ubiquitin mediated regulation of the e3 ligase gp78 by ... · journal of cell science advance...
TRANSCRIPT
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
© 2016. Published by The Company of Biologists Ltd.
Ubiquitin mediated regulation of the E3 ligase GP78 by Mahogunin in trans affects
mitochondrial homeostasis
Rukmini Mukherjee and Oishee Chakrabarti*
Biophysics & Structural Genomics Division, Saha Institute of Nuclear Physics, 1/AF
Bidhannagar, Kolkata – 700064, India
*Correspondence: [email protected]
JCS Advance Online Article. Posted on 7 January 2016
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Abstract
Cellular quality control provides an efficient surveillance system to regulate
mitochondrial turn-over. This study elucidates a novel interaction of the cytosolic E3 ligase,
MGRN1 with the ER ubiquitin E3 ligase, GP78. Loss of Mgrn1 function has been implicated
in late-onset spongiform neurodegeneration, congenital heart defects amongst several
developmental defects. MGRN1 ubiquitinates GP78 in trans via non-canonical K11 linkages.
This helps maintain constitutively low levels of GP78 in healthy cells, in turn downregulating
mitophagy. GP78, however, does not regulate MGRN1. When mitochondria are stressed,
cytosolic Ca2+ increases.This leads to reduced interaction between MGRN1 and GP78 and its
compromised ubiquitination. Chelating Ca2+ restores association between the two ligases and
the trans ubiquitination. Catalytic inactivation of MGRN1 results in elevated levels of GP78
and consequential increase in the initiation of mitophagy. This is significant because
functional depletion of MGRN1 by membrane-associated disease causing prion protein,
CtmPrP affects polyubiquitination and degradation of GP78, also leading to an increase in
mitophagy events. This suggests that MGRN1 participates in mitochondrial quality control
and could contribute to neurodegeneration in a sub-set of CtmPrP mediated prion diseases.
Keywords: MGRN1 / GP78 / mitochondria / ubiquitination/ mitophagy
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Introduction
Ubiquitination of proteins is an essential regulator of the cellular machinery and has multiple
roles in maintaining its homeostasis. Addition of ubiquitin molecules to cellular substrates act
as signals which either result in proteasomal degradation of targets or regulate their function.
The ubiquitination process involves an E1 ubiquitin-activating enzyme, an E2-conjugating
enzyme and an E3-ubiquitin ligase. The E3-ubiquitin ligase imparts substrate specificity
(Hershko and Ciechanover, 1998). Ubiquitination mediated regulation can be complex where
several E3 ligases act together to modulate cellular processes. The regulation of degradation
of the E3 ligases remains a relatively unexplored area. They can be degraded by the
proteasome via two main mechanisms – self-catalyzed ubiquitination and/or the activity of an
exogenous ligase. Self-ubiquitination, the hallmark of E3 ligases has long been considered to
target them for degradation. However, it turns out that many of them, even those that catalyze
their own ubiquitination, are targeted in trans by exogenous ligases. Similarly, self-
ubiquitination has been implicated in regulation of their activity and need not necessarily
target these proteins for degradation (Weissman et al., 2011; de Bie and Ciechanover, 2011).
Several ligases that can mediate their own degradation are also shown to be regulated
by other external ligases. One such ligase is the mouse double minute (Mdm2), which can
direct its own ubiquitination and subsequent proteasomal degradation. In parallel, it has also
been reported that the histone acetyl transferase p300-CBP-associated factor (PCAF)
ubiquitinates Mdm2, resulting in its proteasomal degradation (Linares et al., 2007). It has
been proposed that self-induced degradation of Mdm2 serves as a backup mechanism that
occurs only when its level exceeds a certain threshold (Song et al., 2008). Similarly, GP78, a
RING finger ligase implicated in ER-associated degradation (ERAD) of misfolded proteins,
can self-ubiquitinate leading to its own degradation (Fang et al., 2001). In addition it is also
targeted for proteasomal degradation by HRD1 and in turn affects the levels of insulin-
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
induced gene-1 (Insig-1) (Ballar et al., 2010; Shmueli et al., 2009). GP78 may also be
ubiquitinated by the TRIM25 (tripartite motif-containing protein 25) for proteasomal
degradation, though the physiological revelance of this is unknown (Wang et al., 2014). The
E3 ligases of the CBL (named after Casitas B-lineage Lymphoma) family known to
ubiquitinate and down-regulate growth factor receptors; also appear to be regulated by other
ligases in trans. The HECT (homologous to the E6-AP carboxyl terminus) E3 ligases
NEDD4 and ITCH degrade CBL proteins to reverse their effects on receptor downregulation
and signaling (Courbard et al., 2002; Magnifico et al., 2003; Yang et al., 2008; Gruber et al.,
2009).
GP78/AMFR (autocrine motility factor receptor), is an E3 ligase that is linked to
tumor metastasis as a receptor of autocrine motility factor. It is also established to mediate
ubiquitination of ERAD substrates like CFTR (cystic fibrosis transmembrane conductance
regulator) and APOB (apolipoproteinB) for proteasomal degradation, thereby playing an
important role in this cellular process. Recent studies further highlight a role of GP78 in
mitophagy. Overexpression of functional GP78 but not its catalytic RING domain mutant
causes perinuclear mitochondrial clustering. This leads to increased ubiquitination and
degradation of mitofusins along with an increase in LC3 recruitment to the mitochondria
associated endoplasmic reticulum (Fu et al., 2013). Degradation of mitofusins by GP78 is
depolarisation dependent as this occurs in the presence of CCCP (carbonyl cyanide m-chloro
phenyl hydrazone), thus suggesting a role for GP78 in quality control of depolarised
mitochondria. Here we show that the protein levels of GP78 are in turn controlled by
Mahogunin RING Finger 1 (MGRN1) mediated ubiquitination in a CCCP dependent manner,
thereby providing a higher order of regulation of mitochondrial health.
MGRN1 is a cytosolic RING domain containing E3 ligase, loss of which has been
implicated to have roles in mahoganoid coat color, adult-onset spongiform neurodegeneration
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
(phenotypically similar to Prion diseases), reduced embryonic viability (with 46-60%
mortality of homozygotes by weaning age) and developmental defects (including heterotaxia
and congenital heart defects) in mice (He et al., 2003; Cota et al., 2006; Chakrabarti and
Hegde, 2009; Jiao et al., 2009). While recent studies implicate a role of MGRN1 in oxidative
stress, (Sun et al., 2007; Chhangani and Mishra, 2013), the molecular basis for these
observations was elusive.
Our study identifies GP78 to be a molecular player by means of which MGRN1 can
affect the mitochondria. MGRN1 interacts with and ubiquitinates GP78 via non-canonical
K11 lysine linkages, thereby targets it for proteasomal degradation. This ubiquitination is
CCCP dependent as it occurs in normal cells but decreases with CCCP treatment resulting in
concomitant higher GP78 levels favouring mitophagy of depolarised mitochondria. Presence
of CCCP leads to rise in cytosolic Ca2+, which is detrimental for the interaction of MGRN1
with GP78 and hence its ubiquitination. BAPTA [1, 2-bis (o-aminophenoxy) ethane-N, N,
N’, N’-tetraacetic acid], a chelator of Ca2+ ions can reverse these effects. This study becomes
more significant because perturbation of MGRN1 function in the presence of disease-causing
PrP mutants compromises polyubiquitination of GP78 suggesting that MGRN1 participates
in mitochondrial biogenesis and dysfunction in CtmPrP mediated neurodegeneration.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Results
Depletion of MGRN1 results in altered mitochondrial distribution.
We observed in different cell lines and primary cells that the typical well spread-out pattern
of mitochondrial distribution got altered upon functional depletion of MGRN1 (Fig. 1). HeLa
cells treated with MGRN1 siRNAs or transiently expressing catalytically inactive MGRN1
lacking the RING domain (MGRN1ΔR) showed perinuclear clustering of mitochondria with
reduction in mitochondrial distribution when compared to control cells treated with mock
siRNA or those expressing functional MGRN1 (Figs 1A,B,S1A, see also Supplementary
movies 1 and 2). The altered mitochondrial distribution in MGRN1 depleted cells was very
similar to that observed in cells overexpressing GP78 (Fu et al., 2013) (Fig. S1B,C). To
validate the role of MGRN1, siRNA treated HeLa cells were subjected to rescue experiments.
It was noted that expression of MGRN1 rescued the clustering phenotype, while MGRN1ΔR
could not (Fig. 1C,D). The mitochondrial distribution was afflicted in a cell line independent
manner as it was detected in HeLa cells, SHSY5Y cells and primary mouse embryonic
fibroblasts (MEFs) (Fig. 1E-G). Immunostaining of MGRN1 siRNA treated cells with
Cytochrome c oxidase subunit IV (COX4) antibody and confocal imaging of live cells
cotransfected with MGRN1/MGRN1ΔR and mitoRFP also showed perinuclearly clustered
mitochondria (Fig. S1D-F). MGRN1 null melanocytes ([Mgrn1md-nc or Mgrn1 null] cells) did
not have mitochondrial clusters (Fig. S1G). Altered mitochondrial distributions are also seen
on treating most cell-lines (like HeLa) with carbonyl cyanide m-cholorophenyl hydrazone
(CCCP) irrespective of the MGRN1 status. Melanocytes, however did not show this
phenotype which might account for lack of mitochondrial clustering in MGRN1 null
melanocytes (Fig. S1H).
To access connectivity of the mictochondrial populations, HeLa cells were analysed
for fluorescence recovery after photobleaching (FRAP). The mitochondrial fluorescence
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
recovered with a t1/2= ~30 + 3s in control cells expressing MGRN1 (Fig. S2A and B). In
contrast little or no recovery was observed in MGRN1ΔR cells over a 5min period, indicating
that the mitochondrial network is compromised in the perinuclear clusters.
MGRN1 interacts with and ubiquitinates GP78 targeting it for proteasomal
degradation.
Since overexpression of GP78 and depletion of MGRN1 similarly affected mitochondrial
distribution, it was obvious to check if MGRN1 could directly affect GP78 protein levels.
HeLa cell lysates had significantly lower GP78 protein levels in the presence of functional
MGRN1, than in cells expressing catalytically inactive RING mutants or vector controls.
Corroborating this, higher levels of GP78 were present in MGRN1 depleted HeLa cells and
melan md1-nc cells, compared to the corresponding controls (Fig. 2A, B). Ectopic
overexpression of MGRN1 partially rescued the GP78 levels in cells treated with MGRN1
siRNAs (Fig. 2C). As levels of GP78 decreased on MGRN1 overexpression we speculated
that GP78 was itself an ubiquitination substrate of MGRN1. MGRN1 co-immunoprecipitated
with endogenous GP78 in mouse brain lysate (Fig. 2D,E) and with FLAG-tagged GP78 in
HeLa cells (Fig. 2F,G). This interaction required the N-terminus of MGRN1 (Fig. 2H).
