FEBS Letters 584 (2010) 1565–1570

journal homepage: www.FEBSLetters .org

Triad 1 induces apoptosis by p53 activation

Jin Hyuk Jung a,1, Sun-Mi Lee a,1, Seunghee Bae a, Su-Jae Lee b, In-Chul Park c, Young-Woo Jin d, Jae Ho Lee a,*,Sungkwan An a,e,**

a Functional Genome Research Institute, Konkuk University, 1 Hwayang-dong, Gwangjin-gu, Seoul 143-701, Republic of Koreab Department of Chemistry, Hanyang University, 17 Haengdang-dong, Seongdong-gu, Seoul 133-791, Republic of Koreac Laboratory of Functional Genomics, Korea Institute of Radiological and Medical Sciences, 215-4 Gongneung-dong, Nowon-gu, Seoul 139-706, Republic of Koread Division of Radiation Effect Research, Radiation Health Research Institute of KHNP, 388-1 Ssangmoon-dong, Dongbong-gu, Seoul 132-703, Republic of Koreae LIFEnGENE, Inc., Venture Business Supporting Center, Konkuk University, 1 Hwayang-dong, Gwangjin-gu, Seoul 143-701, Republic of Korea

a r t i c l e i n f o a b s t r a c t

Article history:Received 13 December 2009Revised 2 March 2010Accepted 7 March 2010Available online 10 March 2010

Edited by Varda Rotter

Keywords:Triad 1Gfi-1Apoptosisp53RING finger

0014-5793/$36.00 � 2010 Federation of European Biodoi:10.1016/j.febslet.2010.03.011

Abbreviations: RING, really interesting new genlinked

* Corresponding author. Fax: +82 2 3437 4055.** Corresponding author. Address: Functional Gen

kuk University, 1 Hwayang-dong, Gwangjin-gu, SeouFax: +82 2 3437 4055.

E-mail addresses: jaeho390@konkuk.ac.kr (J.H. LeAn).

1 These authors contributed equally to this work.

Triad 1 (2 RING [really interesting new gene] fingers and DRIL [double RING finger linked] 1) is an E3ligase that induces apoptosis and clonogenic inhibition in myeloid cells through Gfi-1 stabilization.Here we demonstrate that Triad 1 induces apoptosis in several cancer cell lines including MCF7,A549, U2OS, and HCT 116 p53+/+ cells via its RING ligase activity. Interestingly, in these cancer cells,Triad 1-induced apoptosis is not mediated by Gfi-1 stabilization but is instead p53-dependent. More-over, Triad 1 promotes transactivation of p53. These results suggest that Triad 1 can induce apopto-sis through its ligase activity via p53 activation.� 2010 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

1. Introduction

Although p53 is a protein of many roles including differentia-tion, cell cycle arrest, and senescence, it is predominantly knownfor its role in apoptosis [1]. Activation of p53 by various stimuli,such as UV, hypoxia, and nutrient depletion, results in apoptosis.Both transcriptional-dependent and -independent activation ofp53 is sufficient for triggering apoptosis [2,3]. In addition, p53 ismodulated by post-translational modification, including acetyla-tion, phosphorylation, or ubiquitination.

Ubiquitination mediates many biological events, includingapoptosis [4,5]. Triad 1 (2 RING [really interesting new gene] fin-gers and DRIL [double RING finger linked] 1) is an E3 ligase thatis highly expressed during granulocyte and monocyte differentia-tion. With its RING-dependent E3 ligase activity, this protein in-

chemical Societies. Published by E

e; DRIL, double RING finger

ome Research Institute, Kon-l 143-701, Republic of Korea.

e), ansfgrc@konkuk.ac.kr (S.

duces apoptosis and clonogenic inhibition in myeloid cells [6].However, the RING domains are not required for all Triad 1 func-tions. In fact, Triad 1 inhibits Gfi-1 ubiquitination and proteasomaldegradation in the absence of its RING ligase activity. Gfi-1 stabil-ization induces apoptosis in immature myeloid and hematopoieticstem cells [7,8]. However, the mechanism of this biological processremains mostly unknown since the substrate for the E3 ligaseactivity of Triad 1 has yet to be identified [6]. Furthermore, Gfi-1serves various roles in different tissues and cell types [9–11].Therefore, we hypothesize that, to induce apoptosis, Triad 1 func-tions via multiple pathways depending on its requirement for RINGligase. Because p53 is central to the regulation of apoptosis, weexamined the dependence of Triad 1-mediated apoptosis on p53using cancer cells including MCF7, A549, U2OS, H1299, HCT 116p53+/+, and HCT 116 p53�/� cells which are widely used in p53 re-lated experiments in vitro.

