the role of hnrnp a1 and hnrnp c1/c2 in the regulation of ...172034/fulltext01.pdf · dan...

ACTA

UNIVERSITATIS

UPSALIENSIS

UPPSALA

2008

Digital Comprehensive Summaries of Uppsala Dissertationsfrom the Faculty of Pharmacy 74

The role of hnRNP A1 and hnRNPC1/C2 in the regulation of thestress responsive genesCyp2a5/2A6 and p53.

KYLE CHRISTIAN

ISSN 1651-6192ISBN 978-91-554-7198-9urn:nbn:se:uu:diva-8722

�� !��"�� #�� $ �� %��& '� �(� ��"��' �� ' )(��(� *#�� ' )(��+, -(� �� .�� /"��(,

��

�(�� 0, ��$, -(� �� ' (12) 3� �� (12) �� (� ��"�� ' �(� �� "�� &��34 �� &�,, 3�� , �� 56, %� ��, ��, 78�2 %5$9%�9&&695�%$9%,

-(� '�� ' �� . �� (��"�� *(12)�+ �� "�� , :'�� (� �� (12) .�� '�� '�� "� �(�� ;��'�� <, -(� �. (12)� . �� (12) 3� ��(12) �� '�� '�� ''�� (� �� "� �� ' ��'�� "��= �123, -(�� "�� 23 ��"� �� (��,-(� �� ' �(�� (�� .�� (� (12) 3� �� (12) ��

��"�� ' �. (�"(�� "�� (� �� &� �� (��(�� )6&� �>�� , ?� ��'�� (12) �� 23 ��"�� " �� .�� (� ��" ��"� ' �&� �123� �� '�� (�� .(�� '�� " �� (�� '�� &� �� '(12) �� .��( �(�� (� ��, -(� �� ""�� (�� . �� (�� '� �(� �.9��"�� ' �&� �� (12) ��, :��(�� " �� (� �'�� (� �(�� , ?� �� (. (12) �� ' �&� �� ,-(� �� (�� '��(�� ""�� (�� (� �� 9��

�� " �(� �� ' �(� �� "�� (12) 3�� '��" '�� (� �� '�� (� �� '�� (� �= -1 ' �(� �123 �� , :�� ' �(�(�� (�" ' �(�� "�� ""�� (�� (�� "�� "��9�� (�� ' �� (�"�� 123 �� ' (12) 3� .��( �� = -1,

�!�"�# (12)� -�� 8�� )�� &�� @)�3&� �@)�34� 3�� (12) �)�� (12) �� 3��

�� $ � �� %�� $ %& �'($ �� $�)*+�(�, ��$ �! " �

A 0�� (�� $

7882 �4&�94�%�78�2 %5$9%�9&&695�%$9%��9$5�� *(��, �,��B��C��9$5��+

For my mom and dad.

List of Papers

This thesis is based on the following original papers, which will be referred to by their Roman numerals (I-IV) in the text.

I. Glisovic T, Soderberg M, Christian K, Lang M and Raf-falli-Mathieu F (2003) Interplay between transcriptional and post-transcriptional regulation of Cyp2a5 expression. Biochem Pharmacol 65(10):1653-1661.

II. Christian K, Lang M, Maurel P and Raffalli-Mathieu F

(2004) Interaction of heterogeneous nuclear ribonucleopro-tein A1 with cytochrome P450 2A6 mRNA: implications for post-transcriptional regulation of the CYP2A6 gene. Mol Pharmacol 65(6):1405-1414.

III. Christian KJ, Lang MA and Raffalli-Mathieu F (2008) In-

teraction of hnRNP C1/C2 with a novel cis-regulatory ele-ment within p53 mRNA as a response to cytostatic drug treatment. Mol Pharmacol. Feb 22 [E-pub ahead of print]

IV. Christian KJ, Raffalli-Mathieu F, and Matti A. Lang (2008) hnRNP C1/C2 represses the expression of human p53 via two distinct mechanisms. (Manuscript)

Contents

Introduction...................................................................................................13 The Importance of Gene Regulation ........................................................13 The Anatomy of the mRNA Molecule .....................................................13 Post-transcriptional Gene Regulation.......................................................15

The role of mRNA binding proteins in gene regulation ......................16 mRNA turnover ...................................................................................17 Protein activity control ........................................................................20

Cellular Response to DNA Damage.........................................................21 Physical DNA Damage contra Effects Upon RNA Polymerase II Dependent Transcription .....................................................................22

The hnRNP Proteins: Definition and Function ........................................24 hnRNP A1 and hnRNP C1/C2 .................................................................24

Structure...............................................................................................25 Subcellular Localization ......................................................................26 Known Target Genes ...........................................................................27 The Fate of hnRNP A1 and C1/C2 During Apoptosis.........................29 The Expression of hnRNP A1 and C1/C2 in Cancer...........................29 Evidence for hnRNP C1/C2 in DNA damage response pathways ......31 Telomere biogenesis ............................................................................31 Control of hnRNP A1 and hnRNP C1/C2 Protein Levels and Binding Activity. ...............................................................................................32

Cytochrome P450 2A5/2A6; Function, Expression, and Substrate Metabolism...............................................................................................34

The Regulation of Cyp2A5/2A6...........................................................35 The role of hnRNP A1 in the expression of cytochrome P450 2A5 (Cyp2a5) ..............................................................................................35

p53............................................................................................................36 Background..........................................................................................36 The Structure of p53 ............................................................................36 The Cellular Function of p53...............................................................37 p53 Dependent Apoptosis....................................................................38 Activation of p53 Response.................................................................39

Aims..............................................................................................................41 General Aims.......................................................................................41

Specific Aims ......................................................................................41

Materials and Methods..................................................................................42 Cell Culture ..............................................................................................42

Culture of HepG2 and HeLa cells (Papers II-IV). ...............................42 Isolation and treatment of primary human hepatocytes (Papers II and III) ........................................................................................................42 Animals (Paper I).................................................................................43

Reporter Gene Construction and Transfection .........................................43 Cyp2a5 (Paper I)..................................................................................43 Human p53 (Paper III).........................................................................44 Transient transfection (Papers I-IV) ....................................................44 Site Directed Mutagenesis ...................................................................44

Preparation of Radioactive RNA Probes..................................................45 Paper I (CYP2A5) ...............................................................................45 Paper II (CYP2A6) ..............................................................................45 Human p53 (Paper III).........................................................................45

RNA-protein Interaction Analysis............................................................46 UV Cross-Linking (Papers I-IV). ........................................................46 Partial Proteolysis of the RNA/Protein Complexes (Paper II).............46 Immunoprecipitation (Paper II-III)......................................................46

Competition Assays..................................................................................47 CYP2A6 (Paper II) ..............................................................................47 Human p53 (Paper III).........................................................................47

Poly(A) tail Length Analysis....................................................................47 Computational Analysis of Biological Sequences ...................................48

RNA secondary structure analysis (Papers II-III)................................48 Alignment of the 3’ UTR from CYP2A5 and CYP2A6 (Paper II)......48

Quantitation of mRNA Levels .................................................................48 Quantitative real time PCR (Paper IV) ................................................48 Northern blot (Paper I).........................................................................49 Semiquantitative RT-PCR (Paper II) ...................................................49

Protein Analysis .......................................................................................50 Whole cell protein extract preparation (Paper IV)...............................50 Cytoplasmic and nuclear protein extract preparation (Papers I-III) ....50 Western blot assay ...............................................................................50

Electrophoretic Mobility Shift Assay (Paper I)........................................51 Statistical Analysis ...................................................................................51

Results...........................................................................................................52 Transcriptional and Post-transcriptional Processes Controlling the Expression of Murine Cyp2a5 are Linked via hnRNP A1. ......................52

The Subcellular Localization and Binding Activity of hnRNP A1 is Affected by the Transcriptional State of the Cell (Paper I). ................52

hnRNP A1 Interacts With the Proximal Promoter of Cyp2a5 (Paper I).............................................................................................................52 The Transcriptional and Post-transcriptional Regulation of the Murine Cyp2A5 Gene is Linked Through the Multifunctional Protein hnRNP A1 (Paper I). ........................................................................................55

The Human CYP2A6 Gene is Regulated Post-transcriptionally in a Manner Similar to that of the Murine Cyp2a5. ........................................56

The 3’ UTR of the Human CYP2A6 mRNA Contains Two Regions of High Similarity to the Mouse CYP2A5 3’ UTR (Paper II). ................56 hnRNP A1 Binds to the 3’ UTR of CYP2A6 mRNA (Paper II) .........58 The CYP2A6 mRNA is Post-transcriptionally Stabilized in a Manner Similar to the Mouse Gene (Paper II). .................................................58

The Tumor Suppressor p53 is Down-regulated by hnRNP C1/C2 via two Alternate Mechanisms (papers III-IV). ....................................................60

DNA Damaging Agents and Interruption of Transcription Cause a Massive Increase in Binding Activity of hnRNP C1/C2 Towards p53 mRNA (Paper III). ...............................................................................60 The Cytoplasmic Levels and Binding Activity of hnRNP C1/C2 are Induced by Short term Act D Treatment, and Then Reduced During Apoptosis (Paper III-IV)......................................................................63 Mapping of the hnRNP C1/C2 Binding Sites (Paper III) ....................64 The Function of the hnRNP C1/C2 Binding Sites on p53 mRNA (Papers III-IV) .....................................................................................66 A Working Model of hnRNP C1/C2 Dependent Regulation of Cell Survival (Paper III and IV). .................................................................70

Conclusions...................................................................................................73

Acknowledgements.......................................................................................75

Abstract .........................................................................................................77

Populärvetenskaplig Sammanfattning...........................................................78

References.....................................................................................................79

Abbreviations

aa Amino acid(s) Act D Actinomycin D ARE AU rich element bp Base pairs cAMP Adenosine 3’,5’-cyclic monophos-

phate Cap 5’ 7-methylguanosine cap CTD Carboxy-terminal domain CYP Cytochrome P450 enzyme Cyt Cytoplasm(ic) compartment DAN Deadenylation 3’ to 5’ exonuclease DDR DNA damage repair DRB 5,6-dichloro-1-beta-d-ribofuranosyl-

benzamidole DS Double strand(ed) DSB Double strand break hnRNP Heterogeneous nuclear ribonucleo-

protein HSP Heat shock protein IRES Internal ribosome entry site kDa Kilodalton Mut Mutated, mutation(s) NES Nuclear export signal NLS Nuclear localization signal NMD Nonsense mediated decay NRS Nuclear retention sequence nt Nucleotide(s) Nuc Nuclear compartment poly(A) tail Polyadenosine monophosphate tail Quantitative RT-PCR Quantitative real time PCR RBD RNA binding domain RNA pol RNA polymerase RNP Ribonucleoprotein RRM RNA recognition motif RT Reverse transcriptase RT-PCR Reverse transcriptase PCR

RTS RNA transport signal PARP Poly(ADP-ribose) polymerase PCR Polymerase chain reaction SEM Standard error of the mean SDS-PAGE Sodium dodecylsulfate polyacryla-

mide gel electrophoresis snRNP Small nuclear ribonucleoprotein SS Single strand(ed) UTR Untranslated region UVXL Ultraviolet crosslinked(ing) WT Wild type (non-mutated)

13

Introduction

The Importance of Gene Regulation All somatic cells in our body contain identical genetic information. Yet, the cells isolated from different tissues are not identical in function, and respond to stimuli such as hormones and growth factors in a highly divergent fashion. These diverse cell types contain the same genes, but differ in which of these genes are switched on or off. Some gene expression changes are more or less permanent, such as those seen during differentiation, and others are dy-namic. The most extreme example of this is the cancer cell, which via muta-tions in our DNA succeeds in hijacking control of gene expression. The genes that display altered expression in cancer are often responsible for cell division and apoptosis, leading in uncontrolled cell division.

Gene regulation is a complex process. It is critical for the survival of the cell to increase or decrease expression of specific genes in response to exter-nal or internal stimuli, thus responding to changes in the environment. In-creasing or decreasing transcription of specific genes alters the level of mRNA for that gene, and in turn the level of the protein product. This view of gene regulation stems from the view of “one gene, one protein”. However this idea is simplistic, as many other processes other than transcription typi-cally regulate the end amount and activity of the protein product derived from a gene.

The Anatomy of the mRNA Molecule It is important to understand the makeup of the mRNA molecule in order to understand the many facets of eukaryotic gene regulation. Generally, the mRNA molecule contains several functional domains, as shown in Fig. 1. These domains are central to the proper function of the transcript as a “blue-print” for protein synthesis. At the 5’ most end, the mRNA contains a 7-methylguanosine cap. The purpose of this cap is to not only stabilize the

14

mRNA against exonuclease degradation, but it is also central in binding translation factors needed for initiation of cap-dependent protein synthesis. Following the 5’ cap is the 5’ untranslated region (5’ UTR). The 5’ UTR often contains regions of high secondary structure consisting of double stranded (DS) RNA. In some genes, especially those related to cell cycle or apoptosis, a specialized region known as an Internal Ribosome Entry Site (IRES) exists within the 5’ UTR. The cis sites in the 5’ UTR, and the trans-acting factors that bind them, often control translational processes such as initiation or choice of alternative start codons, although they may affect mRNA stability as well. Following the 5’ UTR regulatory region is the cod-ing region. This region begins with one or more start codons, and ends with one or more stop codons signifying the end of the translated sequence. It is from this region that the “blueprint” for the protein product of the gene is read by the ribosome. After the stop codon, we find the 3’ UTR, another regulatory region often containing a high degree of secondary structure. The cis sites and the RNA binding proteins found to interact with this region often control mRNA stability, but may control translational or other gene regulatory processes as well. Finally, we find the poly(A) tail, a region of several hundred to several thousand poly-riboadenosine monophosphate nucleotides. The poly(A) tail is extremely important for both mRNA stabil-ity and normal translation.

