ultrascale computing program vision darpawood/dna/ultrascale_approved.pdf · cellular engineering...
TRANSCRIPT
![Page 1: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/1.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 1
UltraScale ComputingProgram Vision
Machines with Human-Like Cleverness
Humans with Machine-Like Precision
“What the ancients called a clever fighter is one who notonly wins, but excels in winning with ease” -- Sun Tsu
E.D. (Sonny) Maynard, Jr.Information Technology Office
![Page 2: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/2.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 2
Enable Computation
Based OnBiological
Material
Explore TheUpper
Reaches Of ComputerComplexity
Swarm Computing
Artificial Nervous System
Quantum Computing
InorganicMachine
Inference & Creativity
DNA Computing
Cellular Engineering
Living Neuronal Networks
OrganicBiology
ThatComputes
UltraScale ComputingProgram Structure
![Page 3: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/3.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 3
Warrior Robots
Disposable Supercomputers
Materials That Think
Fly-By-Thought
Instant Training
Why Is UltraScale ComputingImportant to DOD?
![Page 4: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/4.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 4
SwarmComputing
Expected Results:Simulation & testshow >1,000,000cellular automatacan solve partial
differential equations
The Inorganic WorldSwarm Computing
Artificial Nervous System
Quantum Computing
![Page 5: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/5.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 5
Swarm ComputingTwo Representative Projects
Context: Applications with very highI/O bandwidth requirements such asimage and signal processing includingSAR, passive and active SONAR, andsatellite reconnaissance images.
Continuum Computer ArchitectureCalifornia Institute of Technology
Context: To reliably obtain a desiredbehavior by engineering the cooperationof many parts, without assuming anyprecision interconnect or precisiongeometrical arrangement of the parts
Amorphous ComputingMassachusetts Institute of Technology
The Inorganic world
Swarm Computing
Artificial Nervous System
Quantum Computing
![Page 6: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/6.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 6
ArtificialNervous System
Expected Results:Machine inferenceand creativity resultfrom interaction with
the environment
The Inorganic WorldSwarm Computing
Artificial Nervous System
Quantum Computing
![Page 7: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/7.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 7
ANS NeuronFour Compartment
Structure
750nm
500nm
500nm
Tuft
Neck
Soma
Base
3.5nm
3.5nm
10nm
6nm
Top DownInputs
ModulatoryInputs
Bottom-UpInputs
Active Currents
Local InhibitionLocal Excitation
Spike Output
Context: Construct realistic electronicnervous system that acquires a worldview through sensory motor controlsto provide the central nervous systemfor battlefield robots.
Artificial Nervous System, Raytheon/TI
Context: Demonstrates the abilityto encode desired machine input tothat region so it is correctlyinterpreted by the rest of the brain
NeuroModem HNC Software Inc./Robert Hecht-Nielsen
Artificial Nervous SystemsTwo Representative Projects
The Inorganic world
Swarm Computing
Artificial Nervous System
Quantum Computing
![Page 8: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/8.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 8
QuantumComputing
Expected Results:An N-bit quantumprocessor solves aproblem of order 2N
The Inorganic WorldSwarm Computing
Artificial Nervous System
Quantum Computing
![Page 9: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/9.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 9
• Information (qubits) = Nuclear spinsNuclear spins
• Interactions = Chemical bondsChemical bonds
• Circuits = Electromagnetic field pulsesElectromagnetic field pulses
0 =
1 =
Single MoleculeSingle MoleculeQuantum ComputerQuantum Computer
(Gershenfeld and Chuang, Science 275, p.350, 1997)
Quantum ComputingThe Inorganic world
Swarm Computing
Artificial Nervous System
Quantum Computing
![Page 10: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/10.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 10
= ?=
1 = 0 =
Quantum ComputingThe Inorganic world
Swarm Computing
Artificial Nervous System
Quantum Computing
![Page 11: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/11.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 11
0 + 11
2
1
2= =Superposition
of 0 and 1!
• Two spins: four states in superposition
1 = 0 =
c c c c0 1 2 3+ + + 1100 01 10
Quantum ComputingThe Inorganic world
Swarm Computing
Artificial Nervous System
Quantum Computing
![Page 12: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/12.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 12
• N spins -- 2N states in superposition
. . .0...00 + 0…01 + … + 1…11
1 = 0 =
Quantum ComputingThe Inorganic world
Swarm Computing
Artificial Nervous System
Quantum Computing
![Page 13: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/13.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 13
Why don’t we have Quantum computerstoday?
• Coupling between quantum computation medium andphysical world
• Must be isolated during computation
• Must be coupled for input/output
• Error correction
• Large scale packaging
Quantum ComputingThe Inorganic world
Swarm Computing
Artificial Nervous System
Quantum Computing
![Page 14: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/14.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 14
Context: Desktop quantumcomputer with NMR I/O.
Bulk Quantum Computation with NMRStanford, MIT, U-California-Berkeley
Quantum ComputingTwo Representative Projects
Quantum Information Computation CalTech, U-Southern California, MIT
Context: Quantum computers solveproblems impossible for classicalcomputers; quantum computationimpacts cryptographic security;quantum communication enables newsecure cryptographic protocols
The Inorganic world
Swarm Computing
Artificial Nervous System
Quantum Computing
![Page 15: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/15.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 15
DNA Computing
01011011001110110101.....
