signalling appears to

play in liver fibrogenesis has made it an attractive therapeutic target for the treatment of

liver fibrosis (14).

In the present study, we have investigated whether the antifibrotic effects of a PDGF

tyrosine kinase inhibitor (PTKI), a drug structurally associated to imatinib (15), can be

enhanced by local delivery to HSC in the fibrotic liver. PDGF tyrosine kinase activity

plays a role in many more processes than HSC proliferation, so it is reasonable to expect

side effects of its inhibition. Drug targeting strategy can improve the effect of the drug by

increasing local concentrations at the target site and by providing slow local drug release.

It will also prevent side effects in other tissue or organs (16).

To effectuate local delivery and effects within HSC in the liver, we have developed a new

drug targeting construct, PTKI-M6PHSA, in which PTKI is coupled to the HSC-directed

carrier protein mannose-6-phosphate-human serum albumin (M6PHSA). M6PHSA is a

129

Chapter 6

well-established carrier that binds to the M6P/IGFII receptor on HSC and accumulates

rapidly and extensively in the liver of fibrotic rats (17). To conjugate PTKI to M6PHSA,

we have employed a novel type of platinum linker chemistry called ULSTM (Universal

Linker System)(18). ULS allows stable coupling of drug molecules to proteins based on

the formation of a platinum-ligand coordination bond (19). Application of this novel

linker technology was essential since it appears to be straightforward and reliable for

linking PTKI molecules to the carrier, allowing high synthesis yields in a relatively simple

approach. Second, the resulting PTKI-ULS-M6PHSA conjugates display a unique

behavior of slow release of drug molecules during a period of days within the designated

target cells.

In the present study, we describe the development of PTKI-M6PHSA and its impact on

liver fibrogenesis in vitro and in vivo. Culture of HSC and fibrotic liver slices were employed

as in vitro systems to prove the antifibrotic effect of PTKI-M6PHSA. In addition, PTKI-

M6PHSA was tested in a model of liver fibrosis to study the distribution and effects on

the development of liver fibrosis.

Chapter 6

130


BDL

day 10

control saline

BDL

day 11

control saline

BDL

day 12

control saline

BDL

day 10

+PTKI-M6PHSA

BDL

day 11

+PTKI-M6PHSA

BDL

day 12

+PTKI-M6PHSA

Number of rats 5 5 5 3 5 5

Body weight (g) 250.2 ± 46.7 311.2 ± 14.7 273.4 ± 16.4 280.7 ± 10.1 301.4 ± 14.1 306.4 ± 13.5

Liver/body ratio (g/g) 0.055 ± 0.009 0.062 ± 0.007 0.065 ± 0.004 0.061 ± 0.002 0.060 ± 0.006 0.065 ± 0.009

Dose Saline Saline Saline 3.3mg/kg 3.3mg/kg 3.3mg/kg

Bilirubin (umol/l) 183.7 ± 35.8 178.0 ± 48.2 228.5 ± 18.7 252.3 ± 55.9 136.0 ± 10.0

183.5 ± 27.9

ALT (U/l) 86.3 ±30.9 79.8 ±46.1 79.3 ±11.2 96.5 ± 4.9 72.7 ±10.6 81.0 ±17.0

Alkaline Phosphatase

(U/l) 391.2 ±46.4 476.0 ±162.6 358.3 ±234.1 458.0 ±11.2 426.0±101.3 511.3±121.4

Table 1. Dose regimens, animal data and biochemical parameters from PTKI-M6PHSA single injection study. Data are shown as mean ± SD. BDL, bile duct ligated animals; ALT, alanine aminotransferase.

131

Chapter 6


Materials

The Protein Tyrosine Kinase Inhibitor (PTKI, 4-Chloro-N-[4-methyl-3-(4-pyridin-3-yl-

pyrimidin-2-ylamino)-phenyl]-benzamide) was kindly provided by György Kéri (Vichem

Chemie Research Ltd., Budapest, Hungary). M6PHSA was prepared as described

previously (19). Cis-[Pt(ethylenediamine)nitrate-chloride] (cisULS) was prepared as

previously described (19).

Synthesis of PTKI-ULS-M6PHSA

PTKI-ULS was synthesized and purified by Kreatech Biotechnology (Amsterdam, The

Netherlands). In brief, PTKI (7.2 µmol, 3 mg; 10 mg/ml in DMF) was mixed with an

equimolar amount of cisULS (7.2 µmol, 2.4 mg; 20 mM in DMF). The reaction mixture

was heated at 37°C for 24h after which consumption of the starting material was

monitored by analytical HPLC. An additional amount of cisULS was added (0.5

equivalent, 3.6 µmol) and the reaction was continued for 48h at 37°C. The crude mixture

was concentrated under reduced pressure and dissolved in methanol (600 µl). The crude

product was purified by preparative HPLC and the collected peaks of the main product

were taken to dryness under reduced pressure. The resulting white solid was treated with

water to remove anorganic salts and dried. Yield: 0.9 mg (20%). Mass spectrometry

analysis confirmed the presence of the 1:1 PTKI-ULS species.

1H NMR of PTKI (CD3OD): δH 2.33 (s, 3H, CH3), 7.26 (d, J = 8.28 Hz, 1H, CCH3CH),

7.37 (m, 2H, CHCl), 7.52 (m, 3H, N(CH)2CCCH), 7.93 (d, J = 8.60 Hz, 2H, CHCHCl),

8.22 (s, 1H, NHCCHC), 8.47 (d, J = 5.23 Hz, 1H, CHNCNH), 8.64 (m, 2H, CH(CH)2C

and CHCHCNH), 9.29 (s, 1H, NCHC) ppm.

1H NMR of PTKI-ULS (CD3OD): δH 2.27 (m, 3H, CH3), 2.66 (m, 2H, CH2), 2.74 (m,

2H, CH2), 7.15 (m, 3H, CHCCH3 and CHCl), 7.47 (m, 3H, N(CH)2CCCH), 7.84 (d, J =

5.23 Hz, 1H, CHCHCNH), 7.89 (m, 2 H, CHCHCl), 8.39 (d, J = 3.95 Hz, 1H,

CHNCNH) ppm.

Chapter 6

132


Mass spectrometry of PTKI-ULS (ESI+): calculated mass: 705 (m/z); detected masses:

706 [M]+, 688 [M-Cl-+OH-]+, 670 [M-Cl--H+]+, 669 [M-Cl--H+]+, 651 [M-Cl--Cl-+OH-

+H]+.

HPLC analysis: Separations were performed on a Luna2 C18 column that was maintained

at 40°C. The mobile phase consisted of a binary solvent system of triethylammonium

acetate (100mM pH 5.0):acetonitrile 90:10 (solvent A) and triethylammonium acetate

(100mM pH 5.0):acetonitrile 70:30 (solvent B). The column was eluted at a flow rate of

1.1 mL/min. Compounds were eluted at a stepwise gradient (0%B from 0-4 min; 0-46%B

from 4-17 min; 46-100%B from 17-19 min; 100%B from 19-25 min; 100-0%B from 25-

27 min; 0%B from 27-34 min). PTKI eluted at 21.2 min (60.8%B) and PTKI-ULS eluted

at 11.5 min (26.5%B).

PTKI-ULS was conjugated to M6PHSA according to a general protocol that has been

described elsewhere for the synthesis of Pentoxifylline-ULS-M6PHSA (19). Briefly,

PTKI-ULS (143 nmol, 1.6 mg that was dissolved in DMF/H2O at 6.7 mg/ml) was added

in 10-fold molar excess to M6PHSA (14.3 nmol, 10 mg, dissolved in 1 ml of 20 mM

tricine/NaNO3 buffer pH 8.3). The pH was checked and adjusted to pH 8 if necessary.

The mixture was incubated overnight at 37°C, and dialysed against PBS at 4°C. The final

product was sterilized by filtration via a 0.2 µm filter and stored at -20°C. Protein content

was assessed by the BCA assay (Pierce, Rockford, IL, USA). PTKI-M6PHSA and

M6PHSA were analyzed by size-exclusion chromatography and anion exchange

chromatography as described before (17) to verify that coupling of PTKI-ULS did not

alter the properties of the M6PHSA protein. The amount of PTKI coupled to M6PHSA

was analyzed by isocratic HPLC after competitive displacement of the drug by overnight

incubation at 80°C with excess of potassium thiocyanate (KSCN, 0.5M in PBS). Elutions

were performed on a Waters system (Waters, Milford, MA, USA) equipped with a 5 µm

Hypersil BDS C8 column (250x4.6 mm, Thermoquest Runcorn, UK), a thermostated

column oven operated at 40°C and an UV detector operated at 269 nm. The mobile phase

consisted of acetonitrile/water/trifluoracetic acid (40/60/0.1, pH 2) at a flow rate of 1.0

ml/min with a sensitivity of 0.01. Retention times: PTKI: 7 min; PTKI-ULS: 5 min.

133

Chapter 6

Figure 2. Activated HSC incubated with PTKI-M6PHSA.

A. Effect of PTKI-M6PHSA and PTKI on HSC cell viability, as determined by Alamar Blue viability

assay. Indicated concentrations reflect the platinum content of the conjugate, or equivalent amounts

cisplatin, PTKI or M6PHSA. Cultured HSC were incubated for 24h with the compounds (*P<0.01).

A. Effect of PTKI-M6PHSA and PTKI on HSC cell viability, as determined by Alamar Blue viability

assay. Indicated concentrations reflect the platinum content of the conjugate, or equivalent amounts

cisplatin, PTKI or M6PHSA. Cultured HSC were incubated for 24h with the compounds (*P<0.01).

B. Activated HSC gene expression after incubation with PTKI-M6PHSA, PTKI and M6PHSA.

Concentrations denote the amount of PTKI (10 µM) or the corresponding amount of M6PHSA carrier

(0.1mg/ml). Gene expressions levels were normalized to the expression of GAPDH and subsequently

normalized to the relative expression of control cells (*P<0.01 and #P<0.05).

B. Activated HSC gene expression after incubation with PTKI-M6PHSA, PTKI and M6PHSA.


(0.1mg/ml). Gene expressions levels were normalized to the expression of GAPDH and subsequently

normalized to the relative expression of control cells (*P<0.01 and

Activated HSC

Activated HSC

cisPlatinum 100µM

cisPlatinum 100µM

PTKI PTKI -M6PHSA -M6PHSA

100µM 100µM PTKI PTKI 100µM 100µM

M6PHSA 100µM

M6PHSA 100µM

Stel

late

cel

l via

bilit

y (A

lam

ar b

lue)

St

ella

te c

ell v

iabi

lity

(Ala

mar

blu

e)

**

0

20

40

60

80

100

120A

B

0,0

0,2

0,4

0,6

0,8

1,0

1,2

1,4

1,6

HSCcontrol PTKI-M6PHSA 10µM(0.1mg/ml)

PTKI 10uM M6PHSA 0.1mg/ml

GAPDH TIMP-1 PDGFR-B Collagen 1a2 SMA

*

#

**

Rel

ativ

e ge

ne e

xpre

ssio

n

#P<0.05).

Chapter 6

134


Cells

Hepatic stellate cells were isolated from male Wistar rat livers by the pronase-collagenase

method followed by a density centrifugation on a 12% Nycodenz gradient according to

Geerts et al (20;21)(Hepatol 1998). The isolated stellate cell fraction was cultured in 6 well-

plates (Corning) in Dulbecco’s Modified Eagle’s Medium (Gibco, Life technologies Ltd.)

supplemented with 10% fetal calf serum, 100 U/ml penicillin and 100 mg/ml

streptomycin in a 5% CO2 humidified atmosphere at 37°C. Cells were split after 3 days

and cultured until day 10 to obtain the activated HSC phenotype, and these culture

activated HSC were used for the experiments described below.

Cell viability studies

Activated HSC (10,000 cells/well seeded in 96 well-plates, Corning) were washed with

serum-free medium and incubated for 24h in medium supplemented with 100 µM PTKI,

PTKI-M6PHSA (1mg/ml, corresponding to 100 µM of PTKI) or M6PHSA (1mg/ml).

During the last 2h of the incubations, Alamar blue reagent (Serotec, Oxford, UK) was

added in a proportion of 10% of the volume per well. Viability of the cells was determined

fluorimetrically according to the supplier’s instructions.

Effects on gene expression

The potential antifibrotic activity of PTKI-M6PHSA and PTKI was evaluated in cultured

HSC and in precision-cut liver slices of fibrotic rat livers.

Activated HSC were incubated as described above with PTKI (10 µM), PTKI-M6PHSA

(0.1mg/ml, corresponding to 10 µM of PTKI), or M6PHSA (0.1 mg/ml) for 24h, after

which they were processed for RNA analysis as described below. A total of four

independent experiments were performed in HSC cultures from four different Wistar

Male rats.

Precision-cut liver slices were prepared as described elsewhere (22;23). Briefly, precision-

cut liver slices (8mm diameter, 250µm) from fibrotic livers of BDL3 rats (week 3 after

BDL) were prepared using a Krumdieck tissue slicer and stored in University of

Winconsin preservation solution (UW) on ice until further use.

135

Chapter 6

0,0

0,2

0,4

0,6

0,8

1,0

1,2

1,4

BDL liver slice + PBS PTKI-M6PHSA 10µM(0.1mg/ml)

PTKI 10uM M6PHSA 0.1mg/ml

GAPDH TIMP-1 PDGFR-B Collagen 1a2 SMA

*#

* *

#

**

Rel

ativ

ege

neex

pres

sion

Figure 3. Effect on gene expression of PTKI-M6PHSA on BDL3 liver slices.


(0.1mg/ml). Gene expression levels of control slices were normalized versus GAPDH and subsequently

normalized versus the expression levels in control fibrotic liver slices (*P<0.01 and #P<0.05).

Slices were preincubated for 2 h in William’s medium E (Gibco, Life technologies Ltd.,

Paisley, Scotland, UK) supplemented with D-glucose (25mM) and gentamycin (50 mg/ml)

and saturated with 95% O2, 5% CO2 at 37°C. Slices were transferred into fresh medium

and incubated individually in six-well plates with PTKI-M6PHSA (0.1 mg/ml,

corresponding to 10 µM of PTKI), PTKI (10 µM) or M6PHSA (0.1 mg/ml). After 24 h

of incubation, slices were snap-frozen in liquid nitogen (real-time PCR analysis). Each

measurement was performed on three liver slices from the same liver and the experiment

was repeated on livers from three different BDL3 rats.

Chapter 6

136


Animal experiments

All animal studies were approved by the local committee for care and use of laboratory

animals at Groningen University, and were performed according to strict governmental

and international guidelines on animal experimentation. Animals had free access to tap

water and standard lab chow and were housed in a 12h/12h light/dark cycle. All the

animals included in these studies were monitored by analysis of body weight (BW) and

biochemical parameters reflecting liver functions like serum bilirubin levels, AST, ALT,

AP and gamma-GT levels. These analyses were performed at the University Medical

Center Groningen by standard biochemical procedures.

BDL model

Liver fibrosis was induced in male Wistar rats (250 g, Harlan, Zeist, The Netherlands) by

bile duct ligation as described previously (24). Briefly, rats were anesthesized with

isoflurane (2% isoflurane in 2:1 O2/N2O, 1 L/min) (Abbot Laboratories Ltd.,

Queensborough, UK). After midline laparotomy, the common bile duct was ligated by

double ligature with 4-0 silk and transected between the two ligations. Animals were

allowed to recover and carefully observed until final sacrifice at the end of the

experiments.