In summary, the RNA transcript contains not only the codon information needed for translation, but also often contains cis-regulatory elements within the mRNA. In addition, the composition of proteins bound to these cis ele-ments reflects cellular state. These cis-acting sites, most often located in the 5’ or 3’ UTR can control the mRNA turnover, export, stability, and transla-tion of specific gene transcripts. It is also important to recognize that the mRNA molecule is not linear (as the simplified Fig. 1 depicts) in vivo, but that proteins binding to the 3’ UTR and poly(A) tail have a high degree of interaction with the 5’ end of the molecule. Therefore, in reality, the mRNA molecule is “looped” upon itself, in a circular fashion, allowing, for exam-ple, factors binding in the 3’ end of the molecule to affect translation of the mRNA transcript.

15

Coding RegionAUG

5’ UTRAAAA(n)Cap UAA

3’ UTR

mRNA binding proteins

endonuclease

DANIRES

5’ 7-methylguanosine cap3’ poly(A)-tail

CBPPAB

Fig. 1 The anatomy of a typical eukaryotic mRNA molecule. The locations of the 5’ 7-methyl-guanosine cap (Cap), the 5’ untranslated regulatory region (5’ UTR), the coding region, the 3’ untranslated regulatory region (3’ UTR), and the poly-adenosine monophosphate tail (3’ poly(A) tail) are given. Also depicted are the 3’ to 5’ deadenylation exonuclease (DAN), and examples of regulatory mRNA binding proteins binding to the 5’ and 3’ UTR. These binding proteins may affect the local-ization, stability, or translation of the mRNA. The general mRNA binding proteins, cap binding protein (CBP) and poly (A) tail binding protein (PAB) are shown. Regulatory elements that may or may not exist in any given mRNA are also de-picted, such as an internal ribosome entry site (IRES) in the 5’ UTR, and an endonu-clease sensitive site within the 3’ UTR. Note that in reality, the mRNA molecule is not linear, and exists in a circular form with interaction between the 3’ and 5’ re-gions of the molecule. In addition, it is covered in mRNA binding proteins rather than existing in a bare state as the simplified figure suggests.

Post-transcriptional Gene Regulation

Processes occurring after transcription, post-transcriptional gene regula-tion, significantly affect the levels of protein products, and in some cases, such as alternative splicing or alternative translation, even the actual protein product produced from the gene. The main points of eukaryotic gene regula-tion are depicted in Fig. 2.

Post-transcriptional regulation occurs by definition after the gene is tran-scribed by RNA polymerase II (RNA pol II), forming a pre-mRNA mole-cule. In eukaryotes, the pre-mRNA is subject to a large number of modifica-tions during and after its initial formation. These include the addition of a 5’ 7-methylguanosine cap (cap), splicing, and addition of the poly(A) tail (Fig. 2 B). Further, the mature mRNA molecule must be successfully exported from the nucleus to the cytoplasm, and translated into protein via the ri-bosomes (Fig. 2 D and F). Because of post-transcriptional regulation, the expression of a gene does not always follow the previous adage that protein levels follow those of the corresponding mRNA. Although at first glance post-transcriptional regulation appears to be a large waste of cellular energy because many RNAs and proteins are made and then simply broken down via these pathways, the benefits to the cell are enormous. By using this form

16

of gene regulation, the cell can “fine tune” gene expression, create multiple protein products from a single gene, as well as initiate necessary changes in gene expression in a much quicker fashion than could possibly be done by transcriptional regulation alone.

Consequently, many genes that are highly post-transcriptionally regulated have important roles in cell cycle and stress response, and are therefore en-sured of fast response time for gene expression.

In the work presented in this thesis, the regulation of two genes and their dependence on the RNA binding proteins hnRNP A1 and hnRNP C1/C2 respectively, were explored in depth. The model genes chosen for study were human cytochrome P450 enzyme Cyp2a5/CYP2A6 and the tumor sup-pressor p53, both highly stress responsive genes, and both controlled to a large extent by post-transcriptional processes.

��

Transcription

A.

��

��

5’UTR 3’UTRExon

Intron

��

5’Cap Poly(A)-Tail

Nuclear mRNA Degradation

C.

��

��

mRNA Export

D.

CytoplasmicmRNA Degradation

E.

��

Translation

F.

��

Ribosome

��

Protein

Protein Activity

G.

�

Protein Degradation

H.

Ubiquitin

Proteosome

Inactive mRNAInactive Protein

Fig. 2 The mechanisms controlling eukaryotic gene regulation. One particular gene may be controlled through several different mechanisms simultaneously. Nuclear processes include the RNA pol II dependent transcription of the pre-mRNA (A), RNA processing by 5’ capping, intron removal, and addition of the poly-(A) tail (B), and degradation of improperly spliced or nuclear retained transcripts via the exosome (C). Once the mRNA is exported from the nucleus to the cytoplasm (D), it becomes subject to cytoplasmic processes such as translation on the ribosome (F), and mRNA degradation mechanisms through the deadenylating nuclease (DAN), NMD pathway, or specific endonucleases (E). The protein product is often subject to post-translational covalent modifications such as phosphorylation, acetylation, sumoylation, or methylation, which can affect the activity or stability of the protein (G). Some proteins, such as p53, are specifically regulated by the addition of the small (76 aa) peptide ubiquitin, which targets the protein for destruction in the pro-teosome (H). Of note, the multifunctional hnRNP proteins can control many of these processes.

17

The role of mRNA binding proteins in gene regulation mRNA binding proteins play a central role in the post-transcriptional

regulation of gene expression. Many of these specialized proteins bind RNA transcripts in a sequence specific fashion, most often at the 5’ or 3’ UTR. They hide active cis sites, recruit other proteins to a site, or affect RNA sec-ondary structure.

For example, by binding the pre-mRNA molecule near 5’ or 3’ splice sites, and hiding or recruiting the splicing machinery to these sites, they can control alternative splicing thereby affecting the sequence of the final protein product. Control of alternative splicing is important for tissue specific differ-ences in gene expression, and for induction of alternate products caused by external or internal stimuli.

In addition to their role in splicing, RNA binding proteins serve as a “proof” that the splicing process has been successful, thereby releasing the spliced mRNA for export. This is accomplished by a collection of proteins called the exon junction complex (EJC) which are deposited 20-25 nt up-stream of the exon-exon junction. This process ensures that damaged, aber-rantly spliced, or truncated transcripts are degraded in the nucleus via the exosome [1].

The control of mRNA turnover and therefore the steady state concentra-tions of specific mRNAs is a highly regulated process, relying on RNA bind-ing proteins. Therefore, differences in sensitivity of different mRNA species are highly dependent upon the primary sequence, and in turn the RNA bind-ing proteins present on the molecule.

By binding the RNA molecule on specific cis sites, RNA binding proteins can recruit endonucleases, hide endonuclease sensitive sites, or stabilize the binding of other more general RNA binding proteins such as PAB (poly(A) binding protein). The RNA binding proteins can drastically change the sta-bility and secondary structure of the RNA molecule.

mRNA turnover The transcript is often subject to a large amount of turnover in the cell, in

both the nucleus and cytoplasm, thus ensuring that gene expression is dy-namic. The steady-state level of mRNA for any gene is determined by the balance of ongoing transcription and degradation processes. Several mRNA degradation pathways exist, in both the nuclear and cytoplasmic compart-ments. As previously mentioned, the EJC mediates nuclear decay of tran-scripts that are improperly spliced. In addition, the same proteins are also of great importance for mRNA surveillance the cytoplasm. Nonsense mediated mRNA decay (NMD) is a cytoplasmic process which allows for the recogni-tion and destruction of faulty transcripts that lead to truncated protein prod-

18

ucts, caused by, for example, premature stop codons. Normally, the EJC complexes are “stripped” from the mRNA molecule during the first round of translation. Those mRNA molecules with EJC complexes remaining close to the 5’ end due to premature translational termination are deemed to be ab-berant and are degraded [2]. Besides NMD mediated decay, there are other pathways of cytoplasmic mRNA turnover as well. Once the transcript reach-es the cytoplasm, deadenylation dependent decay through the deadenylating nuclease (DAN) constantly degrades the poly(A) tail (Fig. 1). Once the poly(A) tail reaches approximately 20-30 nt, rapid removal of the 5’ cap, followed by 5’�3’ and 3’�5’ non-specific exonuclease dependent degrada-tion of the transcript takes place [3]. Interestingly, mRNA which is actively translated is less susceptible to DAN mediated decay, linking the two proc-esses, and ensuring a longer half life for actively translated transcripts [4]. Another, more specific mechanism for mRNA degradation in the cytoplasm is through specific endonucleolytic cleavage. This type of cytoplasmic de-cay takes place through specific endonucleases, which recognize nucleotide sequences on the transcript. These sequences are most often located the in the 5’ or 3’ UTR regulatory regions of the mRNA (see Fig. 1). Once the transcript is cleaved, decapping followed by rapid decay by 5’�3’ and 3’�5’ exonucleases takes place. This method of mRNA degradation is often employed by the cell for genes required to be expressed transiently and rap-idly, such as proto-oncogenes, cytokines, or genes important for the cell cycle [5]. Proteins bound to cis sites in the 5’ or 3’ regulatory region often respond to cellular signaling by hiding endonuclease sensitive sites, recruit-ing specific endonucleases to these sites, or changing secondary structure of the mRNA molecule to expose such sites, adding a precise level of mRNA stability control.

Translational control The translation of the mRNA transcript to protein is a tightly controlled process. There are two types of translation in eukaryotes; normal, also called cap-dependent translation, and IRES-dependent translation. Cap-dependent translation depends upon the 5’ 7-methylguanosine cap, and cap binding protein (CBP) to attract the translational machinery. This is done by the recognition of the 5’ cap by the eukaryotic intiation factor 4E (eIF4E), followed by the association of factors eIF4A, eIF4B, and eIF4G, which con-trol secondary structure and recruit the small (40S) ribosomal subunit. Once the small ribosomal subunit has bound, it begins to migrate or “scan” in a 5’ to 3’ direction along the transcript, searching for the initiator codon. Once the start codon is found, the initiator tRNA with its attached methionine amino acid and the large (60S) ribosomal subunit assembles onto the small subunit and translation is begun [6].

Of interest for potential regulation of this process, it is known that regions of highly ordered secondary structure, such as that found in some 5’ UTRs,

19

impede the scanning of the small ribosomal subunit [7]. This implies that mRNA binding proteins which affect secondary structure, or form steric hindrance in the 5’ UTR have the potential to modulate the initiation of cap-dependent translation. By binding the mRNA molecule, RNA binding pro-teins may prevent translational initiation, cause premature translational ter-mination, recruit the translational machinery, or even steer translation to-wards alternative start sites.

During cellular stress, the translation of housekeeping genes is down-regulated, while the translation of stress related genes is up-regulated. This is the result of signaling cascades which result in the phosphorylation of many general translation factors such as eIF4B and eIF4B-BP, and lead to the sub-sequent down-regulation of cap-dependent translation [8]. Simultaneously, IRES elements on the mRNA allow for an alternate route of translational initiation for a specific subset of mRNAs, such as those involved in cell cy-cle and control of apoptosis [8-10]. These IRES elements are most often found within the 5’ UTR, but may also be found in the coding region, and consist of an ordered secondary structure (see Fig. 1 and 3). In contrast to cap-dependent translation, eIF4E plays no role, as eIF4G interacts with the IRES sequence itself. No scanning of the small ribosomal subunit takes place. A comparison of cap-dependent and IRES-dependent initiation of translation is illustrated in Fig. 3.

Importantly, hnRNP proteins have shown themselves to be trans-acting factors involved in translational control of several genes. Most of the evi-dence suggests that they most often function as IRES suppressors or enhan-cers, but in some cases may affect the choice of alternate downstream start codons [11, 12].

20

Coding RegionAUG AAAA(n)Cap UAA

3’ UTR

CBP

Coding RegionAUG

5’ UTR

AAAA(n)Cap UAA

3’ UTR

IRES

eIF4E

eIF4A, 4B, 4G

40S Ribosomal Subunit

5’ to 3’ scanning

40S

40S40S

eIF4G

40S

40S

A.

B.

Fig. 3. A comparison between cap-dependent (A), and IRES-dependent (B) transla-tion initiation mechanisms. Cap-dependent translational initiation is dependent upon the eukaryotic initiation factor (eIF) 4E interaction with the 5’ cap binding protein (CBP). Following this, the factors eIF4A and B affect RNA secondary structure, and eIF4G serves as a bridge to bring in the small (40S) ribosomal subunit, which then proceeds to migrate (scan) in a 5’ to 3’ direction until it finds the start codon. The initiation of protein synthesis from the IRES sequence is not dependent upon eIF4E, but instead upon eIF4G, which interacts either directly or through adaptor proteins with the IRES sequence. The eIF factors do not interact with the 5’ cap, and no scanning of the mRNA by the small ribosomal subunit takes place. mRNA binding proteins (such as hnRNPs) may interfere with the binding of, or help to recruit, one or more of these initiation factors. In addition, secondary structure or steric hindrance caused by these proteins can potentially prevent the scanning of the small ribosomal subunit.

21

Protein activity control Finally, the end protein products within the cell are subject to a variety of

modifications such as phosphorylation, acetylation and ubiquitination, result-ing in dramatic changes of protein function, binding activity, or stability (Fig. 2 G and H). Changes in phosphorylation state, for example, is among the most common covalent modifications observed on proteins in response to cellular signaling pathways. These covalent modifications often change functional state drastically, for example by raising or lowering enzymatic activity. One well known example is the cyclin dependent kinase (CDK) proteins, which rely upon phosphorylation changes to control the cell cycle. This and other covalent changes such as methylation, acetylation, and su-moylation can affect the subcellular localization, and function of individual proteins. These changes in state allow for a quick response to external or internal stimuli.

