INFECTION AND IMMUNITY,0019-9567/00/$04.0010

Aug. 2000, p. 4706–4713 Vol. 68, No. 8

Copyright © 2000, American Society for Microbiology. All Rights Reserved.

Ultrastructure of Rickettsia rickettsii Actin Tails and Localizationof Cytoskeletal Proteins

LEVI S. VAN KIRK,1 STANLEY F. HAYES,2 AND ROBERT A. HEINZEN1*

Department of Molecular Biology, University of Wyoming, Laramie, Wyoming 82071-3944,1 and Microscopy Branch,Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases, Hamilton, Montana 598402

Received 19 January 2000/Returned for modification 17 March 2000/Accepted 8 May 2000

Actin-based motility (ABM) is a mechanism for intercellular spread that is utilized by vaccinia virus and theinvasive bacteria within the genera Rickettsia, Listeria, and Shigella. Within the Rickettsia, ABM is confined tomembers of the spotted fever group (SFG), such as Rickettsia rickettsii, the agent of Rocky Mountain spottedfever. Infection by each agent induces the polymerization of host cell actin to form the typical F (filamentous)-actin comet tail. Assembly of the actin tail propels the pathogen through the host cytosol and into cellmembrane protrusions that can be engulfed by neighboring cells, initiating a new infectious cycle. Little isknown about the structure and morphogenesis of the Rickettsia rickettsii actin tail relative to Shigella and Lis-teria actin tails. In this study we examined the ultrastructure of the rickettsial actin tail by confocal, scanningelectron, and transmission electron microscopy. Confocal microscopy of rhodamine phalloidin-stained infectedVero cells revealed the typhus group rickettsiae, Rickettsia prowazekii and Rickettsia typhi, to have no actin tailsand short (;1- to 3-mm) straight or hooked actin tails, respectively. The SFG rickettsia, R. rickettsii, displayedlong actin tails (>10 mm) that were frequently comprised of multiple, distinct actin bundles, wrapping aroundeach other in a helical fashion. Transmission electron microscopy, in conjunction with myosin S1 subfragmentdecoration, revealed that the individual actin filaments of R. rickettsii tails are >1 mm long, arranged roughlyparallel to one another, and oriented with the fast-growing barbed end towards the rickettsial pole. Scanningelectron microscopy of intracellular rickettsiae demonstrated R. rickettsii to have polar associations of cy-toskeletal material and R. prowazekii to be devoid of cytoskeletal interactions. By indirect immunofluorescence,both R. rickettsii and Listeria monocytogenes actin tails were shown to contain the cytoskeletal proteins vaso-dilator-stimulated phosphoprotein profilin, vinculin, and filamin. However, rickettsial tails lacked ezrin,paxillin, and tropomyosin, proteins that were associated with actin tails of cytosolic or protrusion-bound Listeria.The unique ultrastructural and compositional characteristics of the R. rickettsii actin tail suggest that rickett-sial ABM is mechanistically different from previously described microbial ABM systems.

Members of the genus Rickettsia are obligate intracellularbacteria that grow within the cytoplasm of their eucaryotic hostcell (13). They are the etiologic agents of a variety of serioushuman diseases such as Rocky Mountain spotted fever andepidemic typhus and are transmitted to their mammalian hostsexclusively by arthropod vectors that include ticks, fleas, lice,and mites (13). Rickettsiae display a tropism for the endothe-lium, where they invade and spread to cause vascular perme-ability (47).

Because of experimental limitations imposed by the obligateintracellular nature of rickettsiae and the lack of workablegenetic systems, little is known about specific virulence deter-minants utilized by these organisms. However, there is a cur-sory understanding of some rickettsia-host interactions. Stud-ies employing the typhus group rickettsia, Rickettsia prowazekii,demonstrate that internalization requires adherence to an un-identified plasma membrane receptor by viable, metabolicallyactive organisms (49). Uptake of rickettsiae ensues by a mi-crofilament-dependent process (48). Collectively, the two pro-cesses have been termed parasite-induced phagocytosis (48).Evidence suggests that internalized rickettsiae are initiallybound within a phagocytic vacuole (12, 40). An increase inphospholipase A2 activity occurs concomitantly with rickettsialentry and presumably facilitates rickettsial access to the host

cytoplasm (36, 49, 52). Once in the intracytoplasmic milieu,rickettsiae are free to exploit the nutrient-rich environmentand interact with host structural components.

A suspected virulence mechanism unique to spotted fevergroup (SFG) rickettsiae, such as Rickettsia rickettsii, is the uti-lization of an intracellular actin-based motility (ABM) systemto promote direct cell-to-cell spread (12, 15, 16). This mecha-nism of pathogenesis is also exploited by the facultative intra-cellular bacteria Listeria monocytogenes and Shigella flexneri (9)as well as vaccinia virus (50). Using the propulsive force sup-plied by parasite-directed polymerization of host cell actin,motile bacteria move into plasma membrane-bound protru-sions that can be subsequently engulfed by neighboring cells.Escape from the double-membrane vacuole allows infection ofthe newly encountered cytoplasm (45). The ability of patho-gens to spread within the host tissues, using ABM to directlytransit from one cell to another, allows evasion of the hosthumoral immune response.

The bacterial surface proteins ActA and IcsA are necessaryand sufficient for ABM by Listeria (8, 18) and Shigella (2, 21),respectively. The viral protein A36R is essential for vacciniavirus ABM (11). Rickettsial protein synthesis is required forABM, but the identity of the necessary protein(s) is unknown(16). A number of host cytoskeletal proteins are also necessaryor suspected modulators of bacterial ABM and protrusionformation. These were initially identified by immunolocaliza-tion studies and include proteins involved in F (filamentous)-actin cross-linking, side binding, severing, capping, depolymer-izing, and nucleating (3, 9). Direct biochemical evidence for

* Corresponding author. Mailing address: Department of MolecularBiology, University of Wyoming, Laramie, WY 82071-3944. Phone:(307) 766-5458. Fax: (307) 766-3875. E-mail: rheinzen@uwyo.edu.