2. Materials and methods

2.1. Plasmid construction

The GFP-Triad 1 and GFP-Triad 1 H158A plasmids were giftsfrom Dr. van der Reijden (Netherlands). siRNAs against p53 and

lsevier B.V. All rights reserved.

1566 J.H. Jung et al. / FEBS Letters 584 (2010) 1565–1570

Gfi-1 were purchased from Santa Cruz Biotechnology (Santa Cruz,CA, USA). Control siRNA (sequence: AUGAACGUGAAUUGCUCAAG)was purchased from Ambion (Austin, TX, USA). To generate theshTriad 1-expressing plasmids, siRNA oligos were subcloned intothe pSuper-GFP-neo vector. Triad 1A forward: GATCCCCAATTGTGAGGAAGAGGAAGAATTCAAGAGATTCTTCCTCTTCCTCACAATTTTT-TT, reverse: GGGTTAACACTCCTTCTCCTTCTT AAGTTCTCTAAGAAG-GAGAAGGAGTGTTAAAAAAATTCGA; Triad 1B forward: GATCCCCTTGTGAGGAAGAGGAAGAATTCAAGAGATTCTTCCTCTTCCTCACAATTTTT, reverse: GGGAACACTCCTTCTCCTTCTTAAGTTCTCTAAGAAG-GAGAAG GAGTGTTAAAAATTCGA); control forward: GATCCCCG-CAAGCTGACCTGAAGTTCATTTCAAGAGAATGAACTTCAGGGTAGAGAGTTGCTTTTT, reverse: GGGCGTTCGACTGGACTTCAAGTAAA-GTTCTCT TACTTGAAGTCCCATCTCTCAACGAAAAATTCGA. The pPV-PUMA FLAG2-Luc vector was a gift from Dr. Bert Vogelstein (JohnsHopkins University Medical Institutions, USA), and the pcDNAHA-p53 plasmid was kindly provided by Dr. Gerald M. Cohen(Leicester University, UK).

2.2. Cell culture, transient transfection, and immunoblotting

MCF7 cells were maintained in Dulbecco’s Modified Eagle Med-ium. HCT 116 p53+/+ and HCT 116 p53�/� cells were maintained inMcCoy’s Medium. The H1299, A549, and U2OS cell lines weremaintained in RPMI medium supplemented with 10% fetal bovineserum and 1% penicillin/streptomycin.

For transient transfection, plasmids were transfected usingHilymax (Dojindo) according to the manufacturer’s protocol. siRNAtransfections were performed using RNAimax (Invitrogen, Carls-bad, CA, USA) also according to the manufacturer’s instructions.Immunoblot analysis was performed using whole cell extracts thatwere lysed in SDS lysis buffer and then boiled for 10 min in 5�sample buffer. Proteins were separated on 10–15% SDS polyacryl-amide gels and then electrotransferred onto nitrocellulose mem-branes. The membranes were blocked with 5% skim milk for 1 hand incubated with primary antibody for 2 h at room temperatureor overnight at 4 �C. After incubation, the membranes were washedthree times with TBST (TBS containing 0.05% Tween 20) and incu-bated with HRP-conjugated a-mouse, -rabbit, or -goat secondaryantibody for 1 h at room temperature. Bands were detected byenhanced chemiluminescence using Westpico solutions (Pierce,Rockford, IL). Primary antibodies included mouse monoclonalanti-p53 and goat polyclonal anti-Gfi-1 antibodies, which werepurchased from Santa Cruz Biotechnology. Rabbit polyclonalantibody against GFP was purchased from Cell Signaling Technol-ogy (Danvers, MA, USA). Mouse monoclonal antibody againstb-actin was purchased from Sigma–Aldrich (St. Louis, MO, USA).Rabbit polyclonal antibody specific to Triad 1 was generated byLabfrontier (Seoul, Korea) using the peptide sequence N-EN-QMHIAEQRRRTL-C conjugated to Keyhole Limpet Hemocyanine(KLH).