1
(+5V) 1
NAND
(+5V)
+5V
0
1 (+5V)
+5V
0 (0V)
(0V) 0
NOR
AGGTCAGCGTAGCCGATC
GuanineCytosineAdenine Thymine
Expected Results: Datahas been stored &
retrieved from DNA & asimulated problem, order
>256, is solved
The Organic WorldThe Organic WorldDNA Computing
Cellular Engineering
Living Neuronal Networks
![Page 16: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/16.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 16
● Draw a path from the first city to the last while passing through all citiesonly once
– This is known to be a hard problem● When the number of cities is > 70, the problem is too complex for even
a supercomputer to solve
● Generate all possible paths
● Keep only those paths that go from “start” to “end”
● Find the ones passing through 7 cities
● Isolate paths with 7 different cities
DNA ComputingRepresentative Project
11
2233
44
77
6655
Theoretical & Experimental Aspects of Biomolecular ComputingUniversity of Southern California
The Organic world
DNA Computing
Cellular Engineering
Living Neuronal Networks
![Page 17: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/17.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 17
DNA Mk 1The Stickers Model
• Memory Strand for Breaking DES– 11580 bases in length– Subdivided into 579 non-overlapping regions, 20 bases long
• Stickers– Each sticker is 20 bases long– Complementary to one and only one of the 579 memory regions
• Each Region is One Bit– Bit On: Sticker is annealed to memory strand– Bit Off: No sticker
Memory Strand
ACGGTTAACGCAGGATCCCAATACACTGACTCCCAATAGGCCCTGCAAGCTAACGTTAGCCTGCCAATTGCGTCCTAGGGT GGACGTTCGATTGCAATCGG
StickerOn
StickerOn
1 10Sticker
Off
The Organic world
DNA Computing
Cellular Engineering
Living Neuronal Networks
![Page 18: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/18.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 18
DNA + Robotics =DNA Computing
Robotic Refinery
00 11
0 000 101 001 10
Bo
1 0 01 1 0
00 11
B1
1 1 0
0 0 00 1 0
00 110 0 0
B1
1 0 00 1 0
S2
1 0 1
S2
0 0 0 1 1 00 1 1 1 0 10 1 1
0 000 11
Context: If the biochemical errorrate is <1:10,000 and unit operationis one second, then a computer of<1m3 breaks DES in 2 hours.
The Organic world
DNA Computing
Cellular Engineering
Living Neuronal Networks
![Page 19: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/19.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 19
CellularEngineering
Expected Results:Finite state machinesimplemented via gene
expression &transcription of a
bacterium
The Organic WorldThe Organic WorldDNA Computing
Cellular Engineering
Living Neuronal Networks
![Page 20: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/20.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 20
Cellular Engineering
Embedded Process-control Computation
novel, patterned materials
New ComputationalParadigms
Programming Technology
engineered cell
FSM
Create and exploit a novel technology for information processing andmanufacturing by controlling processes in living cells
DNA Computing
Cellular Engineering
Living Neuronal Networks
The Organic world
![Page 21: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/21.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 21
Context: Establish the viability of animplantable electrical to chemicaltransducer.
Oscillating Channels and SensorsHarvard University
Cellular EngineeringTwo Representative Projects
Gene Regulatory ModelingStanford University
Context: Model the interior processesof bacteria to demonstrate externalcontrol of internal computation.
DNA Computing
Cellular Engineering
Living Neuronal Networks
The Organic world
![Page 22: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/22.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 22
Living NeuronalNetworks
Expected Results:Hybrid information
appliances, such ascomputers, peripherals,
and storage devices.
The Organic WorldThe Organic WorldDNA Computing
Cellular Engineering
Living Neuronal Networks
![Page 23: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/23.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 23
Living Neuronal NetworksTwo Representative Projects
Context: Form neuronal circuitsconnected to electronics so thatpowerful, cheap signal processingis enabled.
Electrode patterns
axon pattern
neuron body
Schematic of Neuraonl element
A Hybrid Neuron-SiliconComputational System
University of Southern California
Context: Develop novel, hybridneuron-silicon technology to harnesscomputational capacity of culturednetworks of hippocampal neurons fortemporal and spatio-temporal patternrecognition applications.
Interfacing Directed NeuronSystems with Silicon Electronics
Cornell University, WadsworthCenter, and U-Va
DNA Computing
Cellular Engineering
Living Neuronal Networks
The Organic world
![Page 24: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/24.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 24
Context: Deliver synthetic inputs directly into sensory andmemory systems of the brain; demonstrate direct, remoteaccess to the outputs of these systems in biologicalorganisms performing high level information processing.
Responses of 80monitored hippocampalcells
Decoding patterned neuralactivity for location
Detection of novel environment through neuralmonitoring
Interfacing with Large-Scale Neuronal EnsemblesMassachusetts Institute of Technology
Living Neuronal NetworksRepresentative Project
DNA Computing
Cellular Engineering
Living Neuronal Networks
The Organic world
![Page 25: UltraScale Computing Program Vision DARPAwood/DNA/ultrascale_approved.pdf · Cellular Engineering Embedded Process-control Computation novel, patterned materials New Computational](https://reader034.vdocuments.mx/reader034/viewer/2022050414/5f8a7381b8f64153350cc62f/html5/thumbnails/25.jpg)
DARPA
Approved for Public Release, Distribution Unlimited 25
Warrior Robots
Disposable Supercomputers
Materials That Think
Fly-By-Thought
Instant Training
How Can DoD UseUltraScale Computing?