4706

on October 31, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

roles in Listeria ABM has been established for vasodilator-stimulated phosphoprotein (VASP) (5, 22, 25, 38), the complexof actin-related proteins 2 and 3 (Arp2-Arp3) (22, 51), gelsolin(19), profilin (22, 32, 38, 42), a-actinin (7, 22), actin depoly-merization factor (also called cofilin) (4, 22, 31), and cappingprotein (22). Using a reconstitution assay, Loisel et al. (22)have recently determined that actin, Arp2-Arp3 complex, co-filin, and capping protein are minimally required for in vitroABM by Listeria. The Arp2-Arp3 complex is stimulated byinteraction with ActA to nucleate the production of new actinfilaments (22, 51). Capping protein stops the growth of existingactin tail filaments by binding to their fast-growing barbedends, thus possibly funneling available G (globular)-actin tothe production of new filaments at the bacterium-tail interface(22). Cofilin stimulates the release of G-actin from the slow-growing pointed ends of filaments, thereby increasing the localconcentration of G-actin for use in new filament assembly (4,22, 31). Listerial ABM is more efficient if profilin (a G-actinsequestering protein), VASP (a focal adhesion point proteinand a ligand of profilin), and a-actinin (an F-actin cross-linkingprotein) are present (22). Additional host proteins may benecessary or stimulatory in vivo. Other than actin, the cellularproteins necessary for R. rickettsii intracellular motility arecompletely unknown.

Elegant transmission electron microscopy (TEM) studies(33, 43–45), have elucidated the ultrastructural characteristicsof listerial actin tails and allowed initial formulation of me-chanical models for how actin might provide the propulsiveforce needed to move the bacterium through the viscous cy-tosol. Studies using fixation protocols optimized to preservefilamentous actin structures and myosin S1 subfragment todecorate individual actin filaments demonstrate that listerialactin tails are comprised of a cross-linked meshwork of short(;0.2-mm) actin filaments (43–45). Tails associated with pro-trusion-bound Listeria have a different ultrastructure; in addi-tion to containing random short filaments, they contain long(.1-mm) filaments that lie parallel with the protrusion axis(33).

To gain insight into the mechanism of rickettsial ABM, weexamined R. rickettsii actin tail ultrastructure and composition.Identification of host cytoskeletal proteins associated with therickettsial actin tail was accomplished by immunofluorescencelocalization with specific antibodies. TEM and scanning elec-tron microscopy (SEM) were utilized to examine actin tailstructure and rickettsia-containing protrusions. In addition, thepolarity of F-actin filaments comprising rickettsial actin tailswas determined by myosin S1 subfragment decoration andTEM.

MATERIALS AND METHODS

Organisms. R. rickettsii (HLP strain), Rickettsia typhi (Wilmington strain), andR. prowazekii (Madrid E strain) were propagated in African green monkeykidney (Vero) fibroblasts (CCL-81; American Type Culture Collection) and werepurified by Renografin density gradient centrifugation as previously described(14). L. monocytogenes 1043S was a generous gift of Dan Portnoy, University ofCalifornia at Berkeley, and was cultivated overnight in 3.7% brain heart infusion(BHI) broth (Difco Laboratories, Detroit, Mich.).

Infection of Vero cells. Twelve-millimeter-diameter glass coverslips in 24-wellplates were seeded with Vero cells to semiconfluency and cultivated overnight at37°C in M199 medium (Life Technologies, Grand Island, N.Y.) supplementedwith 10% fetal bovine serum (FBS) (Life Technologies) and gentamicin (20mg/ml; Life Technologies). Rickettsiae suspended in 3.7% BHI broth (DifcoLaboratories) were used to infect monolayers at a multiplicity of infection of 0.1to 1.0 for 45 min. The inoculum was removed, the cells were washed once, M199medium supplemented with 2% FBS was added, and incubation continued at34°C. For infection of Vero cells with L. monocytogenes, an overnight culture ofListeria in BHI broth was pelleted, washed once, and suspended in twice theculture volume of Hanks buffered saline solution (Life Technologies). Sus-pended bacteria (200 to 300 ml) were added to each tissue culture plate well and

incubated for 1 h at room temperature. Vero cells were then washed three timeswith Hanks buffered saline solution and M199 with 2% FBS and gentamicinsulfate (20 mg/ml) were added to culture wells. For TEM, cells were grown in35-mm-diameter Thermanox petri dishes (Nunc Inc., Naperville, Ill.).

Construction of GFP-profilin. The human profilin gene was amplified from aHeLa cell cDNA library (Stratagene, La Jolla, Calif.) using PCR. The 59 oligo-nucleotide GGATCCATGGCCGGGTGGAACGCCTAC contains a BamHIsite and the profilin ATG start codon. The 39 oligonucleotide TCTAGATCAGTACTGGGAACGCCGAAGG contains an XbaI site and the profilin stop co-don. The resulting 434-bp PCR product was cloned into pCR2.1 (InvitrogenCorp., Carlsbad, Calif.). The profilin-encoding insert was then excised by diges-tion with BamHI and XbaI, and the profilin reading frame was directionallycloned in frame with the 39 end of gfp carried by pEGFP-C1 (Clontech Labora-tories, Inc., Palo Alto, Calif.). Nucleotide sequencing of the resulting clone(pEGFP-C1/profilin) confirmed the cloning procedure.

Fluorescence microscopy. All fixation and staining procedures were carriedout at room temperature. Infected cells on coverslips were fixed and permeabil-ized as previously described (16). Fixed cells were then washed three times in 25mM sodium phosphate–150 mM sodium chloride (pH 7.4) (PBS) containing0.5% bovine serum albumin (PBSA). The primary antibodies used in indirectimmunofluorescence labeling of intracellular bacteria were the monoclonal anti-body 13-2 directed against the rOmpB protein (1) or rabbit anti-R. rickettsii se-rum for R. rickettsii, rabbit anti-R. prowazekii serum for R. typhi and R. prowazekii,and rabbit anti-Listeria serum (Biodesign International, Kennebunk, Maine) forL. monocytogenes. Bacteria were subsequently labeled with an anti-mouse im-munoglobulin G (IgG) Texas Red conjugate (Jackson ImmunoResearch Labo-ratories, Inc., West Grove, Pa.), an anti-rabbit IgG fluorescein conjugate (Pierce,Rockford, Ill.), or an anti-rabbit IgG rhodamine conjugate (Pierce). Followingstaining of bacteria, coverslips were washed three times in PBSA and F-actinstained by incubating with rhodamine phalloidin (Molecular Probes, Eugene,Oreg.) at 10 U/ml for 20 min. Other cytoskeletal proteins were labeled by indirectimmunofluorescence using monoclonal antibodies. Antibodies directed againstVASP (clone 43), ezrin (clone 18), and paxillin (clone 349) were purchased fromTransduction Laboratories (Lexington, Ky.); antibodies directed against tropo-myosin (clone TM311) and vinculin were purchased from Sigma (St. Louis, Mo.);and a filamin-specific monoclonal antibody was purchased from Chemicon In-ternational, Inc. (Temecula, Calif.). Proteins were subsequently labeled witheither an anti-mouse IgG Texas Red conjugate or an anti-mouse IgG fluoresceinconjugate. Coverslips were mounted onto glass slides using Vectashield mount-ing medium (Vector Laboratories, Inc., Burlingame, Calif.) and observed with aLeica laser-scanning confocal microscope equipped with a krypton-argon laserilluminator. Collected images were processed with Adobe Photoshop 3.0.

