the yeast h'-atpase gene is controlled by the promoter binding

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1989 by The American Society for Biochemistry and Molecular Biology, Inc

Vol. 264, No. 13, Issue of May 5, pp. 1431-1446,1989 Printed in U. S. A.

The Yeast H’-ATPase Gene Is Controlled by the Promoter Binding Factor TUF*

(Received for publication, December 6, 1988)

Etienne CapieauxS, Marie-Luce Vignaisg, Andre SentenacB, and Andre GoffeauS From the $Unite de Biochimie Physiologique, Uniuersite de Louuain, Place Croix d u Sud, I, 1348 Louuain-la-Neuve, Bebium and the SDepartement de Biologie, Service de Biochimie Centre d’Etudes Nucliaires de Saclay, 91 191 Gif-sur- YuetteCedex, France

The H+-ATPase, located in the yeast plasma membrane and encoded by the PMAl gene, provides energy for the active transport of nutrients and regulates intracellular pH. Expression of the PMAl gene is essential for cell growth and development. In this study, progressive deletions of the PMAl promoter fused to the &galactosidase gene have identified two upstream activating sequences. These upstream activating sequences have high homologies with the consensus sequence known to control the expression of the ribosomal protein genes (RPG). I n vivo deletion of these RPG sequences from the PMAl gene results in slower growth and reduces ATPase activity to one-third of its original value. The RPG sequences from PMAl inter- act with the promoter binding factor TUF. Thus, PMAl belongs to the RPG-TUF system which includes many constitutive genes encoding nonrelated functions such as ATP metabolism, transcription, translation, and active transport.

In 1789, Lavoisier discovered that yeast produces acid during the fermentation of sugar (Lavoisier, 1789). We know today that this acid secretion is largely driven by a proton pump (H’-ATPase) located in the plasma membrane of yeasts and fungi (for reviews, see Goffeau and Slayman, 1981; Bow- man and Bowman, 1986; Serrano, 1988). The purified H’- ATPase is composed of a single polypeptide of M, = 100,000 (Dufour and Goffeau, 1978). Recent sequencing of the corresponding genes from Saccharomyces cereuisiae, Neurospora crassa, and Schizosaccharomyces pombe confirms this value (Serrano et al., 1986; Hager et al., 1986; Ghislain et al., 1987). The deduced amino acid sequences of the fungal ATPase are homologous to those of the mammalian Ca2+, Na’/K+ transport ATPases, consistent with the known similarities in the mechanism for ATP hydrolysis (Amory and Goffeau, 1982).

The fungal H+-ATPase plays a crucial role for cell growth; it may consume as much as 40% of the cellular ATP (Grad- mann et al., 1978), it is a limiting factor for yeast growth (Cid et al., 1987), and it increases tumorigenicity when expressed in mammalian cells (Perona and Serrano, 1988). The most important function of the plasma membrane ATPase is to fuel the proton motive force driving the import of nutrients such as sugars, amino acids, nucleosides, and calcium (Foury

*We are grateful to the Institut pour I’Encouragement de la Recherche Scientifique pour 1’Industrie et 1’Agriculture for fellow- ships (to E. C.). Supporting grants were provided by the Services pour la Programmation de la Politique Scientifique and by the Fonds National de la Recherche Scientifique. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

and Goffeau, 1975; Foury et al., 1977; Boutry et al., 1977; Ulaszewski et al., 1987a; Cid et al., 1987). The plasma membrane H’-ATPase also controls the intracellular pH (Eraso and Gancedo, 1987; Ulaszewski et al., 1987a). The importance of the ATPase for cell cycle progression (McCusker et al., 1987; Cid et al., 1987) may correlate with the intracelluar alkalization observed before DNA synthesis (Gillies et al., 1981).

The plasma membrane H’-ATPase activity is modified by several physiological effectors; it oscillates during progression through the cell cycle (Lentzen et al., 1987), varies during growth (Tuduri et al., 1985; Francois et al., 1987), and is activated by glucose (Serrano, 1983), phorbol ester (Portillo and Mazon, 1985), and acid media (Eraso and Gancedo, 1987). There are indications that ATPase activity is subject to the control of CAMP (Foury and Goffeau, 1975) and that it might be regulated through phosphorylation by a membrane-bound seryl kinase recently identified (Kolarov et al., 1988). In this paper, we report on the promoter controlling the expression of the H’-ATPase gene PMAl. We show that PMAl transcription is under the control of the DNA binding protein TUF, which recognizes two nearly perfect consensus sequences found upstream of most ribosomal protein genes and therefore called RPG’ boxes (Leer et al., 1985; Huet et al., 1985). Until recently, TUF was considered as a factor for coordinated activation of the transcription of a family of RPG-depending genes coding for the translation machinery (Huet et al., 1985). The demonstration that the TUF-RPG system also controls the PMAl gene, together with the detection of RPG boxes upstream of six glycolysis genes (this paper and Lue and Kornberg, 1987), leads us to propose that this system is part of a generalized mechanism of growth control.

MATERIALS AND METHODS

Strains and Media-S. cereuisiae DBY745 (Matcu, leu2-3, leu2- 3,112, urd-52, adel-100) was used as the host for transformations. The diploid US86 (ura3 PMAl /ura3 PMAI) was used as the host for the disruption. The strains were grown at 30 “C either in rich medium (YEPD) containing 1% yeast extract (Difco), 1% Bacto-peptone (Difco), and 2% glucose or in minimal medium containing 0.7% yeast nitrogen base without amino acids, 2% Bactoagar (Difco), and 2% glucose. Auxotrophic mutants were supplemented with L-histidine (30 gg/ml), L-tryptophan (20 pglml), uracil (40 gg/ml), or adenine (40 gg/ml). Yeast transformation was carried out according to Dieck- mann and Tzagoloff (1983). Hygromycin B resistance was scored on YEPD containing 200 pg of hygromycin B (Sigma)/ml. Escherichia coli JM109 (recAl, endAl, gyrA96, thi , hdRl7, relAl, X-, A(hc- proAB) [F’,traD36,proAB,hcP,lacZ M151) was used for transformation by the CaCL procedure (Maniatis et al., 1982). Conventional LB

The abbreviations used are: RPG, ribosomal protein genes; UAS, upstream activating sequences; UAS, upstream activating sequences; bp, base pair(s); kb, kilobase(s); PIPES, 1,4-~iperazinediethanesul- fonic acid; SDS, sodium dodecyl sulfate.