Confocal imaging of cells expressing CyTERM-GFP and immunostained with MGRN1
antibody showed that MGRN1 though chiefly cytosolic did show some colocalization with
the endoplasmic reticulum in HeLa cells (Fig. S2C). Also digitonin fractionation of cells
shows a minor fraction of MGRN1 to be associated with membranes though it was primarily
cytosolic (Fig. S2D). This protein-protein interaction led to ubiquitination of GP78, for which
MGRN1 and Ub were both required (Fig. 2I). Further, in vivo ubiquitination of FLAG-GP78
in presence of MGRN1/MGRN1ΔR and Ub elucidated the requirement of functional
MGRN1. Depletion of MGRN1 reduced this polyubiquitination smear. Among the various
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
lysine mutants of ubiquitin, only K11Ub in lieu of Ub was able to recapitulate a similar
pattern of ubiquitination (Figs 2J, S2E). Hence MGRN1 caused K11 linked
polyubiquitination of GP78; GP78 however did not affect ubiquitination of MGRN1 (Fig.
2K). Inhibiting the proteasome with MG132 restored GP78 levels in the presence of MGRN1
to similar levels as detected with catalytically inactive MGRN1 (MGRN1ΔR or C316D
MGRN1) (Fig. 2L, M). To further verify this, GP78 protein levels in lysates from
MGRN1/MGRN1ΔR expressing cells subjected to cycloheximide chase experiment were
assayed. Drug treatment led to decrease in GP78 levels over time in cells with control vector
or MGRN1, with faster kinetics observed in the presence of MGRN1 (Fig. 2N). Catalytic
inactivation of MGRN1 substantially prolonged the half-life of GP78. Thus MGRN1
mediated ubiquitination of GP78 regulates its steady-state levels.
Depletion of MGRN1 alters Mitofusin 1 protein levels but not mitochondrial mass.
It has been reported that overexpression of functional GP78 leads to ubiquitination of
mitofusins leading to their degradation (Fu et al., 2013). MGRN1 depleted cells phenocopy
this result and decrease in mitofusin1 (Mfn1) levels was noted in cells expressing
catalytically inactive MGRN1 (MGRN1ΔR or MGRN1C316D) and in cells treated with
MGRN1 siRNA (Fig. 3A, B). Over-expression of MGRN1 did not alter the levels of Mfn1 or
Mfn2 beyond that of the control cells. Levels of Optic Atrophy 1(Opa1) decreased with
functional depletion of MGRN1. Other proteins regulating mitochondrial dynamics (Mfn 2,
Fis1, and Drp1) remained unchanged (Fig. 3C). Decrease in Mfn1 levels in MGRN1
knockdown cells could be rescued by expressing functional MGRN1 but not MGRN1R
(Fig. 3D). Mfn1 levels were less, but no detectable changes in Mfn2 levels could be seen
when MGRN1 was totally absent as in melan md1-nc, compared with the control melan a6
cells (Fig. 3E). GP78 has been reported to affect protein levels of both mitofusins but the
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
effect of GP78 on Mfn1 protein levels is more prominent than that on Mfn2 (Fu et al., 2013)
which may be the reason why indirect perturbation of GP78 by MGRN1 did not yield
detectable alteration in Mfn2 protein levels (Fig. S2F). While perinuclear clustering of
mitochondria and reduced levels of Mfn1 were observed with depletion of functional
MGRN1, the overall mitochondrial mass remained unaffected. Equivalent levels of Timm23
(translocase of inner mitochondrial membrane 23) were detected across mitochondrial
fractions isolated from MGRN1 and MGRN1R expressing cells (Fig. 3F). The
mitochondrial DNA (mtDNA) levels with respect to the nuclear DNA (nDNA) were similar
in both the samples (Fig. 3G).
Therefore as noted earlier, GP78 mediated degradation of mitofusins occurs when
GP78 levels are high, even in absence of CCCP but this does not alter mitochondrial mass
(Fu et al., 2013).
MGRN1 mediated ubiquitination of GP78 is altered by mitochondrial stress
Since high levels of GP78 regulate mitofusin protein level and affect mitochondrial mass in a
CCCP dependent manner, (Fu et al., 2013) we hypothesized that amount of GP78 protein in
the cell might be regulated in a depolarization dependent manner. We observed that the
difference in GP78 levels between MGRN1 and MGRN1ΔR transfected cells was reduced
when cells were treated with CCCP (Fig. 4A). Next we addressed whether the mitochondrial
depolarization affected MGRN1 regulation of GP78. MGRN1 mediated in vivo ubiquitination
of GP78 was severely compromised in the presence mitochondrial stressors (like, CCCP,
antimycinA and oligomycinA). Vector controls lack the CCCP sensitivity of the
ubiquitination (Fig. 4B). Further, cells expressing MGRN1 and GP78 showed that
ubiquitination signal intensity decreased with increase in CCCP concentration (Fig. 4C).
These results pointed to a mechanism where the interaction between MGRN1 and GP78
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
could depend on mitochondrial health. The N-terminus of MGRN1 was essential for its
interaction with GP78. Hence, we checked for the in vivo ubiquitination of GP78 in presence
of MGRN1ΔN50 and MGRN1ΔN100 (N-terminal deletion mutants of MGRN1 lacking the
first 50 or 100 amino acids, respectively) when cells were either treated with CCCP or left
untreated. Ubiquitination of GP78 in presence of MGRN1ΔN50 showed mitochondrial stress
dependence like full length MGRN1 but MGRN1ΔN100 did not (Fig. 4D). Ubiquitination in
presence of MGRN1ΔN100 was constitutive and did not change with CCCP treatment. It
suggested that MGRN1ΔN100 did not interact with GP78. In this case the ubiquitination
might be due to the effect of another E3 ligase which binds and post-translationally modifies
GP78 when MGRN1 does not. Therefore amino acids 50-100 of MGRN1 interact with GP78
in a depolarization dependent manner. It might be argued that in the presence of MGRN1ΔR,
association with GP78 would occur (via 50-100 amino acids of MGRN1) but its ubiquitin-
mediated degradation is compromised due to lack of the RING domain.
Next, we addressed how this interaction between MGRN1 and GP78 could sense
mitochondrial health. Since treatment with CCCP, antimycinA or oligomycinA ultimately
leads to an increased pool of cytosolic free calcium (Ca2+), it was logical to check whether
this small molecule affected MGRN1 mediated GP78 ubiquitination during mitochondrial
stress. Moreover, Ca2+ is also an important molecule of crosstalk between the ER and
mitochondria (de Brit and Scorrano, 2010). The in vivo ubiquitination of GP78 was assayed
in presence of either CCCP alone or along with the Ca2+ chelator, BAPTA. Presence of
BAPTA could rescue the ubiquitination of GP78 in CCCP treated cells similar to the
untreated controls. Expression of MGRN1ΔN50 resulted in a similar phenotype as MGRN1,
however MGRN1Δ100 showed constitutive ubiquitination which did not change with either
CCCP or BAPTA (Fig. 4E). Hence it was prudent to hypothesize that the interaction between
MGRN1 and GP78 could be dependent on cytosolic Ca2+ -- in that case MGRN1 and GP78
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
would interact when cytosolic Ca2+ was low. High Ca2+ would disrupt such an interaction
eventually leading to reduced ubiquitination and degradation of GP78. Free intracellular
levels of Ca2+ levels were measured using FURA-2AM (Fura-2-acetoxymethyl ester) in
untreated control cells and in those treated with CCCP or/and BAPTA (Fig. 4F). Expression
of MGRN1, MGRN1Δ50 or MGRN1Δ100 did not affect the levels of free intracellular Ca2+.
Immunoprecipitation assays were performed to verify the interaction between GP78 and
MGRN1 with different Ca2+ contents in a cell-free system. The association was strongest
when EGTA was used to chelate Ca2+ and weakest when the buffer was supplemented with
5mM calcium chloride (Fig. 4G). Similar Ca2+-dependent interaction was observed with
MGRN1ΔN50 (Fig. 4H). Immunoprecipitation of GP78 by MGRN1 was compromised in the
presence of MGRN1ΔN100 and was not affected by altering Ca2+ levels. Results so far
suggest that MGRN1 mediated ubiquitination modulates steady-state levels of GP78. This
response is withdrawn specifically in response to increase in cytosolic Ca2+ levels – hence
MGRN1 indirectly participates in mitochondrial QC mechanism.
MGRN1 depleted cells show higher propensity for mitophagy
High levels of GP78 have been shown to increase mitophagy in a CCCP dependent manner.
Mitophagy events were quantitated by analysing the number of LC3 positive mitochondria
from 3D projection images (Fig. S3A). No significant increase in sensitivity to CCCP was
detected in control vector cells (Fig. S3B). When cells were cotransfected with
MGRN1/MGRN1ΔR, mitoGFP and RFP-LC3, and treated with low levels (1µM) of CCCP
and 100 nM bafilomycin A1, MGRN1ΔR expressing cells revealed increased number of LC3
positive mitochondria per cell compared to those expressing functional MGRN1 (Fig. 4I, see
also Supplementary movies 3 and 4). Under similar drug treatments, MGRN1ΔR expressing
cells showed increased colocalisation of mitochondria with p62 positive autophagic vesicles
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
than the control MGRN1 cells (Fig. S3C, D). Even in the absence of either drug, cells with
MGRN1ΔR had more number of LC3 positive mitochondria (Fig. S3B). Mitophagy was also
monitored using a dual-tagged construct called mitoRosella (Rosado et al., 2008) which
differentiates between the neutral (white) healthy mitochondria from those in acidic (red)
compartments (like amphisomes and autolysosomes). Similar results showed that MGRN1ΔR
transfected cells have more number of mitochondria in acidic compartments per cell
compared to MGRN1 control cells (Fig. S4A, B). Also as reported earlier that GP78
mediated mitophagy is PARKIN independent (Fu et al., 2013), the cell lines in this study had
similar phenotypic distribution of mitochondria and levels of GP78 but drastically varied
expression patterns of PARKIN (Fig. S4C). Hence, proposing that the mitophagy events
observed with functional depletion of MGRN1 were also PARKIN independent. Presence of
MGRN1R or non-functional MGRN1 increased LC3 and p62 in mitochondria enriched
fractions even without CCCP treatment suggesting that increase in GP78 triggered propensity
for mitophagy (Figs 4J,S3B). It was observed that catalytic inactivation of MGRN1 led to a
higher propensity towards mitochondrial depolarization as detected in cells loaded with the
potentiometric dye tetramethylrhodamine, ethyl ester (TMRE), followed by CCCP treatment
(Fig. 4K). It was further verified that when cells were transfected with different amounts of
MGRN1 construct, GP78 levels decreased with increase in MGRN1 protein levels.
Mitochondria enriched fractions from these cells showed a corresponding decrease in LC3 II
levels suggesting that increase in MGRN1 led to decrease in GP78 which in turn decreased
GP78 regulated mitophagy. Expression of MGRN1ΔR had the reverse effect on cellular
GP78 and mitochondria-associated LC3 II levels (Fig. 4L). It has been previously reported
that 10 µM CCCP treatment for 2 hours is sufficient for recruitment of LC3 to the
mitochondria-associated ER and detection of elevated levels of LC3 II in cells. However, for
the evaluation of mitochondrial loss via mitophagy a prolonged (24 hours) treatment with
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
CCCP is required (Fu et al., 2013). These indirectly also suggest that high levels of GP78
prime mitochondria for mitophagy but elevating its levels further by CCCP treatment or
depolarization ultimately culminates in mitochondrial loss.