2.3. Colony formation assay

Cells were plated in 60-mm dishes and transfected with 500 ngof plasmid. The cells were incubated for 24 h and then selectedwith G418 (500 lg/ml) for 14 days. Then the cells were fixed andstained with crystal violet.

2.4. Viability assay

For cell viability analysis, cells were trypsinized for the indi-cated times after transfection and then stained with 4% trypan bluesolution (Invitrogen). The cells were counted using a hemacytom-eter. The Cell Titer 96� AQueous Non-Radioactive Cell ProliferationAssay (Promega) was also performed. Cells were incubated with

appropriate solution for 1 h prior to measurement of the O.D. at490 nm for the MTS assay using a Biotek synergy HT microplatereader. For analysis of apoptosis, DNA content was determinedby propidium iodide (50 lg/ml propidium iodine, 0.1 mg/ml RNaseA, 0.05% Triton X 100) staining followed by flow cytometry. TheApo-ONE� Homogeneous Caspase-3/7 Assay Kit (Promega, Madi-son, WI, USA) was used according to the manufacturer’s protocolto measure caspase 3 and 7 activities.

2.5. Luciferase assay

Aliquots of 5 � 104 cells were plated into 24-well plates. Thefollowing was added to each well: 100 ng of pPV vector encodingthe p53 binding site from the puma promoter, 100 ng of p53-expressing plasmid, and 200 ng of plasmid expressing the wild-type or mutant RING domain of Triad 1. At 48 h after transfection,the cells were harvested and lysed by adding passive lysis buffer.The luciferase activities driven by p53 binding element wereanalyzed using Luciferase Assay System (Takara-Clontech). Therelative luciferase activities were normalized by measuring b-galactosidase activities using Luminescent b-galactosidase detec-tion kit II (Takara-Clontech).

2.6. Statistical analysis

Statistical analysis was performed using the two-tailed Stu-dent’s t test. Statistical significance was determined as P < 0.05.

3. Results

3.1. Triad 1 induces apoptosis and clonogenic inhibition in MCF7 cells

Previous studies have demonstrated that Triad 1 induces apop-tosis in myeloid cells [6]. As such, we examined whether Triad 1also triggers apoptosis in other cell types. Ectopic expression ofTriad 1 in MCF7 cells resulted in cell growth inhibition (Fig. 1A).However, the Triad 1 H158A mutant, which lacks RING ligase activ-ity [6], did not affect cellular growth, suggesting that this domainof Triad 1 is involved in inhibiting MCF7 growth. Immunoblot anal-ysis demonstrated that GFP-Triad 1 and GFP-Triad 1 H158Aexpression was comparable in MCF7 cells (Fig. 1F). Inhibition ofMCF7 cell growth continued for 10 days after transfection (Fig. 1B).

Next, we determined whether Triad 1 inhibited the clonogenicgrowth of MCF7 cells. Colony formation assays revealed thatapproximately 70% of clonogenic growth was inhibited 48 h afterTriad 1 overexpression (Fig. 1C). Furthermore, we used flow cytom-etry to examine whether Triad 1 induces apoptosis in MCF7 cells.Propidium iodide staining was used to assess DNA content 48 hafter transfection with plasmids expressing Triad 1 and the Triad1 H158A mutant. The percentage of sub-G1 phase cells present fol-lowing transfection with Triad 1 increased 2.5–3-fold over controlcells and Triad 1 mutant-transfected cells (Fig. 1D). Moreover, theactivities of caspases 3 and 7 increased with Triad 1 transfection,indicating that Triad 1-induced apoptosis in MCF7 cells (Fig. 1E).These results suggest that Triad 1 inhibited cellular and clonogenicgrowth in MCF7 cells by inducing apoptosis via its RING ligaseactivity. Interestingly, the level of Gfi-1 was increased by bothTriad 1 and the Triad 1 H158A mutant (Fig. 1F). Moreover, Gfi-1was reduced by Triad 1 knockdown in MCF7 cells (data not shown).