7438 TUF Control of Yeast H+-ATPase medium was supplemented, when appropriate, with ampicillin (100

DNA-The plasmids were constructed by standard techniques (Maniatis et al., 1982). Single-strand DNA preparations of plasmids to be sequenced were carried out as described by Dente et al. (1983). A set of deletants in the PMAl regulatory region was obtained by treatment of the HindIII 5-kb DNA fragment containing the PMAl gene (Serrano et al., 1986) with Ba131 exonuclease. The partially end- digested DNA was isolated from agarose gel by electroelution. The ends of the Bal31-treated plasmids were repaired with the Klenow fragment of E. coli DNA polymerase I and the four dNTPs. Ligations were performed overnight at 15 "C with the sequencing vector pTZl9R previously linearized at SmaI. Nucleotide sequencing of the corresponding plasmids was carried out according to the dideoxy chain termination procedure (Sanger et al., 1977). The opposite strand was sequenced using 15-mer oligonucleotide primers. Yeast genomic DNA was extracted according to Davis et al. (1980). Agarose gel electrophoresis, transfer of DNA from agarose gels to nitrocellulose paper, and isolation of restriction fragments from agarose were carried out as described previously (Maniatis et al., 1982). The plasmid pTZl9R was from United States Biochemical Corp.

RNA-RNA was extracted from cells grown to a density of 3 X 107/ml by the procedure of Maccecchini et al. (1979), and its concentration was determined by absorbance at 260 nm.

DNA Binding Assays-The TUF factor was purified from S. cere- visiae 20B-12 (pep4-3) by two-step chromatography on heparin-agarose and DEAE-Sephadex as described previously (Huet and Sen- tenac, 1987). Band shift and DNase I footprint assays were performed as described (Huet et al., 1985). The DNA probe used for these assays was a 463-bp PvuII-XhoI fragment labeled by filling at the XhOI site. This fragment, obtained from one of the deletants in the PMAl regulatory region described above, contains the two PMAl UAS which are included in the region between -898 and -682 (XhoI) relative to the ATG start codon. The remaining 247 bp is a pTZ19R fragment comprised between the PuuII site and the destroyed SmaI site. TEFZ DNA used in the competition experiment was pLB25-1 plasmid DNA harboring the TEF2 promoter with two strong binding sites for TUF factor (Huet et al., 1985).

Mapping of the PMAl 5"mRNA Termini-For 5' end mapping, a 520-bp SalI-Sac1 fragment overlapping the start of PMAl mRNA was 5' end-labeled with [T-~'P]ATP using polynucleotide kinase (Boehringer Mannheim) after dephosphorylation with calf intestinal phosphatase (Boehringer Mannheim). The DNA was obtained from a Ba131 deletant in the PMAl regulatory region (see above). This deletant was inserted into pTZ19R with the PMAl regulatory part (about 400 bp) proximal to the pTZ19R Sac1 restriction site. The 5' terminus of mRNA was mapped using S1 nuclease according to the method of Berk and Sharp (1977). A total of 65,000 cpm of double- stranded probe and 120 pg of total RNA were denatured for 15 min at 75 "C in 65% formamide, 400 mM NaC1,40 mM PIPES, pH 6.4,l mM EDTA and hybridized at 46 "C for 13 h. The reaction medium was diluted &fold into S1 buffer (final concentration: 250 mM NaC1, 30 mM sodium acetate, pH 4.5, 1 mM ZnSO,). s1 nuclease (1.2 units/ pl, Boehringer Mannheim) was added, and the mixture was incubated at 25 "C for 1 h. The S1 nuclease-resistant DNA was precipitated with ethanol, resuspended in water, and subjected to electrophoresis on a 8.3 M urea, 5% polyacrylamide gel. The gels were autoradi- ographed for a few days at -70 "C using Kodak XAR-5 film and Du Pont Cronex Lightning Plus intensifying screens.

Isolation of Crude Membrane Fraction and ATPase Assays-Crude membrane fractions were obtained by differential centrifugation of a subcellular homogenate, and assays for ATPase activity were carried out as described by Ulaszewski et al. (1987b). Membrane proteins were analyzed by SDS-polyacrylamide gel electrophoresis (7% acryl- amide) and stained with Coomassie Brilliant Blue R.

8-Galactosidase Assays-50-pl aliquots of cell cultures (OD, = 0.7-1) were centrifuged. The pellets were resuspended in 1 ml of the buffer described by Miller (1972), treated with 0.05 ml of chloroform and 0.05 ml of 0.05% SDS, and vortexed. 8-Galactosidase activity was then assayed as described by Miller (1972). An arbitrary unit corresponds to 1000 X ODlzonm/t X u X OD,,, where t is the time of the reaction in minutes, u is the volume of culture used in the assay in milliliters, and the ODwnm reflects the cell density just before assay.

rg/ml). RESULTS

The Two Upstream Activating Sequences of the PMAl Gene-PMAl, the structural gene for the plasma membrane H+-ATPase from S. cereuisiae, was isolated as a 5-kb Hind111 DNA fragment (Serrano et al., 1986; Ulaszewski et al., 1987b). Fig. 2 shows the nucleotide sequences of 936 bp from the 5'- and 1007 bp from the 3"flanking regions of PMAl.

The start sites for transcription were estimated by S1 nuclease mapping. PMAl possesses four adjacent mRNA starts with a major signal near -233 (Fig. IA). This is an unusually long leader for a yeast mRNA, but it does not contain AUG sequences other than the initiator one. Using the Zuker program for RNA folding (Zuker and Steigler, 1981), a stable secondary structure with a free energy of formation of -54 kcal/mol was predicted for the PMAl 5'- noncoding region (Fig. 1B).

The HindIII-EcoRV fragment containing 936 bp of upstream sequence and the first 126 bp of the PMAl coding sequence were fused in frame to the E. coli lacZ gene by insertion into the polylinker of the high-copy number plasmid YEpZ12O (Oberto and Davison, 1985) (Fig. 3A). This PMAl- lacz fusion plasmid directed the synthesis of a strong @- galactosidase activity (8300 arbitrary units) when introduced into yeast. The same fusion gene inserted into the centromeric plasmid YCp50 gave a @-galactosidase activity of 415 arbitrary units.

A deletion analysis was carried out in order to determine the sequences which are essential for the transcription of PMA1. Both ends of the HindIII 5-kb DNA fragment were progressively digested by the exonuclease Ba131. DNA fragments of various lengths were electroeluted from agarose gels, filled up with the Klenow enzyme, and inserted in the SmaI site of the bacterial sequencing vector pTZ19R. The end points of the deletions were determined by sequence analysis. The selected deletants were fused to the lacz gene as described in Fig. 3A. Deletion of the region upstream of nucleotide -788 abolished almost totally the @-galactosidase activity. Close analysis of the deletants reported in Fig. 3B revealed two regions called UASlpMAl and UAS2pWI located, respectively, at -893 to -866 and -809 to -788. The UAS~PMA~ region alone promoted 85% of the total @-galactosidase activity, but both U A S ~ ~ M A ~ and U A S ~ P M A ~ were required for maximal expression.

Deletion of the region upstream of -788 reduced the @- galactosidase activity more than 100-fold but allowed residual @-galactosidase activity similar to that observed when the region upstream of -230 was deleted (Fig. 3B). Because position -230 is located just downstream of the major transcription start (-233), one may infer the presence of a second PMAl promoter downstream of -230.