Distr bution study i

At day 10 after BDL, rats received a single intravenous injection of PTKI-M6PHSA (3.3

mg/kg, corresponding to 150 µg PTKI/kg). Control animals were injected with an

equivalent volume of the vehicle (saline, 250 µl). Animals were sacrificed 2h post injection

of the compounds. Organs were harvested and processed for immunohistochemical

detection of the conjugate as described below.

Single dose effect study

At day 10 after BDL, rats received a single intravenous injection of 3.3 mg/kg PTKI-

M6PHSA or saline. Animals were sacrificed day 11 or 12 post injection of the

compounds. Blood and organs were harvested and processed for analysis of serum

markers, RNA isolation and immunohistochemical analysis as described below.

Chapter 6

A PTKI-M6PHSA after 2h Control saline

100µM 100µM

Figu

Immu

2hour

Immu

points

Mult

Starti

M6PH

saline

subse

cyclo

1M H

every

(24h

137

100µM 100µM

100µM 100µM

re 4. Localization of PTKI-M6PHSA in different organs and liver.

nostaining with Anti-HSA of different organs from rats treated with PTKI-M6PHSA after

s of PTKI-M6PHSA single administration. A. liver; B. heart; C. kidney; D. lung; E. spleen.

nostaining with Anti-HSA of liver tissue from rats treated with PTKI-M6PHSA at different time

after single administration: control saline; 2h; 24h; 48h. Magnification, 20x.

iple dose study

ng at day 10 after BDL, rats received four daily intravenous injections of PTKI-

SA (3.3 mg/kg, corresponding to 150 µg PTKI/kg), free PTKI (150 µg/kg) or

. PTKI was dissolved first in DMSO at a concentration of 15 mg/ml and

quently diluted to a concentration of 0.25 mg/ml with Hydroxy propyl-B-

dextrin (ENCAPSIN, Janssen Biotech 30-222-55) 20% w/v (pH adjusted to 3.0 with

Cl). The final dosage of DMSO was less than 0.05%. Animals were treated again

24h, and received a total of 4 doses until they were sacrificed at day14 after BDL

post injection of the last dose). A control group of animals was sacrificed at day 10,

Chapter 6

138


i.e. just before start of the treatments. Blood and organs were harvested and processed

similar as for single dose effect studies.

i

BDL day 10

control saline

BDL day 14

control saline

BDL day 14

+ PTKI-M6PHSA

BDL day 14

+ PTKI

Number of rats 5 6 5 6

Body weight (g) 250.2 ± 46.7 290.4 ± 9.6 273.4 ± 16.4 280.7 ± 10.1

Liver/body ratio (g/g)

0.055 ± 0.009 0.060 ± 0.009 0.063 ± 0.011 0.060 ± 0.004

Dose saline saline

150 ug/kg (PTKI conc) or

3.3mg/kg (prot conc)

150 ug/kg

Bilirubin (umol/l)

183.7 ± 35.8 152.0 ± 14.2 187.4 ± 35.7 156.5 ± 32.8

ALT (U/l) 86.3 ±30.9 118.5 ±46.9 117.6 ±32.3 121.3 ±34.2

Alkaline Phosp

(U/l) 391.2 ±46.4 405.2 ±46.0 478.6 ±132.9 410.0 ±91.2

Table 2. Dose regimens, animal data and biochem cal serum parameters from

PTKI-M6PHSA multiple administration study. Data are shown as mean ± SD. BDL, bile

duct animals.

RNA isolation and gene expression analysis

Total RNA was isolated from cells or liver slices using an RNA isolation kit (Qiagen

GmbH, Hilden,Germany) according to the manufacturer’s procedures. Isolation of RNA

from liver tissue was performed using Trizol (manufacturer). The amount of RNA was

estimated with a Nanodrop system (ND-1000 Spectrophotometer, NanoDrop

Technologies, Wilmington, DE). cDNA was synthesized from similar amounts of RNA

139

Chapter 6

using Superscript III first strand synthesis kit (Invitrogen life technology, Carlsbad, CA).

The reverse transcriptase reaction was performed for 5min at 65°C, 10 min at 25°C, 50

min at 50°C and 5 min at 85°C with random primers. Quantitative Real-time RT-PCR was

performed in duplicate on a ABI 7900HT system (Applied Biosystems, Foster City, CA)

using SYBR green primers. 1µl of cDNA solution corresponding to approximately 0.5µg

was added in each PCR reaction as well as 10µl of SYBR Green PCR Master Mix (Applied

Biosystems) and the forward and reverse primers (50 µM). For each sample, 1 µl of

cDNA was mixed with 0.4 µl of each gene-specific primer (50 µM), 0.8 µl DMSO, 8.4 µl

water and 10 µl SYBR Green PCR Master Mix. The housekeeping gene Glyceraldehyde-3-

phosphate dehydrogenase (GAPDH) was used as a reference gene and for normalization

of the other genes, while ultrapure water was used as a negative control.

The following primers were used to investigate antifibrotic responses: rat smooth muscle

α actin forward, 5'-GACACCAGGGAGTGATGGTT -3’, reverse, 5'-

GTTAGCAAGGTCGGATGCTC-3’ (product size 202 bp); rat collagen type 1 a1

(collagen 1 a1) forward, 5’-AGCCTGAGCCAGCAGATTGA-3’, reverse, 5’-

CCAGGTTGCAGCCTTGGTTA-3’, (product size 145 bp); rat PDGFR-β forward, 5'-

TGTTCGTGCTATTGCTCCTG -3’, reverse, 5'-TCAGCACACTGGAGAAGGTG -3’,

(product size 201 bp); rat timp-1 forward, 5'-GAGAGCCTCTGTGGATATGT -3’,

reverse, 5'-CAGCCAGCACTATAGGTCTT -3’, (product size 334 bp); and rat GAPDH

forward 5’-CGCTGGTGCTGAGTATGTCG-3’, reverse, 50-CTGTG

GTCATGAGCCCTTCC-30, (product size 179 bp). PCR reactions consisted of 40 cycles

(denaturation 15 s 95°C, annealing 15 s 56°C, extension 40 s 72°C). The formation of

single products was confirmed by analyzing the dissociation step at the end of each PCR

reaction.


RNA was isolated from frozen liver samples using an RNA isolation kit (Qiagen GmbH,

Hilden,Germany). Quantitative PCR was performed as described above with primers for

rat collagen α1 (II), smooth muscle α-actin, PDGFR-β, tissue inhibitor metalloproteinase

type 1 (TIMP-1) and GAPDH (Applied Biosystems, Foster City, CA). Real-time PCR was

Chapter 6

140


carried out on an ABI PRISM 7900HT. Data were analyzed with the SDS 2.1 software

program (Applied Biosystems). The relative amount of the designated PCR product was

calculated by the comparative threshold cycle (CT) method and referred to control

treatment.

Immunohistochemical analyses

Cryostat sections (4 µm) of liver, heart, kidney, lung and spleen were acetone-fixed and

stained for the presence of the PTKI-M6PHSA conjugate with an antibody directed

against HSA (Cappel ICN Biomedicals, Zoetermeer, The Netherlands) as described

elsewhere (24).

The degree of hepatic fibrosis was estimated as the percentage of area of each section

(4µm) stained positive with picro Sirius Red in saturated picric acid (both from Sigma).

The amount of fibrogenic myofibroblasts was estimated by measuring the percentage of

area stained with anti-smooth muscle α actin (αSMA, Sigma, Gillingham, UK) in 10

randomly selected high power fields per sample. An optic microscope (Olympus BX40)

connected to a high-resolution camera (Olympus Camedia C-5050 zoom) was used for

morphometric assessment of percentage of area with positive staining. Microphotographs

were taken at an original magnification of 4x10. The fibrotic area per liver section was

quantified by morphometric analysis of the sections using the Image J software package

(NIH, Bethesda, ML, USA) and images were captured following automatic white balance

and light intensity equilibration with a 40 × magnification objective and digitized as RGB

24-bit. After shading correction and interactive thresholding, the selected positive pixels

were measured. The positive area was the sum of the area of positive pixels per liver

biopsy. Results were calculated as the average area of positive pixels per liver biopsy and

divided into each group of animal treatment.


Results are expressed as the mean of at least three independent experiments ± SD, unless

otherwise indicated. Statistical analysis was performed with an unpaired Student’s t-test

and differences were considered significant at p<0.05.

141

Chapter 6

Results

Synthesis and characterization of PTKI-M6PHSA conjugate

When observing the structure of PTKI (Figure 1A) or the related kinase inhibitor

imitanib, it is clear that the structure is mainly composed of aromatic rings lacking

functional groups that can be used for drug linking purposes. In general, drug conjugation

protocols often start with the preparation of a drug-linker adduct at carboxyl, hydroxyl,

thiol or primary amino groups. Since this is not possible for PTKI, we applied a novel

type of platinum-based drug linker that conjugates the drug via a coordinative linkage at

one of the pyridyl nitrogens (Figure 1A). HPLC analysis and mass spectrometry indicated

complete derivatization of the drug into the drug-ULS 1:1 product. The PTKI-ULS

adduct was subsequently conjugated to M6PHSA and the final high-molecular weight

product was extensively purified by dialysis, which also removed free PTKI-ULS

molecules not linked to the carrier (HPLC analysis, data not shown). Summarizing the two

reaction steps, an overall yield of 84% was reached for the synthesis of PTKI-M6PHSA

(Figure 1A). An average of eight PTKI-ULS molecules was coupled per M6PHSA, as

determined by HPLC after release of the drug from the carrier. Conjugation of PTKI to

M6PHSA did not change the charge or size features of M6PHSA, as assessed by anion-

exchange chromatography and size exclusion chromatography, respectively (Figure 1B).

Effect of PTKI-M6PHSA on cultured stellate cells

The use of ciplatinum as a linker may introduce platinum-associated effects in the drug

targeting preparation. We therefore evaluated PTKI-ULS-M6PHSA for its effect on HSC

viability. In contrast to free cisplatin, which clearly displayed toxic effects, PTKI-

M6PHSA, PTKI and M6PHSA did not reduce the viability of HSC after 24h treatment

(Figure 2A).

To examine the potential antifibrotic effects of PTKI-M6PHSA conjugate and non-

conjugated PTKI on activated HSC, we investigated the expression of fibrosis related

genes in cultured HSC by quantitative RT-PCR. PTKI-M6PHSA downregulated the

Chapter 6

142


expression of α-SMA and collagen α1 (II) by 80% and 60% respectively, and PTKI

reduced the expression of the same genes with a similar potency (figure 2B). In contrast,

M6PHSA did not affect the expression of these genes in HSC. The other genes that were

examined, PDGFR-β or TIMP-1, were not significantly reduced by either treatment.

Effect of PTKI-M6PHSA on BDL3 liver slices

In addition to cultured cells, we also used another in vitro system, which encompasses all

liver cell types (hepatocytes, HSC, Kupffer cells and liver endothelial cells) in the context

of their natural environment and extracellular matrix (22). We incubated precision-cut

slices from fibrotic BDL rat livers (BDL3 slices) with PTKI-M6PHSA, PTKI or

M6PHSA and measured the impact of the compounds on gene expression by real-time

PCR.

Interestingly, PTKI-M6PHSA and PTKI had similar effects in liver-slices treatment and

cultured HSC (Figure 3). A significant suppression of collagen α1 (II), α-smooth muscle

actin, PDGFR-β and TIMP-1 mRNA levels by PTKI (80%; 70%; 60%, p<0.01 and 50%,

p<0.05, respectively) and PTKI-M6PHSA (70%; 70%, p<0.01; 40%, p<0.05, respectively)

was found after evaluation of mRNA expression levels.

Animal studies

Table 1 shows the animal characteristics after a single injection study of PTKI-M6PHSA

or vehicle. Administration of PTKI-M6PHSA did not affect the body weight of the

treated BDL rats versus non-treated. None of the biochemical parameters analyzed were

significantly changed.

Distr bution of PTKI-M6PHSA in f brotic ratsi i

Previous studies in our laboratory have demonstrated that M6PHSA binds to and is taken

up by activated HSC in the fibrotic liver. Typically, about 60% of the injected dose

accumulated in the fibrotic liver already within 10 min after administration, in a non-

parenchymal distribution pattern (17). The present study confirms this accumulation of

PTKI-M6PHSA in the liver 2h after administration (Figure 4A), while the construct was

undetectable in other organs like heart, kidney, lung and spleen. (Figure 4B-E). As shown

143

Chapter 6

in Figure 4A (right panel), the staining in the liver reflects non-parenchymal cell

distribution, with hardly any accumulation of the product in the hepatocytes. These results

suggest that the coupling of PTKI-ULS did not alter the distribution of the HSC-selective

carrier in vivo.

0

5000

10000

15000

20000

25000

30000

BDL + saline BDL + PTKI-M6PHSA

Sir

ius

Red

stai

ning

: ar

ea s

tain

ed p

er li

ver

bios

y

bdl day 10 bdl day 11bdl day 12

#

*

A

t

B

BD

L da

y 11

B

DL

day

12

Figure 5. Effect of PTKI-M6PHSA single adminis ration to BDL rats on the

deposition of collagen in the liver, as assessed by Sirius Red staining.

A. Quantification of the area with Sirius Red staining in rat liver specimens (n = 25, mean±sd ttest

between saline and drug treated groups:*P<0.01 and #P<0.05 vs. BDL saline control). B. Liver

sections were processed for immunohistochemistry and then stained with Sirius Red. Rats receiving saline

(left column) showed a marked deposition of collagen, as assessed with Sirius Red, which co-localized with

areas with active fibrogenesis. However, rats treated with PTKI-M6PHSA (right column) showed

Chapter 6

144


attenuated liver fibrosis development. Magnification (40x) photomicrograph of liver sections from bile duct

ligated rats on day 10 and 11 post BDL (i.e. 24h and 48h after administration, respectively).

fiEffects of PTKI-M6PHSA in brotic rats

Antifibrotic effects of PTKI-M6PHSA were studied in two different experimental set-ups.

First, we investigated whether a single dose of the product would affect fibrotic gene

expression, in a similar approach as described above for cultured HSC and precision-cut

slices. We did not observe changes in the expression of the chosen reporter genes for

fibrosis (data not shown). Immunohistochemical staining of fibrotic markers, however,

clearly indicated pharmacological activity of the delivered drug. Sirius Red staining for

collagen showed a continuous increment in deposited extracellular matrix components

between day 10 to 12 after bile duct ligation (Figure 5A). Treatment with a single dose of

PTKI-M6PHSA significantly attenuated collagen deposition both 24h and 48h after

administration (p<0.01; 0<0.05, respectively) (Figure 5B). Apart from reduced staining

intensity, the antifibrotic effect of PTKI-M6PHSA was also illustrated by a reduced

portal-portal bridging in fibrotic areas.

Smooth muscle α-actin staining (αSMA) showed an increased number of αSMA-positive

cells between days 10 and 12, which correlates with the exacerbation of liver fibrosis upon

prolonged BDL (Figure 6A). Treatment of BDL rats with PTKI-M6PHSA significantly

attenuated the number of activated HSC stained areas at 24h and 48h respectively (Figure

6B, p<0.01).

After completion of the single dose study, we continued our pharmacological evaluation

with a multiple dose study in the same model. Apart from testing of the conjugate PTKI-

M6PHSA, we now also included the free drug at a dose equivalent to the amount of PTKI

in the conjugate (150 µg/kg). Such a low dosage will not necessarily be therapeutically

effective, in view of the necessary dose of 5 to 20 mg/kg of imitanib in other studies

(12;25). Animal characteristics of the multiple dose study are included in Table 2.