One covalent modification that has shown great importance in gene regu-lation is the ubiquitination of proteins. Ubiquitin is a small, 76 aa peptide that is specifically attached to proteins destined to be degraded by the pro-teosome. The interaction of proteins with ubiquitin ligases is specific, and drastically downregulates the protein stability of the target. Of importance in this thesis, the interaction of the HDM-2 (human double minute 2) protein with p53 leads to its ubiquitination and subsequent destruction in normal cells [13]. This mechanism keeps p53 levels low until it is needed, and al-lows for the extremely fast induction of the protein that would not otherwise be possible by standard transcriptional means.

The Cellular Response to DNA Damage It is of utmost importance for the cell to be able to detect and respond to diverse types of DNA damage, including single strand breaks (SSBs) double strand breaks (DSBs) gaps, nicks, bulky lesions and inter and intra-strand cross-links. The ability of the cell to quickly respond to DNA damage en-sures both the continued survival of the cell, and the prevention of mutations which could potentially lead to carcinogenesis. Generally, the downstream stress induced target proteins function fall into four categories; repair of DNA damage, cell cycle control, dealing with reactive oxygen species, or apoptotic control.

The process is intricate, and many different kinases, mediators, adaptors, and downstream targets are involved [14, 15]. In general, two main kinases are responsible for the majority of DNA damage signaling; the ATM and ATR kinases. These kinases sense physical DNA damage either directly, or

22

in association with other sensory mediators [16]. Once activated, they initi-ate a kinase cascade response through the downstream kinases Chk1 and Chk2, which leads to activation of proteins which help to repair the damage, alter ongoing DNA replication, or halt cell cycle progression [17]. The ATM kinase is required for the response to DSBs, and the ATR kinase mainly controls response to stalled replication forks, although a large amount of crosstalk goes on between the two pathways to cover other types of DNA damage [17-21]. Although many downstream response enzymes and pro-teins are activated by DNA damage, the specific genes that are induced de-pend upon the type of stress sensed by the cell [15].

Although great strides have been made in the study of DNA damage re-sponse, many questions remain unanswered. For example, stimuli which cause no discernable DNA damage, such as osmotic shock [18], or the inter-ference with ongoing global transcription, lead to the activation of many stress responsive genes, such as p53 [22, 23]. The processes linking stress signals that do not cause physical DNA damage to their downstream targets are a subject of continued research.

Physical DNA Damage contra Effects Upon RNA Polymerase II Dependent Transcription This thesis investigates role of proteins hnRNP A1 and hnRNP C1/C2 in the expression of two genes during conditions of cellular stress involving reduc-tion of RNA pol II-dependent transcription.

Transcriptional disturbance is often encountered during treatment with cy-tostatic drugs that damage DNA such as cis-platinum diamine dichloride (cisplatin) [24]. These drugs are known to interfere with transcription through DNA adduct formation, DNA strand breaks, and also lead to the phosphorylation, ubiquitination, and subsequent destruction of RNA pol II [25]. In principle, most drugs which damage DNA will cause transcriptional disturbances to a varying degree, especially in higher doses. Thus, under-standing cellular stress response related to transcriptional disturbance may be critical to understanding the overall response of the cell to genotoxic agents.

One drug used for the study of these processes is Actinomycin D (Act D). Act D is a potent transcriptional inhibitor used in the treatment of cancer [26, 27]. It is a polypeptide antibiotic produced by a soil bacterium of the genus Streptomyces (Fig. 4). Act D interferes with transcription through its partial intercalation in the DNA, thus preventing elongation [28]. The doses used in the studies included in this thesis are known to fully prevent RNA pol II- dependent cellular transcription [29], yet not cause discernable physical DNA damage [30]. Thus, the use of Act D or other transcriptional inhibitors allows the study of stress induced gene regulation in a unique way; largely

23

absent of physical DNA damage, but causing cellular stress through interfer-ence with transcription.

The molecular mechanisms involved in controlling the cellular response to decreases in global transcription are not fully understood. However, the studies included in this thesis suggest that mRNA binding proteins in the hnRNP family may be of great importance.

Actinomycin D

Fig. 4 The molecular structure of the transcriptional inhibitor actinomycin D (Act D).

Copyright notice: I, the copyright holder of this work, hereby publish it under the following licenses: Permission is granted to copy,

distribute and/or modify this image under the terms of the GNU Free Documentation license, Version 1.2 or any later version published by

the Free Software Foundation; with no Invariant Sections, no Front-Cover Texts, and no Back-Cover Texts. A copy of the license can be

found at the following http address entitled "GNU Free Documentation license".

http://commons.wikimedia.org/wiki/Commons:GNU_Free_Documentation_License

24

The hnRNP Proteins: Definition and Function

The pre-mRNA/mRNA transcript does not exist natively in a bare state, but is instead covered in mRNA binding proteins that profoundly affect the transcript’s structure function, and fate [31]. The RNA transcripts, together with these proteins are collectively known as ribonucleoprotein complexes (RNPs). The protein components of these RNPs which are not stable com-ponents of other RNP complexes, (such as snRNPs) are known as heteroge-neous nuclear ribonucleoproteins (hnRNPs) [32, 33].

The composition of the protein/RNA complex is not static. Consequently, some proteins disassociate, others bind, some follow the transcript on its travels from the nucleus to the cytoplasm, while still others remain trapped within the nucleus. The binding activity of the hnRNP proteins towards the transcript is affected both by previous events, such as splicing, and availabil-ity of specific binding sequences on the mRNA. In addition, intracellular signaling pathways result in changes in binding activity of hnRNP proteins towards the transcript, often through changes in phosphorylation state [34, 35].

The family comprising the hnRNP proteins is both large and diverse. Some 20 major proteins, designated from A1 (34 kDa) to U (120 kDa), have been identified in human cells [31]. Their cellular functions are wide rang-ing, with roles in both the nuclear and cytoplasmic compartment. Often, one and the same hnRNP will perform several cellular functions, leading to term “multifunctional proteins”.

Research into hnRNPs has revealed roles in the regulation of gene expres-sion at both transcriptional and post-transcriptional levels [36-39]. Further, they have been shown to play important roles in splicing of proto-oncogenes, telomere biogenesis, DNA repair, and cell signaling, thus suggesting their importance for tumor development and progression [40, 41].

hnRNP A1 and hnRNP C1/C2 Of the hnRNP species first isolated from the nucleoplasm of HeLa cells, hnRNP C1/C2 and hnRNP A1 are among the most abundant [32, 42]. Both proteins are broadly distributed in the nucleoplasm, and are important in mRNA biogenesis [32]. They are among the hnRNPs designated as the “core hnRNP” proteins. Core hnRNPs are thought to help package nuclear RNA into so called 40S particles comprised of about 700 nt segments [43, 44]. In addition to the above role as “RNA packaging proteins”, hnRNP A1 and hnRNP C1/C2 play roles as specific mRNA and DNA binding proteins, and

25

regulate the expression of genes by acting as splicing or transcription factors in the nucleus, and by modulating mRNA stability and translation in the cytoplasm [12, 38, 39, 41, 45-47].

Structure Both proteins share a similar modular structure, consisting of one or more N-terminal RNA binding domains, and a C-terminal regulatory domain. The 320 aa long, 34 kDa hnRNP A1 protein contains two RNA binding domain (RBD) motifs (also known as RRM), in the amino terminus and one RGG box (Arg-Gly-Gly) motif RNA binding domain in the glycine rich carboxyl terminus. The C- terminus of hnRNP A1 is also the location of the combined nuclear localization (NLS) and nuclear export signal (NES) sequence known as M9.

In contrast, the 306 aa long hnRNP C1/C2 contains only one RRM do-main in its N-terminus [31], while its negatively charged C-terminus appears to be the site of phosphorylation activity which regulates its binding to mRNA [48] and the site of a nuclear export signal sequence (NES). This is also the site of an oligomerization domain, controlling C1-C1 interaction [49]. A 78 aa nuclear retention sequence (NRS) is located in the central do-main of hnRNP C [50]. The primary domains of the hnRNP A1 and hnRNP C1/C2 proteins are illus-trated in Fig. 5.

NLSN C

Amino acid 15 89 106 180 196 268 305 320

RRM I

UP1 Fragment C-Terminal Domain

hnRNP C1

hnRNP A1

RRM II M9RGG

N C

Amino acid 16 87 165 306

RRM

C-Terminal Domain

NESNRS OM

Fig. 5 The major functional domains of hnRNP C1 and hnRNP A1. Both proteins share a similar structure. hnRNP C1: The protein contains one RRM motif RNA binding domain in the N-terminus, followed by a nuclear retention signal (NRS) which keeps it within the nucleus during most conditions. The C-terminal regula-

26

tory domain is the site of phosphorylations of the protein, and also contains a nu-clear export signal (NES) and an oligomerization motif (OM). hnRNP A1: There are two RRM motif RNA binding domains in the N-terminus. A naturally occurring fragment of hnRNP A1 (UP1) is formed from the first 196 residues. The C-terminal domain contains one auxiliary RGG box motif RNA binding domain, and the com-bined nuclear import-export signal known as M9.

Splice variants Although an alternatively spliced verision of hnRNP A1 exists, hnRNP A1b, it appears to be a only minor variant comprising about 5% of the total con-centration of hnRNP A1 species [51], and its function is unknown.

The hnRNP C proteins consist of two alternatively spliced variants; hnRNP C1, 41 kDa in size, and the 13 aa larger hnRNP C2 (43 kDa) [52]. The hnRNP C2 isoform comprises about 25% of the total amount of hnRNP C in the cell, and the two isoforms bind RNA cooperatively as heterotetram-ers in the ratio C1(3)C2 [53].

Subcellular Localization The hnRNP A1 protein contains both nuclear import and export signals with-in its 38 amino acid M9 carboxy-terminal domain, and is a typical example of a “shuttling” hnRNP protein [54, 55]. Diverse stress conditions, including UV light, osmotic pressure changes, and inhibition of transcription cause a dramatic translocation of hnRNP A1 from the nuclear to the cytoplasmic compartment and a simultaneous increase in its phosphorylation [56, 57]. Of note, the subcellular localization of hnRNP A1 appears to be dependent upon the transcriptional state of the cell. During active transcription in early mouse embryos, for example, hnRNP A1 is localized to the nucleus. In con-trast, when transcription is not ongoing, it is evenly distributed between the nucleus and cytoplasm [58]. Further, transcriptional inhibition of RNA pol II is a strong trigger for nucleo-cytoplasmic translocation of the protein [59], thus suggesting that hnRNP A1 may change subcellular localization depend-ing upon where it is needed in the cell.

The hnRNP C protein contains both a nuclear export signal and nuclear retention signal (NRS), and in contrast to hnRNP A1, there is evidence that the retention signal overrides the nuclear export signal during most condi-tions, effectively keeping hnRNP C nuclear [50]. However, recent research suggests that there are some cellular conditions during which hnRNP C1/C2 may play a prominent cytoplasmic role. The work of Lee et al. [60] indi-cates that during apoptotic conditions induced by tumor necrosis factor alfa (TNF-�) or phorbol-12-myristate-13-acetate (PMA), hnRNP C is actively exported to the cytoplasm via activation of Rho associated kinase (ROCK).

27

Further, evidence suggests that the hnRNP C proteins are released into the cytoplasm upon nuclear membrane breakdown in late G2-M phase of the cell cycle [12]. Several cytoplasmic gene regulation targets for hnRNP C1/C2 regulation have recently been demonstrated, including translational control of the proto-oncogene c-myc and the antiapoptotic protein XIAP, strongly suggesting a cytoplasmic role for hnRNP C in addition to its nuclear role, at least during certain cellular conditions [12, 47].

Known Target Genes

These two hnRNP proteins can bind both DNA and RNA, and have surpris-ingly large and diverse number of specific target genes in both the nuclear and the cytoplasmic compartments. For the purpose of this thesis, only those with direct bearing on the work presented here will be discussed in more detail. However, it should be noted that the targets for these hnRNP proteins fall into several categories, including targets where the hnRNP A1 or hnRNP C proteins act as splicing factors, transcription factors, trans-acting factors affecting mRNA stability or translation, and finally, direct protein-protein interations. Many of the presently known targets for hnRNP A1 and hnRNP C1/C2 are listed in Table 1.

28

hnR

NP C

1/C

2 In

tera

ctor

s/Ta

rget

s

Inte

ract

ion

Targ

et

Targ

et F

unct

ion

Func

tion

of In

tera

ctio

n

Mec

hani

sm

Refe

renc

e(s)

Chr

omat

in (D

NA)

Bind

ing

Resp

onse

to D

NA

dam

age

? hn

RNP

C1/

C2

DN

A bi

ndin

g

activ

ity

[81]

Vita

min

D r

ecep

tor

Prom

oter

N

ucle

ar r

ecep

tor

VD

R Tra

nscr

iptio

n

Com

pete

s w

ith

RX

R- Bi

ndin

g at

VD

R pro

mot

er.

[38]

XIA

P m

RN

A

In

hibi

tor o

f apo

ptos

is

XIA

P Tr

ansl

atio

n

Bind

ing

to X

IAP

mR

NA

on

IRES

.