3.2. Triad induces apoptosis in MCF7 cells through a Gfi-1-independentmechanism

Next, we examined whether Gfi-1 was also essential for Triad 1-mediated apoptosis in MCF7 cells. Ablation of Gfi-1 by siRNA in the

Fig. 1. Triad 1 induces apoptosis. (A) The viability of MCF7 cells at 48 h after transfection with plasmids expressing GFP, GFP-Triad 1, and Triad 1 mutant H158A wasmeasured by cell count following trypan blue staining. Error bars indicate the S.E.M. (n = 3). (B) The viability of MCF7 cells after transfection with plasmids expressing GFP,GFP-Triad 1, and Triad 1 mutant H158A (ligase activity defect) was measured by cell count following trypan blue staining at the indicated times. Error bars indicate the S.E.M.(n = 3). (C) Colony formation assay in MCF7 cells transfected with plasmids expressing GFP, GFP-Triad 1, and Triad 1 mutant H158A. Cells were stained with crystal violet aftera 14-day culture in G418-containing media. Colony counts are presented in a graph (right panel). (D) Apoptosis of MCF7 cells transfected with plasmids expressing GFP, GFP-Triad 1, and Triad 1 mutant H158A was measured by flow cytometry. Cells were stained by propidium iodine after transfection. (E) The activities of caspases 3 and 7 weremeasured at 48 h after transfection with plasmids expressing GFP, GFP-Triad 1, and Triad 1 mutant H158A in MCF7 cells. Cell lysates were mixed with caspase substrate Z-DEVD-R110 and the fluorescence was measured (485Ex/527Em) after 12-h incubation at room temperature. (F) The level of exogenous Triad 1 and endogenous Gfi-1 wereassessed by immunoblotting. MCF7 cells were transfected with the indicated expression plasmid. Expression of wild-type and mutant Triad 1, as well as endogenous Gfi-1,were measured at 48 h after transfection by immunoblotting with anti-GFP antibody or anti-Gfi-1 antibody. b-actin expression was assessed as a loading control.

J.H. Jung et al. / FEBS Letters 584 (2010) 1565–1570 1567

presence of Triad 1 overexpression did not rescue Triad 1-mediatedgrowth inhibition (Fig. 2A). In fact, results were similar to those ofcontrol siRNA-transfected cells. Also, caspase 3 and 7 activation byTriad 1 was not inhibited by Gfi-1 ablation (Fig. 2B). Together,these results indicate that Gfi-1 is not involved in Triad 1-mediatedapoptosis in MCF7 cells.

We also tested other p53 positive cancer cell lines, A549 andU2OS. In these experiments, only wild-type Triad 1 promoted cellgrowth inhibition while the level of Gfi-1 was maintained by bothwild-type and mutant (H158A) Triad 1 (data not shown). These re-sults imply that the pathway to induce Triad 1-mediated apoptosismay differ according to the cancer cell line.

Fig. 2. Triad 1 induces apoptosis by a Gfi-1-independent mechanism. (A) Theviability of MCF7 cells was measured by cell count following trypan blue staining at48 h after transfection with control siRNA or Gfi-1-specific siRNA. Error barsindicate the S.E.M. (n = 3). (B) The activities of caspases 3 and 7 were measured at48 h after transfection with control siRNA or Gfi-1-specific siRNA in MCF7 cells. Celllysates were mixed with caspase substrate Z-DEVD-R110 and the fluorescence wasmeasured (485Ex/527Em) after 12-h incubation at room temperature.