To ask whether the two elements UAS~PMAI and UAS~PMAI also control the expression of the genomic PMAl gene, a foreign 7500-bp sequence was integrated at position -767 located just downstream of the two UAS regions. As shown in Fig. 44, the inserted DNA fragment came from the vector YIp5, which contains a URA3 gene, a truncated ATPase- coding sequence, and 767 bp of the PMAl upstream region lacking the two UAS. The integrative plasmid was directed by linearization with HpaI which cuts in the coding fragment of PMA1. Integration in an ura3/ura3 diploid disrupted the regulatory region located upstream of position -767 of PMAl and thus inactivated the two RPG boxes. The transformed diploid gave rise to four viable spores from which the two Ura+ spores grew more slowly than the two Ura- sister spores. Correct integration was confirmed by Southern blot analysis. As shown in Fig. 4B, the Ura+ and Ura- strains contain a

TUF Control of Yeast H+-ATPase 7439

A

1 2 3 4 5 6 7

FIG. 1. Characterization of the 5’ end of PMAl mRNA. A, S1 nuclease mapping. A 5’-labeled Sun-Sac1 fragment containing about 400 bp of the PMAl regulatory sequence described under “Materials and Methods” was used for the 5’ end mapping. This fragment was hybridized to total RNA from S. cereuisiue strain IL-125-2B (lane 5) and total RNA from S. pombe strain 972h- (as internal control) (lane 6 ) and then submitted to digestion by S1 nuclease. A known sequence was used to measure the length of the protected fragments (lanes I, 2, 3, and 4) . Lane 7 shows the two strands of the DNA probe. B, secondary structure prediction. The secondary structure of the mRNA between positions -233 and +19 was analyzed by the algorithm of Zuker and Stiegler (1981). The estimated stability of the predicted structure is -54 kcal. The ribosomal binding site and the initiator codon are underlined.

XhoI fragment of about 10,500 bp which hybridizes to the 4,650-bp HindIII-XbaI PMAl probe, while the Ura+ strains show an additional hybridizing band of 7,500 bp. Crude membrane fractions were prepared from each strain, and ATPase activity was measured (Fig. 4C). The Ura+ colonies exhibited only one-third of the ATPase activity observed in Ura- cells. When analyzed by densitometry after SDS-polyacrylamide gel electrophoresis, the crude membrane fraction from Ura+ cells showed a 55% decrease in the quantity of the M, = 100,000 protein, which comigrates with purified ATPase (Fig. 40). These results show that in vivo the promoter region comprised between -936 and -767 indeed controls the expression of the PMAl gene.

When tetrads from the disruption of Fig. 4A were plated on hygromycin B, a 2:2 cosegragation was observed for resistance to the antibiotic and for growth in the absence of uracil (Fig. 5). McCusker et al. (1987) have isolated 53 independent mutants in the PMAl gene which are resistant to hygromycin B. We have recently observed that our four original PMAl mutants (Ulaszewski et al., 1983) obtained as Dio-9 resistant are also resistant to hygromycin B. At least one of the Dio-9- resistant pmal mutants2 and one of the hygromycin-resistant

A. Schlesser, L. Van Dyck, and M. Ghislain, personal communication.

B

I

U-A

A- U A-U U-A U A U-A C.G U.A U-A U -A

U.A U-A

ACUU

A A ‘U-A

AC A uAi:: U-A C-G U-A

A C u A

C G U-A

U.A U.AU U-A U G U-A U-A U.A CG

-228 u-A -21

i . g m c A A

AC A A UA

U

A.UlrdJ A& lj AG U C A CA

pmal mutants3 are located in the coding region of PMAl. Our present observation that an insertional mutant in the regulatory region of PMAl also leads to hygromycin resistance shows that the drug resistance phenotype of thepmal mutants does not require specific modifications in the amino acid sequence of the ATPase but can result from a nonspecific reduction in ATPase activity. This observation supports our former proposal that the multiple drug resistance phenotype of pmal mutants is due to reduced drug uptake driven by the H+-ATPase (Ulaszewski et al., 1983).

The Two UAS Elements from PMAl Are Recognized by TUF-From comparison of the 5”flanking sequences of several ribosomal protein genes, two consensus sequences have emerged the HOMOLl box (AACATCT/CG/ATA/GCA) and the RPG box (ACCCATACATTT/A) (Teem et al., 1984; Leer et al., 1985). Because they share significant similarity (8 over 9 nucleotides of overlapping sequence) and because they both compete for the same DNA-binding protein called TUF (Vignais et al., 1987), the two boxes are considered as variants which have diverged from a common sequence. Since they both represent transcription activation sites (Rotenberg and Woolford, 1986; Woudt et al., 1986; Larkin et al., 1987;

J. Haber, personal communication.

7440 TUF Control of Yeast H+-ATPase

-936 ~ A ~ ~ ~ I C C I ~ A A * S G ~ * G A A ~ C * T ~ ~ * C ~ ~ ~ C ~ T I G C ~ ' ~ C ~ * ~ C ~ C C C ~ T A C ~ T ~ ~ ~ ~ ~ I G T

-574 T T I C C C I G ~ C C T T T T C C G G I A A T T I G A A A A C ~ A A C C C ~ C C G G C ~ ~ T

Hnnd Ill

4 1 2 A A T ~ A C C G C A G A i A T * r \ A C C C A T ~ ~ ~ . ~ C G A G A C G T A G A A C C A G C C G i C A C A T G G C C G G A G A A A ~

-780 T C C T G i C G A C h A T T T C G T A A A C T C G C ~ C G C A I T G C A T C I G I A T T T C C I A A T ~ C G G C A C T I S C A

-688 G G C C T C G A G A C C T C T G A C A T G C T T ~ G A C A G C A A T A A C A A I G I T A T C C A T A I G

- 6 2 6 CCTTTCGGGTTTTTTISSI~CCTTTICCATCATGAAAAATCTCTCGAGACCGTTTATCCATT

-564

-502 -440

-378

-316

- 2 8 4

- 192 - I10 - 60 G C T A G T I A A A G A h A * I C A T T G A A A A G A A G * A G I A I

- 6 A T C A A A T G - M A 1 - T A C C T G T T G A A G T r2769 """

"""

A G C A ~ ~ T A A T C A T A A T T T T T ~ T ~ A C . ~ T T I I A A T C A A C T I C A I T T T T C T G G I I I A A T T T T ~ C I +2831

A A T T I T A A I T T T A A I T T T T T T A T C ~ ~ I G G G A A C T G A I A C A C T A A A A A C A A T T A G G A C C C A A C 12893

AAGA~TAAGCCGCTIATTTCCTACT*GAGTTT*CTTAAAAITICAICTCGAAIIGICATTCT +2955

A A T A T T T T A T C C ~ C A C A C A C A C A C ~ C A C C T T A A A A T I I T I A G A I I A A A T G C C A T C A A C I C T T + X 1 7