Electron microscopy. SEM using the dry cleave method was conducted essen-tially as described by Prevost et al. (26). Briefly, infected Vero cells were rinsedin PHEM buffer (60 mM piperazine-N,N9-bis[2-ethanesulfonic acid] [PIPES], 23mM HEPES, 10 mM EGTA, 2 mM MgCl2 [pH 6.9]) and then treated withPHEM containing 0.5% saponin for 5 min at room temperature. Cells were thenfixed in 2.5% glutaraldehyde in PHEM for 30 min, rinsed with PHEM, andpostfixed with 0.5% osmium tetroxide in PHEM for 90 min. Cells were rinsedwith distilled water and dehydrated in a graded series of alcohol. Cells were thentreated with hexamethyldisilazane and air dried. Cell interiors were exposed bydry cleaving the monolayer via application and removal of cellophane tape. Cellswere then sputter-coated with gold-palladium. To visualize intact pseudopodia,infected cells were similarly processed, except the saponin membrane solubili-zation and dry cleave steps were omitted. Samples were examined with a HitachiS-570 scanning electron microscope.

TEM was conducted on Vero cells infected for 4 days with R. rickettsii. Forpreservation of filamentous actin structures, cells were quick fixed in situ by themethod of Tilney and Tilney (46). Cells in 35-mm-diameter Thermanox petridishes were fixed for 30 min with a solution containing 1% glutaraldehyde, 1%osmium tetroxide, and 50 mM phosphate buffer (pH 6.3) on ice. Fixed cells werewashed with distilled water three times for 5 min and stained overnight with 0.5%uranyl acetate. Cells were dehydrated in a graded series of ethanol and embed-ded in Epon, and sections were cut and poststained with uranyl acetate and leadcitrate. Myosin S1 decoration was conducted according to the method of Tilneyet al. (44). All procedures prior to dehydration were conducted on ice. R.rickettsii-infected cells in Thermanox petri dishes were washed with PHEMbuffer. Membranes were then solubilized for 10 min with 50 mM phosphatebuffer (pH 6.8) containing 1% Triton X-100 and 3 mM MgCl2. Cells were washedtwo times with 0.1 M phosphate buffer (pH 6.8), and this was followed byincubation for 30 min in phosphate buffer containing myosin S1 subfragment (5mg/ml; Sigma). This solution was decanted, and the cells were washed in 100 mMphosphate (pH 6.8) buffer; this was followed by fixation for 30 min in 50 mMphosphate buffer (pH 6.8) containing 1% glutaraldehyde and 2% tannic acid.Cells were washed again in 50 mM phosphate buffer (pH 6.8) and subsequentlypostfixed in 1% osmium tetroxide in 0.1 M phosphate buffer (pH 6.3). Fixed cellswere washed with distilled water three times for 5 min and stained overnight with0.5% uranyl acetate. Cells were dehydrated in a graded series of ethanol andembedded in Epon, and sections were cut and poststained with uranyl acetateand lead citrate. Samples were examined using a Hitachi HU-11E-1 electronmicroscope.

VOL. 68, 2000 RICKETTSIAL ACTIN TAIL STRUCTURE 4707

on October 31, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

RESULTS

Laser scanning confocal microscopy of actin tails. Laserscanning confocal microscopy was conducted on rhodaminephalloidin-stained Vero cells infected with species of Rickettsiathat display the 3 representative actin tail phenotypes (16):long tails (R. rickettsii), short tails (R. typhi), and no tails (R.prowazekii). We employed L. monocytogenes as a comparativecontrol in this procedure. The prototypic long actin tails of R.rickettsii (Fig. 1A and B) were morphologically distinct fromthose associated with L. monocytogenes (Fig. 1E). R. rickettsiiactin tails were straighter and longer (average length, 16.7 mm)than those of Listeria (average length, 6.7 mm). Occasionallyrickettsial tails with dramatic curves were observed, usually inassociation with organisms that had obviously collided with theplasma membrane. This occurrence has also been observed bytime-lapse video microscopy (15). In contrast to listerial tails,where actin staining results in a relatively uniform gradient offluorescence throughout the tail length, R. rickettsii tails wereoften comprised of two or more distinct actin bundles (Fig. 1A

and B). These bundles often twisted around each other in ahelical fashion to form nonfluorescent gaps in the tail struc-ture. The truncated actin tails of R. typhi were small (;3 mm)and usually hook shaped and did not exhibit the gapped ap-pearance of the R. rickettsii tail (Fig. 1C). R. prowazekii dis-played a null actin tail phenotype as illustrated by the absenceof actin tail appendages (Fig. 1D).