We analyzed mRNA expression levels for collagen-α1 (II), smooth muscle α-actin,

PDGFR-β and TIMP-1 and found no significant differences between treated and

145

Chapter 6

untreated animals of study. Also collagen deposition and α- SMA expression was not

different between those groups (Table 3).

t

l

0

5000

10000

15000

20000

25000

30000


SM

A st

aini

ng:

area

sta

ined

per

live

r bio

sy bdl day 10 bdl day 11bdl day 12

**

A

B

BD

L da

y 11

B

DL

day

12

Figure 6. Effect of PTKI-M6PHSA single adminis ration to BDL rats on the

accumulation of myofibrob asts and activated HSC, as assessed by smooth muscle

α-actin expression (αSMA).

A. Quantification of the area with αSMA staining in rat liver specimens (n = 25, mean±sd ttest

between saline and drug treated groups:*P<0.01 vs. BDL saline control).

B. Liver sections were processed for immunohistochemistry and then stained with anti-αSMA antibody.

Rats receiving saline (left panels) showed a marked accumulation of αSMA-positive cells, which co-

localized with areas with active fibrogenesis. However, rats treated with PTKI-M6PHSA (right panels)

showed less quantity of αSMA-positive cells. Magnification (40x) photomicrograph of liver sections from

bile duct ligated rats on day 10 and 11 post BDL (i.e. 24h and 48h after administration, respectively)

Chapter 6

146


Discussion

Liver fibrosis is in principle a reversible process in which the stellate cells have been

identified as the key fibrogenic cells (26). PDGF is the most potent mitogen for HSC in

vitro, and it plays an important role in the transformation of HSC into myofibroblast-like

cells in vivo (27). Targeting the PDGF signalling cascade therefore represents a promising

antifibrotic approach. In the present study, we employed a kinase inhibitor with a closely

related structure to imatinib (Gleevec, Novartis). The antifibrogenic properties of the

latter well-known kinase inhibitor have already been described (10;12). On the other hand,

concerns have been raised in relation to the effectiveness of imatinib as an antifibrogenic

drug (13), especially in later stages of fibrosis. The new product PTKI-M6PHSA was

designed to effectively and specifically deliver the inhibitor to HSC, in order to improve

its antifibrotic properties. In the present study, we demonstrate the antifibrogenic effects

of PTKI-M6PHSA in two different and validated in vitro systems and in the BDL model

of liver fibrosis.

We confirmed that PTKI showed a similar antifibrotic potential as imatinib by incubating

the drug with culture-activated HSC and precision-cut liver slices. In both test systems,

PTKI potently inhibited the gene expression of fibrotic markers. The observed effect is

presumably attributed to the blockade of PDGF’s profibrogenic and mitogenic actions

since the growth factor is synthesized in situ by the activated HSC in culture or in slices

(28). Furthermore, PTKI is a very potent inhibitor of PDGFR-kinase with an IC50 of 10

nM (15). We also found that PTKI reduced PDGFR-β and TIMP-1 expression. TIMP-1

expression is increased during liver fibrosis and plays an important role in liver

fibrogenesis by modulating extracellular matrix remodelling (29). More importantly,

PTKI-M6PHSA had similar pharmacological effects as PTKI in activated HSC and

fibrotic liver slices. These results suggest that the drug is effectively released from the

carrier during the incubation period, and is capable of inhibiting the PDGF-R kinase

pathway.

147

Chapter 6

Having established the antifibrotic potential of the conjugate, we confirmed in vivo homing

of PTKI-M6PHSA from the circulation to the fibrotic liver. Similar to findings with other

drug-M6PHSA conjugates (19;30) we detected its presence in non-parenchymal cells by

anti-HSA immunostaining. These findings suggest that PTKI-M6PHSA is mainly

delivered within the fibrotic organ in BDL rats and therefore is associated with HSC.

Assuming that PTKI-M6PHSA behaves similar to other drug targeting preparations that

encompass the ULS linker, we can expect a slow release of PTKI during days rather than

hours, providing continuous local drug levels (19) (Prakash, SB-LZM paper2006,

Temming RGD-PEG-SB-HSA paper2006).

Several approaches for a blockade of the PDGF signaling have been investigated as a

strategy to block the ongoing liver fibrotic process. Some papers showed that monoclonal

antibodies directed against the extracellular domain of the PDGF receptor can prevent

binding of the PDGF ligand, thereby inhibiting mitogenic signaling (31;32). Consistent

with this, Kinnman and colleagues (9) described that imatinib inhibited PDGF-BB

induced proliferation of HSC in vitro, but a short-term treatment in vivo did not completely

blunt HSC proliferation 48 hours after BDL. In a different strategy, Borkham-Kamphorst

and colleagues produced a soluble antifibrogenic protein drug, sPDGFRB, and observed a

reduction in ECM deposition after daily administration fourteen days after BDL (33).

According to Neef and colleagues (13) this effect of imatinib is limited to the early phase

of fibrogenesis, due to the lack of efficiency in advanced liver injury, i.e., 3 to 4 weeks

after BDL. In contrast to this latter observtions, there is another study where a

pronounced inhibition of SMA-positive cells is found after 8 weeks of imatinib

administration (12). These authors found a marked attenuation of the liver fibrosis in the

pig-serum induced model of liver fibrosis, characterized by a slow progression of

fibrogenesis, resembling the human situation. Thus, it might be a relevant therapy in

patients with early stages of liver fibrosis.

Our strategy differs completely from the above listed studies in which the free drug

imatinib is used (10;12). We employed a carrier, M6PHSA that is internalized by the target

HSC and releases the kinase inhibitor inside the cells.

Chapter 6

148


After single administration, PTKI-M6PHSA markedly reduced collagen deposition

together with a suppression of αSMA-positive cells number which reflects activated HSC

(34). In contrast to the effects on protein levels, PTKI-M6PHSA administered to BDL

animals did not affect the gene expression of the fibrotic markers. This discrepancy either

reflects different sensitivity of the assays, or corresponds to a greater reduction of collagen

and αSMA at the protein level than at gene expression level. This divergence has

previously been described in experiments investigating the inhibition of hepatic fibrosis

(35), and might be due to post-transcriptional regulation of collagen expression in cultured

HSC (36).

The observation that antifibrotic effects are discernable even 48h after a single dose

suggests that effective PTKI levels are present during a prolonged period of time. In

previous studies with other ULS-based conjugates, we have observed a slow drug release

pattern from the ULS linker that may afford continuous drug release during a period of

days (19). The proposed mechanism is competitive displacement of the drug by S-donor

ligands like glutathione and ligands containing sulfur atoms (e.g. methionine) or aromatic

nitrogens (nucleotides, histidine). After binding of PTKI-M6PHSA to HSC and its

internalization, the release of PTKI from the conjugate is a critical point for exerting the

inhibitory effect on PDGF-R kinase. The release of PTKI may occur in the lysosomes, the

compartment to which M6PHSA is routed after internalization (37). Hence, a continued

release of PTKI from the conjugate would be available and a sustained blockade of

PDGF kinase activity may be achieved. In the present study, PTKI-M6PHSA produced a

significant effect on the fibrotic process 24 to 48 hours after its administration to BDL

rats. These results are in good agreement with the previously hypothesized release kinetics

of our drug-conjugates. Furthermore, it suggests the possibility of employing PTKI-

M6PHSA as a depot from which the drug is released for a prolonged period of time.

Our data are in good agreement with the studies of Neef and colleagues. Yet, after

multiple dose administration of PTKI-M6PHSA, the collagen and αSMA protein

expression was not decreased while the results mentioned above show that the process of

liver fibrosis development is clearly decreased by a single dose of PTKI-M6PHSA. How

149

Chapter 6

can this unexpected lack of effect after repeated administration of our drug-targeting

conjugate be explained? We propose that this may be due to the activation of alternative

cytokine pathways that compensates for the inhibition of PDGF-R cascade (38).

Parameter analyzed

BDL day 10 + control

saline

BDL day 14 + control

saline

BDL day 14 + PTKI-M6PHSA

BDL day 14 + PTKI

GAPDH 1.1 ± 0.4 1.3 ± 0.6 0.8 ± 0.2 1.3 ± 0.4

α-SMA 0.8 ± 0.4 1.1 ± 0.7 1.2 ± 0.3 1.1 ± 0.3

Collagen

0.8 ± 0.3 1.3 ± 0.3 1.2 ± 0.4 1.2 ± 0.5

Gene expression

(fold induction)

PDGF Receptor 1.0 ± 0.3 3.2 ± 2.4 3.2 ± 1.9 2.6± 0.6

Sirius Red staining ++ +++ +++ +++

Protein expression

(staining intensity)

αSMA staining

++ +++ +++ +++

Table 3. Effect of PTKI-M6PHSA multiple administration to BDL rats. Data are

shown as mean ± SD.

Redundancy of regulatory pathways is a common feature in the fibrotic process.

Especially if the causative agent of liver fibrosis is not removed, the specific inhibition of

PDGF-R on the hepatic stellate cells may temporarily affect the proliferation of HSC and

collagen deposition, as we observed after single injection of PTKI-M6PHSA, but not after

prolonged administration of PDGF-R inhibitor. Long-term administration of PTKI-

M6PHSA may allow enough time for the activation of alternative pathways, such as TGF-

Chapter 6

150


β, that may compensate for the inhibition of PDGF cascade (13). Albeit other

compensatory mechanisms are also possible, this would also suggest that the combined

elimination of more than one pathway could lead to an effective inhibition of hepatic

fibrosis (33). For example, simultaneous inhibition of PDGF and TGF-β cascade might

be more appropriate strategy to attenuate the process of liver fibrosis. Recent experiments

explaining this approach showed that it was more effective than inhibition of either

pathway alone (39). A TGF-β receptor kinase inhibitor has been described and cell-

selective delivery of this construct to the kidney is now being examined in our laboratory

(Prakash, manuscript in preparation). Consequently, targeting both cascades would be an

eligible approach in future investigations.

In conclusion, the data presented in the present study provide evidence that PTKI-

M6PHSA is effective in vitro and specifically taken up by non-parenchymal cells in the

liver, during fibrosis. Single dose administration of PTKI-M6PHSA proved to be an

effective antifibrotic strategy in vivo, although prolonged administration did not reveal

significant effects. Cell-selective elimination of multiple signalling pathways may provide a

tool to design novel strategies.

Acknowledgements


Netherlands (R 02-1719, 98-162). Jan Visser and Jai Prakash (University of Groningen,

The Netherlands) are kindly acknowledged for assistance in HPLC analysis and colleagues

at Kreatech for critical reading of the manuscript.

151

Chapter 6

Reference List




4. Wong,L., Yamasaki,G., Johnson,R.J., and Friedman,S.L. 1994. Induction of b-platelet-derived growth factor receptor in rat hepatic lipocytes during cellular activation in vivo and in culture. J. Clin. Invest.1563-1569.

5. De Bleser,P.J., Jannes,P., Van Buul-Offers,S.C., Hoogerbrugge,C.M., Van Schravendijk,C.F.H., Niki,T., Rogiers,V., Van den Brande,J.L., Wisse,E., and Geerts,A. 1995. Insulinlike growth factor-II/mannose 6-phosphate receptor is expressed on CCl4-exposed rat fat-storing cells and facilitates activation of latent transforming growth factor-b in cocultures with sinusoidal endothelial cells. Hepatol 21:1429-1437.

6. Weiner,J.A., Chen,A., and Davis,B.H. 2000. Platelet-derived growth factor is a principal inductive factormodulating mannose 6-phosphate/insulin-like growth factor-II receptorgene expression via a distal E-box in activated hepatic stellate cells. Biochem. J. 345 Pt 2:225-231.

7. Bachem,M.G., Meyer,D., Schäfer,W., Riess,U., Melchior,R., Sell,K.M., and Gressner,A.M. 1993. The response of rat liver perisinusoidal lipocytes to polypeptide growth regulator changes with their transdifferentiation into myofibroblast-like cells in culture. J. Hepatol. 18:40-52.

8. von,M.M. 2005. Targeted therapy with imatinib: hits and misses? J. Clin. Oncol. 23:8-10.

9. Kinnman,N., Goria,O., Wendum,D., Gendron,M.C., Rey,C., Poupon,R., and Housset,C. 2001. Hepatic stellate cell proliferation is an early platelet-derived growth factor-mediated cellular event in rat cholestatic liver injury. Lab Invest 81:1709-1716.


11. Buchdunger,E., Zimmermann,J., Mett,H., Meyer,T., Muller,M., Regenass,U., and Lydon,N.B.

1995. Selective inhibition of the platelet-derived growth factor signal transduction pathway by a protein-tyrosine kinase inhibitor of the 2-phenylaminopyrimidine class. Proc. Natl. Acad. Sci. U. S. A 92:2558-2562.

12. Yoshiji,H., Noguchi,R., Kuriyama,S., Ikenaka,Y., Yoshii,J., Yanase,K., Namisaki,T., Kitade,M., Masaki,T., and Fukui,H. 2005. Imatinib mesylate (STI-571) attenuates liver fibrosis development in rats. Am. J. Physiol Gastrointest. Liver Physiol 288:G907-G913.

13. Neef,M., Ledermann,M., Saegesser,H., Schneider,V., Widmer,N., Decosterd,L.A., Rochat,B., and Reichen,J. 2006. Oral imatinib treatment reduces early fibrogenesis but does not prevent progression in the long term. J. Hepatol. 44:167-175.


15. Zimmermann,J., Buchdunger,E., Mett,H., Meyer,T., and Lydon,N.B. 1997. Potent and selective inhibitors of the abl-kinase:phenylamino-pyrimidine (PAP) derivatives. Bioorganic & Medicinal Chemistry Letters 7:187-192.





20. Beljaars,L., Weert,B., Geerts,A., Meijer,D.K.F., and Poelstra,K. 2003. The preferential homing of a platelet derived growth factor receptor-recognizing macromolecule to fibroblast-like cells in fibrotic tissue. Biochem. Pharmacol. 66:1307-1317.

21. Geerts,A., Niki,T., Hellemans,K., De Craemer,D., Van den Berg,K., Lazou,J.-M., Stange,G., Van de Winkel,M., and De Bleser,P.J.

Chapter 6

152


1998. Purification of rat hepatic stellate cells by side scatter-activated cell sorting. Hepatol 27:590-598.

22. Olinga,P., Merema,M.T., de Jager,M.H., Derks,F., Melgert,B.N., Moshage,H., Slooff,M.J., Meijer,D.K., Poelstra,K., and Groothuis,G.M. 2001. Rat liver slices as a tool to study LPS-induced inflammatory response in the liver. J. Hepatol. 35:187-194.

23. van de,B.M., Groothuis,G.M., Draaisma,A.L., Merema,M.T., Bezuijen,J.I., van Gils,M.J., Meijer,D.K., Friedman,S.L., and Olinga,P. 2005. Precision-cut liver slices as a new model to study toxicity-induced hepatic stellate cell activation in a physiologic milieu. Toxicol. Sci. 85:632-638.

24. Beljaars,L., Poelstra,K., Molema,G., and Meijer,D.K.F. 1998. Targeting of sugar- and charge-modified albumins to fibrotic rat livers: the accessibility of hepatic cells after chronic bile duct ligation. J. Hepatol. 29:579-588.



27. Pinzani,M., Milani,S., Grappone,C., Weber,F.L., Gentilini,P., and Abboud,H.E. 1994. Expression of Platelet-Derived Growth Factor in a Model of Acute Liver Injury. Hepatol 19:701-707.