A G C T T C A C A C A C ~ C A C A C A C A C C G A ~ C C T G G T T C T I I I A T T I G A T I T G A I A T A A I T G C I I T C +3079

T C T G G A T G G T A C T T I T I C T T I C I T C G T I A I T T C C T A I I T T A A A A I A T G A A A ~ C C A C A C A A C T + 3 1 4 1

C A T A A I T A T T C T A I T A G A G C A C A A T T C A C A A C A C G C A C A I T ~ C A A C T T I A A T A T T T T I T T ~ +3203

A A A C A C T T T A T T T ~ C T A A I T C I T I A ~ A A T A T A T A I A A T C C A C A C A C A C T A A T T T A T + x 6 8

T C A T T A A T T T T T T h T T G A G T I G G A T T T G A A A A T I I T T G G r3327

G A G G G A C A A A G A A T C G I C T I \ T I \ G T A T G G T C A A G C C T T G C r3389

T C T T C T A T ~ A T A C T I I A A A G * T C T C T C I I C ~ C ~ T T T G C T C C A T T C C C A A ~ T C ~ C ~ C I T A C G I T T r3451

ATGCGCCCATAC.IGACACTC*AGATIICPICI\CTTACACTTACATCAACGIAIACAAATTTACT~ACACT r3513

A C T I G A A A A T A T ~ ~ A C C A C A C T A C ~ I C A T A I T ~ A T ~ C G T R G T A I T C C A T G ~ T I G A A C G C C G C +3575

C I C C G C C A A A T A ~ : C I I T A C T G A T T I T C C C G G T T A A T C C C A T C G A A A I T T C I T ~ : A T C A C A A G A r3637

A A G C A A A C A A A T : G C C A C G C C A T T C T A C A A C I T I C C T I I T C T ~ A T C A A G A T G ' C A A A A G C T A C +3699

T A A G G C G I C A T T ~ C T C T A C A T C A C T C A G I T T A G C C T C A C C T I C I A T A G T A T ~ C I A C C C T C C C 13761

FIG. 2. Nucleotide sequence of the PMAl 6'- and 3'-noncoding regions. The black dots indicate the starting position of transcription. The 9-bp repeat homologous to the consensus RPG, the putative TATA box, the ribosome-binding site sequence, the CA repeat, and the Zareth and Sherman termination consensus are underlined. The end points of deletions in the B'-regulatory region are indicated by arrows. The two T-rich regions and the PMAl coding region are boxed.

Schwindinger and Warner, 1987) the HOMOLl and RPG- related sequences are called UASRPG. The two regions UASlp" and U A S ~ P M A ~ share an exact 9-bp repeat underlined in Fig. 3B. These repeated sequences match well with the RPG consensus sequence and were therefore candidates for specific recognition by the TUF factor.

Using the gel electrophoretic retardation assay (Fried and Crothers, 1981; Garner and Revzin, 1981), we observed that addition of increasing amounts of TUF altered the migration of the PuuII-XhoI DNA fragment which encompasses the two UAS elements (Fig. 6A). Two distinct complexes C1 and C2 of lower electrophoretic mobilities than free DNA were formed. Complex C2 progressively accumulated in the presence of excess TUF (Fig. 6A). TUF binds tightly to the RPG boxes from the TEF2 gene encoding the translation elongation factor EF1-a (Huet et al., 1985). Addition of increasing amounts of unlabeled TEF2 competitor DNA to the radioac- tive PMAl probe resulted in complete inhibition of the formation of the PMAl-TUF complexes, with complex C2 dis- appearing first (Fig. 6B). These results strongly suggest that TUF interacted with two different sites on the PMAl promoter, complex C2 correspondig to the binding of the TUF factor to both sites.

The precise location of these binding sites was identified by the indirect footprinting procedure. The DNA-protein complexes were treated lightly with DNase I prior to gel electrophoresis. The bands corresponding to free DNA and to C1 and C2 complexes were excised from the gel, eluted, and separated on a sequedcing gel (Fig. 6C). When compared to the free DNA cleavage pattern (lune 0) , analysis of complex C1 (lune 1) revealed a partial protection of DNA over the predicted RPG boxes present in UASl and UAS2. Partial

protection was due to the binding of one molecule of TUF to either one of the two UAS elements. As expected, in complex C2 (lune 2), the TUF factor was bound simultaneously to the two RPG boxes as shown by the two clearly footprinted regions over UASl and UAS2 (referred to as RPG1 and RPG2 in Fig. 6C).

Further Analysis of the 5'- and 3'-Noncoding Sequence- An unexpected finding was the presence between -14 and -21 on the PMAl coding strand of a sequence highly homologous (7 nucleotides/8 nucleotides) to a complementary sequence from the 3' end of the yeast 16 S rRNA (Rubtsov et al., 1980). According to the Shine-Dalgarno model (1974) the 3' terminus of the E. coli 16 S RNA interacts with complementary ribosome-binding sites of mRNAs. Such ribosome- binding site sequence had not previously been detected in yeast mRNA leaders. Only a few cases of poor homologies often located very close to the messenger 5' end have been described (Zalkin and Yanofsky, 1982; Cigan and Donahue, 1987). However, the typical ribosome-binding site of PMAl is not unique for yeast since a literature search allowed us to identify a similar sequence upstream of the well expressed gene PGK sequenced by Ogden et al. (1986).

The PMAl codon bias index was 0.83 when calculated according to Bennetzen and Hall (1982b). This value predicts that the PMAl gene is highly expressed, and indeed Fig. 40 shows that the H+-ATPase is a major membrane protein. The PMAl promoter possesses the pyrimidine-rich block (CT block) on the coding strand just upstream of the mRNA initiation sites (Fig. 2), which is a feature of well transcribed genes (Dobson et al., 1982; Neil, 1988). With the T block between -465 and -449, the PMAl promoter has thus a tripartite organization: UASRPG-UASRPG-T block similar to that reported for constitutive genes from the translation machinery (Rotenberg and Woolford, 1986).

Analysis of the 3'-noncoding region of PMAl revealed that a transcription termination-polyadenylation consensus sequence TAG. . .TAGT. . .TTT (Zaret and Sherman, 1982) was centered at +3218 downstream of the stop codon TAA (Fig. 2). In addition, an intriguing 18-bp repeat composed of CA motifs was found at positions +2967 and +3023 in the mRNA trailer sequence. So far, CA motifs had been found only in leader sequences where they are assumed to interfere with the initiation of translation (Cigan and Donahue, 1987; Stiles et al., 1981).