[47]

Hum

an T

elom

eras

e

RN

A

Telo

mer

e bi

ogen

esis

/

Can

cer

? Bi

nds

Telo

mer

ase

RN

A co

mp

o-

nent

[8

7]

Am

yloi

d Pr

ecur

sor

Prot

ein

(AP

P) m

RN

A

Plaq

ues:

Alz

heim

-

ers/

Dow

ns S

yndr

ome

AP

P

mR

NA

stab

iliza

tion

(3

’UTR

) [3

9]

Uro

kina

se m

RNA

Pl

asm

in g

ener

atio

n-

Extr

avas

cula

r pro

teol

ysis

St

abili

zatio

n of

mR

NA

m

RN

A st

abili

zati

on

(3’U

TR)

[185

]

PARP

-1

DN

A da

mag

e re

spon

se.

Ap

opto

sis

? Pr

otei

n-Pr

otei

n in

tera

ctio

n [1

86]

Hum

an P

apill

oma

Viru

s-1

RN

A

Path

ogen

. Cer

vica

l

canc

er d

evel

opm

ent.

? Bi

nds

3’U

TR U

rich

ele

men

t [1

84]

DN

A-PK

Ku

antig

en

D

NA

dam

age

resp

onse

D

NA-

PK p

hosp

hory

late

s

hnR

NP C

1/C

2 Pr

otei

n-Pr

otei

n In

tera

ctio

n [8

2]

SUM

O li

gase

Sm

all u

biqu

itin-

like

Bind

ing

of h

nRNP

C1/

C2

to n

ucle

ic a

cids

SU

MO

on

lysi

ne K

237

[88]

c-m

yc m

RNA

Pr

oto-

onco

gen

e, tr

an-

scrip

tion

fact

or

c-m

yc tr

ansl

atio

n

Bind

ing

c-m

yc m

RN

A on

IRE

S.

[12]

hnR

NP A

1 In

tera

ctor

s/Ta

rget

s

Inte

ract

ion

Targ

et

Targ

et F

unct

ion

Func

tion

of In

tera

ctio

n

M

echa

nism

Re

fere

nce(

s)

Cyp

2A5

mR

NA

Xeno

biot

ic m

etab

olis

m/

Ox.

stre

ss r

espo

nse

Cyp

2A5

m

RN

A st

abili

zati

on

(3’U

TR)

[46,

115

]

PARP

-1

DN

A da

mag

e re

-

spon

se/A

pop

tosi

s

? Pr

otei

n-p

rote

in in

tera

ctio

n [1

86]

INK4

a lo

cus

(p16

INK4

a an

d

p14A

RF) p

re-m

RN

A

Cel

l cyc

le in

hib

ition

pr

efer

entia

l gen

erat

ion

of

the

p14(

ARF

) iso

form

Alte

rnat

ive

splic

ing

of tr

an-

scrip

t

[73]

I

scrip

tion

Poss

ible

incr

ease

d ub

iqui

tina

-[1

87]

Telo

mer

ic r

epea

ts,

telo

mer

ase

Telo

mer

e bi

ogen

esis

/

Can

cer

Telo

mer

es e

long

ated

Bi

nds

telo

mer

ic r

epea

ts/U

P1

inte

ract

s w

ith te

lom

eras

e

[84]

Hum

an c

-H-r

as p

re-

mR

NA

Onc

ogen

e, p

rolif

erat

ion

sign

al tr

ansd

ucti

on

Alte

rnat

ive

splic

ing

of

tran

scrip

t

Inte

ract

ion

with

intr

onic

si-

lenc

er

[41]

SUM

O li

gase

Sm

all u

biqu

itin-

like

? SU

MO

on

hnR

NP A

1

G

mR

NA

Stim

ulat

es a

deny

l cyc

lase

A

ltern

ativ

e sp

licin

g of

tran

scrip

t

Alte

rnat

ive

splic

ing

mak

es tw

o [4

5]

Fibr

obla

st g

row

th

fact

or 2

mR

NA

Prol

ifera

tion.

Gro

wth

Fact

or

FGF-

2

IRES

tran

slat

ion

[78

]

Hum

an A

paf-

1

mR

NA

Indu

ctio

n of

ap

opto

sis,

Form

atio

n of

ap

opto

som

e

Apa

f-1

IR

ES tr

ansl

atio

n [1

88]

[88]

Tabl

e 1.

A

sel

ectio

n of

cel

lula

r tar

gets

for h

nRN

P C1

/C2

and

hnRN

P A

1

29

The Fate of hnRNP A1 and C1/C2 During Apoptosis Apoptosis is a form of programmed, ordered cell death that is essential for development, homeostasis, and the protection of the organism against cancer [61, 62]. It is an intricate process, with many individual proteins involved, and is not fully understood. It is clear, however, that induction of apoptosis is a process that depends upon the balance of pro-apoptotic and anti-apoptotic signals from within and outside the cell. Once apoptosis is in-duced, the release of cytochrome c from the mitochondria results in a cas-cade of active aspartic acid specific cysteine proteases known as caspases. Initiator caspases, like caspase 9, cleave and activate downstream affector caspases, such as caspase-3 and 7 [63]. These affector caspases then target specific cellular proteins, resulting in typical phenotypical changes such as condensation of nuclei, and membrane blebbing [62].

The hnRNP C and hnRNP A1 proteins are targets of caspase-3 effector cysteine proteases [64]. In addition, hnRNP C1/C2 is a target of enzymes related to interleukin 1�-converting enzyme (ICE) [65]. ICE like proteases are active during apoptosis, and are known to target proteins involved in DNA repair processes, such as poly(ADP-ribose) polymerase (PARP) and DNA-dependent protein kinase [66].

As previously discussed, hnRNP C1/C2 appears to be actively exported from the nucleus to the cytoplasm upon early apoptotic stimulation with PMA or TNF-�, through the actions of the Rho associated kinase (ROCK). This kinase is known to be activated by RhoA GTP-ase, an enzyme known to affect cytoskeletal rearrangements during apoptosis [67]. The transloca-tion of hnRNP C1/C2 takes place prior to nuclear membrane breakdown, and caspase-3 activation, thus suggesting an early function in apoptosis.

The reason for the active regulation of both protein levels and subcellular localization of hnRNP A1 and hnRNP C1/C2 during apoptosis is unclear. However, it may serve a purpose in the specific regulation of apoptosis re-lated genes during the ongoing apoptotic process, and/or in preventing nor-mal mRNA biogenesis during these conditions.

The Expression of hnRNP A1 and C1/C2 in Cancer. The hnRNP family of proteins play many roles in regulating genes responsi-ble for cell proliferation, DNA repair, apoptosis, and telomere biogenesis [40]. Recent evidence indicates that both hnRNP A1 and hnRNP C1/C2 may play important roles in both carcinogenesis and tumor progression. These RNA binding proteins are over-expressed in diverse forms of cancer-ous tissues, suggesting either a direct role in, or a positive influence on, cell

30

proliferation. To date, hnRNP A1 is known to be over-expressed in cancer-ous tissues of the lung and colon, while hnRNP C1/C2 is over-expressed in cancerous lung and hepatocellular carcinoma [68-70]. Further, down-regulation of hnRNP C1/C2 via siRNA in Hela cells increases their sensitiv-ity to various chemical agents, such as hydrogen peroxide, halogenated de-oxyuridines and the topoisomerase II inhibitor ICRF-193, thus suggesting a role for hnRNP C1/C2 in cell survival after challenge with toxic agents [71]. The known cellular targets (Table 1) for hnRNP A1 and hnRNP C1/C2 strongly suggest a direct involvement of these proteins in cancer develop-ment and progression.

Cell proliferation, cell cycle, and apoptosis targets The levels of hnRNP A1 are not constant in human diploid fibroblasts, but instead decrease after mid-passage, and reach their lowest levels upon senes-cence of these cells [72]. Research done on these cells suggests that changes in the expression of hnRNP A1 regulate the alternative splicing of and mRNA levels of two isoforms of the INK4a locus, known as p14(ARF) and p16(INK4a). Both of these isoforms are growth suppressors, and deletion of this gene allows cells to escape cellular senescence. The work of Zhu et al. [73], shows that over-expression of hnRNA1 results in a preferential expres-sion of the p14(ARF) isoform, and an increase in the mRNA levels of both isoforms, thus suggesting a role for hnRNP A1 in control of cell proliferation and senescence.

Another example of hnRNP A1-dependent splicing control influencing genes important in cell proliferation is given by the alternative splicing of the human c-H-ras proto-oncogene transcript. Ras GTPase proteins are ex-tremely important components of mitogenic signal transduction pathways [74]. The H-ras pre-mRNA can produce two alternatively spliced versions, one containing an alternative exon known as IDX with an in frame stop codon [75]. It was found that hnRNP A1 functions as a negative regulator of IDX inclusion [41].

The hnRNP A1 protein has also been shown to have a direct role in luekemogenesis through the action of the p210 (BCR-ABL) oncoprotein. This oncogene is a transducer mitogenic signals, and leads to an modified expression of other genes that regulate hematopoietic cell formation and survival [76]. Research by Lervolino et. al. [77] shows that the nuclear-cytoplasmic shuttling ability of hnRNP A1 is necessary for BCR-ABL de-pendent luekemogenesis, and it is suggested that this action may be through control of mRNA trafficking of gene transcripts which are affected via this pathway.

The human fibroblast growth factor, FGF-2, is a well documented pro-moter of proliferation, cell survival, and angiogenesis [78]. This gene con-tains five alternative translation start codons, producing different isoforms of

31

FGF-2 [79]. The hnRNP A1 protein has been shown to bind the IRES of FGF-2 and up-regulate translation of four of the five isoforms.

Research into the roles of hnRNP C1/C2 provides even more direct evi-dence of its involvement in the regulation of the cell cycle and apoptotic processes. It is known that cap-dependent translation is suppressed during mitosis, making those genes which contain an active IRES sequence prefer-entially translated [10]. Further, the subcellular localization of hnRNP C1/C2 is changed during G2-M phase of the cell cycle, concurrent with nuclear membrane breakdown, and it becomes distributed throughout the cell [12]. It has been shown that hnRNP C binds the IRES sequence of c-myc, and increases its translation in vitro. Further, it was shown that the translation of c-myc mRNA is increased during the G2-M phase of the cell cycle, when hnRNP C is present in the cytoplasm, dependent upon the hnRNP C binding site in the c-myc IRES [12]. The protein product of the proto-oncogene c-myc is a well known transcription factor which dimerizes with its partner Max, and the Myc/Max dimer controls the transcription of target genes criti-cal for cell cycle and apoptosis [80].

On a similar note, hnRNP C1/C2 was recently shown to interact with an IRES sequence on the XIAP mRNA, and increase its translation. XIAP (X-linked inhibitor of apoptosis) is a major, potent, inhibitor of both the initiator and effector caspases.

Therefore, the available data indicate that hnRNP A1 and hnRNP C1/C2 may act as survival factors for the cell, by interacting directly with the mRNA of genes responsible for the induction of cell cycle and prevention of apoptosis.

Evidence for hnRNP C1/C2 in DNA damage response pathways There is evidence that hnRNP C1/C2 is directly involved in the cellular re-sponse to DNA damage. It has been found that hnRNP C1/C2 responds to DSBs caused by gamma irradiation by binding chromatin in HeLa cells [81]. Further, hnRNP C1/C2 has been found to be phosphorylated by the DNA dependent protein kinase complex (DNA-PK) [82], a well known DNA damage control kinase.

Telomere biogenesis Telomeres are several kilobase long repeated sequences with 3’ over-

hangs at the end of chromosomes. Increases in telomere length are associ-ated with the transformation of cells, and shortened telomeres are associated with senescence and apoptosis. Therefore, it is vital for the tumor cell to maintain telomere length by induction and recruitment of the enzyme telom-erase to the telomere ends.

32

Of the two hnRNP proteins discussed here, hnRNP A1 is implicated to have a greater role in telomere biogenesis. It binds telomeres in vitro [83], and an hnRNP A1 deficient cell line, CB3, displays shorter telomeres than a corresponding wild type cell line, CB7 [84]. In addition, a naturally occur-ring proteolytic fragment of hnRNP A1, known as UP1, (see Fig. 5) interacts directly with the telomerase enzyme [84] and its over-expression has been shown to extend the life of primary porcine fibroblasts in culture [85]. It has been suggested that hnRNP A1 may act as a docking site for the recruitment of the telomerase enzyme to the telomeres [86].

The hnRNP C1/C2 proteins have been shown to interact with the RNA component of the telomerase enzyme [87]. However, the function, if any, of this interaction is unknown.

Control of hnRNP A1 and hnRNP C1/C2 Protein Levels and Binding Activity.

Phosphorylation control Many different stimuli lead to the phosphorylation of hnRNP A1 and hnRNP C. hnRNP A1 is phosphorylated by protein kinase C isoform zeta, (PKC �), which reduces its RNA binding activity, thus suggesting a link between mi-togenic signaling cascades and hnRNP A1 function [35]. Further, the sub-cellular localization and splicing control functions of hnRNP A1 are sensi-tive to stress stimuli such as osmotic shock or UV irradiation through activa-tion of the MKK(3/6)-p38-signaling cascade, thus suggesting a role of this protein as a downstream stress kinase cascade target [56].

The hnRNP C1/C2 protein has been shown to be phosphorylated in re-sponse to physiological levels of hydrogen peroxide. Treatment of human umbilical vein endothelial cells (HUVECs) with low concentrations of hy-drogen peroxide leads to a rapid and transient increase of phosphorylation of the hnRNP C1/C2 protein [34]. The work of Stone et al. [48] further re-vealed that the hnRNP C1/C2 protein is phosphorylated on several serine residues in its acidic C-terminal regulatory region, and showed that two of these sites are constitutively phosphorylated during normal resting condi-tions. Treatment with low concentrations of H2O2 results in the increased phosphorylation at two other serine residues. The group further showed that casein kinase 2 (CK2) was able to phosphorylate these sites in vitro, while several other protein kinases were unable to do so. Thus, their work demon-strates that the acidic C-terminal domain is a site for both basal and H2O2 dependent phosphorylation of hnRNP C1/C2.