29. Iredale,J.P., Benyon,R.C., Pickering,J., McCullen,M., Northrop,M., Pawley,S., Hovell,C., and Arthur,M.J.P. 1998. `Mechanisms of spontaneous resolution of rat liver fibrosis - Hepatic stellate cell apoptosis and reduced hepatic expression of metalloproteinase inhibitors. J. Clin. Invest. 102:538-549.

30. Greupink,R., Bakker,H.I., Reker-Smit,C., van Loenen-Weemaes,A.M., Kok,R.J., Meijer,D.K.F., Beljaars,L., and Poelstra,K. 2005. Studies on the targeted delivery of the antifibrogenic compound mycophenolic acid to the hepatic stellate cell. J. Hepatol. 43:884-892.

31. Heldin,C.-H. 1997. Simultaneous induction of stimulatory and inhibitory signals by PDGF. FEBS Lett. 410:17-21.

32. Shulman,T., Sauer,F.G., Jackman,R.M., Chang,C.N., and Landolfi,N.F. 1997. An antibody reactive with domain 4 of the platelet-derived growth factor beta receptor allows BB binding while inhibiting proliferation by impairing receptor dimerization. J. Biol. Chem. 272:17400-17404.

33. Borkham-Kamphorst,E., Herrmann,J., Stoll,D., Treptau,J., Gressner,A.M., and Weiskirchen,R. 2004. Dominant-negative soluble PDGF-beta receptor inhibits hepatic stellate cell activation and attenuates liver fibrosis. Lab Invest 84:766-777.

34. Olaso,E., and Friedman,S.L. 1998. Molecular regulation of hepatic fibrogenesis. J. Hepatol. 29:836-847.

35. Yata,Y., Gotwals,P., Koteliansky,V., and Rockey,D.C. 2002. Dose-dependent inhibition of hepatic fibrosis in mice by a TGF-beta soluble receptor: implications for antifibrotic therapy. Hepatology 35:1022-1030.

36. Stefanovic,B., Hellerbrand,C., Holcik,M., Briendl,M., Aliebhaber,S., and Brenner,D.A. 1997. Posttranscriptional regulation of collagen alpha1(I) mRNA in hepatic stellate cells. Mol. Cell Biol. 17:5201-5209.


38. Kinnman,N., Hultcrantz,R., Barbu,V., Rey,C., Wendum,D., Poupon,R., and Housset,C. 2000. PDGF-mediated chemoattraction of hepatic stellate cells by bile duct segments in cholestatic liver injury. Lab Invest 80:697-707.

39. Yoshiji,H., Kuriyama,S., Noguchi,R., Ikenaka,Y., Yoshii,J., Yanase,K., Namisaki,T., Kitade,M., Yamazaki,M., Asada,K. et al 2006. Amelioration of liver fibrogenesis by dual inhibition of PDGF and TGF-beta with a combination of imatinib mesylate and ACE inhibitor in rats. Int. J. Mol. Med. 17:899-904.

2

costa da mote

boektitel

In ancient times, Romans called the Galician coast in Spain along the n

tip of the Iberia

orthwestern

n Peninsula " Finisterrae" (End of the Land), and in modern

osta da Morte, Finisterre, La Coruña

times this coastal area is known as "Costa da Morte" (The Dead Coast).

Severe storms have destroyed many ships over the centuries.

C

Galicia, España.

Chapter7Summarizing discussion, conclusions and future perspectives

156

Summarizing discussion, conclusions and perspectives

Liver fibrosis is a progressive disease that ultimately leads to cirrhosis and this occurs

when the ongoing injury and the subsequent excessive production of extracellular matrix

are not stopped (1). The cause of liver fibrosis can be very diverse: alcoholism, chronic

infection by virus Hepatitis B or C, diabetes, obesity, as well as autoimmune diseases. A

considerable number of people are affected by liver fibrosis, presently being the 9th

leading cause of death in the western world. Since most of the proclaimed antifibrotic

therapies have failed in clinical testing, liver transplantation remains the only relevant and

successful treatment. This invasive procedure however constitutes severe risks for the

patient, and is associated with high costs and lack of donor organs. Consequently, liver

fibrosis is an unmet medical need and novel antifibrotic therapies will have a huge impact

on the future treatment of liver diseases (2).

Recent insights in the molecular mechanisms of liver fibrosis have provided novel

approaches in mechanistically-based antifibrotic strategies. One of the most important

findings is the recognition of activated hepatic stellate cells (HSC) as major collagen-

producing cells in the injured liver, and their identification as a major target cell for

antifibrotic therapy (3;4). In the present PhD research project we exploited this knowledge

and studied the possibility of treating liver fibrosis by targeting antifibrotic drugs to these

HSC. By using a cell-selective delivery of drugs in the body, we can improve drugs that

exhibit unacceptable side-effects that limit their clinical applicability. To deliver these

potential antifibrotic drugs to HSC, mannose-6-phosphate-modified human serum

albumin (M6PHSA) was employed as a drug carrier (5). Although this technology has

been applied for various drugs in recent years as a novel therapeutic approach in the liver

fibrosis field, not all promising antifibrotic drugs possess appropriate chemical groups for

their conjugation to M6PHSA. In the present study, we therefore explored a new linker

technology for the preparation of HSC-directed conjugates of antifibrotic drugs, which

allowed the targeting of a broader range of drugs. We show that the application of the

platinum-based linkage system ULS™ as drug linker, permitted a straightforward and

rapid method for the development of drug-M6PHSA conjugates, and afforded the

investigation of three new products in the chosen liver fibrosis models. We hypothesized

157

Chapter 7

that cell-specific distribution of these products and the fact that they accumulate inside the

target stellate cells will improve the efficacy of the conjugated drugs greatly, and will also

prevent undesired side effects.

Chapter 1 presents the scope of the present thesis. Chapter 2 briefly reviews the function

of the liver and the problems associated with liver fibrosis. In the same chapter, we also

describe the pharmacological actions of the drugs employed in the present thesis. The

selection of the antifibrotic drug candidates was guided by two main criteria:

1. The candidate drug should be a promising antifibrotic agent to treat liver fibrosis or

acts on a crucial HSC process in this respect, but may exhibit severe side effects in

other tissues than the liver. The candidate drug may not only exert antifibrotic actions

in HSC but also profibrotic actions in other cell types, so that cell-selective drug

targeting will confine its activity to HSC. Pentoxifylline (PTX, chapter 3) is a

representative of this latter class of compounds, while losartan (chapter 4&5) can be

regarded a compound with a safety risk in fibrotic patients, despite its well-

documented safety in hypertensive patients. The third compound (PTKI, chapter 6), a

PDGF kinase inhibitor with great similarity to the anticancer agent Gleevec

(Novartis), is an experimental compound of which the safety profile has not been

investigated. Yet, the widespread involvement of PDGF receptor systems in various

physiological processes implies that its inhibition will evoke intra or extrahepatic side

effects, and that this drug may strongly benefit from targeting.

2. The candidate drug lacks appropriate chemical groups that allow its conjugation to

the M6PHSA carrier via the common covalent coupling reactions. Yet, it should have

a chemical structure that enables a coordinative bond with the ULS linker. These

specifications are discussed in the second part of chapter 2.

In chapter 3, we describe the development of the first generation of ULS-based

conjugates, PTX-M6PHSA, and we demonstrate that the application of the ULS

linker is straightforward and safe, despite its cisplatin-related structure. Several

Chapter 7

158


chemical and biological characteristics of the product were examined in various in vitro

assays, to demonstrate the feasibility of platinum-based linkage chemistry for drug delivery

purposes. We investigated conjugate stability and biodegradability, safety, and

pharmacological efficacy, and concluded that the conjugate possessed unique drug-

releasing properties. We also observed promising antifibrotic effects of PTX-M6PHSA in

vitro. The production of collagen was reduced notably and we observed striking changes in

the morphology of HSC, which were not observed after treatment with free PTX.

Although the observed changes in morphology suggest that the cells may detach and die

“anoikis”, we did not observe this in our apoptosis or viability assays. An elimination of

fibrogenic HSC by PTX-M6PHSA may be a beneficial effect during liver fibrosis, apart

from antifibrotic effects by reducing collagen deposition. We therefore concluded that

PTX-M6PHSA is a promising candidate for further evaluation as an antifibrotic drug.

We also showed that advanced liver fibrosis can be successfully treated with

losartan-M6PHSA, the second novel conjugate presented in this thesis. Chapters 4

& 5 describe the development, characterization and in vivo properties of losartan-

M6PHSA. The effect of losartan-M6PHSA was extensively studied in two different rat

models of liver fibrosis. Importantly, this novel drug targeting preparation appeared to be

far more effective than free losartan, despite the lower dosage of losartan-M6PHSA

administered, compared to free losartan. This observation indicated that drug targeting

may enhance the intrinsic efficacy of antifibrotic agents. This improvement was attributed

to an altered biodistribution of the drug in the organism and we demonstrated an

enhanced delivery of our construct to HSC. We examined several steps in the cellular

handling of the conjugate: First, after binding to M6P/IGFII receptor, losartan-M6PHSA

was internalized via the endocytotic route (5). Degradation of the conjugate will therefore

occur in the lysosomes, the compartment to which M6PHSA is routed after

internalization (6). We postulate that drug release occurs in multiple steps, in which the

albumin is first degraded by lysosomal enzymes, followed by actual release of the drug

from ULS in other intracellular compartments, e.g. in the cytosol. This chemical bond

between the drug and the ULS can not be degraded by proteinases or low pH present

159

Chapter 7

within the lysosomes. More likely, release of the drug will occur by competitive agents that

bind to the ULS and displace the drug. Glutathione may be such a compound (7). The

cytosol contains high levels of glutathione, so we hypothesize that this compound

competitively displaces losartan from the platinum linker, a process that we have already

demonstrated in vitro for PTX-M6PHSA. Since the intracellular drug release rate was

shown to be relatively slow, a local depot of losartan is formed in the target cells that will

generate continuous drug levels at the target site.

The mechanism of action of losartan-M6PHSA during liver fibrosis is unknown, and

pharmacodynamic differences with the parent drug can not be excluded. The effect of

losartan is mediated by binding to the angiotensin II type 1 receptor (AT1). Interaction of

losartan with this AT1 receptor after binding of losartan-M6PHSA to the M6P/IGFII

receptor may occur via receptor cross-talk in the dynamic plasma membrane. In this

context, the so- called “rafts”, enriched domains where various receptors reside (8), or the

dynamic membrane invaginations in the early endosomes may facilitate such a process. In

this case, we propose a model where cell-membrane associated losartan-M6PHSA might

bind to other putative receptors on the plasma membrane. Another possibility is that

Losartan-M6PHSA may act as an antagonist of the AT1 receptor of a neighbouring cell.

Subsequently, the involvement of angiotensin II (Ang II) in the modulation of TGF-β

ligand expression may be important for the antifibrotic action of losartan (9). Ang II

increased TGF-β gene expression in a dose-dependent manner in activated HSCs in vitro

(10). TGF-β plays a crucial role in HSC activation and thereby regulates the production of

matrix molecules during liver fibrosis. The increase of intrahepatic levels of TGF-β,

induced by bile duct ligation, was attenuated in AT1 receptor knockout mice (11).

Inhibition of the release of Ang II by losartan therefore can markedly suppress the

development of liver fibrosis (12;13). So, Ang II seems to be an important pro-fibrotic

factor. Thus, the selective delivery of losartan to the HSC by means of losartan-M6PHSA

may also interfere in the TGF-β cascade and therefore account for the observed

antifibrotic effect.

Chapter 7

160


Drug targeting of antifibrotic agents to the liver has been frequently investigated in the

bile duct ligation (BDL) model. The extrahepatic obstruction of the bile duct leads to an

accumulation of bile salts and other molecules that provoke an inflammatory and

fibrogenic process in the liver and bile duct proliferation (14). In the CCl4 model of liver

fibrosis, the injury is induced by administration of CCl4 and phenobarbital and the

pathogenesis of fibrosis in this model is completely different from the BDL model. BDL

is a very rapid and progressive model (15), while the CCl4 model of liver fibrosis is

relatively slow. Consequently, the CCl4 model may better reflect human fibrotic disease, in

which the slow fibrogenic process can be ongoing for several years before the disease

becomes manifest and treatment is initiated.

The demonstration of the efficacy of losartan-M6PHSA in both the BDL model and the

CCl4 model of liver fibrosis thus strengthens its potential as a new antifibrotic modality.

In Chapter 6, we present studies showing that the delivery of a PDGF-kinase-

inhibiting drug to HSC may be a novel strategy to attenuate liver fibrogenesis.

Targeting the PDGF signaling cascade represents a promising antifibrotic approach since

PDGF is regarded as the most potent mitogen for HSC in vitro, and it plays an important

role in the transformation of HSC into myofibroblast-like cells in vivo (16). Recent studies

have reported antifibrogenic effects of the BCR-ABL kinase inhibitor imatinib (Gleevec),

which potently inhibits PDGF-BB kinase (17;18). Kinase inhibitors represent an

important and challenging class of novel therapeutics. They seem especially suitable for

specific interference with the activation or transformation of cells induced by growth

factors or inflammatory mediators. The HSC-selective carrier M6PHSA was therefore

equipped with the PDGF receptor tyrosine kinase inhibitor (PTKI, a compound closely

related to imatinib) by means of the ULS-based linkage strategy. PTKI-M6PHSA induced

antifibrogenic effects in cultured HSC and in fibrotic liver slices, and also displayed

significant antifibrotic effects after a single dose in the BDL model of liver fibrosis.

However, the administration of multiple dosages did not lead to a significant

enhancement of the effect. Thus, while PTKI-M6PHSA proved most effective in vitro,

losartan-M6PHSA was the most effective compound in animal models. Of note, there is

161

Chapter 7

an evident increase of PDGF receptor expression in the BDL model of liver fibrosis from

day 10 to day 14. This receptor system apparently could not be efficiently blocked by the

dose of the targeted PTKI that we administered. We suggest that a higher dose could

improve the effect of PTKI via an effective blockade of the PDGF receptor kinase, which

is so abundantly expressed in activated HSC.

The observed differences in effectiveness may be also explained by the complex nature of

liver fibrosis and HSC activation. Especially if the causative agent of liver fibrosis is not

removed, specific inhibition of PDGF-R in HSC may only temporarily affect HSC

proliferation (19). Chronic treatment regimens might allow enough time for the activation

of alternative pathways and cytokines that may compensate for the inhibition of the

PDGF cascade (20). Thus, only inhibiting PDGF would not be sufficient to stop HSC

proliferation, activation and subsequent production of extracellular matrix constituents.

Parallel pro-fibrogenic mechanisms, such as TGF-β-mediated activation, could be

responsible for triggering the fibrogenic process within the liver despite a complete

blockade of the PDGF receptor pathway.

Future perspectives.

Our strategy offers multiple opportunities for the development of novel HSC- directed

therapeutics. For instance, the coupling of different classes of kinase inhibitors that

presented problems with conjugation to M6PHSA-like carriers in the past. This strategy

profoundly changes the body distribution of these drugs and thus leading to enhanced

efficacy and reduced side-effects which are important especially for the long-term

treatment with this kind of drugs.

An interesting new concept that may originate from the studies with PTKI-M6PHSA is

the use of so-called “cocktail treatments”. Such combination therapies are already

common in anticancer research, but could also be applicable to liver fibrosis.