DISCUSSION

Our study shows that the major regulatory elements of the PMAl gene are located in the 5' region of the HindIII fragment not sequenced previously by Serrano et al. (1986). In addition we found that the HindIII fragment is 100 bp longer than reported by Serrano et al. (1986) and that the region upstream of the initial ATG possesses not one but two XhoI restriction sites 100 bp apart from one another. This small XhoI-XhoI fragment was probably missed because of the XhoI linker insertion strategy employed for sequencing (Serrano et al., 1986). Using S1 nuclease techniques, we have mapped the 5' termini of the messenger RNA near -233. This leader sequence is longer than the average length found for yeast mRNAs ((52 nucleotides) Cigan and Donahue, 1987) and contrasts with that of N. crussa ATPase mRNA which has only 50 bases of 5"noncoding sequence (Aaronson et al., 1988).

The Zuker program for RNA folding predicts a stable mRNA leader secondary structure for PMAl which is quite unusual for yeast (see Cigan and Donahue, 1987, for a review). In yeast and other eukaryotic cells, the preinitiation com-

A

TUF Control of Yeast H+-ATPase

1 Kpb

7441

" RV PMA1- H

B

PMAl -1acZ *I Xhol ""

- 230 -285

- 503"" - 542 "-

- 607 "_ - 663 "_

- 745 "_ - 767 "-

- 788 "_ - 8 0 9 D "_

- 8 2 0 a "_ - 836- "_

- 866-0 "_ - 8930-a "_

- 8 9 8 ~ - = "_ - 9 3 6 a - 0 "_

I- , YEpZ120 lOODb

8 0 63

75

74

6 2

70

8 1

77

74

6 ,900

6 ,840

7 , 2 3 0 7> 200

8 , 3 0 0

8 , 3 6 0

8 , 2 2 0

0

p-galactosidase arbitrary units

FIG. 3. Detection of two PMAI UAS. A, the HindIII-EcoRV DNA fragment containing the 936 bp of the putative regulatory region and the first 42 codons of PMAl was fused in frame with a E. coli lac2 coding sequence on the multiple copy plasmid YEpZ120. The open and filled bars represent, respectively, the plasmid and ATPase coding sequences. The thick line correspond to the PMAl 5'- and 3-noncoding region. H, HindIII; RV, EcoRV; S, SmaI. B, both ends of the HindIII 5-kb DNA fragment containing PMAl were digested with Ba131 and cloned into the polylinker of the bacterial sequencing vector pTZ19R. The selected deletants were fused to the lacz gene as described in A , the HindIII site now being located on the pTZ19R polylinker. The 9-bp repeats which match the UASR~C consensus sequence are underlined. The thick line corresponds to the PMAl 5'-noncoding region. The major PMAl transcription start is indicated with an arrow. The open and filled bars represent, respectively, the PMAI UAS regions and coding sequence.


B

SPORES I

A

n

P M A 1

H X X

P M A l

C S p o r e 1A 1B 1C 1D 2A 28 2C 2D

:: SPORE

P ,

Kd 2 C 2 0 28 ?A'

SPORE 28

\

94 -

SPORE 2 0

c'

FIG. 4. The effects of UAS deletion on ATPase. A, disruption of the ATPase UAS region. A yeast integrative plasmid comprising a deleted part of the PMAl gene and possessing 767 bp of the regulatory region was directed by linearization with HpaI into the chromosome VI1 of a ura3 diploid host. Thin and thick lines correspond to plasmid and yeast DNA, respectively. The open bur represents the ATPase coding region. The regions with the two UAS are dotted. H, HindIII, X , XhoI. B, Southern blot analysis. Yeast colonies from tetrad obtained by sporulation of the disrupted diploid were grown in liquid media. Genomic DNA was isolated and digested by XhoI, electrophoresed on a 1% agarose gel, transferred to a nitrocellulose filter, and hybridized to 32P-labeled HindIII- XbaI fragments containing the ATPase gene. C and D, effects of the disruption on the ATPase activity and protein amount. Crude membrane fractions were prepared from Ura+ and Ura- yeast. ATPase activity was measured ( C ) , and each fraction was analyzed by SDS-polyacrylamide gel electrophoresis followed by densitometric analysis (D).

TUF Control of Yeast H+-ATPase 1 2 3

FIG. 5. Hygromycin B resistance phenotype after PMAl UAS deletion. The meiotic segregants from the tetrads obtained after the disruption described in Fig. 4 were replica-plated on YEPD plus 100 pg ( I ) or 200 pg (2) of hygromycin B/ml or on yeast minimal medium (3 ) .

plexes bind the free 5' end of mRNA at the CAP structure and then migrate through the leader region "scanning" for a translational start site (Kozak, 1983). Extensive secondary structures in the 5"untranslated sequence should block translation (Pelletier and Sonenberg, 1985). Indeed, Baim and Sherman (1988) and Cigan et al. (1988) have inhibited the translation of CYCl and HIS4 by introducing a RNA structure of -58 kcal/mol and -21.3 kcal/mol, respectively, upstream of the AUG initiator codon. The long secondary structure predicted between -228 and -21 (Fig. 1B) in the PMAl mRNA leader (-49.6 kcal/mol) may act as a barrier to ribosome scanning and might therefore be involved in translation control. Translation of in vitro-synthesized PMAl mRNA in rabbit reticulocyte lysate was strongly reduced when the complete 5' end leader was present (results not shown). This result suggests that, in yeast, translation of the PMAl mRNA is facilitated by factors which are not present in the reticulocyte.

Several properties of the PMAl mRNA such as the stable secondary structure, the ribosome-binding site, and the CA repeat may be related to a post-transcription mechanism which avoids overproduction of ATPase (Eraso et al., 1987).

The major result of this work is the identification of UASRpG sequences controlling the expression of PMAl. Yeast possesses several families of genes coordinately transcribed and belonging to specific metabolic pathways such as those involved in amino acid biosynthesis and in galactose utilization. Each of these families possesses a specific DNA-binding protein which binds to a well defined oligonucleotide site found upstream of all the coregulated genes (see Guarente, 1987 for a review). Up to now, the same principle seemed to apply to the genes encoding components of the translation machinery. These genes are controlled by the DNA-binding protein TUF, a polypeptide of 150,000 relative mass (Huet and Sentenac, 1987), which interacts with the UASRPG present in the 5'- flanking region of at least nine constitutive genes all encoding components of the translation machinery (Huet et al., 1985; Vignais et al., 1987; Mann et al., 1987). Now, with the demonstration that TUF also binds the RPG boxes located upstream of the transport ATPase gene PMAl, it becomes obvious that the role of TUF is not restricted to genes involved in translation. There are other recent indications that the role of TUF is pleiotropic. By scanning published yeast promoter sequences, we have identified a nearly perfect UASRpC in the promoter region of several glycolytic genes: PYK, PGK, ENOl, PDC, and upstream of the ADHl and GPD genes (Fig. 7). Recently a protein factor, which in our view is likely to be TUF, was shown to bind to the UAS region of EN01 at the site where our computer search identifies a UASRpc (Machida et al., 1988). Two laboratories have recently identified a similar DNA-binding protein called either RAP1 or GRFl

B

C O M P E T I T I O N -

Cl

free DNA

C

RPGl -88

-79!