Electron microscopy of actin tails and protrusions. UsingSEM and a dry cleave procedure to reveal the host cell interior,we observed R. rickettsii in association with a polar stalk ofcytoskeletal material, presumably F-actin (26) (Fig. 2A). R.rickettsii organisms were randomly dispersed at low numbersthroughout the cell cytoplasm. Occasionally R. rickettsii existedas clumps of two or more organisms, with the cytoskeletal stalkusually associated with one organism (unpublished observa-tions). With organisms undergoing binary fission, the cytoskel-etal stalk was associated with one pole of a single formingdaughter cell (Fig. 2B). A similar behavior has previously beenobserved for actin tails associated with a dividing rickettsia by

FIG. 1. Actin tail phenotypes of rickettsiae and comparison to tails of L. monocytogenes. Dual fluorescent staining of intracellular bacteria and F-actin wasconducted on Vero cells. F-actin was stained with rhodamine phalloidin (red), and intracellular bacteria were stained by indirect immunofluorescence (green). Cellswere visualized by laser scanning confocal microscopy. (A) R. rickettsii showing long actin tails that are frequently comprised of multiple, twisting, distinct F-actinbundles. (B) High magnification of an R. rickettsii actin tail in panel A comprised of two F-actin bundles. (C) Truncated hook-shaped tail of R. typhi (arrow). (D) R.prowazekii with no actin tails. (E) Actin comet tails of L. monocytogenes. Bars, 5 mm.

4708 VAN KIRK ET AL. INFECT. IMMUN.

on October 31, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

TEM (16) and rhodamine phalloidin staining (15). In contrastto R. rickettsii, R. prowazekii existed as dense groups of organ-isms without obvious polar cytoskeletal associations (Fig. 2C).

TEM was conducted on infected cells using a fixation tech-nique optimized for preservation of F-actin structures (46).R. rickettsii actin tails existed as long, parallel-arranged actinfilaments that appeared to be minimally cross-linked (Fig. 3A).In most instances, filaments were absent from the extreme poleof the organism, which is consistent with the gapped tail ap-

pearance in Fig. 1. Myosin S1 subfragment decoration furtherdemonstrated the linearity of rickettsial actin tail filaments(Fig. 3B). Although a precise measurement of the length ofindividual actin filaments was difficult to achieve, close inspec-tion of Fig. 3A and B suggests that they are at least 1 mm inlength. A high-magnification image of S1 decorated F-actinimmediately adjacent to the bacterium shows the fast-growingbarbed ends of individual actin filaments oriented towards therickettsial surface (Fig. 3C).

FIG. 2. SEM of Vero cells infected with R. rickettsii or R. prowazekii. Cells were fixed and dry cleaved to expose the cell interior. (A and B) R. rickettsii with a polarstalk of cytoskeletal material. Note the organism undergoing binary fission with only one daughter cell associated with cytoskeletal material (B). (C) R. prowazekii devoidof polar cytoskeletal stalks. Bars, 0.5 mm.

FIG. 3. Ultrastructure of the R. rickettsii actin tail as viewed by TEM. (A) Sections of Vero cells infected with R. rickettsii showing a bilateral association of bundlesof long actin filaments that appear to be minimally cross-linked. (B) Myosin S1 subfragment decoration of the rickettsial actin tail depicting long, parallel actin filaments.(C) High magnification of myosin S1 subfragment decorated tail filaments showing the fast-growing barbed ends of filaments oriented towards the rickettsial surface.A decorated actin filament, designated with an asterisk at the barbed end, is shown in the inset. Individual S1 subunits are demarcated with white lines to highlight thedirectional binding of this protein. Bars, 0.5 mm.

VOL. 68, 2000 RICKETTSIAL ACTIN TAIL STRUCTURE 4709

on October 31, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

Formation of bacterium-containing protrusions is prerequi-site for cell-to-cell spread by L. monocytogenes (30) and S.flexneri (17). R. rickettsii was similarly found in protrusions ;3to 5 mm in length. Figure 4A depicts a rickettsia-containingprotrusion that is apparently in the process of uptake by aneighboring uninfected cell. The plasma membranes of theinfected and adjacent uninfected cell are clearly visible. Pro-trusions containing more than one rickettsia were also ob-served. Figure 4B depicts a short protrusion containing tworickettsiae with an accompanying actin tail extending into theVero cell cytoplasm. F-actin of comprising tails of protrusion-bound rickettsia appeared more compressed than that of cy-tosolic bacteria. Protrusions were also observed by SEM. Fig.4C shows a short membrane-bound protrusion that has col-lapsed to the cell surface and consists of a bulbous head har-boring the organism, and a sphinctered stalk containing a con-densed actin tail.

Fluorescence localization of cytoskeletal proteins. A numberof host cytoskeletal proteins are associated with actin tailand/or protrusion formation by Listeria and Shigella (9). Em-ploying L. monocytogenes as a comparative control, we con-ducted confocal laser scanning microscopy to determine thelocation of cytoskeletal proteins in R. rickettsii-infected Verocells. VASP and profilin are accelerators of the actin-basedmotor of Listeria (22). By indirect immunofluorescence, VASPwas diffusely dispersed throughout rickettsial actin tails asshown in Fig. 5A. A rickettsia in this figure was apparentlycaptured in the process of entering the nucleus while stilltethered to its actin tail, suggesting that the mechanism ofentry by rickettsia into this intracellular compartment is anactive process driven by actin polymerization. In contrast to R.rickettsii, VASP localized only to the actin-polymerizing pole ofListeria where, as previously reported, it binds directly to theproline-rich region of the listerial surface protein ActA (Fig.5A) (5, 25). VASP is a ligand for profilin, a G-actin-sequester-ing protein (27). GFP-profilin, when introduced into infectedVero cells by transfection, also localized throughout the R.rickettsii actin tail, possibly via direct binding to VASP (Fig.5A). This confocal image shows at least two distinct clumps ofrickettsiae within the nucleus that are associated with onebranching actin tail. We have previously observed the clumpingof intranuclear rickettsiae and their associated actin tails bytime-lapse video microscopy (15). GFP-profilin was primarilylocalized to one pole of Listeria and the beginning of their actintails, as described by others (42).

In addition to VASP and profilin, we localized by indirect

immunofuorescence other cytoskeletal proteins implicated asmodulators of bacterial ABM and protrusion formation (Fig.5B). Vinculin, filamin, ezrin, and paxillin are cytoskeletal pro-teins that are enriched in plasma membrane focal adhesionpoints (23, 24). Tropomyosin is an actin side binding protein(3). In keeping with previous studies, filamin (7), vinculin (7),ezrin (10, 33, 39), and tropomyosin (6) were detected in actintails of cytoplasmic or protrusion-bound Listeria. In contrast toa previous study (10), we additionally detected paxillin in thelisterial tail. Only vinculin and filamin were detected in theR. rickettsii tail. Vinculin labeling is associated with the actintail of clumped intranuclear rickettsia (Fig. 5B).