Chapter 7

162


What cocktail would be the most effective one, can only be speculated but a combined

inhibition of TGF-β and PDGF cascades might significantly contribute to an effective

inhibition of hepatic fibrosis (21). Kinase inhibiting drugs may represent a valuable asset

in such an approach. In a similar linkage strategy as described for the other drugs in this

thesis, a TGF-β receptor kinase inhibitor (ALK5 inhibitor, 3-(Pyridin-2-yl)-4-(4-quinonyl)-

1H-pyrazole) was conjugated to a renal targeting system (Prakash, manuscript in

preparation), and this approach is also applicable to the M6PHSA carrier. Combined

administration of the ALK5-inh-M6PHSA conjugate with PTKI-M6PHSA can be

explored to counteract PDGF and TGF kinase cascades in HSC, but other rational

combinations of inhibitors are feasible as well. Interestingly, the combination of two

antifibrotic agents intervening in PDGF signaling (imitanib) and the renin-angiotensin

pathway (the angiotensin converting enzyme inhibitor, perindopril) has recently been

investigated and proved more effective than inhibition of either pathway alone (22). The

participation of angiotensin II (Ang II) in modulating TGF-β expression has been already

discussed. Ang II is a potent inducer of TGF-β synthesis in cultured HSCs in vitro (10)

and intervention with the renin-angiotensin system (RAS) appears to be very effective if

this is combined with an inhibition of the mitogenic action of PDGF. In this respect, a

combination therapy with losartan-M6PHSA and PTKI-M6PHSA seems an attractive

approach, and both conjugates are currently available in our department. Thus, targeting

of both intracellular cascades in the HSC could be the eligible approach in future

investigations for an effective anti-fibrotic therapy.

Another possibility is to target anti-angiogenic drugs to the fibrotic liver, in order to

prevent the development of hepatocarcinoma in patients with liver fibrosis. It has been

already reported that neovascularization is increased during the development of liver

fibrosis, and suppression of angiogenic signaling attenuates liver fibrogenesis (23). The

ongoing destruction of healthy liver tissue and tissue remodeling during liver fibrosis

constitutes a serious risk factor for the development of liver cancer (24). Among others,

liver fibrosis is associated with hypoxia, which is one of the strongest inducers of vascular

endothelial growth factor (VEGF)(25). The elevated expression of VEGF and other

163

Chapter 7

growth factors favors the progression of tumor growth and angiogenesis. Delivery of a

VEGF receptor kinase inhibitor to the fibrotic liver thus seems an interesting approach,

and the delivery of anti-angiogenic agents to endothelial cells was shown to be a feasibile

option in our lab. We have recently developed drug-carrier conjugates of the VEGF-

receptor kinase inhibitor PTK787 (vatalanib) and RGD-equipped albumins (Temming,

manuscript in preparation). The presently discussed ULS-based conjugation strategy was

also applied for preparation of these PTK787-HSA conjugates. Another interesting aspect

of PTK787 is that it also inhibits the PDGR receptor kinase, apart from its VEGF

receptor kinase inhibition. Therefore, the delivery of PTK787 to the fibrotic liver by

means of a PTK787-M6PHSA conjugate would interfere with the formation of new blood

vessels and simultaneously affect the proliferative actions of PDGF on HSC, thus

combining antiangiogenic activity with antifibrotic actions.

Another quite relevant question is which specific pathways need to be blocked at specific

phases of the fibrotic process. Various profibrotic pathways become activated at different

time points during the progression of liver fibrosis (26), so the timing of an appropriate

therapy is crucial for its efficacy. Antifibrotic agents can either serve as a preventive

therapy for the development of fibrosis in newly affected areas, or they may act in areas

where the fibrosis is already established. A specific treatment might evolve in a

personalized therapy, in which the disease progression and therapeutic response should

both be closely monitored in time. Future experiments may therefore focus on the

activation of kinase pathways and expression profiles of profibrotic factors by inspecting

biopsies from patients suffering from liver fibrosis. The availability of appropriate

biomarkers will enable disease monitoring and the proper selection of antifibrotic drugs

that subsequently can be delivered specifically to the fibrotic liver by means of drug

conjugates.

Apart from developing a novel linker technology, we also have developed a very

promising compound, losartan-M6PHSA, which showed antifibrotic effects in two

different models of liver fibrosis. The optimization of losartan-M6PHSA conjugates

should be part of future research, including the investigation of long-term administration

Chapter 7

164


and safety before the clinical trials. In addition, it would be interesting to explore the

application of losartan-M6PHSA to treat the portal hypertension occurring in liver

fibrosis. Cirrhotic patients suffer from portal hypertension which, as a consequence, leads

to systemic hypotension. The specific delivery of losartan to the liver would avoid its

hypotensive actions in peripheral vascular beds, and by this reduce the risk of a

hypotensive shock. Testing of this hypothesis in an animal model of advanced liver

fibrosis, including measurement of both systemic and portal blood pressure seems one of

the most challenging ideas. In addition, follow-up studies of losartan-M6PHSA in

different animal models of liver fibrosis are required to validate its therapeutic applicability

in this disease.

Furthermore, we have demonstrated that ULS-based products are not-toxic per se, as

demonstrated by Alamar blue studies, caspase 3/7 activation and TUNEL assays in vitro. In

sight of a prolonged administration of ULS conjugates to treat liver fibrosis the question

that remains unanswered is the toxicity of cisplatinum after drug release. There are various

reasons that validate its potential application in therapy. Compared to the high

administration of cisplatinum in antitumour therapy, the dose that it would be

administered to stop liver fibrosis is rather low. First, because the fibrogenesis in the liver

is developed during ten to twenty years and the therapy would aim to a monthly

administration of a potent antifibrotic drug targeted to HSC, which would prevent the

formation of extracellular matrix and scar tissue. Secondly, ULS’s reactive groups are

covered with the targeted drug and the carrier. After degradation of the carrier and release

of the drug, ULS linker would be readily detoxified with many intracellular molecules that

are available in the cell containing amino or thiol groups. Taking into consideration that

this is one of the reasons explaining the cell-resistance phenomenon to cisplatinum in

anticancer therapy, the ULS strategy remains applicable. In any case, a favorable treatment

for the patients with liver fibrosis would prevail always considering the suitable balance of

the beneficial treatment versus possible side effects. In this regard, more extensive safety

testing is required during further development of this technology.

165

Chapter 7

Conclusions

The research presented in this thesis demonstrates that platinum coordination chemistry

can be employed for the conjugation of potential drug candidates to target the fibrotic

liver. Drug-ULS conjugates display adequate stability and bioreversibility, and a unique

slow release profile of the coupled drug upon prolonged incubation. This feature can be

attributed to the platinum-coordination bond and has been observed for all tested

compounds. We demonstrated that our approach of HSC-directed drug targeting is

effective in animal models of liver fibrosis, both when examining hepatic drug levels and

the pharmacological outcome. Eventually, the present work may generate a versatile

approach for linking various antifibrotic agents and other classes of drugs to targeting

devices, leading to effective conjugates that can stop or reverse the ongoing process of

liver fibrosis.

7

Chapter 7

166


Reference List








8. Pike,L.J. 2006. Rafts Defined. J. Lipid Res.


10. Bataller,R., Sancho-Bru,P., Gines,P., Lora,J.M., Al Garawi,A., Sole,M., Colmenero,J., Nicolas,J.M., Jimenez,W., Weich,N. et al 2003. Activated human hepatic stellate cells express the renin-angiotensin system and synthesize angiotensin II. Gastroenterology 125:117-125.

11. Yang,L., Bataller,R., Dulyx,J., Coffman,T.M., Gines,P., Rippe,R.A., and Brenner,D.A. 2005. Attenuated hepatic inflammation and fibrosis in angiotensin type 1a receptor deficient mice. J. Hepatol. 43:317-323.

12. George,J., Roulot,D., Koteliansky,V.E., and Bissell,D.M. 1999. In vivo inhibition of rat stellate cell activation by soluble transforming growth

factor beta type II receptor: a potential new therapy for hepatic fibrosis. Proc. Natl. Acad. Sci. U. S. A 96:12719-12724.

13. Nakamura,T., Sakata,R., Ueno,T., Sata,M., and Ueno,H. 2000. Inhibition of transforming growth factor beta prevents progression of liver fibrosis and enhances hepatocyte regeneration in dimethylnitrosamine-treated rats. Hepatology 32:247-255.

14. Nan,J.X., Park,E.J., Lee,S.H., Park,P.H., Kim,J.Y., Ko,G.N., and Sohn,D.H. 2000. Antifibrotic effect of Stephania tetrandra on experimental liver fibrosis induced by bile duct ligation and scission in rats. Arch. Pharm. Research 23:501-506.

15. Kountouras,J., Billing,B.H., and Scheuer,P.J. 1984. Prolonged bile duct obstruction: a new experimental model for cirrhosis in the rat. Br. J. Exp. Pathol. 65:305-311.




19. Kinnman,N., Hultcrantz,R., Barbu,V., Rey,C., Wendum,D., Poupon,R., and Housset,C. 2000. PDGF-mediated chemoattraction of hepatic stellate cells by bile duct segments in cholestatic liver injury. Lab Invest 80:697-707.


21. Borkham-Kamphorst,E., Herrmann,J., Stoll,D., Treptau,J., Gressner,A.M., and Weiskirchen,R. 2004. Dominant-negative soluble PDGF-beta receptor inhibits hepatic stellate cell

167

Chapter 7

activation and attenuates liver fibrosis. Lab Invest 84:766-777.


23. Yoshiji,H., Kuriyama,S., Yoshii,J., Ikenaka,Y., Noguchi,R., Hicklin,D.J., Wu,Y., Yanase,K., Namisaki,T., Yamazaki,M. et al 2003. Vascular endothelial growth factor and receptor interaction is a prerequisite for murine hepatic fibrogenesis. Gut 52:1347-1354.

24. Park,Y.N., Yang,C.P., Cubukcu,O., Thung,S.N., and Theise,N.D. 1997. Hepatic stellate cell activation in dysplastic nodules: evidence for an alternate hypothesis concerning human hepatocarcinogenesis. Liver 17:271-274.

25. Kim,K.R., Moon,H.E., and Kim,K.W. 2002. Hypoxia-induced angiogenesis in human hepatocellular carcinoma. J. Mol. Med. 80:703-714.


Chapter 7

Cafe Central with its gothic vaults and quality coffee is probably the most famous coffeehouse in Vienna. At the turn of the century, it was a meeting place for intellectuals such as Victor Adler and Otto Bauer, writer Peter Altenberg and Leon Trotsky.

Annual meeting & Exposition of the Controlled Release Society

Vienna, Austria, 2006.

Chapter8Samenvatting

Don’t take life too seriously; you will never get out of it alive.

(Elbert Hubbard, 1856-1915).

170

Samenvatting

Lever fibrose is een chronische ziekte waarbij de leverfunctie steeds verder achteruitgaat

door beschadiging van gezonde delen van de lever en de daaropvolgende productie van

littekenweefsel (extracellulaire matrix). Veel voorkomende oorzaken van lever fibrose zijn:

alcoholisme, infecties met het Hepatitis B of C virus, diabetes, obesitas en autoimmuun

ziektes. Lever fibrose is de 9e doodsoorzaak door ziekte in de wereld, maar komt in

toenemende mate voor door stijging van het aantal mensen met overgewicht en met

hepatitis C infecties.

Op dit moment zijn er nog geen goede therapieën voor lever fibrose en veel van de

nieuwe experimentele middelen falen in klinische studies. Transplantatie van de lever is op

dit moment de enige mogelijke behandeling voor cirrhotische patiënten, maar deze

invasieve procedure brengt grote risico’s met zich mee voor de patiënt, en is ook zeer

kostbaar. Daarnaast is er een groot tekort aan geschikte transplantatie levers. De

ontwikkeling van nieuwe therapeutische middelen die lever fibrose kunnen remmen is dan

ook een belangrijke medische vraagstelling.

Recente inzichten in de onderliggende mechanismen van lever fibrose hebben geleid tot

nieuwe aangrijpingspunten voor antifibrotische geneesmiddelen. Eén van de belangrijke

ontdekkingen is de sleutelrol die geactiveerde Hepatische Stellaat Cellen (HSC) spelen bij

fibrotische processen. In dit proefschrift worden studies beschreven waarin antifibrotische

geneesmiddelen naar de stellaat cellen gestuurd worden middels cel-specifieke drug

targeting. Deze gerichte sturing kan de werking van een geneesmiddel verbeteren: een

hogere concentratie geneesmiddel in de stellaat cel leidt mogelijk tot een sterker

antifibrotisch effect. Daarnaast kan drug targeting de bijwerkingen van een geneesmiddel

verminderen, omdat er minder van de werkzame stof in andere weefsels terecht komt. Dit

is met name relevant voor antifibrotische geneesmiddelen, die wel werkzaam zijn in

klinische studies, maar tegelijkertijd onacceptabele bijwerkingen hebben, omdat

extracellulaire matrix vorming een normaal proces is in alle weefsels.

Om de geneesmiddelen af te leveren in stellaat cellen en te zorgen dat ze pas daar

beginnen te werken, worden ze gekoppeld aan het eiwit mannose-6-fosfaat-HSA

(M6PHSA; HSA is humaan serum albumine). Deze geneesmiddel drager (‘carrier’) is in

171

Chapter 8

onze groep ontwikkeld en wordt al een aantal jaren succesvol toegepast. In dit proefschrift

is daarbij een nieuwe koppelingstechniek toegepast, het zogeheten Universal Linkage

System (ULS™). De kern van het ULS is een platina atoom dat coördinatie bindingen kan

vormen met het geneesmiddel en de carrier. De reden dat we voor deze nieuwe

koppelingsstrategie gekozen hebben is dat veel therapeutisch interessante geneesmiddelen

niet geschikt zijn om met de bestaande koppelingschemie aan een geneesmiddeldrager te

binden. De synthese van de preparaten is dan technisch moeilijk of zelfs geheel

onmogelijk. Dit proefschrift toont aan dat de ULS-techniek een effectieve methode is

voor de synthese van geneesmiddel-M6PHSA conjugaten. In een kort tijdsbestek werden

drie nieuwe conjugaten met antifibrotische geneesmiddelen ontwikkeld: de

geneesmiddelen pentoxifylline, losartan en een tyrosine kinase remmer werden gekoppeld

aan de stellaat cel-specifieke geneesmiddeldrager. Naast de chemische en

physicochemische karakterisatie werden de conjugaten getest op gekweekte stellaatcellen.

Een belangrijk onderdeel van het proefschrift is de evaluatie van de nieuwe producten in

diermodellen van leverfibrose.

In hoofdstuk 1 wordt de doelstelling van het proefschrift toegelicht. De basishypothese is

dat geneesmiddelen via ULS aan M6PHSA gekoppeld kunnen worden, en dat de werking

van antifibrotische geneesmiddelen verbeterd kan worden middels cel-specifieke

aflevering in stellaat cellen.

Hoofdstuk 2 behandelt de achtergronden van lever fibrose en de geneesmiddelen die in

dit proefschrift onderzocht zijn. Verder worden de achterliggende principes van ULS

coördinatie chemie en drug targeting middels M6PHSA behandeld.

Hoofdstuk 3 beschrijft de ontwikkeling van het conjugaat PTX-M6PHSA. Pentoxifylline

(PTX) is een geneesmiddel dat in de lever zowel gunstige (antifibrotische) als ongunstige

(profibrotische) activiteit heeft. Drug targeting naar stellaat cellen zou de profibrotische

effecten in Kupffer cellen kunnen voorkomen. Omdat PTX-M6PHSA het eerste

ontwikkelde preparaat met ULS is, hebben we dit product uitvoerig getest op stabiliteit en

geneesmiddel afgifte. In deze proeven bleek al snel dat het geneesmiddel met een

langzame snelheid uit het conjugaat vrijkomt. Dit zogeheten vertraagde afgifteprofiel kan

Chapter 8

172

Samenvatting

gunstig zijn bij de behandeling van chronische ziekteprocessen. Daarnaast hebben we de

mogelijke toxiciteit van het ULS onderzocht, vanwege de overeenkomsten met

cytostatische platinaverbindingen. Een groot verschil met zulke cytostatica is echter dat de

reactieve groepen van ULS al gebruikt zijn voor de koppeling van het geneesmiddel aan

de geneesmiddeldrager, en dus niet meer kunnen reageren met andere producten. Platina

toxiciteit van de conjugaten was dan ook niet aantoonbaar. Wel werd er een duidelijk

farmacologisch effect van het gekoppelde PTX aangetoond in gekweekte stellaat cellen,

waarmee het basisprincipe van dit proefschrift werd aangetoond.