RPG2 1 -784

7443

PMAl s o 1 2

I

0 '10 25 50 .loQ

TEF2 (fmol) FIG. 6. Binding of the TUF factor to UASl and UASB. A

and B, retardation of the mobility of the PMAl promoter by TUF binding. The 463-bp PuuII-XhoI 32P-labeled DNA probe harboring the PMAl UAS was used for the gel retardation assay (3000 cpm/ assay). In all these experiments the DNA concentration was kept constant (300 ng/20 pl) by adding appropriate amounts of pBR322 DNA. A, the DNA probe was incubated in 20 pl for 10 min at 25 "C with increasing amounts of TUF factor as indicated. DNA-protein complexes were analyzed by the gel retardation assay. The migration of free DNA and of complexes C1 and C2 is indicated on the autoradiography. The arrow shows the origin. B, the competition experiment was done by incubating TUF factor (100 ng) with a mixture of the PMAl probe and increasing amounts of TEF2 DNA competitor as indicated. C, indirect footprinting of the RPGl and RPG2 boxes of the PMAl promoter. The C1 and C2 complexes were digested by DNase I and separated from free DNA by electrophoresis. The bands corresponding to free DNA and complexes C1 and C2 were excised. The DNA fragments were eluted and analyzed on a sequencing gel. Lanes 0, 1 , and 2 correspond, respectively, to free DNA, complex C1, and complex C2. The footprinted regions are indicated by the brackets. The location of the two RPG boxes, RPGl and RPG2, present within UASl and UAS2 respectively, is indicated. The numbering is from the initiator ATG codon.

(Shore and Nasmyth, 1987; Buchman et al., 1988). The RAP1/ GRFl protein binds in vitro to several DNA sequences: the UAS of MATa, the silencer elements E of the HML and HMR loci, DNA sequences within the (C1-3A) repeats of yeast telom- eres, and also the UAS of PYK (Lue and Kornberg, 1987). The sequence protected by the protein shares good homology with the UASRPG. In fact, the RAPl/GRFl protein was proved to bind to the UASRPG of TEF2 and RP51 (Shore and Nas- myth, 1987), two genes of the translation machinery also recognized by TUF. In addition, TUF associates to the telom-


GPD PGK PY K

PDC EN01

ADHi PMAi PMA 1

* - 5 6 3 - 4 7 1 - 6 5 1 - 4 6 5 - 6 3 2 - 6 6 0 -890 - 793

RPG - BOX IACCCATACAT)

FIG. 7. Comparison of homologous sequence to RPG box. Segments of the regulatory region of the yeast genes, pyruvate kinase (PYK), phosphoglycerate kinase (PGK), alcohol dehydrogenase (ADHl) , enolase 1 (ENOl) , pyruvate decarboxylase (PDC), glyceraldehyde-3-phosphate dehydrogenase (GPD), plasma membrane ATPase (PMAl) , are reported. For each gene, the position of the conserved nucleotide C, indicated by an *, is given. The regions showing homology to the consensus sequence RPG (Leer et al., 1985; Vignais et al., 1987) are boxed. For references see Fig. 8.

eric repeat and to the HML-E and the HMR-E RPG sequence~.~ There are thus strong indications that the RAP1/ GRFl protein is TUF. The RAPl gene has been cloned and sequenced recently. Its disruption leads to lethality (Shore and Nasmyth, 1987). Fig. 8 represents a collection of 45 yeast genes which possess a RPG sequence in their regulatory region. Several of them have been shown to be recognized by the TUF (RAPl/GRFl) factor.

Among the genes listed in Fig. 8, those belonging to glycolysis, active transport, transcription, and translation have in common to be well expressed and to be essential for growth. These results strongly support an earlier proposal of Huet et al. (1985) that the DNA-binding protein TUF is a component of a generalized transcriptional mechanism for control of

yeast growth. For instance, by binding upstream of the RPC40 and RPAISO genes which encode subunits of RNA polymerase A and C, TUF controls the two polymerase activities which produce 97% of total RNA. By affecting PMAl, TUF inter- feres with nutrient transport and modifies many enzymatic reactions and developmental signals responding to the internal pH. By affecting glycolytic genes, TUF determines the production of ATP and thereby the whole anabolism. As the genes of Fig. 8 control quite different functions, it is unlikely that they are regulated in a strictly identical way. TUF seems to be a DNA-binding protein necessary for a high level of transcription but whose efficiency and specificity must be determined by its proteic environment.

It is interesting to note the recent report that RAPl belongs to the class of scaffold protein^.^ It can be envisaged that PMAl, like several of the genes of Fig. 8, may have in common to be attached to the nuclear matrix by means of their RPG sequences. This could provide a mechanical basis for a pleiotropic action of TUF. Which signal(s) may control TUF efficiency? Transcription of the ribosomal protein genes is subject to regulation by the carbon source. After shifting a yeast culture from an ethanol-based medium to a glucose- based medium, the level of ribosomal protein-mRNA rises considerably within 30 min (Herruer et al., 1987). Using a synthetic oligonucleotide carrying the RPG consensus sequence derived from the L25 ribosomal protein gene, these authors conferred carbon source regulation to a heterologous promoter. This regulation is a transcriptional event mediated by the UASRp~. Recently the ENOl-UAS was found to re- spond to glucose induction (Cohen et al., 1987). More pre- cisely, the amount of the ENOl-UAS binding protein (which covers the RPG sequence) was shown to be regulated by

~ ~ ~~~~ ~ ~~

J. Huet and M. L. Vignais, unpublished results.

NUTRIENTS TRANSPORT

J. F. X. Hofmann and S. M. Gasser, personal communication.

TRANS1

~ ~- TRANSCRIPTION

P M A l P M A 2

( 1 RNA rRN4) GLYCOLYSIS

EN07

rlON

/ ( R A P l / G R F l )

FIG. 8. UASRpo upstream nonrelated yeast genes. This figure shows a collection of 45 yeast genes for which one or two UASR~G have been identified. Genes whose UASRp~ have been reported to complex TUF (RAPl/GRFl) are indicated with heavy capital letters. The other genes are indicated with light italic letters. Pyruvate kinase, PYK (Burke et al., 1983; Lue and Kornberg, 1987); phosphoglycerate kinase, PGK (Ogden et al., 1986); enolase 1, ENOl (Uemura et al., 1986); alcohol dehydrogenase 1, ADHl (Bennetzen and Hall, 1982a); pyruvate decarboxylase, PDC (Butler and Connell, 1988); glyceraldehyde-3-phosphate dehydrogenase, GDP (Bitter and Egan, 1984); PMA2 (Schlesser et al., 1988); lysyl-tRNA synthetase gene, KRSl (Mirande and Waller, 1988); HML-E, HML-R, MATa (Shore and Nasmyth, 1987; Buchman et al., 1988); the fixation of GRFl to telomeric repeat (Buchman et al., 1988); the fixation of TUF on telomeric repeat is unpublished data of M. L. Vignais; the fixation of TUF on the RPG sequences of HML-E and HMR-E is unpublished data of J. Huet (Saclay); RPC40 (Mann et al., 1987); RPA190 (Memet et al., 1988); SUFl2 (Wilson and Culbertson, 1988); SUP1 (Breining and Piepersberg, 1986); SUP2 (Kushnirov et al., 1988); TZFl (Linder and Slonimski, 1988). For the ribosomal protein and elongation factors genes, see Leer et al. (1985); Woudt et al. (1987); Remacha et al. (1988); Dabeva and Warner (1987); Lucioli et al. (1988); for the fixation of TUF on RP28-2, R28-I, R51-A, L25, zA6, S24, TEF1, TEF2, see Huet et al. (1985); Vignais et al. (1987).