One of the most interesting studies on the phosphorylation control of hnRNP C1/C2 as it relates to this thesis is a series of experiments performed by Zhang et al. [82]. They found via immunoprecipitation and two-

33

dimensional gel electrophoresis a number of proteins that interact with the Ku antigen, the DNA binding subunit of a well known DNA damage control kinase complex known as DNA dependent protein kinase (DNA-PK). The group found that DNA-PK interacts with, and phosphorylates hnRNP C1/C2. Strikingly, they found that the phosphorylation was highly dependent upon intact total RNA [82]. Thus, DNA-PK can function not only in a DNA de-pendent manner, but also in an RNA-dependent manner, implying that hnRNP C1/C2 function may be changed by altered cellular RNA levels.

Ubiquitination/Sumoylation Ubiquitination is known to occur on hnRNP A1. Decreased ubiquitination of the protein is seen in response to oncogene activation, thereby increasing its levels [77].

In addition, both hnRNP A1 and hnRNP C have been identified as targets for sumoylation (small ubiquitin like modifier ) [88, 89]. SUMO is a small peptide sequence, similar to ubiquitin, that is covalently attached to proteins and can affect their translocation, activity, or stability [90-93]. The research into SUMO and targets of sumoylation is still in its infancy, therefore, the role of sumoylation on hnRNP A1 and hnRNP C1/C2 is at the present time unclear.

However, it has been proposed that sumoylation of hnRNP C1/C2 at the nuclear fibrils may promote the release of hnRNP C1/C2 from the mRNA, and prepare the transcript for export [89]. Intriguingly, the target proteins for sumoylation identified so far tend to be important nuclear regulatory proteins such as p53, I�B, promyelocytic leukemia protein and c-Jun [92, 94].

Methylation The role of methylation on hnRNPs is not well understood. However, hnRNP A1 is known to be methylated on four amino acids within its RGG box binding RNA binding domain. Experiments using purified nuclear pro-tein/histone-specific protein methylase I (S-adenosylmethionine:protein-arginine N-methyltransferase) showed that methylation of these sites re-duced binding activity of hnRNP A1 towards RNA [95].

Protein level control The information on transcriptional control mechanisms of hnRNP protein

expression is extremely limited. However, investigation into the promoter of hnRNP A1 has revealed the presence of many so called E-boxes [96], which are known to bind c-myc, suggesting the possibility that this oncogene may affect transcription of hnRNP A1. In addition, hnRNP A1 levels are known to be increased in cells expressing the p210 (BCR/ABL) oncoprotein by altering its ubiquitin/proteasome-dependent degradation [77].

34

As previously mentioned, hnRNP A1 appears to be expressed in a prolif-eration dependent manner in human diploid fibroblasts, suggesting a link between the expression of hnRNP A1 and ongoing cell division [72]. In addition, both hnRNP A1 and hnRNP C1/C2 are targets of caspase-3, and hnRNP C1/C2 is a target of ICE like proteases during ongoing apoptosis, thereby drastically decreasing their concentrations.

Recently, and of great interest to current thesis, it was found that hnRNP C1/C2 total protein levels were post-transcriptionally induced by p53 in re-sponse to treatment with the DNA damaging agent mitomycin C (MMC) in colon carcinoma cells [97]. Further evidence of this type of induction was found very recently in HT22 cells where neural apoptosis was induced by ischemia in mice or staurosporine in HT22 cells [98]. The induction of hnRNP C1/C2 was simultaneous with induction of XIAP, thus suggesting functional importance of this phenomenon [98]. The exact mechanism of this induction is unknown, but it suggests an important function for in-creased hnRNP C1/C2 protein levels in early stress response.

Cytochrome P450 2A5/2A6; Function, Expression, and Substrate Metabolism The murine Cyp2a5 gene and its corresponding human ortholog CYP2A6 are interesting models for the study of stress induced gene regulatory mecha-nisms. These genes are induced during many conditions which are known to down-regulate the expression of other cytochrome P450 enzymes, such as physical liver damage by hepatotoxins, liver tumors, hepatic infection with hepatitis B virus and liver flukes [99-101]. These enzymes are primarily hepatic and show large inter-individual variation, although they are also expressed at lower levels in other tissues such as nasal mucosa [102]. Al-though the CYP2A5/2A6 enzyme has been shown to catalyze the 7-hydroxylation of coumarin [103], many other more physiologically relevant substrates have been identified including carcinogens such as aflatoxin B1 and nitrosamines [104, 105]. In addition, the human ortholog CYP2A6 is a major metabolizer of nicotine [106]. Until recently, no endogenous substrate for this P450 enzyme was known. However, recent evidence suggests that one endogenous ligand, at least in mice, may be a byproduct of heme break-down, bilirubin [107]. Although the mechanisms for the regulation of Cyp2a5 have been intensely studied, the endogenous function of this enzyme remains a source of debate.

35

The Regulation of Cyp2A5/2A6 Most of the regulatory work on these two cytochrome P450s has been done on the murine gene. Cyp2a5 is regulated both on a transcriptional and post-transcriptional level. Intriguingly, the mouse ortholog shows transcriptional regulation by circadian rhythm through the transcription factor DBP (albu-min D-site-binding protein) [108]. In addition, the transcription of both mur-ine and human genes appears to be induced by hepatic nuclear factor alfa (HNF-4�), a transcription factor found in hepatocytes [109, 110]. In addi-tion to HNF-4�, several other transcription factor binding sites exist in the human CYP2A6 promoter including Oct-1 and C/EBP [111]. The mouse Cyp2a5 gene was recently found to be inducible by the aryl-hydrocarbon receptor (AHR) pathway by TCDD, a dioxin [112]. Other transcriptional inducers include phenobarbital, and cadmium [113, 114]. Evidence suggests that the post-transcriptional regulation of Cyp2A5/2A6 via hnRNP A1 is of great importance for stress related induction and consequent mRNA stabili-zation of this gene [46, 115, 116].

Of note, oxidative stress has been strongly implicated in the expression of 2A5/2A6. For example, it known that the induction of CYP2A5 is linked to the redox status of the endoplasmic reticulum [117], and recent research indicates the toxic heavy metal cadmium, known to cause oxidative stress in the liver [118] is an inducer of CYP2A5 and corresponding bilirubin me-tabolism [107, 113, 117, 119] through the action of nuclear receptor factor 2 (NRF-2).

The role of hnRNP A1 in the expression of cytochrome P450 2A5 (Cyp2a5) Previous studies have shown that hnRNP A1 controls the gene expression of Cyp2a5 post-transcriptionally. Cellular stress, caused by the toxic compound pyrazole, activates the binding of hnRNP A1 to a 71 nt primary binding site in a hairpin loop contained within the 3’ UTR of CYP2A5 mRNA. It has been demonstrated that the binding of hnRNP A1 to this site leads to a stabi-lization of its mRNA, most likely through lengthening of its poly(A) tail [46, 115, 116]. Recently, and of interest to the original paper II presented here, Wang et. al. found that a polymorphism within the 3’ UTR of the human CYP2A6 mRNA, known as CYP2A6*1B, increased the half life of its mRNA, strongly suggesting a post-transcriptional regulation similar to that of its murine counterpart [120]. The trans-acting factor(s) affected by these single nucleotide polymorphisms on the mRNA were not identified in the study.

36

p53

Background The tumor suppressor p53 is one of the best known stress induced pro-

teins, and has been the study of intense research due to its importance in carcinogenic and apoptotic processes.

It was originally identified in 1983 as an oncogene due to its over-expression in many tumor cell types [121, 122]. However, it soon became apparent that the protein product was in fact a tumor suppressor, and that the previous observations of over-expression were in fact a result of a compen-sation mechanism by the cell for loss of p53 function [123]. By some esti-mates, over 50% of all cancers contain a form of p53 that is either mutated, or down-regulated by other means, thus emphasizing the importance of this gene for preventing cancer. The research into this protein’s function and regulation has been intense, and to date, over 50,000 original articles on the subject have been cited in the PubMed database alone (http://www.ncbi.nlm.nih.gov/sites/entrez).

The Structure of p53 The p53 protein is 53 kDa in apparent molecular mass, and consists of 393 amino acids. The protein itself has several structural domains, which serve diverse functions (Fig. 6). The N-terminus of p53 (aa 1-94) contains two transactivation domains, TAD I and TAD II. These residues are are neces-sary for transcriptional control of target genes, as well as the site of HDM-2 (human double minute 2, a.k.a. MDM-2) interactions [124-126]. Within TAD II, is a proline rich domain important for p53 dependent apoptosis, (aa 80-94). Following the PRD, is the central DNA binding domain (DBD) consisting of amino acids 102-292 [127-130]. The consensus DNA binding sequence for p53 on the target gene via this domain is RRRCWWGYYY, where R is a purine, W is A or T, and Y is a pyrimidine. A typical p53 re-sponse element is composed of two or more of these sequences, separated by a short spacer of less than 21 bp [131]. There is an NLS located at residues 305-322, and two NES domains, one in the N-termius (aa 11-27) and one located in the C-terminus at residues 340-351 [132, 133]. These sequences are necessary for p53’s translocation from the cytoplasm to the nucleus and back. Curiously, the tetramerization domain domain (aa 307-355), responsi-ble for the proteins’ homotetramerization, and the C-terminal NES share common amino acids. The C-terminal regulatory domain (aa 356-393), re-gulates DNA binding activity via phosphorylation and acetylations [134, 135]. This domain is also important for p53 dependent apoptosis, and is the

37

site of ubiquitination of the p53 protein via HDM-2 [129, 136, 137]. More information on the structural domains of p53 and its isoforms can be found here [138]. Of note, most mutations that affect the function of p53 exist within the DNA binding domain, thus preventing it from functioning nor-mally as a transcription factor [139].

N C

Amino acid 1 42 64 94 292 325 356 393

TADs

DNA binding domainI II NLS TET NES BDPRD

Human p53

Fig. 6 The functional domains of the human p53 protein. There are two transactiva-tion domains (TADs) within the N-terminus, controlling the ability of p53 to affect transcription of gene targets. The proline rich domain (PRD) is necessary for the apoptotic activity of p53. This is followed by the DNA binding domain, which allows p53 to interact with DNA and act as a transcription factor. The nuclear ex-port sequence (NES) is located within the tetramerization domain (TET). The nu-clear localization signal (NLS) in combination with the nuclear export sequence (NES) is responsible for p53 shuttling activity. The tetramerization (TET) domain allows for p53 to form homotetramers, while the C-terminal basic domain (BD) is a regulatory region controlling DNA binding activity, among other functions.

The Cellular Function of p53 The tumor suppressor p53 is a cellular stress activated protein, that acts

both in the nucleus as a transcription factor for genes that that regulate cell cycle and apoptosis, and in the cytoplasm as a pro-apoptotic factor inde-pendently of transcription [140]. Disturbances in its level and/or function are linked to a highly increased risk of cell damage, transformation, and car-cinogenesis [141]. The levels and activation state of p53 are dramatically increased in response to DNA damage [142], oxidative stress [143], and inhibition of transcription [30, 144], among other stimuli. This leads to a stop in the cell cycle, and in cases where cellular damage is not able to be repaired, initiation of p53-dependent apoptosis [145].

Activation of the p53 stress pathway leads to its phosphorylation and ace-tylation, causing its disassociation from the HDM-2 protein, which normally targets p53 for degradation via the proteosome in unstressed cells [13, 146]. The p53 protein then forms a homotetramer, and translocates to the nucleus to affect the transcription of target genes involved in stopping the cell cycle and induction of apoptosis such as p21, PUMA, NOXA, BID and BAX [147-150]. The p21 protein acts as a CDK (cyclin dependent kinase) inhibi-tor, and effectively stops the cell cycle in G1 phase, thus preventing con-

38

tinuation into S phase [151]. In the event of irreparable damage, p53-dependent apoptosis is initiated. In addition to the above functions in re-sponse to cell damage, it lives up to its name as a tumour suppressor by causing the self destruction of those cells which display aberrant, uncon-trolled division caused by constitutively activated mitogenic cascades [152].

Thus, the protein functions both as an “emergency brake” in the event of cellular damage, stopping all ongoing cell division, and at the same time a “watch-dog” for signs of carcinogenic activity.

Loss of function mutations in p53 massively increases the susceptibility of the organism to malignant tumours. Studies by Donehower et. al. in 1992 showed that homozygous knockout mice display normal development, but are prone to the development of a variety of cancers by 6 months of age [153]. These results are echoed by the study of heritable mutations of p53 in humans. Li–Fraumeni syndrome (LFS) is a rare inherited condition in hu-mans first described in 1969, and found to be caused by germ line mutations in the p53 gene locus in 1990. Individuals with LFS show a predisposition to a number of different cancers, including cancer of the breast, bone sarco-mas, leukaemias, stomach cancer, melanoma and many others. The individu-als with LFS show an 85% lifetime chance of developing cancer, with more than half of those cases appearing prior to the age of 30 [154]. In summary, the function of tumours suppressor p53 is dispensable for development, but indispensable for protection against carcinogenesis.

p53 Dependent Apoptosis The induction of apoptosis is a balance between positive and negative fac-

tors. Apoptosis may be p53 independent, such as that seen when the Fas-L ligand binds its death receptor on the plasma membrane surface, or depend-ent upon p53, such as when the cell experiences double strand breaks via ionizing radiation. It is well known that p53 plays a central role in DNA damage response. However, the damage may be too severe to repair, or the cell may eventually exhibit signs of transformation, at which time p53 can play its second role as a pro-apoptotic factor. p53 induces apoptosis through the Apaf-1/caspase-9 pathway [155], and the process is dependent upon cy-tochrome c release from the mitochondrial intermembrane space [156]. Apaf-1 (apoptotic protease activating factor 1) binds to the released cyto-chrome c and ATP forming the multimeric complex known as the apopto-some. The apoptosome then interacts with the initiator caspase-9 leading its activation and the subsequent cleavage of the inactive pro-forms of the ef-fector caspases such as caspase-3 and 7, which then cleave downstream cel-lular targets resulting in an ordered shutdown of cellular processes and ulti-mately, cell death [157]. The process of apoptosis and its dependence upon p53 is complex, showing a large amount of heterogeneity in different cell

39

types and in response to various stimuli [135, 158]. However, it is clear that one main role of p53 in the nuclear compartment is to induce the transcrip-tion of several genes responsible for apoptotic initiation. These include the pro-apoptotic genes Bax, NOXA, PUMA and BID, among others [148-150, 159]. Many of these genes encode mitochondrial proteins. BAX, NOXA, and PUMA for example, accumulate in the mitochondria and interact with the anti-apoptotic mitochondrial proteins Bcl-2 and Bcl-XL thus inhibiting their action and leading to apoptosis [160].