DISCUSSION

In comparison to free-living facultative intracellular bacte-ria, our current understanding of rickettsial virulence factorsthat allow entry and intercellular spread in cultured cells isfragmentary. By analogy to ABM mutants of Listeria (8, 18)and Shigella (2, 21), which display attenuated virulence in an-imal models, it is logical to assume that recruitment and poly-merization of host cell actin by SFG rickettsiae to allow intra-cellular motility and direct cell-to-cell spread represent arickettsial virulence determinant. Although the general processof rickettsial ABM appears similar to that described for Liste-ria and Shigella, in this report we have demonstrated thatrickettsial actin tails are compositionally and ultrastructurallydifferent from tails produced by these bacteria.

The R. rickettsii actin tail is frequently comprised of two ormore distinct, coiled actin bundles. We suggested in a previousreport (15) that the coiling of actin tail bundles may be amanifestation of the rickettsial pole harboring multiple, fixed,asymmetrically opposed polymerization zones. The resultantasymmetry in polymerization may provide a rotational forcethat spins the organism as it moves through the cytosol.

Elegant electron microscopy studies, primarily by Tilney andcoworkers (43–45), have defined the ultrastructure of listerialactin tails. They demonstrated that tails of cytosolic Listeria arecomprised of a network of short (;0.2-mm) cross-linked actinfilaments having their fast-growing barbed ends oriented to-wards the bacterial surface (43–45). Actin tails of protrusion-bound Listeria are compositionally and ultrastructurally differ-ent from those associated with cytosolic bacteria. For example,they lack a-actinin, an F-actin cross-linking protein that isobserved in tails of cytosolic Listeria and may be required formaintenance of the bundled structure in this environment.

FIG. 4. Protrusion formation and cell-to-cell spread by R. rickettsii in Vero cells. (A) Thin section of rickettsia-containing protrusion. The plasma membrane of theinfected cell and the adjacent uninfected cell are clearly visible. The actin tail has been grazed in this thin section. (B) Protrusion containing two rickettsiae that extendsa few micrometers from the cell surface. The cup-shaped beginning of the accompanying actin tail is designated with an arrow. (C) SEM of R. rickettsii in a shortprotrusion that has collapsed to the cell surface. Bars, 0.5 mm.

4710 VAN KIRK ET AL. INFECT. IMMUN.

on October 31, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

They also have a lower percentage of short filaments andexhibit long (.1-mm) filaments. Tails of protrusion-bound Lis-teria gain ezrin, a membrane protein responsible for formingcytoskeleton-membrane associations, that has been postulatedto stabilize the longer tail filaments (33).

In our original description of rickettsia-induced actin poly-merization we employed a TEM fixation procedure that used

ruthenium red as an F-actin stabilizer (16). These micrographsprovided the first glimpse of R. rickettsii actin tails by electronmicroscopy and suggested that the tail consisted of long actinfilaments. In this report we confirm our early observations byusing quick-fix fixation (46) and myosin S1 subfragment deco-ration to demonstrate that the R. rickettsii actin tail consists oflong (.1-mm), parallel-arranged filaments that appear to be

FIG. 5. Fluorescence localization of the cytoskeletal proteins VASP, profilin, vinculin, filamin, tropomyosin, ezrin, and paxillin in fixed Vero cells infected withR. rickettsii (R. r.) or L. monocytogenes (L. m.). Images were collected using a confocal laser scanning microscope. Cytoskeletal proteins, with the exception of profilin,were labeled by indirect immunofluorescence by using specific monoclonal antibodies. Profilin was localized by transiently expressing GFP-profilin in infected cells asdescribed in Materials and Methods. Intracellular bacteria were counterstained by indirect immunofluorescence. (A) VASP labeling (red) is diffusely dispersedthroughout the actin tail of R. rickettsii (green), whereas labeling is concentrated to one pole of Listeria (green). (Note the rickettsiae apparently in the process ofpenetrating the nuclear membrane.) GFP-profilin (green) is similarly dispersed throughout the actin tail of R. rickettsii (red), in this case intranuclear rickettsiae,whereas GFP-profilin is primarily localized to one pole of Listeria (red) and the beginning of the actin tails. (B) Vinculin and filamin (green) were detected throughoutthe length of tails of R. rickettsii (red) and Listeria (red). Tropomyosin, ezrin, and paxillin (green) were detected in tails of cytoplasmic or protrusion-bound Listeria(green) but not tails of R. rickettsii (red). Bars, 5 mm.

VOL. 68, 2000 RICKETTSIAL ACTIN TAIL STRUCTURE 4711

on October 31, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

minimally cross-linked. Like listerial tail filaments, rickettsialtail filaments are juxtaposed with the fast-growing barbed endoriented towards the rickettsial surface, suggesting that G-actin incorporation occurs at the rickettsial surface. Moreover,tail filaments of protrusion-bound rickettsiae display a morecondensed architecture, as is observed for listerial tails (33).The short actin tail of R. typhi implies that the organism isdeficient in actin recruitment and polymerization. Of interestwould be to determine the polarity and length of R. typhi actintail filaments and whether tail production confers intracellularmotility.

The absence of a cytoskeletal stalk associated with one poleof R. prowazekii by dry cleave SEM is consistent with theabsence of actin tails by TEM and phalloidin staining (16). Thelack of ABM by R. prowazekii correlates with a reduced capac-ity to form plaques on cell monolayers. R. prowazekii alsogrows to high numbers in individual cells with little cytopathiceffect (37). R. rickettsii are toxic to cells in small numbers, withcytopathological changes indicative of oxidative stress (for ex-ample, dilation of the rough endoplasmic reticulum) observed2 days after infection (35). Elevated cellular levels of reactiveoxygen species, such as superoxide anion and hydrogen perox-ide, are observed concomitant with R. rickettsii infection (34).Movement of SFG rickettsiae by ABM likely results in fre-quent collisions with the plasma membrane, where the actionof rickettsial phospholipase(s) may produce by-products capa-ble of activating membrane-bound NADPH oxidase (or a sim-ilar enzyme) to produce superoxide anion (34).