Hoofdstuk 4 & 5 behandelen het conjugaat losartan-M6PHSA. Losartan is een remmer

van angiotensine II, en wordt veel toegepast bij de behandeling van hoge bloeddruk.

Recent is ontdekt dat angiotensine II ook een belangrijke rol speelt bij de activatie van

stellaatcellen, en wordt losartan getest als antifibrotisch geneesmiddel. Het gebruik van

losartan door leverpatiënten is echter niet zonder gevaar omdat leverfibrose vaak gepaard

gaat met een systemisch verlaagde bloeddruk. Wij hebben daarom onderzocht of losartan

specifiek in de lever afgeleverd kan worden, om zo de stellaat cel-specifieke effecten te

versterken. Losartan-M6PHSA is onderzocht in twee verschillende diermodellen van

leverfibrose, het galgangligatie model (bile duct ligation, BDL) en het CCl4 inhalatie

model. In beide modellen vertoonde losartan-M6PHSA een superieur effect, ondanks de

veel lagere dosis van het conjugaat in vergelijking met vrij losartan (niet getarget losartan).

Deze observatie toont aan dat de intrinsieke werkzaamheid van een geneesmiddel

verbeterd kan worden middels drug targeting.

Hoofdstuk 6 behandelt het derde product, PTKI-M6PHSA. De afkorting PTKI staat

voor PDGF Tyrosine Kinase Inhibitor, en verwijst naar een verbinding die sterk verwant

is met het geneesmiddel imitanib (Gleevec). PDGF (Platelet Derived Growth Factor) is

één van de belangrijkste factoren die aanzetten tot leverfibrose en wordt beschouwd als de

meest krachtige factor in stellaat cel proliferatie. Het remmen van PDGF-geïnduceerde

effecten in stellaatcellen is dan ook een interessante aanpak van leverfibrose, en kinase

remmers zoals imitanib en PTKI zijn daarvoor zeer geschikt. PTKI biedt geen

aangrijpingspunten voor de koppeling aan M6PHSA middels klassieke

173

Chapter 8

koppelingsstrategieën. De synthese via het ULS was echter wel succesvol, en het

ontwikkelde product werd vervolgens getest in gekweekte stellaatcellen en in

weefselplakjes (slices) van levers van fibrotische ratten. In beide systemen was PTKI-

M6PHSA effectief. Ook in de daaropvolgende studies in ratten met lever fibrose was het

product werkzaam, hoewel de effectiviteit paradoxaal genoeg afnam bij meerdaagse

toediening. Een mogelijke verklaring hiervoor is dat de gekozen dosis te laag geweest is.

Daarnaast spelen ook andere groeifactoren een rol in lever fibrose, en het kan zijn dat

remming van PDGF alleen niet voldoende is om het complexe fibrotische proces te

stoppen. Remming van meerdere groeifactoren middels een combinatie van

geneesmiddel-M6PHSA conjugaten zou hiervoor een interessante aanpak zijn.

Samenvattend kan gesteld worden dat platina coördinatie chemie een veelbelovende

techniek is voor de koppeling van geneesmiddelen aan drug targeting preparaten.

Geneesmiddel-ULS conjugaten zijn stabiel maar tegelijkertijd ook bioreversibel, en

vertonen een uniek vertraagd afgifteprofiel. De werkzaamheid van de ontwikkelde

preparaten is aangetoond in stellaatcellen en in diermodellen, en werd onderbouwd met

gegevens over de orgaandistributie van de conjugaten. Verder is aangetoond dat ULS-

conjugaten niet per definitie toxisch zijn, hoewel verdere en langduriger studies

betreffende de veiligheid van de linker nog wel nodig zijn. De toevoeging van een nieuw

linker systeem om geneesmiddelen aan eiwitten te koppelen vormt een belangrijke

bijdrage in het huidige onderzoek naar de ontwikkeling van effectieve geneesmiddelen die

leverfibrose kunnen tegengaan. Dankzij deze techniek kunnen vele verschillende soorten

geneesmiddelen worden gekoppeld and cel-specifieke geneesmiddeldragers.

Chapter 8

The author.

AppendixResumenAbbreviationsAcknowledgementsSelected color picturesCurriculum Vitae and publications

Nobody said it was easy,No one ever said it would be this hard…

I was just guessing, at numbers and fi gures, pulling the puzzles apart…Question of science, science and progress…

Do not speak as loud as my heart.

“The Scientist”,

A Rush of Blood to the Head, Coldplay, 2002.

176

Una nueva estrategia para tratar la fibrosis hepática

La fibrosis hepática es el resultado de un proceso inflamatorio y de reparación de tejido en

respuesta a un daño hepático prolongado. Se define como la acumulación de tejido

conectivo en el hígado debido al desequilibrio entre producción y degradación de matriz

extracelular. Mientras que la fibrosis hepática es un proceso reversible, su fase final, la

cirrosis, está considerada como una fase irreversible de la enfermedad (1).

Las causas que provocan la fibrosis hepática son diversas: alcoholismo, infección crónica

por virus de la Hepatitis B o C, diabetes, obesidad y enfermedades autoinmunes. La

fibrosis hepática representa la novena causa de muerte en el mundo occidental. La mayoría

de las terapias antifibróticas han fallado a nivel clínico y el transplante de hígado continúa

siendo el único tratamiento relevante de éxito. Sin embargo, este procedimiento invasivo

implica riesgos graves para el paciente, está sujeto a la existencia de donantes de órganos y

es muy costoso. Consecuentemente, la fibrosis hepática es una enfermedad que

actualmente no tiene tratamiento, por lo que una nueva terapia antifibrótica tendría un

gran impacto en el tratamiento futuro de las enfermedades del hígado.

Recientemente se han descubierto mecanismos moleculares que intervienen en el proceso

de fibrosis hepatica, proporcionando nuevas alternativas en la búsqueda de estrategias

antifibróticas. Uno de los descubrimientos más importantes es el reconocimiento de las

células estrelladas hepáticas (Hepatic Stellate Cells, HSC) como las mayores productoras

de colágeno en el hígado dañado (2), y su identificación como célula diana en la terapia

antifibrótica (3).

En este proyecto de tesis doctoral hemos investigado la posibilidad de tratar la fibrosis

hepática mediante el transporte específico de fármacos con actividad antifibrótica a las

células estrelladas del hígado. Mediante dicho transporte, podemos mejorar la eficacia de

fármacos en el organismo que provocan graves efectos secundarios limitando su

aplicabilidad en la clínica. Para este transporte específico a las células estrelladas,

utilizamos como transportador de fármacos la albúmina humana modificada con un

azúcar manosa-6-fosfato (M6PHSA) (4). Este transportador se utiliza por su unión

específica al receptor M6P/IGFII que se sobreexpresa en las células estrelladas durante el

desarrollo la etapa de fibrosis hepática, tal como se ha demostrado en nuestro laboratorio.

177

Resumen

De este modo, la droga unida a M6PHSA será transportada específicamente a las células

estrelladas en el hígado durante la fase fibrótica. A pesar de que esta tecnología ha sido

utilizada con varios fármacos como una nueva estrategia terapéutica en el campo de la

fibrosis hepática, la elección de la droga estaba restringida por su estructura química que

permite, o no, su conjugación con M6PHSA.

En esta tesis doctoral, hemos desarrollado una nueva tecnología de enlace de fármacos

con el transportador específico a las células estrelladas, M6PHSA. De este modo,

podemos preparar complejos fármaco-transportador que tienen HSC como célula diana

con la posibilidad de conjugar diferentes clases de medicamentos potencialmente

antifibróticos.

En el presente proyecto, hemos demostrado que el uso del sistema de enlace de

medicamentos basado en platina, ULS™ linker (Universal Linkage System TM), permite el

desarrollo rápido de complejo droga-M6PHSA que hemos aplicado en tres fármacos

antifibróticos. Además, la acumulación de estos complejos en la célula estrellada diana va a

mejorar considerablemente la eficacia de los fármacos transportados y va a prevenir

efectos secundarios no deseados.

En el capítulo 1 se expone el objetivo de esta tesis doctoral. En el capítulo 2 se revisa

brevemente la función del hígado y las complicaciones derivadas de la fibrosis hepática.

En el mismo capítulo se describe el mecanismo de acción de los fármacos utilizados en

este proyecto de investigación. La selección de los fármacos antifibróticos está

basado en dos criterios fundamentales:

1. El fármaco candidato debe tener potencial antifibrótico en el hígado, actuando en

una fase crucial en el proceso fibrótico llevado a cabo por las células estrelladas. Sin

embargo, puede tener efectos opuestos a lo esperado, tales como provocar acciones

profibróticas en otros tejidos o tipos celulares. Al unirse a un transportador

específico, se posibilitará el efecto farmacológico únicamente en la célula estrellada.

2. El fármaco candidato carece de grupos químicos apropiados para conjugarse con el

transportador M6PHSA utilizando los enlaces covalentes tradicionales. No obstante,

la droga debe poseer una estructura química apropiada que permita un enlace de

Appendix

178


coordinación con el ULS linker. Estas especificaciones se tratan en detalle en la

segunda parte del capitulo 2.

En el capitulo 3, detallamos el desarrollo de la primera generación de compuestos

basados en ULS linker, PTX-M6PHSA, y demostramos que el uso de ULS linker

es sencillo y seguro, a pesar de su estructura parecida al cisplatino.

Se han examinado varias características químicas y biológicas de PTX-M6PHSA en

diferentes ensayos in vitro, para demostrar la viabilidad del uso del enlace químico de

platino como objetivo para construir complejos droga-M6PHSA de liberación específica

en la célula diana.

En nuestro laboratorio, investigamos la estabilidad, biodegradabilidad, seguridad y eficacia

farmacológica de PTX-M6PHSA y concluimos que posee propiedades únicas relacionadas

con la liberación controlada de la droga PTX. Además observamos un interesante efecto

antifibrótico después de analizar el efecto de PTX-M6PHSA in vitro. La producción de

colágeno se redujo notablemente y observamos cambios sorprendentes en la morfología

de las células estrelladas, que no se observaron después del tratamiento con PTX sin

conjugar. A pesar de que los cambios observados en la morfología sugieren que las células

pueden separarse y morir “anoikis”, no observamos este efecto en los ensayos de

apoptosis o viabilidad celular. La eliminación de células estrelladas fibrógenicas mediada

por PTX-M6PHSA puede constituir un efecto beneficioso durante la fase de la fibrosis

hepática, máxime si se suma a la reducción de la deposición de colágeno. En conclusión,

proponemos PTX-M6PHSA como candidato potencial para su evaluación posterior como

droga antifibrógenica.

En los capítulos 4 & 5 de la presente tesis, demostramos que la liberación

específica de losartán a las células estrelladas mediante losartán -M6PHSA, es más

efectivo que el losartán oral en el tratamiento de la fibrosis hepática avanzada.

Losartán-M6PHSA es el segundo compuesto que sintetizamos con ULS linker, y

en estos capítulos describimos su desarrollo, caracterización y efecto antifibrótico

in vivo.

179

Resumen

El efecto de losartán-M6PHSA ha sido ampliamente investigado en dos diferentes

modelos de fibrosis hepática. El efecto de losartán consiste en el bloqueo antagonista del

receptor de angiotensina-II tipo 1 (AT1) (5). Es importante destacar que este nuevo

compuesto de liberación específica resultó ser mucho más efectivo que losartán oral, a

pesar de la dosis tan baja administrada en el compuesto losartán-M6PHSA en

comparación con losartán oral. Estas investigaciones indicaron que esta nueva estrategia

puede mejorar la eficacia intrínseca de losartán mediante la alteración de su

biodistribución en el organismo y así provocar la liberación especifica de losartán a las

células estrelladas.

La demostración de la eficacia de losartán-M6PHSA en dos modelos de fibrosis hepática,

ligadura de conducto biliar (BDL) y de tetracloruro de carbono (CCl4), refuerza su

potencial como nueva estrategia para el tratamiento de la fibrosis del hígado.

En el Capitulo 6, se presentan los estudios que demuestran que la liberación a las

células estrelladas de una droga inhibidora del receptor de PDGF puede ser una

estrategia innovadora para atenuar la fibrogénesis en el hígado dañado.

La cascada de señales de PDGF es una diana terapéutica crítica y una interesante estrategia

antifibrótica, desde que PDGF está considerado como el más potente mitógeno para las

células estrelladas in vitro, y desempeñan una función crucial en la transformación de las

células estrelladas a miofibroblastos in vivo (6). Estudios recientes han descrito efectos

antifibrógenicos del inhibidor de kinasa Imatinib (Gleevec), que inhibe potencialmente la

kinasa PDGF-BB (7). El transportador selectivo para células estrelladas, M6PHSA, se

unió al inhibidor de la tirosina kinasa del receptor de PDGF (PTKI, compuesto similar a

imatinib) mediante el ULS linker.

PTKI-M6PHSA promovió efectos antifibrogénicos en células estrelladas cultivadas y en

un sistema in vitro que consiste en capas de tejido fibrótico hepático (fibrotic liver slices).

Además, PTKI-M6PHSA demostró efectos antifibróticos significativos después de una

sola administración en el modelo animal BDL de fibrosis hepática. Sin embargo, la

administración de más dosis no produjo una mejora del efecto observado.

Appendix

180


Las diferencias observadas en la efectividad de los tratamientos podrían ser explicadas por

la naturaleza compleja de la fibrosis hepática y la activación de las células estrelladas (9).

Especialmente, si el agente que causa la fibrosis hepática no se elimina, la inhibición

específica de un determinado receptor en las células estrelladas podria afectar sólo

temporalmente a la fase de fibrogénesis hepática. Por lo tanto, es necesaria la inhibición

simultánea de mecanismos cruciales durante la activación de células estrelladas en la

fibrosis hepática (8).

Perspectivas de futuro.

La estrategia descrita proporciona muchas oportunidades para el desarrollo de nuevos

compuestos que liberen drogas a las células estrelladas. Por ejemplo, la unión de diferentes

clases de inhibidores de kinasas que presentaban problemas de conjugación con M6PHSA

transportadores en el pasado. Esta estrategia modifica la distribución en el organismo de

estos medicamentos mejorando su eficacia y reduciendo los efectos secundarios que son

vitales especialmente para el tratamiento a largo plazo con este tipo de medicamentos.

Un concepto interesante es el uso de “tratamientos cocktail”. Estas terapias de

combinación de drogas son comunes en investigación contra el cáncer, pero podría ser

también aplicable a la fibrosis hepática.

Sólamente podemos especular qué tratamiento cocktail sería el más efectivo, pero una

inhibición combinada de la cascada de TGF-β y PDGF podría contribuir

significativamente a una inhibición eficaz de la fibrosis hepática (8). En este caso, una

terapia combinando losartán-M6PHSA y PTKI-M6PHSA promete ser una estrategia

atractiva y ambos compuestos han sido sintetizados y están disponibles en nuestro

laboratorio. Por lo tanto, la liberación de fármacos inhibiendo ambas cascadas

intracelulares en las células estrelladas podría ser la estrategia apropiada en investigaciones

futuras para una efectiva terapia antifibrótica.