1568 J.H. Jung et al. / FEBS Letters 584 (2010) 1565–1570

3.3. p53 activation is involved in apoptosis mediated by Triad 1 and itsRING ligase activity

Next, we tested several cancer cell lines for their sensitivity toTriad 1-mediated apoptosis. Unexpectedly, while A549, MCF7,and U2OS cells exhibited similar reductions in viability followingectopic Triad 1 expression (data not shown), H1299 cells did notexhibit the same phenotype. Comparison of MCF7 and H1299 via-bility showed dramatically different sensitivity to apoptosis(Fig. 3A). H1299 cells do not express p53; therefore, we used arti-ficial knockdown of p53 and Gfi-1 in MCF7 cells to elucidatewhether p53 is involved in Triad 1-mediated apoptosis (Fig. 3B).

The sub-G1 phase in cells containing only a single knockdownof p53 or Gfi-1 in the presence of Triad 1 overexpression was com-pared. As expected, knockdown of p53 alone and in combinationwith Gfi-1 resulted in resistance to Triad 1-mediated apoptosis,whereas single knockdown of Gfi-1 had no effect. These resultsindicate that Triad 1-mediated apoptosis was p53-dependent but

Gfi-1-independent in MCF7 cells. Confirmation of p53 and Gfi-1knockdown was assessed by immunoblotting (Fig. 3C). Moreover,we used HCT 116 p53+/+ and HCT 116 p53�/� cells to confirm theinvolvement of p53 in Triad 1-induced apoptosis. And, only HCT116 p53+/+ cell growth was inhibited by Triad 1 (Fig. 3D).

Next, we tested whether Triad 1 influences p53 activation.Puma is a potential mediator of apoptosis induced by p53 [12].Thus, to assess p53 activity, the level of Puma expression wasdetermined by luciferase assay in HCT 116 p53+/+ and HCT 116p53�/� cells after co-transfection with a pPV vector, which encodedthe p53 binding site of the puma promoter, and GFP, GFP-Triad 1,or GFP-Triad 1 H158A mutant (Fig. 3E). Induction of puma by Triad1 was detected only in HCT 116 p53+/+ cells, demonstrating thatTriad 1-induced Puma expression was p53-dependent.

Finally, we examined whether Triad 1 was involved in pumainduction by p53. We generated two different shTriad 1-expressingconstructs to knockdown Triad 1. Both shTriad 1 constructs re-duced the level of endogenous Triad 1 protein (Fig. 3F). As ex-pected, puma induction by p53 was inhibited by Triad 1 ablation(Fig. 3G). These results indicated that Triad 1 induces p53-medi-ated puma expression, and that Triad 1 is required for p53-medi-ated puma induction. Taken together, our data suggest that Triad1 induces apoptosis via its E3 ligase activity by inducing p53 acti-vation. Fig. 3H depicts a schematic diagram of the proposed Triad1-mediated apoptosis pathway.

4. Discussion

Ubiquitination is involved in various biological processes,including apoptosis, metabolism, and differentiation [5]. A recentstudy suggested that Triad 1 functions to promote apoptosis inmyeloid cells [6] using its E3 ligase activity. However, the directsubstrate of Triad 1 remains unknown despite knowledge of theinvolvement Gfi-1 stabilization in myeloid cell apoptosis. AlthoughTriad 1 can stabilize Gfi-1 in MCF 7 cells (Fig. 1F), Gfi-1 may not beinvolved in apoptosis mediated by Triad 1 and its RING ligase activ-ity. Because Gfi-1 is a double-faced molecule depending on the celltype and tissue [9], Triad 1 may participate in a novel pathway toinduce apoptosis with its E3 ligase activity. In fact, Triad 1 mayhave a different substrate for its apoptotic role. In support of this,Mdm2 has different substrates depending on its function [13].With the exception of HCT 116 p53�/� and H1299 cells, whichare p53-deficient, ectopic expression of Triad 1 in several cancercells resulted in inhibition of cellular or clonogenic growth byapoptosis induction. These data indicate that p53 plays a role inTriad 1-mediated apoptosis. p53 is a central molecule involved inapoptosis [14] that is regulated by various post-translational mod-ifications [15], including ubiquitination. Our data demonstratingthat Triad 1 induces p53-dependent puma expression with itsRING ligase activity also supports this hypothesis.