Of particular interest for this thesis, it is known that p53 can induce apop-tosis in the absence of ongoing cellular transcription [30, 161] by interacting with the anti-apoptotic proteins Bcl-2 and Bcl-XL directly at the mitochon-drial surface and causing the release of cytochrome c [140, 162]. The mechanisms controlling the apoptotic role of p53 in the cytoplasm, and in particular the signalling mechanisms and intermediates linking a reduction of RNA synthesis with downstream apoptotic processes remain a subject of continued scientific interest and debate.

Activation of p53 Response The DNA damage pathways that sense damage and control activation and induction of p53 are not fully understood. However, depending upon the type of stress, the ATM, ATR or both kinase pathways may be involved. For instance, the ATM-Chk2 kinase cascade plays a large role in DSB re-sponse, such as is induced via ionizing radiation (IR) or genomic instability caused by cellular transformation [163]. In contrast, the ATR kinase path-way appears to play a role in response to diverse other stimuli such as oxida-tive stress by reactive oxygen species (often causing SSBs) and DNA cross-links, like those induced by the cytostatic agent cisplatin [164, 165].

The actions of these damage response proteins are logical, in that they re-spond directly to physical DNA damage itself. However, one perplexing mystery in p53 activation and apoptotic response has been the fact that changes in transcriptional state of the cell can lead to p53 activation without corresponding physical DNA damage [30]. Many DNA damaging agents used in treating cancer also affect the rate of RNA pol II dependent tran-scription [24, 166]. Thus, the DNA damage response may be more complex than it appears on the surface. One interesting hypothesis is that interference with ongoing transcription by non-specific DNA damage functions as a so called “lesion dosimeter” which allows the cell to sense the amount of DNA damage, and to decide upon an appropriate response [144].

The present thesis brings together research which, at least in part, may explain one link between ongoing transcription and p53 regulation through the activation of the mRNA binding protein hnRNP C1/C2.

41

Aims

General Aims

To increase the understanding of the molecular mechanisms behind hnRNP-dependent regulation of stress induced genes. Further; to add to the body of knowledge about how these proteins impact vital cellular functions that af-fect carcinogenesis and apoptosis.

Specific Aims

� To investigate the possible coupling between transcriptional and post-transcriptional mechanisms of the mouse cytochrome P450 2A5 regulation.

� To discover whether or not the human gene, CYP2A6 was post-transcriptionally regulated in a manner similar to its mouse ortho-log.

� To investigate the possibility of mRNA binding proteins binding to the coding region of the human tumor suppressor p53 mRNA in re-sponse to DNA damaging agents.

� If found, to locate, map, and describe the cis-binding site of these proteins, and further,

� To describe the cellular function of these binding proteins on p53 mRNA.

42

Materials and Methods

Cell Culture

Culture of HepG2 and HeLa cells (Papers II-IV). HepG2 hepatocellular carcinoma cells were purchased from the American Type Culture Collection (Manassas, VA). The cells were propagated in 10-cm plates (Corning, Palo Alto, CA) in minimal essential medium containing 10% fetal calf serum, 2 mM L-glutamine, 1 mM sodium pyruvate, minimal essential medium nonessential amino acids. HeLa cells were propagated in Dulbecco’s modified Eagle’s medium with 10% fetal calf serum. All cell culture products were purchased from Invitrogen (Carlsbad, CA). The cells were kept in an atmosphere of 5% CO2 at 37°C in a humidified incubator and were subcultured at least two times per week.

Isolation and treatment of primary human hepatocytes (Papers II and III) The primary human hepatocytes were a gracious gift from Dr. Patrick Maurel. The human liver sample was obtained from a 79-year-old man who underwent right lobectomy for a metastasis of a colorectal tumor. Viral sero-logic analysis (hepatitis B virus, hepatitis C virus, HCV, and human immu-nodeficiency virus) was negative. The tissue encompassing the tumor was dissected by the surgeon in the surgery room and sent for pathologic studies, while the remaining encapsulated downstream tissue was used for hepato-cyte preparation. No information on the patient was available in our labora-tory, apart from the reason for surgical resection, age, and gender. Impor-tantly, and as accepted by the French National Ethics Committee, pathologi-cal examination of the surgical specimen was in no way hindered by the procedure used to obtain primary hepatocytes; the tissue sample used for this purpose would otherwise have been immediately discarded. Hepatocytes

43

were isolated and cultured as described previously (Pichard et al., 1992; Pichard-Garcia et al., 2002). The viability of cells before plating was deter-mined using the trypan blue exclusion test and was 80%. Four million cells in 3 ml of culture medium were placed into 25-cm2

flasks precoated with type I collagen. The serum-free culture medium (Pichard-Garcia et al., 2002) was changed every 48 to 72 h. Cultures were maintained at 37° C in a humid atmosphere of air and 5% carbon dioxide. In some experiments, cultures were treated for 24 h with 4 μM Act D or carrier (dimethyl sulfoxide), and RNA or proteins extracts were prepared as described below.

Animals (Paper I) Male DBA/2J mice, aged 6–9 weeks, were provided by Möllegaard. They were allowed to acclimatize for 1 week before use in hepatocyte isolation. During this time, the mice were kept at the animal facility at BMC, Uppsala, and fed chow and water ad libitum. The studies were approved by the Ethi-cal Committee (Uppsala, Sweden; approval number C3/1) and were per-formed accordingly. Isolation of hepatocytes was performed with a two-step perfusion as further described in paper I. The isolated hepatocytes were dispersed in Williams’ medium E containing dexamethasone (20 ng/mL), ITS (insulin 5 mg/L, transferrin 5 mg/L, sodium selenite 5 mg/L), gentamicin (10 mg/mL), 1% L-glutamine and 10% decomplemented fetal calf serum at a density of 5x106

cells/100-mm uncoated culture dish (Corning). The cells were maintained at 37° C, 5% CO2 in a humidified incubator. After 2 hr of incubation, the me-dium was changed to Williams’ medium E without fetal calf serum. Treat-ment of the cells was initiated 24 hr after plating. Act D and DRB were dis-solved in DMSO, whereas cAMP and PB were dissolved in culture medium.

Reporter Gene Construction and Transfection

Cyp2a5 (Paper I) The reporter gene used in paper I contained approximately 3 kb of the mur-ine Cyp2a5 promoter upstream of the luciferase gene in the plasmid pGL3 basic. The plasmid was kindly provided by J. Hakkola, University of Oulu). A control plasmid, pGL3 control from Promega, containing an SV40 pro-moter was also used. The hnRNP A1 over-expressing plasmid pCG-A1 was a gift from A. Krainer, Cold-Spring Harbor Laboratory. A control version of this plasmid was obtained by removing the hnRNP A1 cDNA sequence inserted at the BamHI and XbaI sites of the pCG plasmid.

44

Human p53 (Paper III) Using standard molecular biological techniques, the full-length firefly luciferase coding region cDNA obtained from the plasmid pGL3 (Invitrogen, Carlsbad CA) was cloned in frame downstream of 258 bp of the human p53 cDNA containing the entire 5’ UTR and part of the p53 coding region in the plasmid TC119832 (Origene Technologies, Rockville MD). The resulting plasmid 5’p53luc, was driven via a CMV promoter. The chimeric protein product contained 57 aa from p53 on the N-terminus, a spacer of 11 aa, and the entire luciferase gene (539 aa) in frame downstream of these amino ac-ids. A T7 RNA polymerase promoter was located 5’ of the cloned sequence for in vitro transcription reactions. A schematic of this reporter gene is given in Fig. 13 A Versions of this plasmid which contained silent point mutated putative hnRNP C1/C2 binding sites in the 5’ UTR, early coding region, or downstream coding region denoted mutants A, B, or C were also created.

Transient transfection (Papers I-IV) Transient transfections were performed using either Lipofectamine PLUS (Invitrogen) in paper I or Fugene6 (Roche) III and IV. Exact condi-tions can be seen in the materials and methods of the individual papers. Co-transfection to estimate the transfection efficiency was performed with a a �-galactosidase-expressing plasmid pCMV-SPORT-bGal (Invitrogen). At the indicated times post-transfection, whole cell extracts were prepared using reporter lysis buffer (Promega, Madison WI). Luciferase activities were ob-tained via a TD 20/20 luminometer (Turner Designs) using luciferase assay reagent (Promega, Madison WI) according to the manufacturer’s protocol. The resulting values are expressed as RLU/ ßgal activity.

Site Directed Mutagenesis Site directed mutagenesis was performed on several sites within the plasmid 5’p53luc using the GeneEditor site-directed mutagenesis kit according to manufacturer’s directions (Promega, Madison, WI). All nucleotide assign-ments of mutation sites are in accordance with the GeneBank sequence NM_000546. All mutations located within the coding region of p53 were designed to be silent, and were confirmed to lack rare codons. The location of the primary hnRNP C1/C2 binding site within the early coding region is indicated in Fig. 13 A.

45

Preparation of Radioactive RNA Probes

Paper I (CYP2A5) A 71 nt RNA probe containing the hnRNP A1 protein binding site present in the CYP2A5 3’ UTR was prepared as described in Geneste et al. [167]. This probe is also described in Tilloy-Ellul et. al [116].

Paper II (CYP2A6) Different segments of the CYP2A6 cDNA contained within the plasmid pCOH 17.1, generously donated by Hannu Raunio (University of Oulu, Finland), were amplified by using PCR. PCR-amplified products were tran-scribed with T7 RNA polymerase in the presence of 32P-UTP (800 Ci/mmol; Pharmacia, Peapack, NJ) according to the manufacturer’s instructions (Promega, Madison, WI). After digestion of the DNA template using RQ1 DNase, unincorporated nucleotides were removed from transcripts by the use of a microspin G-50 column (Amersham Biosciences AB, Uppsala, Sweden). All probes were checked for quality by electrophoresis through a denaturing polyacrylamide urea gel followed by autoradiography.

(Paper III) Human p53 The full-length cDNA coding region of human wild type p53 contained within the plasmid pcDNA-p53wt (graciously provided by Dr. M. Gloria Luciani, University of Dundee, UK) was amplified in a PCR reaction utiliz-ing Phusion high fidelity thermostable DNA polymerase (Finnzymes, Espoo Finland) according to the manufacturer’s instructions. The PCR product was cloned into the pGEM-T vector containing a T7 promoter (Promega, Madi-son WI) using standard molecular biological techniques. A series of exonu-clease III digested 3’ truncations was created using the Erase-a-Base system (Promega, Madison WI) according to manufacturer’s recommendations (Fig. X B). The plasmids containing the truncations were linearized 3’ of the p53 sequence, and radiolabelled RNA probes were transcribed from the trunca-tions as described above. Following digestion of the DNA template with RQ1 DNase, unincorporated nucleotides were removed via dialysis against water using VSWP 0.025 μm pore size membranes (Millipore, Billerica, MA). A probe corresponding to the 234 nt 3’ untranslated region of human CYP2A6 mRNA was synthesized as previously described for use as a nega-tive binding control in some experiments (Christian et al., 2004). Probes were checked for quality as described above.

46

RNA-protein Interaction Analysis

Ultraviolet Cross-Linking (UVXL) (Papers I-IV). Binding reactions using the indicated amounts of nuclear or cytoplasmic extracts and the indicated RNA probes were performed essentially as de-scribed by Geneste et al. (1996)[167]. The samples were irradiated for 20 min with UV light at an intensity of 5225 μJ/cm2 in a Spectrolinker XL-1000 UV cross-linker (Spectronics, Westbury, NY). Free RNA was digested with 2 μg of RNase A (Invitrogen, Täby, Sweden) at 37°C for 20 min. The sam-ples were denatured under nonreducing conditions at 95°C for 10 min and separated on a 12% SDS-PAGE gel. Visualization was performed by autora-diography. In some cases, the cell extract was pre-treated with proteinase K or potato acid phosphatase (nr. 108227; Roche Applied Science, Indianapolis, IN), for the indicated times before cross-linking was performed. In all cases, the amount of radioactive RNA probe was quantitated via scintillation, and mas-ter mixes of components in the UV-cross-linking reaction were used to en-sure equal protein and RNA probe amounts in the reactions. All experiments comparing strength of the resulting RNA-protein complex signal or experi-ments comparing apparent molecular mass of complexes were separated on the same gel and exposed to the same film to ensure accuracy.

Partial Proteolysis of the RNA/Protein Complexes (Paper II). Partial proteolysis of RNA/protein complexes was performed essentially as described by Hamilton et al. (1993)[168]. In brief, UV cross-linking reac-tions with human hepatocyte nuclear extracts were performed. Immediately after adding RNase A, 100 ng of trypsin (Roche Applied Science, Indianapo-lis, IN) was added to the samples. The samples were then separated by SDS-PAGE and visualized by autoradiography.