TUF Control of Yeast H+-ATPase 7445

glucose (Machida et al., 1988). Glucose might be thus one of the signals triggering the coordinated regulation exerted by TUF. It is unlikely that this is related to the glucose activation of H’-ATPase activity which is a very rapid effect occurring in the absence of growth (Serrano, 1983). In contrast, it is quite conceivable that the increase followed by the decrease of the H+-ATPase activity at the end of exponential growth (Tuduri et al., 1985) may be controlled by glucose and/or internal pH via modifications of the expression or activity of TUF.

Acknowledgments-We would like to thank Janine Huet (Saclay) for her help with TUF factor preparation, Francoise Foury, Michel Ghislain, and Elisabetta Balzi (Louvain-la-Neuve) for critical reading of the manuscript, Luc Van Dyck (Louvain-la-Neuve) for providing the centromeric construct, Chen Weining (Louvain-la-Neuve) for help in computer analysis, and Alistair Chambers (Oxford) for helpful discussion.

REFERENCES

Aaronson, L. R., Hager, K. M., Davenport, J. W., Mandala, S. M., Chang, A., Speicher, D. W., and Slayman, C. W. (1988) J. Bid. Chem. 263,14552-14558

Amory, A,, and Goffeau, A. (1982) J. Biol. Chem. 257,4723-4730 Baim, S. B., and Sherman, F. (1988) Mol. Cell. Bid . 8 , 1591-1601 Bennetzen, J . L., and Hall, B. D. (1982a) J. Biol. Chern. 2 5 7 , 3026-

Bennetzen, J. L., and Hall, B. D. (1982b) J. Biol. Chem. 2 5 7 , 3018-

Berk, A. J., and Sharp, P. A. (1977) Cell 12,721-732 Bitter, G. A., and Egan, K. M. (1984) Gene (Amst.) 32 , 263-274 Boutry, M., Foury, F., and Goffeau, A. (1977) Biochim. Biophys. Acta

Bowman, B. J., and Bowman, E. J. (1986) J. Membr. Biol. 94,83-97 Breining, P., and Piepersberg, W. (1986) Nucleic Acids Res. 14,5187-

Buchman, A. R., Kimmerly, W. J., Rine, J., and Kornberg, R. D.

Burke, R. L., Tekamp-Olson, P., and Najarian, R. (1983) J. Biol.

Butler, G., and Connell, D. J. M. (1988) Curr. Genetics 14 , 405-412 Cid, A., Perona, R., and Serrano, R. (1987) Curr. Genet. 12, 105-110 Cigan, A. M., and Donahue, T. F. (1987) Gene (Amst.) 5 9 , 1-18 Cigan, A. M., Pabich, E. K., and Donahue, T. F. (1988) Mol. Cell.

Cohen, R., Yokoi, T., Holland, J. P., Pepper, A. E., and Holland, M.

Dabeva, M. D., and Warner, J. R. (1987) J. Biol. Chem. 2 6 2 , 16055-

Davis, R. W., Thomas, M., Cameron, J., St. John, T. P., Scherer, S.,

3031

3025

464,602-612

5197

(1988) Mol. Cell. Biol. 8, 210-225

Chem. 258,2193-2201

Biol. 8,2964-2975

J. (1987) Mol. Cell. Biol. 7 , 2753-2761

16059

and Padgett, R. A. (1980) Methods Enzymol. 65, 404-411 Dente, L., Cesareni, G., and Cortese, R. (1983) Nucleic Acids Res. 11,

1645-1655 Dieckmann, C. O., and Tzagoloff, A. (1983) Methods Enzymol. 9 7 ,

Dobson, M. J., Tuite, M. F., Roberts, N. A., Kingsman, A. J., and Kingsman, S. M. (1982) Nucleic Acids Res. 10, 2625-2637

Dufour, J. P., and Goffeau, A. (1978) J. Biol. Chem. 2 5 3 , 7026-7032 Eraso, P., and Gancedo, C. (1987) FEBS Lett. 224 , 187-192 Eraso, P., Cid, A., and Serrano, R. (1987) FEBS Lett. 1 , 193-197 Foury, F., and Gdffeau, A. (1975) J. Biol. Chem. 250,2354-2362 Foury, F., Boutry, M., and Goffeau, A. (1977) J. Biol. Chem. 2 5 2 ,

Francois, J., Eraso, P., and Gancedo, C. (1987) Eur. J. Biochem. 164 ,

Fried, M., and Crothers, D. M. (1981) Nucleic Acids Res. 9 , 6505-

Garner, M. M., and Revzin, A. (1981) Nucleic Acids Res. 9 , 3047-

Ghislain, M., Schlesser, A., and Goffeau, A. (1987) J. Biol. Chem.

Gillies, R. J., Ugurbil, K., Den Hollander, J . A., and Shulman, R. G.

Goffeau, A., and Slayman, C. W. (1981) Biochim. Biophys. Acta 6 3 9 ,

355-360

4577-4583

369-373

6524

3060

2 6 2 , 17549-17555

(1981) Proc. Natl. Acad. Sci. U. S. A. 7 8 , 2125-2179

197-223

Gradmann, D., Hansen, V. P., Long, W. S., and Slayman, c . L. (1978)

Guarente, L. (1987) Annu. Rev. Genet. 21,425-452 Hager, K. M., Mandala, S. M., Davenport, J. W., Speicher, D. W.,

Renz, E. J., Jr., and Slayman, C. W. (1986) Proc. Natl. Acad. Sci.

Herruer, M. H., Mager, W. H., Woudt, L. P., Nieuwint, R. T. M., Wassenaar, G. M., Groeneveld, P., and Planta, R. J. (1987) Nucleic Acids Res. 15,10133-10144

Huet, J., and Sentenac, A. (1987) Proc. Natl. Acad. Sci. U. S. A. 8 4 ,

Huet, J., Cottrelle, P., Cool, M., Vignais, M. L., Thiele, D., Marck, C., Buhler, J. M., Sentenac, A., and Fromageot, P. (1985) EMBO

Kolarov, J., Kulpa, J., Baijot, M., and Goffeau, A. (1988) J. Biol.