p53 undergoes various post-translational modifications such asacetylation, phosphorylation, and ubiquitination [15]. These mod-ifications affect the transcriptional activity of p53 [16]. Due to thecytotoxic effect of p53, it normally undergoes rapid degradationthrough a ubiquitin-mediated proteasome mechanism involvingseveral E3 ligases including Mdm2 [17]. Ubiquitination of p53 neg-atively regulates transactivation by inhibiting acetylation of theprotein and its export to the cytoplasm [18–20]. Moreover, onceubiquitinated, cytoplasmic p53 cannot induce transcription-inde-pendent cell death [20] neither localize to the nucleus [21]. There-fore, deubiquitination of p53 by USP7 or USP10 are indispensiblefor p53 transcription and transcription-independent cell death[20,22]. The levels of apoptotic genes, including puma and bax,are also reduced by E4F1-mediated p53 ubiquitination [23]. Thesereports indicate that p53 ubiquitination negatively regulates bothp53 transcription-dependent and -independent cell death. Triad

Fig. 3. Triad 1 induces apoptosis by enhancing p53 transactivation. (A) The viability of MCF7 and H1299 cells after 48 h of transfection with plasmids expressing GFP (blackbar), GFP-Triad 1 (dark gray bar), or GFP-Triad 1 H158A mutant (gray bar) was measured by the MTS assay. Error bars indicate the S.E.M. (n = 6). (B) The viability of MCF7 cellswas measured by flow cytometry analysis at 48 h after transfection with control siRNA or siRNA against p53 or Gfi-1 in the presence of wild-type or mutant Triad 1. Cells werestained with propidium iodine after transfection. (C) The levels of exogenous Triad 1 and endogenous p53 and Gfi-1 were measured by immunoblotting. MCF7 cells weretransfected with the indicated expression plasmid or siRNA. Ectopic expression of wild-type and mutant Triad 1 were assessed 24 h later by immunoblotting with anti-GFPantibody. The endogenous levels of p53 and Gfi-1 were measured by immunoblotting with anti-p53 or anti-Gfi-1 antibody. The level of -actin was examined as a loadingcontrol. (D) The viability of HCT 116 p53+/+ and HCT 116 p53�/� cells after transfection with plasmids expressing GFP or GFP-Triad 1 was measured by the MTS assay. Errorbars indicate the S.E.M. (n = 3). (E) Transcriptional activity of p53 upon ectopic expression of Triad 1 was evaluated by the luciferase assay. HCT 116 p53+/+ and HCT 116 p53�/�

cells were co-transfected with a Puma-luc expression construct and a plasmid encoding GFP, GFP-Triad 1 or GFP-Triad 1 H158A mutant. At 24 h after transfection, theluciferase activity was measured in whole cell lysates. Error bars indicate the S.E.M. (n = 6) of three independent experiments. (F) HCT 116 p53+/+ or MCF7 cells weretransfected with Triad 1 shRNA. After 48 h, the level of Triad 1 protein was assessed by immunoblotting with anti-Triad 1 antibody. b-actin expression was analyzed as aloading control. (G) p53 transcriptional activity following Triad 1 knockdown was evaluated by the luciferase assay. HCT 116 p53+/+ or MCF7 cells were co-transfected withthe Puma-luc expression construct and control or Triad 1A, HA-p53-encoding plasmid. At 24 h after transfection, luciferase activity was measured in whole cell lysates. Errorbars indicate the S.E.M. (n = 6) of three independent experiments. (H) A schematic diagram of the proposed pathways of Triad 1-mediated apoptosis. Triad 1 induces apoptosisby two different pathways. One is RING ligase-independent and occurs through Gfi-1 stabilization in myeloid cells. The other requires the RING ligase activity of Triad 1 andp53 activation. The latter pathway has been demonstrated in this study in several cancer cells including MCF7, A549, U2OS, and HCT 116 p53+/+ cells.

J.H. Jung et al. / FEBS Letters 584 (2010) 1565–1570 1569

1570 J.H. Jung et al. / FEBS Letters 584 (2010) 1565–1570

1-induced cell death is p53-dependent and occurs through its RINGligase activity. Triad 1 also induces puma expression via p53.Therefore, it is likely that Triad 1 may activate p53 indirectly viaits E3 ligase. Such a models, in which Mdm2 autoubiquitinationby USP7 also induces apoptosis via p53 activation [24]. Also inhibi-tion of various molecules that negatively regulate p53 function,including SIRT1, results in apoptosis by p53 activation [25], there-by providing additional support that ubiquitination can lead indi-rectly to p53 activation.