Immunoprecipitation (Paper II-III) Immunoprecipitation was performed essentially as described previously by Hamilton et al.[168]. In brief, UV cross-linked samples were made as indi-cated, and added to antibody binding buffer containing 1 �l of the indicated monoclonal antibodies against hnRNP A1 or hnRNP C1/C2, negative con-trol antibodies, or no antibody. Immunoprecipitation was carried out with protein A sepharose beads (GE Healthcare, Buckinghamshire UK). The samples were washed with PBS, and the immunoprecipitated complexes were denatured, separated on a 12% SDS-PAGE gel, and visualized using autoradiography.

47

Competition Assays.

CYP2A6 (Paper II) A 258-nucleotide sequence corresponding to nucleotides 751 to 1009 (Gen-Bank accession no. NM_00762) in the coding region of CYP2A6 cDNA was amplified via PCR using Ampli-Taq Gold hot start Taq DNA polymerase and the plasmid pCOH17.1 containing CYP2A6 cDNA as a template. The 234-nucleotide probe from the 3’ UTR of CYP2A6 was amplified as previ-ously described. PCR amplified products were transcribed with T7 RNA polymerase in the presence of unlabeled ribonucleotides using the Ribomax kit (Promega) according to the manufacturer’s instructions. After digestion of the DNA template with 2.5 U of RQ1 DNase, unincorporated nucleotides were removed from transcripts by the use of a microspin G-50 column (Am-ersham Biosciences AB), followed by phenol chloroform extraction. Cold competitor RNA (10–1000 M excess) or 0.5 to 2.0 μg of yeast tRNA in equal volumes were added to a standard UV cross-linking reaction contain-ing 1 μg of yeast tRNA before incubation with the 234-nucleotide 3’ UTR radioactive probe. Cross-linking was then performed as described above, and the reactions were separated on an SDS-PAGE gel. The gel was visualized by autoradiography after drying.

Human p53 (Paper III) The experiment was performed essentially as described above. The full-length, radioactive p53 coding region RNA (probe A) was incubated with varying concentrations of non-radioactive competitors E or F (see paper III) and UV cross-linked with Act D-treated HepG2 cytoplasmic extracts.

Poly(A) tail Length Analysis Total RNA from untreated or Act D-treated hepatocytes, was incubated with the antisense oligonucleotide TGTAGGTTGGTGGGATCGTG, correspond-ing to nucleotides 1443–1462 in CYP2A5 cDNA. The DNA/RNA hybrid was digested using RNase H (Life Technologies) for 1 hr. The digestion releases two types of RNA fragments: the 5’ portion of the transcript, up-stream of the 1443–1462 region, and the 3’ part of the transcript containing the 227 nucleotides downstream of the 1443–1462 region plus the poly(A) tail. In parallel digestion reactions, oligo dT was added to allow RNase H

48

cleavage of the poly(A) tails. The digested samples were separated through a 2.5% low melting point agarose/formaldehyde gel, blotted on to a Hybond-N nylon filter (Amersham Biosciences) and fixed under UV light. An in vitro transcribed [a-32P]UTP-labeled cRNA probe complementary to nu-cleotides 1456–1689 in the CYP2A5 mRNA, was used to detect the ade-nylated and deadenylated 3’ fragments released by the RNase H.

Computational Analysis of Biological Sequences

RNA secondary structure analysis (Papers II-III) Secondary structure analysis of the CYP2A6 and human p53 mRNA was performed using mfold version 3.1 (Mathews et al., 1999; Zuker et al., 1999) using the web-based server at Rensselaer Polytechnic Institute (http://www.bioinfo.rpi.edu/applications/mfold).

Alignment of the 3’ UTR from CYP2A5 and CYP2A6 (Paper II) Alignment of the primary nucleotide sequence from the 3’ UTR of CYP2A5 and CYP2A6 was performed using the GeneWorks version 2.5 program (Oxford Biomedical Research, Oxford, MI). The GeneBank 3’ UTR acces-sion numbers for CYP2A6 cDNA and CYP2A5 cDNA were NM_00762 and BC046605, respectively. Identical nucleotides are marked as shaded boxes.

Quantitation of mRNA Levels

Quantitative real time PCR (Paper IV) Transfected HepG2 cells were lysed in situ using 600 μl of RLT buffer, and total RNA was prepared using the RNeasy mini kit (Qiagen GMBH, Hilden Germany) according to manufacturer’s recommendations. The total RNA was quantitated using a spectrophotometer. Any remaining genomic DNA was destroyed and 200 ng of the total RNA was reverse transcribed using the QuantiTect reverse transcription kit (Qiagen GMBH, Hilden Germany) ac-cording to the manufacturer’s instructions. Quantitative real-time PCR was performed using an ICycler thermal cycler (Bio-Rad, Hercules CA). The primer sequences for human p53, and GAPDH were obtained from other studies [169]. Reactions were carried out using iQ SYBR Green Supermix

49

(Bio-Rad, Hercules CA) in triplicate, in a 96 well plate. Well factors were taken for each well prior to amplification, and melt curves were taken post-amplification as a control against multiple products. Single amplification products were further ensured by agarose gel electrophoresis (data not shown). To ensure lack of genomic or other DNA contamination, a no RT negative control and a reaction lacking cDNA were included in each experi-ment. In order to ensure the delta-delta Ct method was a valid approxima-tion, the efficiencies of the amplification of all products were verified to be similar using dilution curves. All p53 mRNA levels are normalized to levels of GAPDH mRNA.

Northern blot (Paper I) Total cellular RNA was isolated from primary mouse hepatocytes and mouse liver using RNeasy Mini and Midi kits (QIAGEN) according to the manufac-turer’s protocol. In short, Total RNA was size-fractionated by electrophore-sis through a 1.2% agarose/formaldehyde gel, transferred to a Hybond-N nylon membrane (Amersham Biosciences) and UV cross-linked before hy-bridization. For Northern analysis, plasmids containing the full length CYP2A5 cDNA (kindly provided by M. Negishi, NIEHS), and the CYP2B10 cDNA (a gift from P. Honkakoski, University of Kuopio) were radiolabeled with [a-32P]dCTP (Amersham Biosciences). After hybridization overnight, the membrane was visualized by autoradiography. In order to assess equal loading of the samples, the mRNA level of the housekeeping gene GAPDH was measured using radiolabelled GAPDH cDNA (Clontech).

Semiquantitative RT-PCR (Paper II) Total cellular RNA was isolated from treated and untreated human primary hepatocytes using the RNeasy Mini kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instructions. To ensure the lack of genomic DNA contamination, total RNA was digested using RQ1 Rnase-free DNase (Promega). The RNA was then purified by phenol chloroform extraction. Reverse transcription of the total RNA was performed using an oligo dT16

primer and murine leukaemia virus reverse transcriptase according to the manufacturer’s instructions (PerkinElmer Life and Analytical Sciences, Bos-ton, MA). The gene-specific primers for human CYP2A6, CYP2B6, and �-actin are described in paper II. PCR was performed using AmpliTaq Gold hot start Taq DNA polymerase (Applied Biosystems, Foster City, CA). After an initial Taq activation step of 3 min at 95°C, the CYP2A6 or CYP2B6 gene-specific primers were added to the reaction. The conditions for PCR can be found in paper II. Extensive optimization was carried out to ensure

50

linearity of the CYP2A6, CYP2B6, and �-actin signal response, after which RT-PCR semi-quantitative analysis was performed, and the relative band intensities for CYP2A6, CYP2B6, and �-actin were quantitated using NIH Image software version 1.62f (http://rsb.info.nih.gov/nih-image/). CYP2A6 and CYP2B6 expression were normalized using the �-actin signal before plotting.

Protein Analysis

Whole cell protein extract preparation (Paper IV) The cells were harvested using reporter lysis buffer (Promega, Madison WI), vortexed, and snap frozen at –80º C for lysis. Protein concentrations were measured using the Lowry method [170] with bovine serum albumin as a standard.

Cytoplasmic and nuclear protein extract preparation (Papers I-III) The cultured cells were scraped into PBS and centrifuged at 2000 x g for 30 s. The cell pellet was resuspended in buffer A (10 mM HEPES-KOH, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol, 0.2 mM pheny-methylsulfonyl fluoride, 10 �g/ml leupeptin, and 0.4% Igepal) and incubated at 4° C for 1 h. The cells were homogenized and centrifuged at 12000 x g, 4° C for 10 min. The supernatant (crude cytoplasmic fraction) was stored at -80° C, and the nuclear pellet was resuspended in buffer B (20 mM HEPES-KOH, pH 7.9, 25% glycerol, 1.5 mM MgCl2, 0.2 mM EDTA, 420 mM NaCl, 0.5 mM dithiothreitol, 0.2 mM phenymethylsulfonyl fluoride, 0.4% Igepal) homogenized, and then centrifuged at 12000 x g for 15 min at 4° C. The supernatant containing the nuclear proteins was stored at –80° C. Protein concentrations were measured using the Lowry method (Lowry et al., 1951) with bovine serum albumin as a standard. Separation between subcellular compartments was confirmed by western blot using antibodies against nu-clear or cytoplasmic specific proteins.

Western blot assay Denatured samples were separated on a 4% stacking, 12% separating SDS- PAGE gel. The separated proteins were transferred to a nitrocellulose mem-

51

brane (Hybond ECL; GE Healthcare, Buchinghamshire UK), and blocked with 5% milk, 0.1% Tris-buffered saline-Tween 20. The primary antibodies were as indicated in the individual papers. Detection was performed using ECL reagents according to manufacturer’s recommendations (GE Health-care, Buckinghamshire UK). In some cases, western blots were measured via densitometry using the program Scion Image for Windows (Scion Corp, Worman’s Mill Ct.).

Electrophoretic Mobility Shift Assay (Paper I) The PCR-derived oligonucleotides were 5’ -end labelled with [�-32P]ATP (3000 Ci/mmol) using a 5’-end labelling kit (Promega). Binding reactions (10 mL) contained 4% glycerol, 5 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, 10 mM Tris–HCl (pH 7.5), 0.05 mg/mL poly(dI-dC) (Amersham Biosciences) and 4 μg of nuclear extract (NE) from control or PB-treated mice. After 10 min at room temperature, labelled DNA probe was added and the mixtures were incubated for an additional 20 min at room temperature. In the super shift reactions, 1 μL of the indicated monoclonal antibody was added to the reaction mixture and incubated on ice for 60 min. The DNA-protein complexes were loaded onto a pre-electrophoresed, non-denaturing 4% polyacrylamide (60:1 acrylamide:bisacrylamide) gel in 0.5 x TBE. The samples were separated, the gel dried, and then autoradiographed.

Statistical Analysis Statistical analysis of data was carried out for paper I and II using Student’s t test at a 95% significance level, using Minitab statistical software version 13.32 (Minitab Inc., State College, PA). Statistical analysis in papers III and IV were done using one way ANOVA. Statistical significance was assumed at p < 0.05, (*) while p <0.01 is denoted “**”, and p <0.001 is denoted as “***”. ANOVA Analysis was carried out with Minitab v.14 statistical software (Minitab Inc, State College PA). Data are plotted with error bars showing +/- S.D. or S.E.M. as indicated.

52

Results

Transcriptional and Post-transcriptional Processes Controlling the Expression of Murine Cyp2a5 are Linked via hnRNP A1.

The Subcellular Localization and Binding Activity of hnRNP A1 Towards CYP2A5 mRNA is Affected by the Transcriptional State of the Cell (Paper I). It has previously been shown that hnRNP A1 is an important post-transcriptional regulator of the Cyp2a5 gene after treatment with the hepato-toxin pyrazole. It functions by binding a 71 nt cis-acting destabilizing ele-ment within the 3’ UTR of the transcript, thereby increasing its mRNA sta-bility [46, 115, 170]. By treating mouse primary hepatocytes with the tran-scriptional inhibitors Act D and DRB, the results showed that hnRNP A1 translocates from the nucleus to the cytoplasm during transcriptional distur-bance. Simultaneously, the binding activity towards the CYP2A5 mRNA was increased in the cytoplasmic compartment, concurrent with a significant increase in CYP2A5 mRNA stability.

hnRNP A1 Interacts With the Proximal Promoter of Cyp2a5 (Paper I) Through computer alignment, two potential regions of hnRNP A1 interac-tion were found. One region showed similarity with the previously identified 71 nt high affinity binding site in the 3’ UTR of the transcript (Fig. 7 A, probe 1), while the other was similar to a previously described promoter element within the MHC class II gene (Fig. 7 A, probe 2) [171, 172]. The interaction of hnRNP A1 with these sites was tested using EMSA and super-shift assays (Fig. 7 B). The results from these experiments showed that there was an interaction between hnRNP A1 and the proximal promoter of the

53

gene (lanes 4 and 9), and that this interaction was stimulated in response to transcriptional activation of the gene via PB (lane 8). Further, it was found that ectopic over-expression of hnRNP A1 resulted in a significant induction of a luciferase construct containing approximately 3 kb of the Cyp2a5 pro-moter when compared with a control plasmid. Subcellular localization ex-periments revealed that treatment with two known transcriptional inducers of Cyp2a5, cAMP or Phenobarbital (PB), resulted in the retention of hnRNP A1 within the nucleus [114, 173]. The stability of the mRNA was not af-fected by induced transcription, in contrast to conditions where transcription is disturbed. These results suggest that hnRNP A1 is localized to the nu-cleus, and binds the Cyp2a5 promoter during conditions of transcriptional induction of the gene.

54

A.

B.