181

Resumen

Conclusiones

La investigación presentada en esta tesis doctoral demuestra que la química de

coordinación del cisplatino puede ser utilizada para la conjugación de drogas

potencialmente efectivas para tratar la fibrosis hepática. Los compuestos droga-ULS han

demostrado una estabilidad adecuada y bioreversibilidad, y un perfil único de liberación

controlada del medicamento. Esta característica puede ser atribuida a la unión platino y ha

sido observada en todos los compuestos investigados. Se ha demostrado que nuestra

estrategia de liberación específica de medicamentos a las células estrelladas es efectiva en

modelos animales de fibrosis hepática.

Finalmente, el trabajo presentado puede generar una estrategia versátil para unir varios

agentes antifibróticos y otras clases de drogas a transportadores específicos, formando

compuestos efectivos que pueden detener o revertir el proceso de fibrosis hepática.

Lista de referencias










Appendix

182

Abbreviations

List of abbreviations

α-SMA α-smooth muscle actin

ALT Alanine transaminase

Ang II Angiotensin II

AT1 R Angiotensin II receptor type 1

AST Aspartate transaminase

BCA Bicinchoninic acid

BDL Bile duct ligated

CCL4 Carbon tetrachloride

CTGF connective tissue growth factor

cAMP cyclic-adenosine monophosphate

cDNA complementary deoxirrubonucleotide

DMF Dimethylformamide

DTT Dithiothreitol

EC Endothelial cells

ECM Extracellular matrixs

ERK Extracellular-regulated kinase

FAAS Flameless atomic absorption spectroscopy

FLU-ULS Fluorescein and ULS platinum linker

GAPDH Glyceraldehyde-3-phosphate dehydrogenase

GSH Glutathione

HPLC High Pressure Liquid Chromatrography

HSA Human serum albumin

HSC Hepatic stellate cell

ICP-AES Inductive coupled plasma – atomic emission spectroscopy

KC Kupffer cells

KSCN potassium thiocyanate

LPS Lipopolysaccharide

LOS Losartan

M6PHSA Mannose-6-phosphate modified human serum albumin

M6P/IGFIIR Mannose-6-phosphate insulin growth factor II Receptor

MS Mass Spectrometry

MMPs Matrix metalloproteinases

NF-kB Nuclear Factor-kB

NMR Nuclear magnetic resonance

PC Parenchymal cells

PCR Polimerase chain reaction

PKA Protein kinase A

P38 MAP kinase p38 mitogen-activated kinase

PDGF-BB Platelet-derived growth factor

PDGFR Platelet-derived growth factor Receptor

PTKI PDGF receptor tyrosine kinase inhibitor

PTX Pentoxifylline

PTX-ULS PTX and ULS platinum linker

TIMP-1 Tissue Inhibitor of Metalloproteinases-1

TGF-β Transforming Growth Factor-β

TUNEL TdT-mediated dUTP Nick End Labeling

RAS Renin Angiotensin System;

ROS Reactive oxygen species

ULSTM Universal Linker System (cisPlatinum (ethylenediamine) linker

183

Acknowledgements

When does it all begin? The story goes like that…

My first memory about Holland, ever, is related to Gerben Koning at the train station

with a map of Utrecht, willing to welcome me in a completely new country for me, The

Netherlands. I want to thank specially you, Gerben, for trusting in me. You gave me the wings

I needed to possibly think in dedicating the next 5 years doing scientific research.

I also want to express my honest gratitude to Gert Storm for asking me to stay longer

in Utrecht in order to work in a new research project. Thanks also to Enrico, Raymond,

Marieke and Carmen for the good companion in those days that was enough to convince me

that the spirit is important while doing the experiments in the lab!

Starting my PhD in Groningen was easy having already some knowledge of The

Netherlands: habits and meals….tough! Robbert, as my supervisor, I would like to thank you

for supporting me till the end in order to successfully finalize my thesis, and for your always-

open-for-discussion dynamism and scientific views that stimulated me to find the correct

answers.

Specially thanks to Klaas, my promotor. You have this enthusiasm and positive view

of the situation that is contagious, and your spirit was very valuable for the moments that I was

down. From the stressful moments I have learnt from you to handle it better producing a calm

environment, which allowed me to say goodbye to sleepless nights!!

Dick Meijer, thanks for trusting in me, and encourage me to fight for my own ideas.

You also made it possible the connection with Barcelona group via Joan Rodes and always

encouraged me to pursue it.

Ingrid, the great Ingrid. I am really happy to have met you because you inspire and

encourage me. Whenever we got to a conversation, it was rare the day I did not learn

something new. Either science or life, it was always interesting. I hope that you and Nicolien

make it all the way to Santiago de Compostela (Saint James) to do the pilgrimage and enjoy

some Spanish wine!

Geni, I would like to thank you for your bright comments during the friday meetings,

and for your notorious implication in science: you always try to find the appropriate way based

in strict scientific argumentation. I have learnt a lot from you.

I also want to express my sincere thanks to the members of the reading committee,

Prof. Jan Reedijk, Prof. Wim Hennink and Prof. Pére Ginés, for their careful reading and

quick judgement of the thesis.

Appendix

184

Agradecimientos

Naturally, I would like to thank my students, Anke and Josine, who did an excellent

work in the development of these new conjugates! I enjoyed a lot working together with you

and I wish you a bright future in your careers. I also should thank Gerrit Scherphof for your

friendly welcome to Groningen, and to Jan Kamps and Sigga for your participation in the early

stages on my thesis project.

I wish to thank all my colleages of the department of Pharmacokinetics and Drug

Delivery. Leonie, thanks for your smart comments and fruitful brainstorming during the

meetings. Anne-Miek, thanks for our lively conversations and your help during in vivo

experiments. Catharina requires special thanks because she has been my roommate during all

this four years and we have shared sad moments together with very happy moments

(Thomas!!), thanks for your faithful support. Hester, thank you for sharing also the room with

me and for your nice help and support all this time together. Alie, I want to thank you for your

generous help in the lab and above all, your beautiful smile making life more beautiful!. “Ome”

Jan, now more “ome” than ever, million thanks for your warm help in many things: paperwork

and in the HPLC lab, and thanks for smiling in the difficult moments. Gillian and Ingrid,

thanks for your kind help at the secretary office in solving the thousand little problems. Bert,

thanks for your help to learn the mysteries of Reference Manager. Hans, thanks for sharing

your knowledge about pharmacokinetics with the rest of the group. Frits, thanks for your

contagious young spirit!

Special thanks to the “human lab”, Inge, Marieke, Peter, Annelies, Ansar and

Marjolijn for creating a very nice atmosphere in the department. And to the neighbouring

department, Therapeutic Gene Modulation, thanks to Marianne, Hidde Anna-Rita, Antoine,

Gera and Willemijn for their smiles, the how-are-you and good mornings on the corridors.

For your support in you-can-make-the-PhD & smile, I would like to thank Esther,

Asia, Jai, Joanna, Kai, Marja, Anne-Marie, Rick, Werner and Janja for all our conversations and

healthy laughs at thee time or bier time at the Gouden Zweep. Esther, thanks for your honesty

and healthy spirit, please never change that, I wish you the very best in your future! Asia,

thanks for your warm support from the beginning of my PhD thesis, you have been always

there for me. To Jai, thanks for the interminable talks in the lab at around 7 p.m, trying to

solve the world problems or just solve the last experiments crisis! I will never forget your

wedding in New Delhi, and the 4 a.m ring of fire ceremony of compromise with Ruchi. I wish

you the best for the future because you deserve this happiness. To the one who brought a

185

Acknowledgements

good sense of humour (finally) to the lab, Kai, and shared the Indian adventure at 4 a.m (yes, it

was tough). Marja, thanks for sharing good moments in the conferences, New York-Boston-

San Francisco! I wish you good luck in your new adventure, Canada. To Hilde thanks for our

funny talks at the beginning of my PhD, I miss specially the moments we used to laugh so

much that we decided not to share a room in order to be able to finish our projects.

My short research visit to Barcelona was great. Ramón Bataller offered his lab

without hesitance and he adopted me as one of his students. Ramón, I would like to thank you

for your openness, good heart and young spirit, which I hope you never loose. Your brought

scientific expertise made it pleasant from you to learn. It was the best working with friendly

and helpful colleagues at Bataller’s lab: Pau, Montse, Elena, Jordi and Esther made my research

project and stay in a delightful familiar environment. I got to learn there the “you can make

it” attitude from Pau, the innocent and brighten mind from Montse, and the generous help

from Elena. They shared emotions, laughs, tasty catalan meals, and their computers with me,

and above all, the support at the stabulari…Moltes Gracies!

Really special welcome to Barcelona from my favourite Madrilenian and Catalans

waiting for me just arriving from Groningen with a typical home made meal. Laurita i., Eva y

Laura e., pedazo de cenas que nos hemos pegao,ehh, todo eran risas y buen rollo…hay que repetirlo! Those

made my spare time in Barcelona full of laughing and good times, especially when singing and

dancing Brasilian songs see pictures). Moltes gracies, muchas gracias.

To my friends made in Utrecht. A Rocío, gracias guapetona, por ofrecerme siempre tu casa para

dormir y por las tertuliejas con mojitos, y por aquel inolvidable Queensday 2006 con Laura, ya sabes mas

aventuras vendrán y nos seguiremos riendo, eso que no falte. A Dani, por tus consejillos en ciertos momentos y

por tu incombustible energía, como lo haces, tío? To Dan, your amazing enthusiasm and spirit makes

immediately a good atmosphere around you, thanks for all your support these years. To

Miriam, thanks for our times in Utrecht that I will never forget and that finally I will see you

again soon! A Pilar por nuestras aventuras y esas empanadas tan buenas! To Paola, for our amazing

adventures together! To David, Pachi, Ranier, Iciar Jerome, Lorenzo and Jorg thanks for

making Utrecht home every time I come back.

To my friends in Madrid and Bilbao. A Montse, Leticia y Raquel, gracias por mantener

nuestra amistad, por animarme en todo momento, y sobre todo por querer tenerme de vuelta en los madriles

pronto! Elenilla, gracias por todos los momentos que hemos pasado juntas, nuestras charlas y por estar

literalmente siempre ahí si te necesitaba, en Leiden o ahora en Madrid, te mereces lo mejor porque eres una

Appendix

186

Agradecimientos

luchadora y puedes con todo. Ana! que para nosotras no hay distancia porque desde Ameland, pasando por

Australia, y ahora en Bilbao, estamos siempre en contacto y me encanta ir a Bilbao a visitarte, cuenta con ello.

A Puy, Ruth, Inés y Laura gracias por compartir una amistad desde siempre, pasando por cualquier época y

cambios en nuestras vidas. A Puy, Ruth e Inés, gracias por venir a visitarme a Groningen, anda que no nos lo

pasamos bien! Gracias a Maria Victoria, Carolina y Olivia por acogerme en Burgos con alegría.

To my family in Groningen, especially in the moments when I needed support and

hug… Irenilla!! Encanto, jo, muchas gracias por las cenas durante los dias frios de invierno, las tertuliejas y

las risas...te dejo en tu casa-palacio de Groningen, pero te espero en La Coruña! To Harry, thanks for the

incontable dinners together enjoying your company, and next time it will be in different

locations/countries, exciting! Isn’t it? Delphine, thanks for your vitality and your smile, good

luck in Nice!! Antonella, thanks for all the moments together, I wish you the best in your new

adventure in Italy…To Tim& Doretta, heyyy we will see each other in La Coruña, I will miss

you guys and the Zuiping on thursdays. A Marian, chiquilla, que no te queda nada y que vas a

conseguirlo tu también, el doctorado, claro, mucha suerte y muchos ánimos. To Niko, lots of success in

Cambridge!. A Irene y Jon y Pablo, que me encanta veros y que mil gracias por sex in the city, me esta

salvando la vida durante la escritura de esta tesis...no lo sabéis bien! To Magdalena& Dan, I wish you the

best. To Virginia, Kacper, Kieran, Damiano, Alexio, Eleonora, Kengo and Ivan, for the funny

times together. To Astrid & Erika, genial haberos conocido, y os deseo mucha suerte con el futuro: la

galería de arte y la abogada. To Primoz, thanks for your incredible energy and for the delicious

dinners made by you with Slovenian products. To Giorgo, thanks for our lunches and

adventures together and the past in the Ubbo Emmiussingel house!! To Ilir, thanks for

dinners/parties and all the fun together with jokes listening to the music/chun-chun, etc…To

Margot, thanks for taking care of me, sometimes like my dutch mother! I will never forget my

four years spent in the attic apartment of the Ubbo Emmiussingel.

To all my family in Spain. A toda mi familia en España por apoyarme y darme ánimos, en las

Nocheviejas en Santa Cruz, en Santa Pola, San Juan, Alicante, Sevilla, Ciudad Real, Valencia,

Guadalupe...

Janja, thanks a lot for many things. First, for coming to Gronigen, you were a great

surprise because you enlighten all what surrounds you! You brought a positive energy and a

generous heart from Slovenia to our department… and you appeared in the precise moment,

(let’s be soulmates)…and secondly I want to tell you that is great having you as my friend and my

paranimph.

187

Acknowledgements

To Aitana, my second paranimph, I should thank you for the millions of dinner

together, for talking-solving/or not- discussing the problems and for your invariable support.

You have been a pillar for me in Groningen, without you…no sé no sé…bueno, guapa, anda

que…no tengo que decirte yo cosas ni nada….pero sencillamente, gracias por estar ahí incontables veces para ese

abrazillo, para preparar la cena (sabiendo que mis cenas...pfff), para hablar de loquesea....que nos vemos en

Londres-La Coruña de fijo.

To my parents. They have supported me from the beginning: because of them I

obtain the courage and strength to be able to make it. A mis padres: que me habéis apoyado desde el

principio. De vosotros he aprendido a tener la fuerza y el coraje para terminar esta tesis. Gracias, porque no

habéis dejado ni un día de llamarme, de quererme y de apoyarme, y por todos esos momentos buenos y malos,

que nos han unido mucho más. To my brother Pablo. Gracias por tu apoyo y por hacerte 8horas en tren

Karlsruhe-Groningen, dejarlo todo para estar con tu hermana Teresa. Nunca olvidaré aquello. To my sister

Maria. Gracias por tu alegría, buen rollo y optimismo, que no falte! Y por tener esos tres soletes, Javier, Carlos

y Alicia y solazo, Manel. To my sister Clara. Por estar siempre conmigo.

For the one who has been invariably supporting me, Fermín, and for all those

moments that you have been taking care of me, a pesar de la distancia…the distance, instead of

dividing us, has brought us nearer than ever. Now we know that we can cope with everything.

Gracias por todo, mi amor.

Y la vida siguió, como siguen las cosas que no tienen mucho sentido…

Y la sangre al galope por mis venas, y una nube de arena,

dentro de mi corazón...

Donde habita el Olvido, Joaquín Sabina, 1999, 19 Días y500 noches.

Appendix

Selected color pictures


Chapter 3

Figure 3. PTX-M6PHSA binding to target cells.

Negative control PTX-HSA PTX-M6PHSA

C) NIH/3T3 fibroblasts were incubated with PTX-HSA or PTX-M6PHSA at 1 mg/ml for 4h at 37°C, after which the cells were stained for bound products using anti-HSA antibody (red color) and hematoxillin counterstained (blue color) Magnification 20x.