The level of Triad 1 mRNA is strongly induced by all-trans reti-noic acid (ATRA) in NB4 cells [6]. Interestingly, the p53 apoptoticpathway is induced by ATRA in acute myeloblastic leukemia cells[26]. Moreover, studies have shown that the levels of p53 and pro-caspase sensitization are induced by ATRA in keratinocytes [27].These reports support our data showing that Triad 1, which is alsoinduced by ATRA, upregulates Puma in a p53-dependent manner.Moreover, ablation of Triad 1 attenuates p53-mediated pumainduction, suggesting that Triad 1 may be required for p53transactivation.

Here we demonstrate that Triad 1 induces apoptosis via itsRING ligase activity by enhancing p53 transactivation. Triad 1 iscapable of inducing apoptosis in various cell types, and whetherits RING ligase activity is involved differs depending on the path-way (Fig. 3H). Further studies of p53 regulation by Triad 1 are stillrequired to fully elucidate the mechanisms of these pathways.

Acknowledgments

We thank Dr. van der Reijden (Radboud University NijmegenMedical Centre, Netherlands) for providing us the GFP-Triad 1andGFP-Triad 1 H158A plasmids. We are grateful to all other membersin our research group for their support and advice in regards to thisstudy. This work was supported by the Ministry of Education, Sci-ence, and Technology (Grant # 20090081795, 20090077650, and20090078237) of the Republic of Korea.

References

[1] Vousden, K.H. (2000) P53: death star. Cell 103, 691–694.[2] Farmer, G., Bargonetti, J., Zhu, H., Friedman, P., Prywes, R. and Prives, C. (1992)

Wild-type p53 activates transcription in vitro. Nature 358, 83–86.[3] Caelles, C., Helmberg, A. and Karin, M. (1994) P53-dependent apoptosis in the

absence of transcriptional activation of p53-target genes. Nature 370, 220–223.

[4] Finley, D. and Chau, V. (1991) Ubiquitination. Annu. Rev. Cell Biol. 7, 25–69.[5] Broemer, M. and Meier, P. (2009) Ubiquitin-mediated regulation of apoptosis.

Trends Cell Biol. 19, 130–140.[6] Marteijn, J.A., van Emst, L., Erpelinck-Verschueren, C.A., Nikoloski, G., Menke,

A., de Witte, T., Löwenberg, B., Jansen, J.H. and van der Reijden, B.A. (2005) TheE3 ubiquitin-protein ligase Triad1 inhibits clonogenic growth of primarymyeloid progenitor cells. Blood 106, 4114–4123.

[7] Marteijn, J.A., van der Meer, L.T., van Emst, L., van Reijmersdal, S., Wissink, W.,de Witte, T., Jansen, J.H. and van der Reijden, B.A. (2007) Gfi1 ubiquitinationand proteasomal degradation is inhibited by the ubiquitin ligase Triad1. Blood110, 3128–3135.

[8] Hock, H., Hamblen, M.J., Rooke, H.M., Schindler, J.W., Saleque, S., Fujiwara, Y.and Orkin, S.H. (2004) Gfi-1 restricts proliferation and preserves functionalintegrity of haematopoietic stem cells. Nature 431, 1002–1007.

[9] Kazanjian, A., Gross, E.A. and Grimes, H.L. (2006) The growth factorindependence-1 transcription factor: new functions and new insights. Crit.Rev. Oncol. Hematol. 59, 85–97.

[10] Grimes, H.L., Gilks, C.B., Chan, T.O., Porter, S. and Tsichlis, P.N. (1996) The Gfi-1protooncoprotein represses Bax expression and inhibits T-cell death. Proc.Natl. Acad. Sci. USA 93, 14569–14573.