Collectively, our results point towards a mechanism in which MGRN1 keeps GP78
protein levels low in healthy cells but this regulation is withdrawn when the mitochondria is
depolarised with CCCP. Mitochondrial stress, like that induced by CCCP releases Ca2+ into
the cytosol, weakens the interaction between MGRN1 and GP78 causing increase in GP78
levels which could then in turn trigger mitophagy. Functional depletion of MGRN1 skews the
balance towards depolarization and mitophagy. The increased propensity for mitophagy
would also explain decreased levels of the fusion protein Opa1 since it has been previously
reported that mitochondria destined for mitophagy are depolarised and lose Opa1 by
degradation (Twig et al., 2008).
GP78 is downstream of MGRN1 during mitochondrial clustering and activation of
mitophagy
Recent evidences show that non-functional MGRN1 can block fusion between
autophagosomes and lysosomes, however the initial steps of autophagy are not affected by it
Maturation of late endosomes, generation of amphisomes or lysosomal proteolytic activity
also does not get perturbed (Majumder and Chakrabarti, 2015). Hence, it was obvious to
check to confirm that the mitochondrial changes observed in MGRN1 depleted cells were due
to GP78, cells were cotransfected with different MGRN1 and GP78 constructs in indicated
combinations. Imaging studies showed that mitochondria clustered in the presence of
functional GP78, irrespective of the MGRN1 status (Fig. 5A,B). Similarly Mfn1 levels were
lower in cells where functional GP78 was overexpressed irrespective of the presence of
MGRN1 (Fig. 5C). Also, with GP78 depletion, MGRN1ΔR overexpression no longer
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
resulted in perinuclear clustering of mitochondria (Fig. 5D,E). To see if increase in
mitophagy in MGRN1 depleted cells was mediated by GP78 we checked for mitophagy
events in GP78 siRNA treated cells cotransfected with MGRN1/MGRN1ΔR, mitoGFP and
RFP-LC3. In cells treated with GP78 siRNA the difference between MGRN1 and
MGRN1R on LC3 positive mitochondria was no longer significant (Fig. 5F). Thus
perinuclear clustering, decrease in Mfn1 levels and mitophagy may be attributed to GP78.
Functional depletion of MGRN1 by disease-causing PrP mutants affects ubiquitination
of GP78
MGRN1 has been implicated to interact with an aberrant metabolic isoform of the
ubiquitously expressed cell surface glycoprotein, mammalian PrP, referred to as CtmPrP.
Studies have shown that increased generation of CtmPrP {either by expression of artificial
constructs like, PrP(AV3), PrP(KH-II) or naturally occurring human disease mutation
{PrP(A117V)} leads to spongiform neurodegeneration in animal models (Hegde et al., 1998;
Rane et al., 2008) and also affect activity of MGRN1 in cell culture systems (Chakrabarti and
Hegde, 2009). Brain lysates from transgenic mice expressing CtmPrP {PrP(A117V)} show
decrease in Mfn1 and increase in GP78 levels, while Mfn2 protein levels remain unaltered,
when compared with the non-transgenic control (Fig. 6A). In HeLa cells, expression of the
indicated CtmPrP generating constructs {PrP(AV3), PrP(KHII), PrP(A117V)} also resulted in
similar changes in the protein levels of Mfn1 and GP78 (Fig. 6B). Wild type PrP expressing
cells had comparable levels of Mfn1 protein as the empty vector control (data not shown). In
transiently transfected cultured cells expressing wild type PrP, <1–2% of the protein is
present as CtmPrP, this percentage however increases in the presence of the above mutants
(Chakrabarti and Hegde, 2009). Polyubiquitination of GP78 was severely compromised in the
presence of CtmPrP, indicating that even indirect perturbation of MGRN1 activity was
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
sufficient to elicit an effect similar to its depletion (Fig. 6C). Simultaneously, increased levels
of GP78 (due to lack of its polyubiquitination and clearance) led to perinuclear mitochondrial
clusters in CtmPrP expressing cells (Fig. 6D). CCCP dependence of GP78 polyubiquitination
was evident in the presence of PrP (since this does not functionally perturb MGRN1) but not
with PrP(A117V) (Fig. 6E). Presence of CtmPrP led to increase in LC3 II and p62 at the
mitochondria similar to MGRN1R (Fig. 6F). More number of LC3 positive mitochondria
are detected in PrP(KHII) expressing cells where functional MGRN1 is less compared to
those expressing PrP (Fig. 6G). Taking all these results into consideration, it may be
hypothesized that MGRN1 could play a role in regulating mitochondrial turn over by
regulating GP78 in a subset of familial prion diseases and contribute to CtmPrP mediated
neurodegeneration.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Discussion
This study elucidates a novel interaction of the cytosolic E3 ligase, MGRN1 with the
ER ubiquitin E3 ligase, GP78. This results in trans ubiquitination via non-canonical K11
linkages and degradation of GP78. The reverse is not true, meaning GP78 is not responsible
for the regulation of MGRN1. Functional MGRN1 constitutively maintains low levels of
GP78; this subjugates basal mitophagy in healthy cells. When mitochondria are stressed and
cytosolic Ca2+ increases, the ubiquitination of GP78 mediated by MGRN1 gets compromised.
Reduced ubiquitination is due to diminished interaction between MGRN1 and GP78 in the
presence of high levels of cytosolic Ca2+. GP78 interacts with the N-terminus of MGRN1
(more precisely amino acids 50-100) and this results in Ca2+ dependent ubiquitination.
Chelating away Ca2+ restores the association of GP78 with MGRN1 in a cell free system;
likewise trans in vivo ubiquitination of GP78 also occurs in the presence of BAPTA. Lack of
interaction between GP78 and MGRN1 hence over-rides the Ca2+ dependence of this trans
ubiquitination. Phenotypically the decreased MGRN1 mediated ubiquitination and
degradation of GP78 in the presence of mitochondrial stress is reflected as an increase in
propensity for mitophagy (Fig. 7). Elevated level of GP78 and consequential increase in the
initiation of mitophagy is further detected when MGRN1 is catalytically inactive. This study
becomes more significant because perturbation of MGRN1 function in the presence of
disease-causing CtmPrP mutants compromises trans polyubiquitination of GP78. Here again,
CCCP dependent regulation of GP78 levels is observed only in the presence of PrP and not
CtmPrP. Increased mitophagy is detected with over-expression of CtmPrP in cells. This study
hence highlights how MGRN1 detects mitochondrial stress and participates in mitochondrial
biogenesis. It is perfectly plausible to extrapolate that non-functional MGRN1 could
contribute to neurodegeneration in at least sub-set of CtmPrP mediated prion diseases.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Cells have evolved rigorous surveillance systems to efficiently detect and eliminate
damaged and dysfunctional mitochondria. An interdependent but hierarchial cellular quality
control (QC) mechanism exists to maintain normal mitochondrial biogenesis and to ensure
cell survival (Rugarli and Langer, 2012). Chaperones and proteases inside the mitochondria
are responsible for proper folding of preproteins imported the organelle, degradation of
irreversibly damaged polypeptides – these constitute part of the intraorganellar QC system
(Tatsuta and Langer, 2008). Mitochondrial unfolded protein response, mtUPR, part of this
QC mechanism is closely associated with the nuclear transcriptional programme that induces
expression of mitochondrial chaperones and proteases under conditions of mitochondrial
stress (Zhao et al., 2002; Benedetti et al., 2006). This first line of defense is closely followed
by the organellar QC system which alters the balance between fission and fusion during
stress. For example, nutrient deprivation induced stress or stalling cytosolic protein synthesis
may lead to impaired fission and unhindered mitochondrial fusion (Tondera et al., 2009;
Gomes et al., 2011; Rambold et al., 2011; Youle and van der Bliek, 2012). On the contrary,
this balance is pushed more towards fission when mitochondria are depolarised or there is
excessive ROS generation in these organelles. This ultimately culminates in elimination of
dysfunctional mitochondria via mitophagy. (Twig et al., 2008; Narendra et al., 2008; Wang et
al., 2012; Frank et al., 2012).
It is well established that the cytosolic ubiquitin E3 ligase, PARKIN is recruited to the
damaged mitochondria by PINK (PTEN-induced putative kinase 1) and target them for
mitophagy. This happens when these organelles are depolarised and there is increased
uncoupling of mitochondria (Matsuda et al., 2010; Gegg et al., 2010; Narendra et al., 2010;
Youle and Narendra, 2011; Ziviani et al., 2010). Once localized to the mitochondria PARKIN
ubiquitinates VDAC1 and recruites autophagic adapter p62/SQTM1 to facilitate mitophagic
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
clearance of these dysfunctional organelles (Geisler et al., 2010). Upon depolarization,
PARKIN mediates mitochondrial localization of p97, a AAA-ATPase involved in the
retrotranslocation of ER membrane-spanning proteins after ubiquitination en route to
proteasome (Ye et al., 2001; Rabinovich et al., 2002; Tanaka et al., 2010). Further, PINK
phosphorylated Mfn2 may also act as PARKIN receptors on depolarised mitochondria (Chen
and Dorn, 2013). The altered localization of PARKIN and p97 during mitochondrial stress
results in ubiquitination and proteasomal degradation of Mfn1 and Mfn2, which in turn
triggers mitophagy (Tanaka et al., 2010). These illustrate that PARKIN primarily facilitates
mitochondrial QC at the organellar level. On the other hand, the mitochondrial E3 ubiquitin
ligase, MUL1, is transcriptionally upregulated under mitochondrial stress through a
mechanism involving FoxO1/3 transcription factors (Lokireddy et al., 2012). Elevated levels
of MUL1 lead to ubiquitination and proteasomal degradation of Mfn2, finally culminating in
mitophagy (Lokireddy et al., 2012; Yun et al., 2014). Either relocation of a cytosolic ligase to
the mitochondria or transcriptional upregulation of a mitochondrial ligase under stress helps
recruit the molecular components required for mitophagy – these, hence strengthened the
argument that mechanisms must inherently exist in cells to distinguish normal and stress
conditions and facilitate efficient differential activity of these enzymes.
The ER associated E3 ubiquitin ligase; GP78 also extends support to the
mitochondrial homoeostasis via organellar quality control. This ligase is an integral
component of the ERAD machinery, whereby misfolded proteins inside the ER are
ubiquitinated and retro-translocated to the cytosol for proteasomal degradation (Fang et al.,
2001; Fairbank et al., 2009).While high levels of GP78 constitutively interacts with,
ubiquitinates and degrades Mfn1 (primarily) and Mfn2 (more modest effect), it regulates
mitophagy only upon mitochondrial depolarization (Fu et al., 2013). It is plausible to
hypothesize that GP78 levels should be maintained at low levels in cells under normal
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
circumstances to prevent unregulated degradation of mitofusins. Simultaneously it also
emphasizes the need of a molecular sensor to detect depolarization of mitochondria, during
which GP78 mediated degradation of mitofusins and onset of mitophagy would be
physiologically beneficial. Our present study identifying polyubiquitination and degradation
of GP78 by MGRN1 preferentially under normal circumstances thus provides a mechanism
to prevent this ERAD associated protein from indiscriminately removing mitofusins from
cells. This may serve dual purpose of also keeping a check on ERAD.