Differential localization of cytoskeletal proteins was ob-served between R. rickettsii and L. monocytogenes actin tails. Incontrast to Listeria, in which VASP and profilin are localized tothe polymerizing end of the bacterium (5, 38), both proteinsare distributed throughout the R. rickettsii actin tail. VASP is asubstrate of cyclic AMP- and cyclic GMP-dependent proteinkinases and is generally localized to focal adhesions and areasof high actin turnover (28). VASP is also a ligand for profilin(27), a G-actin-sequestering protein, and binds the proline-richmotif in the central region of Listeria ActA (5, 25). Althoughnot essential for Listeria ABM, VASP and profilin acceleratethe process, possibly by recruiting polymerization-competentactin monomers in the form of profilin-actin complexes to theunipolar polymerization zone of the bacterium (20, 22, 38, 42).One possible explanation for the distribution of VASP andprofilin in rickettsial tails is that R. rickettsii secretes a proteinthat is incorporated into the tail and a ligand for VASP. Al-ternatively, VASP may localize to the R. rickettsii actin tail viaassociation with vinculin, which is a known ligand of VASP (29)and also in the rickettsial tail. In this scenario vinculin may serveas an adapter protein between a rickettsial protein necessaryfor ABM and VASP. Whether VASP serves a functional rolein accelerating rickettsial ABM by recruiting profilin-actin com-plexes to the polymerization zone requires further investigation.

Both R. rickettsii and L. monocytogenes actin tails containedfilamin, but rickettsial tails lacked tropomyosin, ezrin, and pax-illin. Filamin is an actin cross-linking protein found in focaladhesions and stress fibers (24) and may play a role in bundlingrickettsial tail filaments. The lack of tropomyosin, ezrin, andpaxillin in rickettsial tails may explain the short length of rick-ettsial protrusions relative to those induced by Listeria. Theseproteins all integrate with the actin cytoskeleton and play rolesin the formation of cell surface extensions, such as filopodia(23). By TEM and SEM we observed rickettsia in short pro-trusions (3 to 5 mm) considerably shorter than those reportedfor Listeria. Depending on the cell type, Listeria-containingprotrusions can exceed 100 mm in length (33). The short R.rickettsii protrusions in Vero cells may reflect an inability of

rickettsial tail filaments to interact and become stabilized byplasma membrane cytoskeletal proteins.

The results of this study are in close agreement with therecently published findings of Gouin et al. (12) in their study ofa related organism, Rickettsia conorii, the agent of Mediterra-nean spotted fever. Like R. rickettsii tails, R. conorii actin tailswere found to be comprised of long, minimally cross-linkedactin filaments with the fast-growing barbed end of the fila-ments oriented towards the organism. In addition to lackingezrin, they reported the absence of Arp3, cofilin, and cappingprotein (CapZ) in R. conorii tails. The unique ultrastructuraland compositional differences between rickettsial and listerialtails may explain the different ABM behavior and kinetics inthe two genera (12, 15). Both R. conorii and R. rickettsii moveconsiderably slower than Listeria within cells (12, 15), and theactin filaments that comprise the R. rickettsii tail are approxi-mately three times more stable than those of listerial tails (15).The lack of Arp3, cofilin, and capping protein may partiallyexplain the low rate of rickettsial ABM relative to that ofListeria. These proteins affect actin nucleation (22, 51) or G-actin acquisition (22, 41) and are required for listerial actin tailformation. The lower rate of rickettsial ABM and longer half-life of tail filaments may also be reflective of the tail containingfewer pointed ends for depolymerization factors to act upon.The absence of Arp3 is particularly interesting, as the Arp com-plex is required for nucleation of new actin filaments in actin-based movements of Listeria (22, 51), Shigella (22), and pre-sumably vaccinia virus (10). This leads to the possibility thatrickettsiae synthesize a protein that confers actin nucleatingactivity rather than recruiting a nucleating factor from the host.

Our results differ from those of Gouin and coworkers (12) indetecting vinculin within the R. rickettsii tail. Furthermore, theydid not observe coiled, distinct actin bundles in R. conorii tails,and tail production was observed only after 24 to 36 h ofinfection. In a previous study we detected R. rickettsii tail for-mation 30 min postinfection, with F-actin-coated rickettsiaeobserved as early as 15 min postinfection (16), suggesting thatsome R. rickettsii organisms enter host cells preloaded with afunctional protein(s) necessary for ABM. This is unlike Liste-ria, in which bacterial cell division and ActA processing isrequired for ABM (30).

The results of this study suggest that R. rickettsii has evolvedto exploit host actin pools in a manner biologically distinctfrom Listeria and Shigella. Additional studies are needed toclearly define the roles of host cytoskeletal proteins in rickett-sial ABM. Of great interest to the field is the identity of theessential rickettsial protein(s) necessary for ABM. A candi-date protein may be identified upon completion of the R.conorii genomic sequencing project currently under way byGenoscope (htpp://www.genoscope.cns.fr/).

ACKNOWLEDGMENTS

We thank Scott Boitano, Shelly Robertson, and Scott Grieshaber forreview of the manuscript, and Lorraine Barrows for technical assis-tance.

This work was supported by National Institutes of Health grantAI-43502-01 (R.A.H.).

REFERENCES1. Anacker, R. L., R. E. Mann, and C. Gonzales. 1987. Reactivity of monoclonal

antibodies to Rickettsia rickettsii with spotted fever and typhus group rick-ettsiae. J. Clin. Microbiol. 25:167–171.

2. Bernardini, M. L., J. Mounier, H. d’Hauteville, M. Coquis-Rondon, and P. J.Sansonetti. 1989. Identification of icsA, a plasmid locus of Shigella flexnerithat governs bacterial intra- and intercellular spread through interaction withF-actin. Proc. Natl. Acad. Sci. USA 86:3867–3871.

3. Bershadsky, A. D., and J. M. Vasiliev (ed.). 1988. Cytoskeleton. PlenumPublishing Corp., New York, N.Y.

4712 VAN KIRK ET AL. INFECT. IMMUN.

on October 31, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

4. Carlier, M. F., V. Laurent, J. Santolini, R. Melki, D. Didry, G. X. Xia, Y.Hong, N. H. Chua, and D. Pantaloni. 1997. Actin depolymerizing factor(ADF/cofilin) enhances the rate of filament turnover: implication in actin-based motility. J. Cell Biol. 136:1307–1322.