[11] Basu, S., Liu, Q., Qiu, Y. and Dong, F. (2009) Gfi-1 represses CDKN2B encodingp15INK4B through interaction with Miz-1. Proc. Natl. Acad. Sci. USA 106,1433–1488.

[12] Nakano, K. and Vousden, K.H. (2001) PUMA, a novel proapoptotic gene, isinduced by p53. Mol. Cell 7, 683–694.

[13] Chi, X.Z., Kim, J., Lee, Y.H., Lee, J.W., Lee, K.S., Wee, H., Kim, W.J., Park, W.Y., Oh,B.C., Stein, G.S., Ito, Y., van Wijnen, A.J. and Bae, S.C. (2009) Runt-relatedtranscription factor RUNX3 is a target of MDM2-mediated ubiquitination.Cancer Res. 69, 8111–8119.

[14] Bargonetti, J. and Manfredi, J.J. (2002) Multiple roles of the tumor suppressorp53. Curr. Opin. Oncol. 14, 86–91.

[15] Bode, A.M. and Dong, Z. (2004) Post-translational modification of p53 intumorigenesis. Nat. Rev. Cancer 4, 793–805.

[16] Brooks, C.L. and Gu, W. (2003) Ubiquitination, phosphorylation andacetylation: the molecular basis for p53 regulation. Curr. Opin. Cell Biol. 15,164–171.

[17] Brooks, C.L. and Gu, W. (2006) P53 ubiquitination: Mdm2 and beyond. Mol.Cell 21, 307–315.

[18] Rodriguez, M.S., Desterro, J.M., Lain, S., Lane, D.P. and Hay, R.T. (2000) MultipleC-terminal lysine residues target p53 for ubiquitin-proteasome-mediateddegradation. Mol. Cell Biol. 20, 8458–8467.

[19] Geyer, R.K., Yu, Z.K. and Maki, C.G. (2000) The MDM2 RING-finger domain isrequired to promote p53 nuclear export. Nat. Cell Biol. 2, 569–573.

[20] Marchenko, N.D., Wolff, S., Erster, S., Becker, K. and Moll, U.M. (2007)Monoubiquitylation promotes mitochondrial p53 translocation. EMBO J. 26,923–934.

[21] Marchenko, N.D., Hanel, W., Li, D., Becker, K., Reich, N. and Moll, U.M. (2010)Stress-mediated nuclear stabilization of p53 is regulated by ubiquitinationand importin-alpha3 binding. Cell Death Differ. 17, 255–267.

[22] Yuan, J., Luo, K., Zhang, L., Cheville, J.C. and Lou, Z. (2010) USP10regulates p53 localization and stability by deubiquitinating p53. Cell 140,384–396.

[23] Le Cam, L., Linares, L.K., Paul, C., Julien, E., Lacroix, M., Hatchi, E., Triboulet, R.,Bossis, G., Shmueli, A., Rodriguez, M.S., Coux, O. and Sardet, C. (2006) E4F1 isan atypical ubiquitin ligase that modulates p53 effector functionsindependently of degradation. Cell 127, 775–788.

[24] Li, M., Chen, D., Shiloh, A., Luo, J., Nikolaev, A.Y., Qin, J. and Gu, W. (2002)Deubiquitination of p53 by HAUSP is an important pathway for p53stabilization. Nature 416, 648–653.

[25] Yamakuchi, M., Ferlito, M. and Lowenstein, C.J. (2008) MiR-34a repression ofSIRT1 regulates apoptosis. Proc. Natl. Acad. Sci. USA 105, 13421–13426.

[26] Zheng, A., Mäntymaa, P., Säily, M., Savolainen, E., Vähäkangas, K. andKoistinen, P. (2000) P53 pathway in apoptosis induced by all-trans-retinoicacid in acute myeloblastic leukaemia cells. Acta Haematol. 103, 135–143.

[27] Mrass, P., Rendl, M., Mildner, M., Gruber, F., Lengauer, B., Ballaun, C., Eckhart, L.and Tschachler, E. (2004) Retinoic acid increases the expression of p53 andproapoptotic caspases and sensitizes keratinocytes to apoptosis: a possibleexplanation for tumor preventive action of retinoids. Cancer Res. 64, 6542–6548.