It is well established that many protein-protein interactions are affected by cytosolic
Ca2+ levels (Vito et al., 1996; Missotten et al., 1999; Park et al., 2013). Our results indicate
that under conditions of high cytosolic Ca2+, the interaction between MGRN1 and GP78 is
disrupted and this prevents ubiquitination and degradation of GP78. Since the physical
association between MGRN1 and GP78 is key for this post-translational modification and
eventual deregulation, functional sequestration of MGRN1 by disease causing CtmPrP mutants
elicits similar results as presence of high cytosolic Ca2+ -- thus mitochondrial deregulation
affected by the ubiquitously expressed MGRN1 could be one of the factors governing
neurodegeneration in a sub-set of prion diseases.
The effect of Ca2+ may be by either of the two ways – a direct one where MGRN1 can detect
fluctuating Ca2+ levels or an indirect method where MGRN1 competes with another ligase for binding
and ubiquitinating GP78. The association of the unknown ligase is stronger in the presence of Ca2+
and hence this competes out MGRN1. Further insight into the mechanism may come from a better
understanding of the regulation of GP78 under physiological conditions.
Further, the involvement of Ca2+ dependent regulation of ER-mitochondrial contacts
by GP78 has been previous reported (Wang et al., 2000, Goetz et al., 2007, Li et al., 2015,
Wang et al., 2015). Presence of AMF (autocrine motility factor) or RING MUT GP78 has
been shown to decrease ER-mitochondria contacts and increase ER–mitochondria Ca2+
coupling times on ATP stimulation (Wang et al., 2015). Depletion of mitofusins leads to
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
enhanced ER–mitochondria Ca2+ crosstalk, and increased sensitivity to mitochondrial
calcium mediated cell death (Filadi et al., 2015, Wang et al., 2015). Also, post translational
modification of GP78 (phosphorylation) has been shown to affect GP78 dependent mitofusin
degradation (Li et al., 2015).
It is possible to extrapolate that MGRN1 mediated ubiquitination of GP78 might be
another layer of regulation to this complex system which phenocopies the effect of AMF or
RING MUT GP78 on ER-mitochondria contacts and calcium coupling. When cytosolic
calcium levels are high MGRN1-GP78 interactions weaken which may cause increase in ER-
mitochondria contacts favoring GP78 dependent degradation of mitofusins and mitophagy.
Decreased levels of mitofusins in high cytosolic calcium conditions may also predispose cells
to other cell death pathways like apoptosis. These hypotheses however need to be
experimentally substantiated.
Excess cytosolic Ca2+ may in turn also lead to ER stress. Under such circumstances it
would be logical to have higher GP78 levels for an efficient ERAD system. It would be
prudent to extrapolate that MGRN1 provides another layer of complexity to the already
existing multi-tiered QC mechanism by repressing GP78 in healthy cells.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Materials and Methods
Constructs, antibodies and reagents
MGRN1, MGRN1ΔR, MGRN1ΔN, MGRN1ΔC, C316DMGRN1, PrP, PrP(A117V),
PrP(KHII), Prp(AV3) constructs have been described before (Chakrabarti and Hegde, 2009;
Srivastava and Chakrabarti, 2014). HA-tagged wildtype Ubiquitin was a gift of Rafael
Mattera (Bethesda, MD, USA); K0, K48, and K63 ubiquitin mutants were gifts of Kah-
Leong Lim (Singapore); HA-tagged K6, K11, K29 and K11R ubiquitin mutants were gifts of
Tomohiko Ohta (Kawasaki, Japan). FLAG-tagged GP78, FLAG-tagged RING MUT GP78,
GP78-GFP, GP78 RING MUT-GFP were gifts of Ivan Nabi (Vancouver, Canada). mito-
Rosella was a gift of Rodney Devenish (Australia), CyTERM-GFP was a gift of Erik Snapp
(NY,USA) , GFP-LC3 was a gift of Debashis Mukhopadhyay, pAcGFP1-Mito (mitoGFP)
was a gift of Subrata Banerjee (Kolkata, India), RFP-LC3, mitoRFP, MGRN1ΔN50, and
MGRN1ΔN100 were generated using standard cloning techniques.
Antibodies were from the following sources: GP78 (#sc-166358, Santa Cruz Biotechnology,
Dallas, TX, USA), Mfn1 (# ab57602, Abcam, Cambridge, UK), Mfn2 (# ab124773, Abcam,
Cambridge, UK), Opa1 (# MA5-16149, Thermo Scientific, Rockford, IL, USA), Fis1 (#
PA22142, Thermo Scientific, Rockford, IL, USA), Drp1 (# ab56788, Abcam, Cambridge,
UK) COX 4 (Cell Signaling Technology), ATP synthase Complex V (# 459240, Invitrogen,
CA, USA), β-tubulin ( # ab7792, Abcam, Cambridge, UK), Timm 23 (# ab116329, Abcam,
Cambridge, UK) p62/ SQSTM1 (#PA20839, Thermo Scientific, Rockford, IL, USA), LC3 (#
NB100-2220, Novus Biologicals), and ubiquitin (#U5379, Sigma-Aldrich). The MGRN1,
GFP, RFP,TRAPα Myc, FLAG and HA antibodies were gifts of Ramanujan S Hegde
(Cambridge, UK).
MG132, CCCP, oligomycin A, antimycin A , FURA-2AM and BAPTA-AM used were from
Sigma Aldrich; Proteinase K (GIBCO-BRL); Mitotracker Deep Red FM (Molecular
Probes,Invitrogen) Universal FastStart Syber Green Master (Rox) was from Roche,
Mannheim, Germany; Drug treatments used in the study is as follows: MG132 (20µM, 4h),
Cycloheximide (100µg/ml), CCCP (20µM, 4h). oligomycinA (10µM, 2h), antimycinA
(10µM, 6h), BAPTA-AM (75µM, 4h) and Bafilomycin A1(100nM,16h).
Cell culture, transfection and siRNA mediated knockdown
Cell lines used for the experiments were HeLa (human cervical cancer cell line), SH-SY5Y
(human neuroblastoma cell line), MEF (mouse embryonic fibroblast cells), immortal
melanocytes (control melan-a6 or Mgrn1-null melanocytes, melan md1-nc). Maintenance of
HeLa cells in culture was as before (Srivastava and Chakrabarti, 2014). Briefly, cells were
grown in 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA)/Dulbecco's
modified Eagle's medium (DMEM; Himedia, Mumbai, India) at 37°C and 5% CO2.
Immortal melanocytes were grown in culture as before (Srivastava and Chakrabarti, 2014;
Hida et al., 2009). SH-SY5Y cells gift of Debashis Mukhopadhyay (Kolkata, India) and MEF
cells (CF-1 strain) gift of Mitradas M Panicker (Bangalore, India) were also grown under
standard cell culture conditions as before (Srivastava and Chakrabarti, 2014; Roy et al., 2013)
. Immortal melanocytes (gift of Ramanujan S Hegde) were obtained from the Wellcome Trust
Functional Genomics Cell Bank.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
For transfections of cells, Lipofectamine 2000 was used (Invitrogen, Carlsbad, CA, USA) as
per the manufacturer's instructions. 24h after transfection, cells were lysed using suitable
lysis buffer. For all siRNA mediated knockdown, pooled siRNAs (Dharmacon ON-
TARGETplus SMARTpool) were used consisting of a mixture of 4 individual siRNAs.
siRNA pools used in the study are as follows: MGRN1 (L-022620-00-0020), GP78 (L-
006522-00-0010), and Non-targeting siRNA (D-001810-01-20) was used.
All tissue culture plastic-ware and Lab-Tek 8-well chambered slides used for microscopy
were from Nunc, bottom coverglass dishes used for microscopy were from SPL Lifesciences.
Mitotracker Deep Red staining and Immunocytochemistry
Mitotracker Deep Red FM was loaded in HeLa cells by incubating live cells with 100nM dye
for 20min followed by fixation with 4% formaldehyde and immunostaining. For
immunocytochemistry, cells were fixed with either 4% formaldehyde or methanol as per the
requirement of the antibody, like before (Chakrabarti and Hegde, 2009; Srivastava and
Chakrabarti, 2014). Cells were permeabilized using 10%FBS/PBS/0.1% saponin (Sigma-
Aldrich) for 60min, followed by overnight staining in primary antibody at 4°C and 60 min
incubation in secondary antibody at room temperature. The samples were then imaged using
confocal microscope.
Western blotting and Immunoprecipitation
The protocol for western blotting was as described before (Srivastava and Chakrabarti, 2014).
10% Tris-tricine gels or 7.5% Tris glycine gels were used for SDS-PAGE followed by
Western blotting. Quantification of Western blots was done using Quantity One software of
Bio-rad. At least 3 independent experiments were performed and band intensities were
normalized to loading control. p-values were determined using Student’s t-test. For
immunoprecipitation, cells were lysed in immunoprecipitation buffer (50mM Tris-Hcl, pH
7.5, 150mM NaCl, 0.1% Triton X-100, 1% IGEPAL, 1mM PMSF, protease inhibitor cocktail
(Sigma Aldrich)), and immunoprecipitation was performed under denaturing condition as
described before (Srivastava and Chakrabarti, 2014).
Total DNA isolation and Quantitative RT-PCR
Total DNA was isolated by lysing HeLa cells from a 90mm dish in 0.5ml lysis buffer
(10mMTris-Cl (pH 8.0), 0.1M EDTA, 0.1%SDS). 10μl Proteinase K (200mg/ml) was added
and incubated at 55C for 3h. The tubes were then centrifuged at 8000g for 15min.To the
supernatant, equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) was added
followed by centrifugation at 8000g for 15min.To the aqueous phase equal volume of
chloroform was added and centrifuged at 8000g for 15min. The DNA was precipitated from
the aqueous phase by adding one volume of isopropanol and one-tenth volume of 3M sodium
acetate followed by centrifugation at 8000g for 15min. Pellet was washed in 70% ethanol and
resuspended in 0.4ml TE (10 mM Tris-Cl, pH 7.5. 1 mM EDTA). 100ng of this DNA was
used as template in RT-PCR using Syber Green and primers against mitochondrially encoded
genes: ATPsynthase F0 and Cytochrome c oxidase subunit II(COXII) and nucleus encoded
gene GAPDH. Primer sequences are as follows: cytochrome oxidase subunit II (COX II Fwd:
ATCAAATCAATTGGCCACCAATGGTA, COXIIRev:
TTGACCGTAGTATACCCCCGGTC), ATPsynthase F0 (ATPS Fwd:
TTTCCCGCTCTATTGATCCC, ATPS Rev: GATGGCCATGGCTAGGTTTA), GAPDH
(GAPDH Fwd: AGAAGGCTGGGGCTCATTTG, GAPDH Rev:
AGGGGCCATCCACAGTCTTC)
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
In vivo ubiquitination assay
In vivo ubiquitination assay was performed as previously described (Srivastava and
Chakrabarti, 2014). Briefly, cells cotransfected with HA-tagged wild type Ubiquitin (or
ubiquitin mutants) MGRN1, and FLAG or GFP tagged GP78 constructs were lysed in
immunoprecipitation buffer and immunoprecipitated under denaturing condition with
FLAG/GFP antibody. Ubiquitinated GP78 or MGRN1 was detected by immunoblotting with
HA antibody. Ubiquitin constructs used are previously described (Mattera et al., 2004;
Nishikawa et al., 2004; Tan et al., 2008).