5. Chakraborty, T., F. Ebel, E. Domann, K. Niebuhr, B. Gerstel, S. Pistor, C. J.Temm-Grove, B. M. Jockusch, M. Reinhard, U. Walter, and J. Wehland.1995. A focal adhesion factor directly linking intracellularly motile Listeriamonocytogenes and Listeria ivanovii to the actin-based cytoskeleton of mam-malian cells. EMBO J. 14:1314–1321.

6. Dabiri, G. A., J. M. Sanger, D. A. Portnoy, and F. S. Southwick. 1990. Listeriamonocytogenes moves rapidly through the host-cell cytoplasm by inducingdirectional actin assembly. Proc. Natl. Acad. Sci. USA 87:6068–6072.

7. Dold, F. G., J. M. Sanger, and J. W. Sanger. 1994. Intact alpha-actininmolecules are needed for both the assembly of actin into the tails and thelocomotion of Listeria monocytogenes inside infected cells. Cell Motil. Cy-toskeleton 28:97–107.

8. Domann, E., J. Wehland, M. Rohde, S. Pistor, M. Hartl, W. Goebel, M.Leimeister-Wachter, M. Wuenscher, and T. Chakraborty. 1992. A novelbacterial virulence gene in Listeria monocytogenes required for host cellmicrofilament interaction with homology to the proline-rich region of vin-culin. EMBO J. 11:1981–1990.

9. Dramsi, S., and P. Cossart. 1998. Intracellular pathogens and the actincytoskeleton. Annu. Rev. Cell Dev. Biol. 14:137–166.

10. Frischknecht, F., S. Cudmore, V. Moreau, I. Reckmann, S. Rottger, and M.Way. 1999. Tyrosine phosphorylation is required for actin-based motility ofvaccinia but not Listeria or Shigella. Curr. Biol. 9:89–92.

11. Frischknecht, F., V. Moreau, S. Rottger, S. Gonfloni, I. Reckmann, G. Su-perti-Furga, and M. Way. 1999. Actin-based motility of vaccinia virus mimicsreceptor tyrosine kinase signalling. Nature 401:926–929.

12. Gouin, E., H. Gantelet, C. Egile, I. Lasa, H. Ohayon, V. Villiers, P. Gounon,P. J. Sansonetti, and P. Cossart. 1999. A comparative study of the actin-based motilities of the pathogenic bacteria Listeria monocytogenes, Shigellaflexneri and Rickettsia conorii. J. Cell Sci. 112:1697–1708.

13. Hackstadt, T. 1996. The biology of rickettsiae. Infect. Agents Dis. 5:127–143.14. Hackstadt, T., R. Messer, W. Cieplak, and M. G. Peacock. 1992. Evidence for

proteolytic cleavage of the 120-kilodalton outer membrane protein of rick-ettsiae: identification of an avirulent mutant deficient in processing. Infect.Immun. 60:159–165.

15. Heinzen, R. A., S. S. Grieshaber, L. S. Van Kirk, and C. J. Devin. 1999.Dynamics of actin-based movement by Rickettsia rickettsii in Vero cells.Infect. Immun. 67:4201–4207.

16. Heinzen, R. A., S. F. Hayes, M. G. Peacock, and T. Hackstadt. 1993. Direc-tional actin polymerization associated with spotted fever group rickettsiainfection of Vero cells. Infect. Immun. 61:1926–1935.

17. Kadurugamuwa, J. L., M. Rohde, J. Wehland, and K. N. Timmis. 1991.Intercellular spread of Shigella flexneri through a monolayer mediated bymembranous protrusions and associated with reorganization of the cytoskel-etal protein vinculin. Infect. Immun. 59:3463–3471.

18. Kocks, C., E. Gouin, M. Tabouret, P. Berche, H. Ohayon, and P. Cossart.1992. L. monocytogenes-induced actin assembly requires the actA gene prod-uct, a surface protein. Cell 68:521–531.

19. Laine, R. O., K. L. Phaneuf, C. C. Cunningham, D. Kwiatkowski, T. Azuma,and F. S. Southwick. 1998. Gelsolin, a protein that caps the barbed ends andsevers actin filaments, enhances the actin-based motility of Listeria monocy-togenes in host cells. Infect. Immun. 66:3775–3782.

20. Lasa, I., V. David, E. Gouin, J. B. Marchand, and P. Cossart. 1995. Theamino-terminal part of ActA is critical for the actin-based motility of Listeriamonocytogenes; the central proline-rich region acts as a stimulator. Mol.Microbiol. 18:425–436.

21. Lett, M. C., C. Sasakawa, N. Okada, T. Sakai, S. Makino, M. Yamada, K.Komatsu, and M. Yoshikawa. 1989. virG, a plasmid-coded virulence gene ofShigella flexneri: identification of the VirG protein and determination of thecomplete coding sequence. J. Bacteriol. 171:353–359.

22. Loisel, T. P., R. Boujemaa, D. Pantaloni, and M. F. Carlier. 1999. Recon-stitution of actin-based motility of Listeria and Shigella using pure proteins.Nature 401:613–616.

23. Luna, E. J., and A. L. Hitt. 1992. Cytoskeleton–plasma membrane interac-tions. Science 258:955–964.

24. Pavalko, F. M., C. A. Otey, and K. Burridge. 1989. Identification of a filaminisoform enriched at the ends of stress fibers in chicken embryo fibroblasts.J. Cell Sci. 94:109–118.

25. Pistor, S., T. Chakraborty, U. Walter, and J. Wehland. 1995. The bacterialactin nucleator protein ActA of Listeria monocytogenes contains multiplebinding sites for host microfilament proteins. Curr. Biol. 5:517–525.

26. Prevost, M. C., M. Lesourd, M. Arpin, F. Vernel, J. Mounier, R. Hellio, andP. J. Sansonetti. 1992. Unipolar reorganization of F-actin layer at bacterialdivision and bundling of actin filaments by plastin correlate with movement

of Shigella flexneri within HeLa cells. Infect. Immun. 60:4088–4099.27. Reinhard, M., K. Giehl, K. Abel, C. Haffner, T. Jarchau, V. Hoppe, B. M.