α-SMA Collagen type I

D

G H

FE

BA

C

Figure 7. Effects of PTX-M6PHSA on fibrosis markers

collagen I and α-SMA. HSC were incubated for 24h withPTX-HSA, PTX-M6PHSA (both at1 mg/ml, equivalent to 100 µM PTX,)or 1 mM non-targeted PTX. Cells werestained for collagen type I or α-SMAand counterstained with hematoxillin. A,B) Stellate cells incubated with: C,D) PTX-HSA; E,F) PTX-M6PHSA; G,H) non-targeted PTX. Magnification 10x.

188

189


Chapter 4

t

Figure 3. Analysis of colocalization of losartan-M6PHSA within hepatic stellatecells. Liver sections were processed for immunohistochemistry and then stained with anti-HSA antibody (see Experimental procedures). Losartan-M6PHSA co-localized with stellate cells in rat livers (arrows), as assessed with double immunostaining with anti-HSA and anti-desmin (A). Analysis performed with confocal laser microscopy verified the colocalization of anti-HSA (red fluorescence color) and anti-desmin (green fluorescence color) in the regions colored in yellow (arrows) (magnification 40x). Five rats were studied per group.


Figure 4. Effect of differen treatments on the degree of liver fibrosis.

Liver sections were processed for immunohistochemistry and then processed for Sirius Red staining. Severe bridging was observed in rats receiving saline (A), M6PHSA (B) and oral losartan (D). However, rats treated with losartan-M6PHSA (C) showed fewer areas with collagen accumulation (magnification 4x). (n = 10, mean±s.e.m., Mann-Whitney test between saline and drug treated groups: *P < 0.05 vs sham; #P<0.05 vs saline, MP6PHSA and oral losartan).

BA

Appendix

190


Chapter 4


Figure 5. Effect of different treatments on the accumula ion of myofibroblasts and activated hepatic stellate cells, as assessed by smooth muscle α-actinexpression (αSMA).

t

0

2

4

6

8

10

12

14

16


Oral losartan

αSM

A s

tain

ing

(% p

ositi

ve a

rea)

F *

#

Liver sections were processed for immunohistochemistry and then stained with anti-αSMA antibody. Rats receiving saline (A), M6PHSA (B) or oral losartan (D) showed a marked accumulation of αSMA-positive cells, which co-localized with areas with active fibrogenesis. However, rats treated with losartan-M6PHSA (C) showed less quantity of αSMA-positive cells (magnification 4x). (E). High magnification (400x) photomicrograph of a liver from a bile duct ligated rat treated with saline. αSMA staining was detected in cells located in the sinusoids corresponding to activated hepatic stellate cells (upper arrow) as well as in myofibroblasts around proliferating bile ducts (lower arrow). (F). Quantification of the area with αSMA staining in rat liver specimens (n = 10, mean±s.e.m., Mann-Whitney test between saline and drug treated groups:*P<0.05 vs sham; #P<0.05 vs saline, MP6PHSA and oral losartan).

191


Chapter 4


E

0

5

10

15

20

25


Orallosartan

CD

43 s

tain

ing

(pos

itive

cel

ls/fi

eld)

**

Figure 7. Effect of different treatments on the infiltration of inf ammatory cells in the hepatic parenchyma, as assessed by CD43 expression.

l

Rats subjected to bile duct ligation received different treatments, as specified in the figure. Liver sections were processed for immunohistochemistry and then stained with anti-CD43. Rats receiving saline (A) or M6PHSA (B) showed intense infiltration by CD43-positive cells (arrows). Treatment with losartan-M6PHSA (C), an in a lesser extent, or oral losartan (D), induced a reduction in the number of CD43 infiltrating leukocytes (magnification 4x). (n=20, mean±s.e.m., Mann-Whitney test between saline and drug treated groups: *P<0.05 vs saline and M6PHSA) E. Quantification of the number of positive cells in 20 randomly chosen high power fields (n=20, mean±s.e.m., Mann-Whitney test between saline and drug treated groups: *P<0.05 vs saline and M6PHSA)

Appendix

192


Chapter 5

tFigure 2. Organ distribution of losar an-M6PHSA.

Localization of Losartan-M6PHSA in different organs was demonstrated by anti-HSA immunostaining. Colocalization of losartan-M6PHSA and HSC was detected by anti-HSA/ anti-DESMIN double immunostaining.

A. Anti-HSA immunostaining in rat liver. B. Colocalization of losartan-M6PHSA with HSC within a fibrotic liver. Arrows indicate the colocalization of red color, presence of carrier, with blue color, desmin, a marker of activated HSC. 40x magnification.

Lung (C), heart (D), spleen (E) and kidney (F) sections stained with anti-HSA after Losartan-M6PHSA injection in CCl4 treated animals. Images were obtained at 20x magnification per organ tissue.

193


Chapter 5

losartan Saline M6PHSAlosartan-M6PHSA

Figure 4. Liver fibrosis histology after losartan-M6PHSA treatment. CCL4 rats were treated with: A. Saline, B. M6PHSA, C. losartan-M6PHSA and D. losartan. Liver sections were stained with Sirius Red. Images represent reconstruction of 16 images of 4x magnification per liver biopsy performed with AnalySIS Image Processing. E. Quantification of Sirius Red positive area. Collagen deposition was analysed per liver area of rat liver tissue treated with: control saline, losartan-M6PHSA, M6PHSA and losartan. Quantification is performed over reconstruction of 16 images of 4x magnification per liver biopsy performed with AnalySIS Image Processing. *p<0.05 significant values of losartan-M6PHSA versus CCL4 control, losartan and M6PHSA groups.

losartan-M6PHSA M6PHSASaline osartan l

Figure 5. SMA immunostaining of rat livers.

A. SMA positive cells on rat liver. CCL4 rats were treated with: A. Saline, B. M6PHSA, C. losartan-M6PHSA and D. losartan and immunostained for α-SMA. Images represent one area of 4x magnification per liver biopsy performed with AnalySIS Image Processing. E. Quantification of SMA positive cells per liver area. CCL4 rats were treated with: control (saline), losartan-M6PHSA, M6PHSA and losartan. Quantification is performed by reconstruction of 16 images of 4x magnification per liver biopsy performed with AnalySIS Image Processing. *p<0.05 significant values of losartan-M6PHSA versus losartan and M6PHSA groups.

Appendix

194


Chapter 6

0

5000

10000

15000

20000

25000

30000


Sir

ius

Red

stai

ning

: ar

ea s

tain

ed p

er li

ver

bios

y

bdl day 10 bdl day 11bdl day 12

#

*

BD

L da

y 12

B

DL

day

11

A

B

i

Figure 5. Effect of PTKI-M6PHSA single admin stration to BDL rats on the deposition of collagen in the liver, as assessed by Sirius Red staining.

A. Quantification of the area with Sirius Red staining in rat liver specimens (n = 25, mean±sd ttest between saline and drug treated groups:*P<0.01 and #P<0.05 vs. BDL saline control).

B. Liver sections were processed for immunohistochemistry and then stained with Sirius Red. Rats receiving saline (left column) showed a marked deposition of collagen, as assessed with Sirius Red, which co-localized with areas with active fibrogenesis. However, rats treated with PTKI-M6PHSA (right column) showed attenuated liver fibrosis development. Magnification (40x) photomicrograph of liver sections from bile duct ligated rats on day 10 and 11 post BDL (i.e. 24h and 48h after administration, respectively).

195


Chapter 6

ii

0

5000

10000

15000

20000

25000

30000


SM

A st

aini

ng:

area

sta

ined

per

live

r bio

sy bdl day 10 bdl day 11bdl day 12

**

A

B

BD

L da

y 11

B

DL

day

12

Figure 6. Effect of PTKI-M6PHSA single admin stration to BDL rats on the accumulation of myof broblasts and activated HSC, as assessed by smooth muscle α-actin expression (αSMA).

A. Quantification of the area with αSMA staining in rat liver specimens (n = 25, mean±sd ttest between saline and drug treated groups:*P<0.01 vs. BDL saline control).

B. Liver sections were processed for immunohistochemistry and then stained with anti-αSMA antibody. Rats receiving saline (left panels) showed a marked accumulation of αSMA-positive cells, which co-localized with areas with active fibrogenesis. However, rats treated with PTKI-M6PHSA (right panels) showed less quantity of αSMA-positive cells. Magnification (40x) photomicrograph of liver sections from bile duct ligated rats on day 10 and 11 post BDL (i.e. 24h and 48h after administration, respectively).

Appendix

197

Curriculum Vitae

Teresa Gonzalo Lázaro was born on 29th October 1977 in Madrid, Spain. She

grew up in Madrid and attended secondary and high school there.

In September 1995 she started as a student of Pharmacy in Universidad de Alcalá,

Madrid. In the summer of 1998, she went to Iowa, EEUU, to do a practicum in a

pharmacy office organized by the International Pharmaceutical Students Federation

(IPSF). In the period 1999-2000, she got a research grant to study the relationship

between aggressive behaviour and the serotonin in humans at the Department of Pharmacology,

under the supervision of. Dr. Betés. In the last year of her studies, she went to the

Netherlands to work on a research project dealing with targeting genes to ovarian carcinoma

cells using lipoplexes under the supervision of Dr. Gerben Koning and Prof. Dr. Gert

Storm, Department of Pharmaceutics at the University of Utrecht. She graduated

from Universidad de Alcalá in September 2001 with a Master’s degree in Pharmacy.

In October 2001, she started a short research project dealing with TAT-

mediated uptake of liposomes by ovarian carcinoma cells in the Department of Pharmaceutics

at the University of Utrecht under the supervision of Dr. Gerben Koning, Dr. Enrico

Mastrobattista and Prof. Dr. Gert Storm.

In September 2002, she started as a PhD student in the Department of

Pharmacokinetics and Drug Delivery at the University of Groningen, under the

supervision of Dr. Robbert Jan Kok, Prof. Dr. Ingrid Molema, Prof. Dr. Dick Meijer

and Prof. Dr. Klaas Poelstra. During the spring of 2005 she was a visiting student at

the IDIBAPS institute in Hospital Clínic in Barcelona, Spain, under the supervision of

Dr. Ramón Bataller. The results of her research project are presented in this thesis

book.

Appendix

198

List of Publications

Articles

T. Gonzalo, E.G. Talman, A. A. van de Ven, K. Temming, R. Greupink, L. Beljaars, C.

Reker-Smit, D.K.F.Meijer, G. Molema, K. Poelstra, and R. J. Kok.

Selective targeting of pentoxifylline to hepatic stellate cells using a novel platinum-based linker

technology. Journal of Controlled Release, 2006 ; 111: 193-203.

T. Gonzalo, R. J. Kok, P. Sancho-Bru, J. Swart, J. Prakash, C.Fondevila, D.K.F. Meijer, L.

Beljaars, M. Lacombe, P. vd Hoeven, V. Arroyo, K. Poelstra, P. Ginès and R. Bataller.

Reduction of advanced liver fibrosis by targeted delivery of the angiotensin II receptor

antagonist losartan to hepatic stellate cells. Submitted for publication.

T. Gonzalo, R. Bataller, P. Sancho-Bru, D.K.F. Meijer, L. Beljaars, M. Lacombe, F. Opdam,

V. Arroyo, K. Poelstra, P. Ginès and R. J. Kok.

Accumulation in hepatic stellate cells and antifibrotic effect of losartan-M6PHSA in the CCL4

model of induced liver fibrosis. Manuscript in preparation.

T. Gonzalo, L. Beljaars, M. Van de Bovenkamp, A-M van Loenen, C. Reker-Smit,

D.K.F.Meijer, M. Lacombe, F. Opdam, G. Keri, L. Orfi, K. Poelstra, and R. J. Kok.

Local inhibition of liver fibrosis by specific delivery of a PDGF kinase inhibitor to hepatic

stellate cells. Submitted for publication.

K. Temming, M. Lacombe, P.van der Hoeven, J.Prakash, T. Gonzalo, E.C.F.Dijkers, L.Orfi,

G.Keri, K. Poelstra, G. Molema, and R. J. Kok.

Delivery of the p38 MAPkinase inhibitor SB202190 to angiogenic endothelial cells:

development of novel RGD-equipped and pegylated drug-albumin conjugates using platinum

(II) based drug linker technology. Bioconjugate Chemistry. In press, 2006.

199

Curriculum Vitae

Selected abstracts

T. Gonzalo, A. A. van de Ven, L. Beljaars, C. Reker-Smit, D.K.F.Meijer, G. Molema, K.

Poelstra, and R. J. Kok.

Delivery of pentoxifylline to hepatic stellate cells as a new tool to attenuate liver fibrosis.

Hepatology, 2004; 40(4):610A-611A.

American Association for Study of the Liver.( AASLD, 2004), Boston, USA.

T. Gonzalo, R. Bataller, P. Sancho-Bru, C. Fontdevilla, J. Swart, L. Beljaars, V. Arroyo, K.

Poelstra, P. Gines, and R. J. Kok.

Stellate cell-targeted losartan, but not oral losartan, reduces liver fibrosis.

FIGON Dutch Medicine Days (2005). Lunteren, The Netherlands.

T. Gonzalo, R. Bataller, P. Sancho-Bru, C. Fontdevilla, J. Swart, L. Beljaars, V. Arroyo, K.

Poelstra, P. Gines, and R. J. Kok.

Short-term treatment with losartan targeted to activated stellate cells reduces advanced liver

fibrogenesis: A new strategy to treat liver fibrosis, Hepatology, 2005; 42:604A.

American Association for Study of the Liver. (AASLD, 2005), San Francisco, USA.

T. Gonzalo, K. Poelstra, L. Beljaars, G. Keri, L.Orfi and R. J. Kok.

Specific targeting of a PDGFR tyrosine kinase inhibitor to activated hepatic stellate cells as a

promising technology to reduce liver fibrosis, Hepatology, 2005; 42: 733A-733A.

American Association for Study of the Liver. (AASLD, 2005), San Francisco, USA.

T. Gonzalo, R. Bataller, P. Sancho-Bru, C. Fontdevilla, J. Swart, L. Beljaars, J. Prakash,

M.Lacombe, Paul vd Hoeven, V. Arroyo, K. Poelstra, P. Gines, and R. J. Kok.

Selective delivery of losartan targeted to hepatic stellate cells using losartan-M6PHSA

successfully reduces advanced liver fibrogenesis.

Annual meeting & Exposition of the Controlled Release Society.(CRS, July 2006), Vienna,

Austria.

Appendix

200

List of Publications

Selected oral presentations

Liposome meeting. (March, 2002), Oberjoch, Germany.

Groningen University Institute for Drug Exploration (GUIDE) early summer meeting.

(June, 2003), Groningen, The Netherlands.

Spanish Asociation for the Study of the Liver (AEEH, Feb 2006), Madrid, Spain.

The Center for Liver Diseases in Groningen, Retraite CLDS (May, 2006), The Netherlands.

Groningen University Institute for Drug Exploration (GUIDE) early summer meeting.

(June, 2006), Groningen, The Netherlands.

Awards

First prize award to the poster giving the best means and angles of improving

communication between various pharmaceutical disciplines. FIGON Dutch Medicine Days

(October, 2005).

Controlled Release Society PhD Student Travel Grant award, for participating in the

Annual meeting & Exposition of the Controlled Release Society. (July, 2006), Vienna,

Austria.

Patent

Participation in the patent: Method of conjugating therapeutic compounds to cell targeting devices via metal

complexes.(nr.of patent P72797EP00) (owned by Kreatech Biotechnology and Groningen

University).

university of groningen a potential strategy to treat ... · (kc), and hepatic stellate cells (hsc,...

Documents