Digitonin fractionation
HeLa cells were lysed in KHM buffer with digitonin (20 mM Hepes pH 7.4,110mM
potassium acetate, 2mM magnesium acetate,100µg/ml digitonin) followed by centrifugation
at 2000g to separate membrane and cytosolic fractions. The membrane fraction was then
washed with KHM buffer and resuspended in KHM buffer with NP 40 (20 mM Hepes pH
7.4, 110mM potassium acetate, 2mM magnesium acetate, 1% NP 40). SDS PAGE was
performed followed by immunoblotting with antibodies against MGRN1, GP78, GAPDH,
and TRAPα.
Subcellular fractionation to get mitochondria enriched fractions
HeLa cells were lysed in isolation buffer (20 mM Hepes pH 7.4,10mM potassium chloride,
1.5mM magnesium chloride,1mM EDTA,1mM EGTA,1mM DTT,0.1mM PMSF, 0.25M
sucrose) by passing through a 25 gauge needle attached on a 1 ml syringe 10 times. This was
centrifuged at 600g to pellet unlysed cell debris, nuclear fractions. The rest is centrifuged at
4000g to get the mitochondria enriched fraction which was then washed twice with isolation
buffer.
Confocal imaging and image analysis
Confocal imaging was done using the Zeiss LSM510-meta, LSM710/ConfoCor 3 and Nikon
A1R+ Ti-E with N-SIM and FCS microscope systems. Ar-ion laser (for GFP excitation or
Alexa-Fluor 488 with the 488 nm line), a He-Ne laser (for RFP, Alexa-Fluors 546 and 594
excitation with the 543 line) and a He-Ne laser (for Alexa-Fluor 633 and mitoTracker
DeepRed with the 633 line) were used with 63x 1.4 NA oil immersion objective. Dichroic
mirrors used were HFT 488/543 and NFT 545.Emission filters BP530-550, BP565-615, and
LP650 were used for imaging GFP, RFP, and Mitotracker Deep Red FM respectively. mito-
Rosella, mitoGFP and mitoRFP transfected cells were imaged in CO2 independent media
maintaining conditions of live cell imaging as described before (Mitra and Lippincott-
Schwartz, 2010). Mitochondria were imaged taking Z stacks with Z interval of 0.25µm. 3D
projection images were generated in ImageJ. Z-projections of the same images were
generated and used to quantify the mitochondrial distribution {defined as (mitochondrial
area/whole cell area) *100}. Colocalisation analyses between p62 and mitochondria were
done using ZEN software. 50-100 cells were analysed from more than 5 independent
experiments for quantitative analyses.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
FRAP
HeLa cells expressing mitoRFP and GFP tagged MGRN1/MGRN1R were imaged using
conditions of live cell imaging. A fixed small ROI (5 × 10 µm) within each cell was
photobleached with a 561-nm laser at 100% power for 10s. Image acquisition was performed
every 10 s for 5min. Total fluorescence intensity of the cell and fluorescent intensity in the
bleached region was quantified using ImageJ. Signal was corrected for overall
photobleaching using signal from an unbleached cell in the same field of view as described
before (Mitra and Lippincott-Schwartz, 2010). Data was plotted using Excel (Microsoft).
Raw data (without postprocessing) were used for the quantitation. For representative images,
brightness/contrast and cropping functions were used with Photoshop (CS2; Adobe).
Measurement of changes in mitochondrial membrane potential using TMRE
HeLa cells were loaded with 200nM TMRE for 20min. A single image was taken focusing on
a single cell and keeping the plate on the microscope stage 10µM CCCP was added and the
TMRE intensity was monitored for 10min at 30s intervals. Initial Fluorescent intensity (F0),
Fluorescent Intensity at time‘t’ (Ft) was calculated using ImageJ. This is done for 8 cells per
set taken from 5 independent experiments. Average Ft/F0 is plotted versus time.
Determination of Intracellular Ca2+
HeLa cells were treated with BAPTA-AM (75 μM ,6h), CCCP (20µM, 6h) and intracellular
free Ca2+ concentration was measured using 10µM fura-2/AM in Tyrodes solution (10mM
hepes pH 7.4, 10mM NaCl, 3mM KCl,2mM CaCl2,10mM glucose). Cell loading of fura-2
was carried out at 37°C for 30 min to enhance dye uptake. Calcium concentrations were
measured from ratio of fluorescent intensitites obtained when samples were excited at 340nm
and 380nm sequentially. Rmax and Rmin were calculated as previously described (Pérez et
al., 1998; Grynkyewicz et al., 1985). An apparent Kd for Fura-2-Ca was taken as 224 nM.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Author Contributions: OC and RM conceived the project and designed the experiments.
RM performed most of the experiments with contributions from OC. RM and OC interpreted
the results and wrote the paper.
Acknowledgements: We thank S. Banerjee, I. R. Nabi, H.-S. Cho, R. Mattera, K.-L. Lim, T.
Ohta, R. Devenish and E. Snapp for plasmids; D. Mukhopadhyay; M. M. Panicker and R. S.
Hegde for cells and antibodies; P.K Chakraborty at Towa Optics (I) Pvt. Ltd. for help with
microscopy experiments; OC laboratory members (P Majumdar, D Srivastava, Z Kaul, D
Mookherjee) for their help and support throughout the study. This work was supported by the
“Integrative Biology on Omics Platform Project”, intramural funding of the Department of
Atomic Energy (DAE), Govt. of India.
Conflict of interest: The authors declare no conflict of interest, financial or otherwise.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
References
Ballar, P., Ors, A. U., Yang, H. and Fang, S. (2010). Differential regulation of
CFTRDeltaF508 degradation by ubiquitin ligases GP78 and HRD1. Int. J. Biochem. Cell
Biol. 42, 167–173.
Benedetti, C., Haynes, C. M., Yang, Y., Harding, H. P and Ron, D. (2006). Ubiquitin-like
protein 5 positively regulates chaperone gene expression in the mitochondrial unfolded
protein response. Genetics 174, 229-239.
Chakrabarti, O. and Hegde, R. S. (2009). Functional depletion of mahogunin by
cytosolically exposed prion protein contributes to neurodegeneration. Cell 137, 1136-1147.
Chen, Y. and Dorn, G. W. (2013). PINK1-Phosphorylated Mitofusin 2 Is a Parkin Receptor
for Culling Damaged Mitochondria. Science 340, 471-475.
Chhangani, D. and Mishra, A. (2013). Mahogunin ring finger-1 (MGRN1) suppresses
chaperone-associated misfolded protein aggregation and toxicity. Sci. Rep. 3, 1972.
Costantini, L. M., Fossati, M., Francolini, M., and Snapp, E. L. (2012). Assessing the
Tendency of Fluorescent Proteins to Oligomerize under Physiologic Conditions. Traffic. 13,
643–649.
Cota, C. D., Bagher, P., Pelc, P., Smith, C. O., Bodner, C. R. and Gunn, T. M. (2006).
Mice with mutations in Mahogunin ring finger-1 (Mgrn1) exhibit abnormal patterning of the
left-right axis. Dev. Dyn. 235, 3438-3447.
Courbard, J. R., Fiore, F., Adelaide, J., Borg, J. P., Birnbaum, D. and Ollendorff, V.
(2002). Interaction between two ubiquitin-protein isopeptide ligases of different classes,
CBL-C and AIP4/ITCH. J. Biol. Chem. 277, 45267–45275.
de Bie, P. and Ciechanover, A. (2011). Ubiquitination of E3 ligases: self-regulation of the
ubiquitin system via proteolytic and non-proteolytic mechanisms. Cell Death Differ. 18,
1393–1402.
de Brit, O. M. and Scorrano, L. (2010). An intimate liaison: spatial organization of the
endoplasmic reticulum–mitochondria relationship. EMBO J. 29, 2715–2723.
Fairbank, M., St‐Pierre, P. and Nabi, I. R. (2009). The Complex Biology of
Autocrine Motility Factor/Phosphoglucose Isomerase (AMF/PGI) and Its
Receptor, the Gp78/AMFR E3 Ubiquitin Ligase. Mol. Biosys. 5, 793‐801.
Fang, S., Ferrone, M., Yang, C., Jensen, J. P., Tiwari, S. and Weissman, A. M. (2001).
The tumor autocrine motility factor receptor, GP78, is a ubiquitin protein ligase implicated in
degradation from the endoplasmic reticulum. Proc. Natl. Acad. Sci. USA 98, 14422–14427.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Filadi, R., Greotti, E., Turacchio, G., Luini, A., Pozzan, T. and Pizzo, P. (2015).
Mitofusin 2 ablation increases endoplasmic reticulum-mitochondria coupling. Proc. Natl.
Acad. Sci. USA 112, E2174-E2181.
Frank, M., Duvezin-Caubet, S., Koob, S., Occhipinti, A., Jagasia, R., Petcherski, A.,
Ruonala, M. O., Priault, M., Salin, B. and Reichert, A. S. (2012). Mitophagy is triggered
by mild oxidative stress in a mitochondrial fission dependent manner. Biochim. Biophys.
Acta. 1823, 2297-2310.
Fu, M., St-Pierre, P., Shankar, J., Wang, P. T., Joshi, B. and Nabi, I. R. (2013).
Regulation of mitophagy by the Gp78 E3 ubiquitin ligase. Mol. Biol. Cell 24, 1153-1162.
Gegg, M. E., Cooper, J. M., Chau, K. Y., Rojo, M., Schapira, A. H. and Taanman, J. W. (2010). Mitofusin 1 and mitofusin 2 are ubiquitinated in a PINK1/parkin-dependent manner
upon induction of mitophagy. Hum. Mol. Genet. 19, 4861-4870.
Geisler, S., Holmström, K. M., Skujat, D., Fiesel, F. C., Rothfuss, O. C., Kahle, P. J. and
Springer, W. (2010). PINK1/Parkin-mediated mitophagy is dependent on VDAC1 and
p62/SQSTM1. Nat. Cell Biol. 12,119-31.
Goetz, J. G., Genty, H., St-Pierre, P., Dang, T., Joshi, B., Sauvé, R., Vogl, W., and Nabi,
I.R. (2007). Reversible interactions between smooth domains of the endoplasmic reticulum
and mitochondria are regulated by physiological cytosolic Ca2+ levels. J. Cell Sci., 120, 3553-
3564.
Gomes, L. C., Benedetto, G. D. and Scorrano, L. (2011). During autophagy mitochondria
elongate, are spared from degradation and sustain cell viability. Nat. Cell Biol. 13, 589–598.
Gruber, T., Hermann-Kleiter, N., Hinterleitner, R., Fresser, F., Schneider, R., Gastl, G.,
Penninger, J. M. and Baier, G. (2009). PKC-θ modulates the strength of T cell responses by
targeting CBL-b for ubiquitination and degradation. Sci. Signal. 2, ra30.
Grynkyewicz, G., Poenie, M. and Tsien, R. Y. (1985). A new generation of Ca2+ indicators
with greatly improved fluorescence properties. J. Biol. Chem. 260, 3440-3450.