Jockusch, and U. Walter. 1995. The proline-rich focal adhesion and micro-filament protein VASP is a ligand for profilins. EMBO J. 14:1583–1589.

28. Reinhard, M., M. Halbrugge, U. Scheer, C. Wiegand, B. M. Jockusch, and U.Walter. 1992. The 46/50 kDa phosphoprotein VASP purified from humanplatelets is a novel protein associated with actin filaments and focal contacts.EMBO J. 11:2063–2070.

29. Reinhard, M., M. Rudiger, B. M. Jockusch, and U. Walter. 1996. VASPinteraction with vinculin: a recurring theme of interactions with proline-richmotifs. FEBS Lett. 399:103–107.

30. Robbins, J. R., A. I. Barth, H. Marquis, E. L. de Hostos, W. J. Nelson, andJ. A. Theriot. 1999. Listeria monocytogenes exploits normal host cell pro-cesses to spread from cell to cell. J. Cell Biol. 146:1333–1350.

31. Rosenblatt, J., B. J. Agnew, H. Abe, J. R. Bamburg, and T. J. Mitchison.1997. Xenopus actin depolymerizing factor/cofilin (XAC) is responsible forthe turnover of actin filaments in Listeria monocytogenes tails. J. Cell Biol.136:1323–1332.

32. Sanger, J. M., B. Mittal, F. S. Southwick, and J. W. Sanger. 1995. Listeriamonocytogenes intracellular migration: inhibition by profilin, vitamin D-bind-ing protein and DNase I. Cell Motil. Cytoskeleton 30:38–49.

33. Sechi, A. S., J. Wehland, and J. V. Small. 1997. The isolated comet tailpseudopodium of Listeria monocytogenes: a tail of two actin filament popu-lations, long and axial and short and random. J. Cell Biol. 137:155–167.

34. Silverman, D. J. 1997. Oxidative cell injury and spotted fever group rickett-siae, p. 79–98. In B. Anderson, M. Bendinelli, and H. Friedman (ed.), Rickettsialinfection and immunity. Plenum Publishing Corp., New York, N.Y.

35. Silverman, D. J. 1984. Rickettsia rickettsii-induced cellular injury of humanvascular endothelium in vitro. Infect. Immun. 44:545–553.

36. Silverman, D. J., L. A. Santucci, N. Meyers, and Z. Sekeyova. 1992. Pene-tration of host cells by Rickettsia rickettsii appears to be mediated by aphospholipase of rickettsial origin. Infect. Immun. 60:2733–2740.

37. Silverman, D. J., C. L. Wisseman, Jr., and A. Waddell. 1980. In vitro studiesof Rickettsia-host cell interactions: ultrastructural study of Rickettsiaprowazekii-infected chicken embryo fibroblasts. Infect. Immun. 29:778–790.

38. Smith, G. A., J. A. Theriot, and D. A. Portnoy. 1996. The tandem repeatdomain in the Listeria monocytogenes ActA protein controls the rate of actin-based motility, the percentage of moving bacteria, and the localization of vaso-dilator-stimulated phosphoprotein and profilin. J. Cell Biol. 135:647–660.

39. Temm-Grove, C. J., B. M. Jockusch, M. Rohde, K. Niebuhr, T. Chakraborty,and J. Wehland. 1994. Exploitation of microfilament proteins by Listeriamonocytogenes: microvillus-like composition of the comet tails and vectorialspreading in polarized epithelial sheets. J. Cell Sci. 107:2951–2960.

40. Teysseire, N., J. A. Boudier, and D. Raoult. 1995. Rickettsia conorii entry intoVero cells. Infect. Immun. 63:366–374.

41. Theriot, J. A. 1997. Accelerating on a treadmill: ADF/cofilin promotes rapidactin filament turnover in the dynamic cytoskeleton. J. Cell Biol. 136:1165–1168.

42. Theriot, J. A., J. Rosenblatt, D. A. Portnoy, P. J. Goldschmidt-Clermont, andT. J. Mitchison. 1994. Involvement of profilin in the actin-based motility ofL. monocytogenes in cells and in cell-free extracts. Cell 76:505–517.

43. Tilney, L. G., P. S. Connelly, and D. A. Portnoy. 1990. Actin filament nucle-ation by the bacterial pathogen, Listeria monocytogenes. J. Cell Biol. 111:2979–2988.

44. Tilney, L. G., D. J. DeRosier, A. Weber, and M. S. Tilney. 1992. How Listeriaexploits host cell actin to form its own cytoskeleton. II. Nucleation, actinfilament polarity, filament assembly, and evidence for a pointed end capper.J. Cell Biol. 118:83–93.

45. Tilney, L. G., and D. A. Portnoy. 1989. Actin filaments and the growth,movement, and spread of the intracellular bacterial parasite, Listeria mono-cytogenes. J. Cell Biol. 109:1597–1608.

46. Tilney, L. G., and M. S. Tilney. 1994. Methods to visualize actin polymer-ization associated with bacterial invasion. Methods Enzymol. 236:476–481.

47. Walker, D. H. 1989. Rocky Mountain spotted fever: a disease in need ofmicrobiological concern. Clin. Microbiol. Rev. 2:227–240.

48. Walker, T. S. 1984. Rickettsial interactions with human endothelial cells invitro: adherence and entry. Infect. Immun. 44:205–210.

49. Walker, T. S., and H. H. Winkler. 1978. Penetration of cultured mousefibroblasts (L cells) by Rickettsia prowazeki. Infect. Immun. 22:200–208.

50. Way, M. 1998. Interaction of vaccinia virus with the actin cytoskeleton. FoliaMicrobiol. 43:305–310.

51. Welch, M. D., J. Rosenblatt, J. Skoble, D. A. Portnoy, and T. J. Mitchison.1998. Interaction of human Arp2/3 complex and the Listeria monocytogenesActA protein in actin filament nucleation. Science 281:105–108.

52. Winkler, H. H., and E. T. Miller. 1982. Phospholipase A and the interactionof Rickettsia prowazekii and mouse fibroblast L-929 cells. Infect. Immun.38:109–113.

Editor: A. D. O’Brien

VOL. 68, 2000 RICKETTSIAL ACTIN TAIL STRUCTURE 4713

on October 31, 2020 by guest

http://iai.asm.org/

Dow

nloaded from