Kozak, M. (1983) Microbiol Rev. 4 7 , 1-45 Kushnirov, V. V., Ter-Avanesyan, M. D., Telckov, M. V., Surguchov,

A. P., Smirnov, V. N., and Inge-Vechtomov, S. G. (1988) Gene

Larkin, J. C., Thompson, J. R., and Woolford, J. L., Jr. (1987) Mol. Cell. Biol. 7 , 1764-1775

Lavoisier, M. (1789) Traite ,%mentaire de Chimie Prisente duns un Ordre Nouveau et d’apres les DQcouvertes Modernes Tome I, Li- brairie Cuchet, Rue et H&el Serpente, Paris

Leer, R. J., Van Raamsdonk-Duin, M. M. C., Mager, W., and Planta, R. J. (1985) Curr. Genet. 9 , 273-277

Lentzen, H., Arreguin, M., Kappeli, O., Fiechter, A., and Fuhrmann, G. F. (1987) J. Biotechnol. 6,281-291

Linder, P., and Slonimski, P. (1988) Nucleic Acids Res. 16, 10359 Lucioli, A., Presutti, C., Ciafre, S., Caffarelli, E., Fragapane, P., and

Lue, N. F., and Kornberg, R. D. (1987) h o c . Natl. Acad. Sci. U. S. A.

Maccecchini, M. L., Rudin, Y., Blobel, G., and Schatz, G. (1979) Proc. Natl. Acad. Sci. U. S. A. 76 , 343-347

Machida, M., Uemura, H., Jigami, Y., and Tanaka, H. (1988) Nucleic Acids Res. 16, 1407-1422

Maniatis, T., Fritsch, E., and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Mann, C., Buhler, J. M., Treich, I., and Sentenac, A. (1987) Cell 48 , 627-637

McCusker, J. H., Perlin, D. S., and Haber, J . E. (1987) Mol. Cell. Biol.

Memet, S., Gouy, M., Marck, C., Sentenac, A., and Buhler, J. M.

Miller, J. H. (1972) Experiments in Molecular Genetics, pp. 352-355

Mirande, M., and Waller, J. P. (1988) J. Biol. Chem. 263 , 18443-

Neil, J. B. M. (1988) Mol. Cell. Bid . 8 , 1045-1054 Oberto, J., and Davison, J. (1985) Gene (Amst.) 40 , 57-65 Ogden, J . E., Stanway, C., Kim, S., Mellor, J., Kingsman, A. J., and

Kingsman, S. M. (1986) Mol. Cell. Biol. 6 , 4335-4343 Pelletier, J., and Sonenberg, N. (1985) Cell 4 0 , 515-526 Perona, R., and Serrano, R. (1988) Nature 334,438-440 Portillo, F., and Mazon, M. J. (1985) FEBS Lett. 192 , 95-98 Remacha, M., Saenz-Robles, M. T., Vilella, M. D., and Ballesta, J. P.

G. (1988) J. Biol. Chem. 2 6 3 , 9094-9101 Rotenberg, H. O., and Woolford, J . L. (1986) Mol. Cell. Biol. 6 , 674-

687 Rubtsov, P. M., Musakhanov, M. M., Zaharyev, V. M., Krayev, A. S.,

5779-5794 Skryabin, K. G., and Bayev, A. A. (1980) Nucleic Acids Res. 8 ,

Sanger, F., Nickeln, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74 , 5463-5467

Schlesser, A., Ulaszewski, S., Ghislain, M., and Goffeau, A. (1988) J. Biol. Chem. 2 6 3 , 19480-19487

Schwindinger, W. F., and Warner, J. R. (1987) J. Biol. Chem. 262 ,

Serrano, R. (1983) FEBS Lett. 156 , 11-14 Serrano, R. (1988) Biochim. Biophys. Acta 9 4 7 , 1-28 Serrano, R., Kielland-Brandt, M. C., and Fink, G. R. (1986) Nature

Shine, J., and Dalgarno, L. (1974) Proc. Natl. Acud. Sci. U. S. A. 71,

Shore, D., and Nasmyth, K. (1987) Cell 5 1 , 721-732

J. Membr. Biol. 39 , 333-367

U. S. A. 8 3 , 7693-7697

3648-3652

J. 4,3539-3547

Chem. 263,10613-10619

(Amst.) 66,45-54

Bozzoni, I. (1988) Mol. Cell. Biol. 8 , 4792-4798

84,8839-8843

7,4082-4088

(1988) J. Biol. Chem. 2 6 3 , 2830-2839

Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

18451

5690-5695

319,689-693

1342-1346


Stiles, J. I., Szostak, J. W., Young, A. T., Wu, R., Consaul, S., and Sherman, F. (1981) Cell 2 5 , 277-284

Teem, J. L., Abovich, N., Kaufer, N. F., Schwindinger, W. F., Warner, J. R., Levy, A., Woolford, J., Leer, R. J., Van Raamsdonk-Duin, M. C., Mager, W. H., Planta, R. J., Schultz, L., Friesen, J. D., Fried, H., and Rosbash, M. (1984) Nucleic Acids Res. 12,8295-8312

Tuduri, P., Nso, E., Dufour, J. P., and Goffeau, A. (1985) Biochem. Biophys. Res. Commun. 133,917-922

Uemura, H., Shiba, T., Paterson, M., Jigami, Y., and Tanaka, H. (1986) Gene (Amst.) 45 , 67-75

Ulaszewski, S., Grenson, M., and Goffeau, A. (1983) Eur J. Biochem.

Ulaszewski, S., Van Herck, J. C., Dufour, J. P., Kulpa, J., Nieuwen- 130,235-239

huis, B., and Goffeau, A. (1987a) J. Biol. Chem. 262,223-228

Ulaszewski, S., Balzi, E., and Goffeau, A. (198%) Mol. Gen. Genet.

Vignais, M. L., Woudt, L. P,, Wassenaar, G. M., Mager, W. H.,

Wilson, P. G., and Culbertson, M. R. (1988) J. Mol. Biol. 199, 559-

207,38-46

Sentenac, A., and Planta, R. J. (1987) EMBO J. 6,1451-1457

573 Woudt, L. P., Smit, A. B., Mager, W. H., and Planta, R. J. (1986)

EMBO J. 5,1037-1040 Woudt, L. P., Mager, W. H., Nieuwint, R. T. M., Wassenaar, G. M.,

Van Der Kuyl, A. C., Murre, J. J., Hoekman, M. F. M., Brockhoff, P. G. M., and Planta, R. J. (1987) Nucleic Acids Res. 15 , 6037- 6048

Zalkin, H., and Yanofsky, C. (1982) J. Biol. Chem. 267 , 1491-1500 Zaret, K. S., and Sherman, F. (1982) Cell 28,563-573 Zuker, M., and Stiegler, P. (1981) Nucleic Acids Res. 9, 133-148

the yeast h'-atpase gene is controlled by the promoter binding

Documents