He, L., Lu, X. Y., Jolly, A. F., Eldridge, A. G., Watson, S. J., Jackson, P. K., Barsh, G. S.
and Gunn, T. M. (2003). Spongiform degeneration in mahoganoid mutant mice. Science
299, 710-712.
Hegde, R. S., Mastrianni, J. A., Scott, M. R., DeFea, K. A., Tremblay, P., Torchia, M.,
DeArmond, S. J., Prusiner, S. B. and Lingappa, V. R. (1998). A transmembrane form of
the prion protein in neurodegenerative disease. Science 279, 827-834.
Hershko, A. and Ciechanover, A. (1998). The ubiquitin system. Annu. Rev. Biochem. 67,
425-479.
Hida, T., Wakamatsu, K., Sviderskaya, E. V., Donkin, A. J., Montoliu, L., Lamoreux,
M. L., Yu, B., Millhauser, G. L., Ito, S., Barsh, G. S. et al. (2009). Agouti protein,
mahogunin, and attractin in pheomelanogenesis and melanoblast-like alteration of
melanocytes: a cAMP-independent pathway. Pigment Cell Melanoma Res. 22, 623–634.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Jiao, J., Kim, H. Y., Liu, R. R., Hogan, C. A., Sun, K., Tam, L. M. and Gunn, T. M.
(2009). Transgenic analysis of the physiological functions of Mahogunin Ring Finger-1
isoforms. Genesis 47, 524-534.
Li, L., Gaoa, G., Shankar, J., Joshi, B., Foster, L. J., and Nabi, I.R. (2015). p38 MAP
kinase–dependent phosphorylation of the Gp78 E3 ubiquitin ligase controls ER–mitochondria
association and mitochondria motility. Mol. Cell. Biol., 26, 3828-3840.
Linares, L. K., Kiernan, R., Triboulet, R., Chable-Bessia, C., Latreille, D., Cuvier, O.,
Lacroix, M., Le Cam, L., Coux, O. and Benkirane, M. (2007). Intrinsic ubiquitination
activity of PCAF controls the stability of the oncoprotein HDM2. Nat. Cell Biol. 9, 331–338.
Lokireddy, S., Wijesoma, I. W., Teng, S., Bonala, S., Gluckman, P. D., McFarlane, C.,
Sharma, M. and Kambadur, R. (2012). The ubiquitin ligase Mul1 induces mitophagy in
skeletal muscle in response to muscle-wasting stimuli. Cell Metab. 16, 613-24.
Magnifico, A., Ettenberg, S., Yang, C., Mariano, J., Tiwari, S., Fang, S., Lipkowitz, S.,
and Weissman, A. M. (2003). WW domain HECT E3s target CBL RING finger E3s for
proteasomal degradation. J. Biol. Chem. 278, 43169–43177.
Majumder, P. and Chakrabarti, O. (2015). Mahogunin regulates fusion between
amphisomes/MVBs and lysosomes via ubiquitination of TSG101. Cell Death Dis. (In Press).
Matsuda, N., Sato, S., Shiba, K., Okatsu, K., Saisho, K., Gautier, C. A., Sou, Y., Saiki,
S., Kawajiri, S., Sato, F. et al. (2010). PINK1 stabilized by mitochondrial depolarization
recruits Parkin to damaged mitochondria and activates latent Parkin for mitophagy. J. Cell
Biol. 189, 211–221.
Mattera, R., Puertollano, R., Smith, W. J. and Bonifacino, J. S. (2004). The trihelical
bundle subdomain of the GGA proteins interacts with multiple partners through overlapping
but distinct sites. J. Biol. Chem. 279, 31409–31418.
Missotten, M., Nichols, A., Rieger, K. and Sadoul, R. (1999). Alix, a novel mouse protein
undergoing calcium-dependent interaction with the apoptosis-linked-gene 2 (ALG-2) protein.
Cell Death Differ. 6, 124-129.
Mitra, K. and Lippincott-Schwartz, J. (2010). Analysis of mitochondrial dynamics and
functions using imaging approaches. Curr. Protoc. Cell Biol. (ed. J. S. Bonifacino), pp.
4.25.1-4.25.21. John Wiley & Sons, Inc.
Narendra, D., Kane, L. A., Hauser, D. N., Fearnley, I. M. and Youle, R. J. (2010).
p62/SQSTM1 is required for Parkin-induced mitochondrial clustering but not mitophagy;
VDAC1 is dispensable for both. Autophagy 6, 1090-1106.
Narendra, D., Tanaka, A., Suen, D. F. and Youle, R. J. (2008). Parkin is recruited
selectively to impaired mitochondria and promotes their autophagy. J. Cell Biol. 183, 795-
803.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Nishikawa, H., Ooka, S., Sato, K., Arima, K., Okamoto, J., Klevit, R. E., Fukuda, M.
and Ohta, T. (2004). Mass spectrometric and mutational analyses reveal Lys-6-linked
polyubiquitin chains catalyzed by BRCA1-BARD1 ubiquitin ligase. J. Biol. Chem. 279,
3916–3924.
Park, S., Scheffler, T. S., Rossie, S. S. and Gerrard, D. E. (2013). AMPK activity is
regulated by calcium-mediated protein phosphatase 2A activity. Cell Calcium 53, 217-223.
Pérez, J. F., Chemello, M. E., Liprandi, F., Ruiz, M. C. and Michelangeli, F. (1998).
Oncosis in MA104 cells is induced by rotavirus infection through an increase in intracellular
Ca2+ concentration. Virology 252, 17-27.
Rabinovich, E., Kerem, A., Fröhlich, K., Diamant, N. and Bar-Nun, S. (2002). AAA-
ATPase p97/Cdc48p, a Cytosolic Chaperone Required for Endoplasmic Reticulum-
Associated Protein Degradation. Mol. Cell. Biol. 22, 626–634.
Rambold, A. S., Kostelecky, B., Elia, N. and Lippincott-Schwartz, J. (2011). Tubular
network formation protects mitochondria from autophagosomal degradation during nutrient
starvation. Proc. Natl. Acad. Sci. USA 108, 10190-10195.
Rane, N. S., Chakrabarti, O., Feigenbaum, L. and Hegde, R. S. (2008). Signal sequence
insufficiency contributes to neurodegeneration caused by transmembrane prion protein. J.
Cell Biol. 188, 4515–4526.
Rosado, C. J., Mijaljica, D., Hatzinisiriou, I., Prescott, M. and Devenish, R. J. (2008).
Rosella: a fluorescent pH-biosensor for reporting vacuolar turnover of cytosol and organelles
in yeast. Autophagy 4, 205-213.
Roy, K., Raychaudhuri, M., Chakrabarti, O. and Mukhopadhyay, D. (2013). Growth
factor receptor-bound protein 2 promotes autophagic removal of amyloid-β protein precursor
intracellular domain overload in neuronal cells. J. Alzheimers Dis. 38, 881-895.
Rugarli, E. I. and Langer, T. (2012). Mitochondrial quality control: a matter of life and
death for neurons. EMBO J. 31, 1336-1349.
Shmueli, A., Tsai, Y. C., Yang, M., Braun. M. A. and Weissman, A. M. (2009). Targeting
of GP78 for ubiquitin-mediated proteasomal degradation by HRD1: cross-talk between E3s
in the endoplasmic reticulum. Biochem. Biophys. Res. Commun. 390, 758–762.
Song, M. S., Song, S. J., Kim, S. Y., Oh, H. J. and Lim, D. S. (2008). The tumour
suppressor RASSF1A promotes MDM2 self-ubiquitination by disrupting the MDM2-DAXX-
HAUSP complex. EMBO J. 27, 1863-1874.
Srivastava, D. and Chakrabarti, O. (2014). Mahogunin-mediated α-tubulin ubiquitination
via noncanonical K6 linkage regulates microtubule stability and mitotic spindle orientation.
Cell Death Dis. 5, e1064.
Sun, K., Johnson, B. S. and Gunn, T. M. (2007). Mitochondrial dysfunction precedes
neurodegeneration in mahogunin (Mgrn1) mutant mice. Neurobiol. Aging 28, 1840-1852.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Tan, J. M., Wong, E. S., Kirkpatrick, D. S., Pletnikova, O., Ko, H. S, Tay, S. P., Ho, M.
W., Troncoso, J., Gygi, S. P., Lee, M. K. et al. (2008). Lysine 63-linked ubiquitination
promotes the formation and autophagic clearance of protein inclusions associated with
neurodegenerative diseases. Hum. Mol. Genet. 17, 431–439.
Tanaka, A., Cleland, M. M., Xu, S., Narendra, D. P., Suen, D. F., Karbowski, M. and
Youle, R. J. (2010). Proteasome and p97 mediate mitophagy and degradation of mitofusins
induced by Parkin. J. Cell Biol. 191, 1367-1380.
Tatsuta, T. and Langer, T. (2008). Quality control of mitochondria: protection against
neurodegeneration and ageing. EMBO J. 27, 306-314.
Tondera, D., Grandemange, S., Jourdain, A., Karbowski, M., Mattenberger, Y.,
Herzig, S., Da Cruz, S., Clerc, P., Raschke, I., Merkwirth, C. et al. (2009). SLP-2 is
required for stress-induced mitochondrial hyperfusion. EMBO J. 28, 1589–1600.
Twig, G., Elorza, A., Molina, A. J. A., Mohamed, H., Wikstrom, J. D., Walzer, G., Stiles,
L., Haigh, S. E., Katz, S., Las, G. et al. (2008). Fission and selective fusion govern
mitochondrial segregation and elimination by autophagy. EMBO J. 27, 433-446.
Vito, P., Lacana, E. and D'Adamio, L. D. (1996). Interfering with apoptosis: Ca2+-binding
protein ALG-2 and Alzheimer's disease gene ALG-3. Science 271, 521–525.
Wang, H., Guay, G., Pogan, L., Sauvé, R., and Nabi, I.R. (2000). Calcium Regulates the
Association between Mitochondria and a Smooth Subdomain of the Endoplasmic Reticulum.
J. Cell Biol. 150, 1489-1497.
Wang, P.T.C., Garcin P. O., Fu, M., Masoudi, M., St-Pierre P., Pante, N., and Nabi, I.R. (2015). Distinct mechanisms controlling rough and smooth endoplasmic reticulum contacts
with mitochondria. J. Cell Sci. 128, 2759-2765.
Wang, Y., Ha, S. W., Zhang, T., Kho, D. H., Raz, A. and Xie, Y. (2014).
Polyubiquitylation of AMF requires cooperation between the gp78 and TRIM25 ubiquitin
ligases. Oncotarget 5, 2044-2051.
Wang, Y., Nartiss, Y., Steipe, B., McQuibban, G. A. and Kim, P. K. (2012). ROS-induced
mitochondrial depolarization initiates PARK2/PARKIN-dependent mitochondrial
degradation by autophagy. Autophagy 8, 1462-1476.
Weissman, A. M., Shabek, N. and Ciechanover, A. (2011). The predator becomes the prey:
regulating the ubiquitin system by ubiquitylation and degradation. Nat. Rev. Mol. Cell
Biol.12, 605–620.
Yang, B., Gay, D. L., MacLeod, M. K., Cao, X., Hala, T., Sweezer, E. M., Kappler, J.,
Marrack, P. and Oliver, P. M. (2008). NEDD4 augments the adaptive immune response by
promoting ubiquitin-mediated degradation of CBL-b in activated T cells. Nat. Immunol. 9,
1356–1363.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Ye, Y., Meyer, H. H. and Rapoport, T. A. (2001). The AAA ATPase Cdc48/p97 and its
partners transport proteins from the ER into the cytosol. Nature 414, 652-656.
Youle, R. J. and Narendra, D. (2011). Mechanisms of mitophagy. Nat. Rev. Mol. Cell Biol.
12, 9-14.
Youle, R. J. and van der Bliek, A. M. (2012). Mitochondrial fission, fusion, and stress.
Science 337, 1062-1065.
Yun, J., Puri, R., Yang, H., Lizzio, M. A., Wu, C., Sheng, Z. H. and Guo, M. (2014).
MUL1 acts in parallel to the PINK1/parkin pathway in regulating mitofusin and compensates
for loss of PINK1/parkin. Elife 3, e01958.
Zhao, Q., Wang, J., Levichkin, I. V., Stasinopoulos, S., Ryan, M. T. and Hoogenraad, N.
J. (2002). A mitochondrial specific stress response in mammalian cells. EMBO J. 21, 4411–
4419.
Ziviani, E., Tao, R. N. and Whitworth, A. J. (2010). Drosophila Parkin requires PINK1 for
mitochondrial translocation and ubiquitinates Mitofusin. Proc Natl Acad Sci USA 107, 5018–
5023.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Figures
Figure 1: Depletion of MGRN1 causes perinuclear clustering of mitochondria.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
(A) HeLa cells were treated with MGRN1 or mock siRNAs or transfected with
MGRN1/MGRN1ΔR and imaged. Mitochondria were marked by mitoGFP. Note perinuclear
clustering of mitochondria in cells with the depletion of MGRN1. Images are 3D-projections
obtained from z-stacks using ImageJ, MGRN1 expression was verified by immunoblotting.
The input levels of β-tubulin in the total lysates serve as loading controls. Scale bar 5 μm.
Transfected cell border is marked by dotted line.
(B) Mitochondrial distribution was calculated with ImageJ for cells imaged in (A) using their
z-projections. Graph shows results from ~150 cells analysed from 5 independent
experiments. ns, Not significant (p=0.2); *** p≤0.001, using Unpaired 2-tailed Student’s t-
test. Error bars, +SEM.
(C) HeLa cells treated with MGRN1 or mock siRNAs were transfected with
MGRN1/MGRN1ΔR and mitoGFP after 48h of siRNA treatment. z-stacks are taken 24h
later. Ectopic expression of MGRN1 but not MGRN1ΔR could rescue mitochondrial
clustering in MGRN1 depleted cells. MGRN1 expression was verified by immunoblotting.
The input levels of β-tubulin in the total lysates serve as loading controls. Scale bar 5 μm.
Transfected cell border is marked by dotted line.
(D) Mitochondrial distribution was calculated with ImageJ for cells imaged in (C) using their
z-projections. Graph shows results from ~175 cells analysed from 5 independent
experiments. *** p≤0.001, ** p≤0.01, using Unpaired 2-tailed Student’s t-test. Error bars,
+SEM.
(E) SHSY5Y cells were cotransfected with GFP tagged MGRN1/MGRN1ΔR and mitoRFP
and imaged. Depletion of MGRN1 causes perinuclear clustering of mitochondria. Scale bar 5
μm.
(F) Mitochondrial distribution was calculated with ImageJ for cells imaged in (E) using their
z-projections. Graph shows results from ~120 cells analysed from 5 independent
experiments. ** p≤0.01, using Unpaired 2-tailed Student’s t-test. Error bars, +SEM.
(G) Mitochondrial distribution in MEFs cotransfected with MGRN1/MGRN1ΔR and
mitoRFP. MGRN1 expression was verified by immunoblotting. The input levels of β-tubulin
in the total lysates serve as loading controls. Scale bar 5 μm. Transfected cell border is
marked by dotted line.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Figure 2: MGRN1 interacts with and ubiquitinates GP78 for proteasomal degradation.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
(A) HeLa cells transfected with MGRN1 or the indicated RING mutants, or treated with
mock or MGRN1 siRNAs were lysed and immunoblotted to check for the levels of GP78.
Melanocytes, melan a-6 and melan md1-nc cell lysates were also analysed for GP78.
Decreased GP78 protein levels in the presence of functional MGRN1. Control RFP vector
(EmpVec) and MGRN1R transfected cells have comparable amounts of GP78. The input
levels of β-tubulin and MGRN1/RFP in the total lysates serve as loading control.
(B) Histogram plotting fold change in GP78 levels, analysing data from (A). Graph shows
results from 5 independent experiments. ** p≤0.01, using unpaired 2-tailed Student’s t-test.
Error bars, SEM.
(C) Cells treated with MGRN1 or mock siRNA were transfected with
MGRN1/MGRN1ΔR/control vector (EmpVec) 48h after siRNA treatment. Cells were lysed
24h later and immunoblotted using GP78 antibody. MGRN1 expression was verified by
immunoblotting.
(D) Mouse brain lysates were immunoprecipitated with -MGRN1 antibody. Western blot
analysis of this with -GP78 antibody shows co-immunoprecipitation of endogenous GP78
with MGRN1. Ab, antibody. Proportion of lysate loaded as input and used for
immunoprecipitation are denoted in brackets by ‘X’
(E) Reverse co-immunoprecipitation confirms the same.
(F) HeLa cells cotransfected with FLAG-tagged GP78 and MGRN1-GFP were lysed,
immunoprecipitated with -MGRN1 antibody. Western blot analysis with -GP78 antibody
shows co-immunoprecipitation of GP78 with MGRN1 when both proteins are over-
expressed. Proportion of lysate loaded as input and used for immunoprecipitation are denoted
in brackets by ‘X’.
(G) Reverse co-immunoprecipitation with HeLa cell lysates cotransfected with FLAG-tagged
GP78 and MGRN1-GFP.
(H) Line diagram of MGRN1 and its mutants. HeLa cells transiently co-transfected with
FLAG-GP78 and the indicated GFP-tagged MGRN1 constructs were lysed and
immunoprecipitated with -GFP antibody. Western blots analysis with -GP78 antibody
shows co-immunoprecipitation of GP78 with MGRN1, MGRN1R and MGRN1C; but not
with MGRN1N.
(I) HeLa cells transiently co-transfected with control RFP vector (EmpVec) or MGRN1-RFP
and HA-Ub constructs along with FLAG-GP78 were lysed and immunoprecipitated with -
FLAG antibody (left panels). Cells transiently co-transfected with control HA vector
(EmpVec) or HA-Ub and MGRN1 constructs along with FLAG-GP78 were also similarly
analysed (right panels). In vivo ubiquitination of GP78 was detected by immunoblotting HA-
Ub with anti-HA antibody. Polyubiquitination is detected only when MGRN1 and Ub are
both present. The input levels of β-tubulin, GP78 and MGRN1/RFP in the total lysates serve
as loading controls.
(J) HeLa cells transiently co-transfected with HA-Ub, HA-K11Ub or HA-K11RUb constructs
along with FLAG-GP78 and MGRN1-GFP/MGRN1R-GFP were lysed and
immunoprecipitated with -FLAG antibody. Cell treated with mock or MGRN1 siRNAs
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
were also similarly analysed. In vivo ubiquitination was detected by immunoblotting HA-Ub
with anti-HA antibody. Polyubiquitination is detected in the presence of MGRN1 along with
either Ub or K11Ub. The input levels of β-tubulin, MGRN1 and GP78 in the total lysates
serve as loading controls.
(K) HeLa cells transiently co-transfected with HA-Ub, MGRN1-GFP and FLAG-
GP78/FLAG-GP78RINGmut were lysed and immunoprecipitated with -GFP antibody. In
vivo ubiquitination of MGRN1-GFP was detected by immunoblotting HA-Ub with anti-HA
antibody. No significant difference in polyubiquitination is detected between FLAG-GP78
and FLAG-GP78RINGmut expressing cells. The input levels of MGRN1 and GP78 in the
total lysates serve as loading controls.
(L) Lysates from cells transiently transfected with MGRN1-GFP or indicated RING mutants
were treated with proteasome inhibitor (20µM MG132 for 4h) or left untreated; followed by
Western blot analysis. Elevated levels of GP78 detected with MG132 treatment when
MGRN1 is catalytically active. The input levels of β-tubulin and MGRN1 in the total lysates
serve as loading control.
(M) Graph shows fold change in GP78 levels, analysing data from (L). Graph drawn from
results of 5 independent experiments. * p≤0.05, using unpaired 2-tailed Student’s t-test.
Error bars, SEM.
(N) Lysates from cells transiently transfected with control RFP vector (EmpVec), MGRN1-
RFP or MGRN1ΔR–RFP were either left untreated or and treated with cycloheximide (Chx,
100µg/ml) for indicated periods of time. Western blot analyses show GP78 levels across
samples. Note decrease in protein levels over time in cells with EmpVec or MGRN1-RFP
with Chx treatment; presence of MGRN1-RFP expedites the process. However this rate is
substantially slower in MGRN1ΔR–RFP cells.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Figure 3: Depletion of MGRN1 causes decrease in Mfn1 levels but mitochondrial mass
is unaltered.
(A) Lysates from HeLa cells transiently transfected with the indicated contructs and
immunoblotted show decreased Mfn1 protein levels with MGRN1 functional depletion. Mfn2
levels remain unchanged. Levels of β-tubulin used as the loading control, expression of
MGRN1 and its mutants verified across different lysates.
(B) Immunoblots from panel A analysed for fold change in Mfn1 and Mfn2 protein levels
from 5 independent experiments. ** p≤0.01, * p≤0.05 using Student’s t-test (unpaired 2-
tailed). ns, Not significant (p>0.1). Error bars, SEM.
(C) Similar lysates generated as in panel A show that MGRN1 catalytic inactivation does not
alter fission mediators Fis1 and Drp1 protein levels. Opa1 decreases with MGRN1 depletion.
(D) HeLa cells treated with MGRN1 or mock siRNA were transfected with
MGRN1/MGRN1ΔR/control vector (EmpVec) 48h after siRNA treatment. Cells were lysed
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
24h later and immunoblotted using -Mfn1 antibody. Ectopic expression of MGRN1 rescues
the decrease in Mfn1 level. endogenous MGRN1 levels.
(E) Mfn2 protein remains unaltered in a-6 and md1-nc melanocyte cells lysates, while Mfn1
decrease in Mgrn1 null melanocytes. Immunoblots from the top panel were analysed for fold
change in Mfn1 and Mfn2 protein levels from 3 independent experiments. ** p≤0.01, using
Student’s t-test (unpaired 2-tailed). ns, Not significant (p=0.12). Error bars, SEM.
(F) Mitochondria enriched fractions from HeLa cells transfected with MGRN1 or
MGRN1ΔR were immunoblotted using -Mfn1 and -Timm23 antibodies. Equal levels of
Timm23 but lower levels of Mfn1 was detected in MGRN1∆R transfected cells. Expression
of MGRN1 was verified in whole cell lysates prior to fractionation.
(G) Total DNA was isolated from MGRN1 or MGRN1∆R transfected cells. Quantitative RT-
PCR was performed using Syber Green and primers against mitochondrially encoded genes
ATP synthase F0 and cytochrome c oxidase subunit II (COX-II) and the nuclear gene
GAPDH. Samples were present in triplicates. ∆Ct values for each mitochondrial DNA
encoded gene was calculated as Ctmitochondrial gene - CtGAPDH. ∆Ct values do not differ
significantly between MGRN1 and MGRN1∆R expressing cells. Error bars indicate standard
deviation. ns, Not significant (p=0.9).
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Figure 4: MGRN1 mediated ubiquitination of GP78 is altered by mitochondrial stress.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
(A) HeLa cells transfected with MGRN1/MGRN1R were treated with CCCP (20µM for 4h)
and immunoblotted with -GP78 antibody. Expression of MGRN1 was verified in cell
lysates and β-tubulin was used as the loading control.
(B) HeLa cells transiently co-transfected with HA-Ub, FLAG-GP78 and MGRN1-GFP either
left untreated or treated with the indicated drugs. Lysates were immunoprecipitated with -
FLAG antibody and immunoblotted with -HA antibody to detect HA-Ub modified GP78.
Blot shows selective decrease in protein polyubiquitination with drugs causing mitochondrial
stress (left panels). Cells transfected with control vector were treated similarly (right panel).
The input levels of MGRN1, β-tubulin and GP78 in the total lysates serve as loading control.
(C) HeLa cells cotransfected with MGRN1, FLAG-GP78 and HA-Ub were treated with
indicated concentrations of CCCP for 4h. Lysates were immunoprecipitated with -FLAG
antibody and immunoblotted with -HA antibody to detect GP78 ubiquitinated with HA-Ub
Ubiquitination of GP78 decreases in a CCCP concentration dependent manner. The input
levels of FLAG-GP78 and MGRN1 in the total lysates serve as loading control.
(D) Line diagram of MGRN1 and its mutants. HeLa cells transiently expressing the indicated
MGRN1 N-terminus deletion constructs along with HA-Ub, FLAG-GP78 were either treated
with CCCP or left untreated; FLAG-GP78 was immunoprecipitated with -FLAG antibody.
In vivo ubiquitination of FLAG-GP78 was detected by immunoblotting with -HA antibody
to detect HA-Ub modified GP78. Note that CCCP partially abrogates GP78
polyubiquitination in the presence of MGRN1∆N50; but similar effect is not detected with
MGRN1∆N100 which shows ubiquitination irrespective of the presence of CCCP.
(E) HeLa cells transiently expressing either MGRN1 or indicated MGRN1 N-terminus
deletion constructs along with HA-Ub, FLAG-GP78 were treated with CCCP (20µM, 4h) and
BAPTA (75µM, 4h) in indicated combinations or left untreated; FLAG-GP78 was
immunoprecipitated with -FLAG antibody. In vivo ubiquitination was detected by
immunoblotting with -HA antibody to detect HA-Ub. Note that BAPTA can partially rescue
GP78 polyubiquitination in CCCP treated cells in the presence of MGRN1 and
MGRN1∆N50; but similar effect is not detected with MGRN1∆N100 which shows
ubiquitination irrespective of the presence of CCCP and BAPTA.
(F) HeLa cells were treated with CCCP and BAPTA in indicated combinations or left
untreated (left graph). Fura-2AM was loaded and cytosolic free Ca2+ concentration was
measured from ratio of fluorescent intensitites obtained when samples were excited at 340nm
and 380nm sequentially. Rmax and Rmin were calculated by digitonin permeabilization of
Fura-2AM loaded cells and by subsequent treatment with EGTA respectively. An apparent
Kd for Fura-2-Ca was taken as 224 nM. An aliquot of cells transfected with indicated
MGRN1 constructs for experiment in panel E (without drug treatment) were also similarly
assayed for the free Ca2+ concentrations (right graph). Data represents 3 independent
experiments with triplicates measured for each experiment.
(G) HeLa cells cotransfected with FLAG-GP78 and MGRN1-RFP were lysed and
immunoprecipitated in buffers containing either 5mM CaCl2, no CaCl2 (control) or 5mM
MgCl2 together with 1 mM EGTA. MGRN1 is immunoprecipitated with α-RFP antibody.
Western blots analysis with -FLAG antibody shows co-immunoprecipitation of GP78 with
MGRN1, in presence of low calcium or no calcium but the interaction is weaker in buffer
supplemented with CaCl2.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
(H) HeLa cells cotransfected with MGRN1∆N50-GFP/MGRN1∆N100-GFP and FLAG-
GP78 were lysed and immunoprecipitated in buffers containing either 5mM CaCl2, no
CaCl2(control) or 5mM MgCl2 together with 1 mM EGTA in similar assay as panel G.
MGRN1 is immunoprecipitated with α-GFP antibody. Western blots analysis with -FLAG
antibody shows MGRN1∆N50-GFP behaves similar to MGRN1, but presence of
MGRN1∆N100 compromises the interaction between the two proteins. Note lack of Ca2+-
dependence in with MGRN1Δ100.
(I) HeLa cells cotransfected with MGRN1/MGRN1R, RFP-LC3 and mitoGFP were treated
with 1μM CCCP and 100nM Bafilomycin A1 for 16h and imaged to observe mitophagy
events. Enlarged views of the areas within the white boxes are also shown (insets). Number
of LC3 positive mitochondria per cell is higher in MGRN1R expressing cells. Data
represents 5 independent experiments with n=50 cells measured per experiment. ***
p≤0.001, using Unpaired 2-tailed Student’s t-test. Error bars, SEM.
(J) Cells expressing MGRN1 or MGRN1R were treated with 20µM CCCP for 4h.
Mitochondria enriched fractions were immunoblotted using antibodies for LC3 and
p62.Timm23 levels serve as loading control.
(K) HeLa cells transfected with MGRN1 or MGRN1ΔR were loaded with TMRE and treated
with CCCP. Time lapse images captured were analysed for the ratio of TMRE intensity at
time‘t’ (Ft) to initial TMRE intensity (F0) and plotted against time. Data represents 3
independent experiments with n=20 cells measured per experiment. Error bars, SEM.
(L) HeLa cells transfected with different amounts of MGRN1 construct show decrease in
GP78 protein levels with increase in MGRN1 protein expression. Mitochondria-enriched
fractions from these cells show corresponding LC3 levels. Levels of β-tubulin and Timm23
serve as loading control.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Figure 5: GP78 is downstream of MGRN1 during mitochondrial clustering and
activation of mitophagy
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
(A) HeLa cells cotransfected with FLAG-tagged GP78/GP78 RINGmut,
MGRN1/MGRN1R and mitoRFP were imaged under live cell conditions. Altered
mitochondrial distribution detected upon overexpression of functional GP78, irrespective of
the presence of MGRN1 or MGRN1ΔR. Scale bar 5 μm. Transfected cell border is marked
by dotted line.
(B) Histogram shows mitochondrial distribution for cells imaged in panel A. Results from 5
independent experiments. Error bars, SEM. ns, Not significant (p=0.4).
(C) HeLa cells similarly transfected as in (A) were lysed and immunoblotted using Mfn1
antibody. Overexpression of functional GP78 decreases Mfn1 levels irrespective of MGRN1.
Levels of β-tubulin, GP78, MGRN1-GFP serve as loading control.
(D) Cells treated with GP78 or mock siRNAs, were cotransfected with MGRN1 or
MGRN1ΔR and mitoRFP were imaged for mitochondrial distribution. Note well spread out
mitochondria even with the expression of MGRN1ΔR, when GP78 is depleted. Scale bar 5
μm. Transfected cell border is marked by dotted line.
(E) Graph quantifying mitochondrial distribution for cells imaged in panel D. Results from 5
independent experiments. ns, Not significant (p=0.08); *** p≤0.001, using Unpaired 2-tailed
Student’s t-test. Error bars, +SEM.
(F) HeLa cells treated with GP78 or mock siRNA were cotransfected with
MGRN1/MGRN1R, RFP-LC3 and mitoGFP and treated with 1μM CCCP and 100nM
Bafilomycin A1 for 16h and imaged to observe mitophagy events. Enlarged views of the
areas within the white boxes are also shown (insets). In GP78 knockdown cells the difference
in mitophagy levels between MGRN1 and MGRN1R becomes non-significant. Data
represents 5 independent experiments with n=50 cells measured per experiment. ns, Not
significant (p=0.1); *** p≤0.001, using Unpaired 2-tailed Student’s t-test. Error bars, SEM.
Scale bar 10 μm.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Figure 6: Functional depletion of MGRN1 by ectopic expression of PrP mutants
perturbs ubiquitination of GP78 and mitophagy.
(A) Transgenic mice whole brain lysates were immunoblotted and analysed for the indicated
proteins. The levels of β–tubulin serve as loading control. Note similar levels of expression of
PrP and MGRN1 across samples.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
(B) Samples prepared from HeLa cells transiently transfected with wildtype PrP and CtmPrP
generating mutants were lysed and immunoblotted to check for the levels of Mfn1, Mfn2 and
GP78. The levels of β–tubulin serve as loading control.
(C) Lysates of cells expressing with HA-Ub and FLAG-GP78 along with PrP constructs were
immunoprecipitated with -FLAG antibody and immunoblotted with -HA antibody to
detect GP78 ubiquitinated with HA-Ub. Blot shows selective decrease in protein
polyubiquitination in the presence of CtmPrP generating mutants. The input levels of PrP, β-
tubulin and GP78 in the total lysates serve as loading control.
(D) Cells cotransfected with wildtype PrP or indicated PrP mutants and mitoRFP were
imaged under live cell conditions. Perinuclear mitochondrial clustering detected upon
expression of CtmPrP generating mutants. Scale bar 5 μm.
(E) HeLa cells transiently co-transfected with HA-Ub, FLAG-GP78 and PrP(A117V)/PrP
either left untreated (U) or treated with CCCP. Lysates were immunoprecipitated with -
FLAG antibody and immunoblotted with -HA antibody to detect HA-Ub in vivo
ubiquitination. Blot shows selective decrease in protein polyubiquitination with CCCP when
PrP is present. The input levels of PrP, β-tubulin and GP78 in the total lysates serve as
loading control.
(F) Cells transfected with indicated PrP constructs were treated with 100nM Bafilomycin A1
for 16h. Mitochondria enriched fractions were immunoblotted using antibodies for LC3 and
p62.Timm23 levels serve as loading control.
(G) HeLa cells cotransfected with wild type PrP / PrP(KHII), RFP-LC3 and mitoGFP were
treated with 1μM CCCP and 100nM Bafilomycin A1 for 16h and imaged to observe
mitophagy events. Enlarged views of the areas within the white boxes are also shown (insets).
Number of LC3 positive mitochondria per cell is higher in PrP(KHII) expressing cells. Data
represents 5 independent experiments with n=50 cells measured per experiment.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Figure 7: Schematic diagram summarizing the results.
MGRN1 mediated polyubiquitination of GP78 occurs in healthy cells where cytosolic
calcium levels are low. This regulates GP78 protein levels. When cytosolic calcium rises (or
when MGRN1 is nonfunctional) the interaction between MGRN1 and GP78 weakens leading
to elevated GP78 levels and hence increase in GP78 mediated mitophagy.