Fig. 7 (A) Potential hnRNP A1 binding sites in the proximal promoter of Cyp2a5. A schematic presentation of the proximal promoter region within in the Cyp2a5 gene. The TATA-box (TATAAAA) and transcriptional start site indicated. The boxed sequences represent the regions of sequence similarity with the 71 nt region (shaded boxes) of the CYP2A5 3UTR (probe 1) and the DNA binding sequence described by Donev et al. [171] (probe 2, open boxes). (B) EMSA analysis of hnRNP A1/Cyp2a5 promoter interactions. Nuclear extracts (NE) from untreated (ctr) or PB-treated (PB) mice were incubated with radiolabeled probe 1 or 2 in an EMSA assay. When indicated the reactions were incubated with monoclonal anti-hnRNP A1 or anti-hnRNP I/PTB antibodies. The super shift and complexes formed are marked by arrows.

55

The Transcriptional and Post-transcriptional Regulation of the Murine Cyp2A5 Gene is Linked Through the Multifunctional Protein hnRNP A1 (Paper I). The findings in paper I suggest that hnRNP A1 not only plays a role in the stabilization of CYP2A5 mRNA, as previous work suggests [46, 115, 116], but also plays a role in the transcriptional control of the gene. In summary, the results in agreement with the idea that hnRNP A1 plays a dual role in the expression of this mouse P450 enzyme. The findings suggest that it not only acts as an mRNA stabilizing trans-acting factor on the 3’ UTR of the mRNA, but also acts as a transcriptional activator by interacting with the proximal promoter. The findings are consistent with a model whereby the multifunctional hnRNP A1 protein changes subcellular localization and binding activity towards CYP2A5 mRNA or alternatively the Cyp2a5 pro-moter dependent upon where it is needed in the gene expression pathway.

56

The Human CYP2A6 Gene is Regulated Post-transcriptionally in a Manner Similar to that of the Murine Cyp2a5.

The 3’ UTR of the Human CYP2A6 mRNA Contains Two Regions of High Similarity to the Mouse CYP2A5 3’ UTR (Paper II). Human CYP2A6, like its mouse ortholog, is known to be over-expressed in a number of major pathological conditions that result in liver inflammation and cirrhosis [102, 174]. We hypothesized that the human gene, CYP2A6, may be regulated post-transcriptionally in a manner similar to that of the mouse gene. In order to investigate this possibility, we performed a com-puter alignment of the 3’ UTR sequences from both transcripts in order to identify putative hnRNP A1 binding cis sites. The comparison showed a 41% nucleotide identity. However, two regions in particular were highly homologous, both composed of “AG rich blocks” containing sequences reminiscent of known hnRNP A1 binding sites [41, 167]. These AG rich blocks were denoted AG rich block I and AG rich block II (Fig. 8 A). The computer predicted secondary structure of the full length 3’ UTR implied that these sites may exist in open, single stranded (SS) loops (Fig. 8 B).

57

A.

B.

Fig. 8 (A) Alignment of the 3’ UTR cDNA sequence of CYP2A5 and CYP2A6. Hyphens indicate gaps in the alignment. Identical nucleotides are marked using a gray box. The AG-rich blocks I and II in the CYP2A6 sequence are indicated by a solid line, and the CYP2A5 71-nucleotide cis-element described by Tilloy-Ellul et al. [116] and Geneste et al. [167] is delineated by a dotted line. (B) The predicted mRNA secondary structure of the CYP2A6 mRNA. The locations of block I and II are shown.

58

hnRNP A1 Binds to the 3’ UTR of CYP2A6 mRNA (Paper II) We wanted to test if hnRNP A1 interacted with the 3’ UTR, and if so, to find the location of the binding site(s). Using human hepatocyte nuclear or cyto-plasmic extracts, we performed RNA-protein interaction studies via ultravio-let cross-linking (UVXL) and were able to observe five distinct protein com-plexes that bound the full length 3’ UTR of the human CYP2A6 gene. Of note were one complex, mostly cytoplasmic, with an apparent molecular mass of 54 kDa, and a mostly nuclear complex of 34/37 kDa. The binding of both of these complexes was inducible in the cytoplasmic compartment by Act D treatment. In addition, the 34/37 kDa complex changed subcellular localization from the nucleus to the cytoplasm during these treatments (Fig. 9 A). We positively identified the 34/37 kDa complex as hnRNP A1 by immunoprecipitation and partial trypsin digestion. Therefore, the results strongly suggest that hnRNP A1 interacts with the 3’ UTR of human CYP2A6 mRNA, and that this interaction is induced by transcriptional dis-turbance.

In order to map the location of the hnRNP A1 complexes on the mRNA, we used a series of PCR created fragments of the 3’ UTR as templates for in vitro transcription of radioactive RNA probes. The mapping results from these studies suggested that the central 111 nucleotides of the CYP2A6 3’ UTR, containing the AG rich block I, are most important for the binding of hnRNP A1. However the data also suggested that the intact secondary struc-ture may also be important for full binding activity.

The CYP2A6 mRNA is Post-transcriptionally Stabilized in a Manner Similar to the Mouse Gene (Paper II). The mouse ortholog of CYP2A6 mRNA is post-trancriptionally stabilized in vivo by treatment with the hepatotoxin pyrazole, most likely by changes in the length of the poly(A) tail [167]. In addition, our work in paper I suggests that the mouse CYP2A5 mRNA is also stabilized by the transcriptional in-hibitor Act D, concurrent with increased binding of hnRNP A1 to its 3’ UTR in the cytoplasm.

We were interested in knowing whether or not the human CYP2A6 gene displayed a similar post-transcriptional regulation mechanism. To this end, we treated primary human hepatocytes with Act D, and measured the effect on mRNA levels of CYP2A6 or a control P450 gene, CYP2B6. CYP2B6 is a P450 isoform known to be regulated primarily at the transcriptional level, and to have relatively stable mRNA [175]. Using semi-quantitative RT-PCR, we showed that CYP2A6 mRNA was stabilized by Act D treatment, while the levels of CYP2B6 mRNA remained unchanged (Fig. 9 B and C).

59

Together, these results suggest that CYP2A6 mRNA is post-transcriptionally stabilized in a manner similar to murine gene, via the action of hnRNP A1.

A. B.

C.

Fig. 9 The human CYP2A6 mRNA is stabilized in a similar fashion to the murine CYP2A5. (A) UV cross-linking using the radiolabeled 234-nucleotide probe and cytoplasmic or nuclear extracts from untreated or treated (4 μM Act D, 24 h) pri-mary human hepatocytes. (B) CYP2A6 mRNA is stabilized in response to interrup-tion of transcription with Act D. Primary human hepatocytes were treated for 24 h with Act D or carrier only, and RNA was prepared. Semi-quantitative duplex RT-PCR was then performed. (C) Densitometric analysis of CYP2A6 and CYP2B6 mRNA expression normalized to �-actin signal.

Of particular interest to these findings, it was recently found by Wang et.

al.[120] that a polymorphism in the 3'-UTR region, known as the CYP2A6*1B allele, increased native CYP2A6 enzyme activity in human liver when compared to other CYP2A6 allelic variants. By using luciferase-2A6 3’ UTR constructs, they were able to find that the 3' UTR CYP2A6*1B constructs caused higher reporter gene activity and increased mRNA stabili-zation when compared with other alleles. The single nucleotide polymor-

60

phisms important for this effect were tracked to an area 3’ of the AG- rich region II described above [120]. Although it is unclear whether hnRNP A1 is directly involved in this process, the work of Wang et. al. further confirms that the human gene contains a destabilization element within the 3’ UTR, very similar to its murine counterpart.

The Tumor Suppressor p53 is Down-regulated by hnRNP C1/C2 via two Alternate Mechanisms (papers III-IV).

DNA Damaging Agents and Interruption of Transcription Cause a Massive Increase in Binding Activity of hnRNP C1/C2 Towards p53 mRNA (Paper III).

We hypothesized that conditions which induce p53 activation may induce mRNA binding proteins to interact with the coding region of its mRNA. Therefore, we tested the effect of two known p53 inducers on mRNA-protein interactions; the cytostatic agent cisplatin, and the transcriptional inhibitor Act D [22, 176]. Using ultraviolet cross-linking (UVXL), we found that treatment with cisplatin in HepG2 cells for 6 hours at physiologi-cally relevant concentrations [177] increased the interaction of a 41/43 kDa complex towards the full length p53 coding region mRNA in both the nu-cleus and the cytoplasm (Fig.10). Of note, we found that Act D treatment not only induced the same complexes, but in fact induced them to a much greater extent than cisplatin, thus suggesting transcriptional disturbance as a trigger for binding. We positively identified the proteins within this induced complex as hnRNP C1 and hnRNP C2 by a series of immunoprecipitation experiments. The Act D induced binding was most apparent in the cyto-plasmic compartment (Fig. 11 B “UVXL”), but also present in the nucleus (Fig. 11 A, “UVXL”), and was sensitive to phosphorylation changes in the protein extract. A kinetic investigation of the binding revealed that the in-duction was time dependent, was greatly increased by 6 hours of treatment with Act D, reached a maximum binding activity at 24 hours, and was there-after decreased in the cytoplasmic, but not the nuclear, compartment.

Significantly, we found that the induced binding was not only present in

transformed HepG2 cells, but also found in primary human hepatocyte ex-tracts, thus suggesting that the effect was a general cellular mechanism and not specific for cancer cells.

61

Fig. 10 The effect of the DNA damaging agent cisplatin on the 41 and 44 kDa com-plexes bound to p53 mRNA. HepG2 cells were treated (+) or untreated (-) for 6 hours with 16 μg/ml cisplatin. 5 μg of nuclear (Nuc), and 10 μg of cytoplasmic (Cyt) extracts are used in the indicated UV-cross-linking experiments with the full length coding region of p53. The 41/44 kDa complexes are indicated.

Of note, we also observed the transient induction of a cytoplasm specific

43 kDa protein recognized by the p53 antibody when the cells were treated with Act D for 6 hours (Fig. 11 B, “p53”) The identity of the protein was not ascertained in the study (paper III), but because the antibody recognizes the N-terminus of the p53 protein, it is not likely to be an N-terminal trunca-tion resulting from known alternative translational start sites [178-180], as these variants lack the proper epitope.

62

A.

B.

Fig. 11 The Effects of Act D on hnRNP C1/C2 binding (UVXL) or p53 and hnRNP C1/C2 protein levels (WB) in the nucleus (A) and cytoplasm (B) of HepG2 cells. The cells are treated with Act D (+) or carrier only (-) for the indicated times. The location of the p53 and hnRNP C1/C2 proteins are indicated. The 85 kDa fragment of PARP-1 cleavage by caspase-3 in the nuclear compartment is shown. The p53-related protein in the cytoplasmic compartment is indicated by “p43”.

63

The Cytoplasmic Levels and Binding Activity of hnRNP C1/C2 are Induced by Short term Act D Treatment, and Then Reduced During Apoptosis (Paper III-IV). The results showed that short term (5-6 hrs) treatment with Act D caused the total (paper IV) and cytoplasmic (paper III) levels of hnRNP C1/C2 to in-crease (Fig. 11 B, “C1/C2”). The concentration of Act D used in these stud-ies is known to completely abolish RNA pol II dependent transcription [29]. Thus, any effects we observed must be post-transcriptional.

It is known that hnRNP C is actively transported from the nucleus to the cytoplasm in response to pro-apoptotic signals from treatment with TNF-� or PMA [60]. However, because total levels of hnRNP C are also increased in our experiments (paper IV), this explanation is unlikely to be a sole cause for our observations. Therefore, the findings suggest that the majority of the cytoplasmic induction of hnRNP C1/C2 is related either to increased transla-tion of the transcript, or increased protein stabilization of hnRNP C1/C2 within that compartment.

Of great interest for this thesis, recent evidence indicates hnRNP C pro-teins are induced post-transcriptionally by p53 after treatment with the DNA damaging drug mitomycin c (MMC) [97]. It is known that Act D induces the proteins levels and activation state of p53 [22, 23]. Thus, although un-confirmed in the studies included in this thesis, it is plausible that Act D, like MMC, causes a p53 dependent post-transcriptional induction of hnRNP C1/C2.

Importantly, we observed that longer treatment times with Act D (e.g. 48 hrs), resulted in a decrease of both the cytoplasmic hnRNP C1/C2 protein levels and its binding activity towards p53 mRNA (Fig. 11 B “C1/C2”, “UVXL”). This reduction occurred concurrent with the activation of cas-pase-3 (Fig. 11 A “PARP”), an indicator of ongoing apoptosis, in the nu-cleus.

Thus, the findings show that while short term treatment with Act D in-duces both the binding activity and cytoplasmic levels of hnRNP C1/C2 post-transcriptionally, long term treatment that results in apoptosis and cas-pase-3 activation reduces it.

64

Mapping of the hnRNP C1/C2 Binding Sites (Paper III)

By using a series of 3’ truncations, we were able to map the coding region binding site to the first 101 nucleotides downstream of the first start codon.

Of note, this region was recently found to contain alternative translational start sites [178-180], and it is suggested that there is a coding region IRES sequence that may control the choice of translational start sites from within this 101 nucleotide region [181]. Further, this 101 nt sequence lies directly downstream of a known IRES element within the 5’ UTR that increases the translation of p53 in response to DNA damage caused by etoposide [182]. Thus, the coding region fragment we found to interact with hnRNP C1/C2 is highly implicated in post-transcriptional regulation of p53, in particular through IRES-dependent translational processes.

The hnRNP C proteins are known to bind U rich sequences [183]. There-fore, we mutated several sites of poly(U) within the 5’ UTR and first 101 nt of the mRNA using site directed mutagenesis in order to more precisely map the hnRNP C binding activity (Fig. 12, A and B). This approach revealed two binding sites for hnRNP C1/C2, one within the 5’ UTR, and the other within the coding region, 55 nt downstream of the primary start codon at nucleotide U308. A silent point mutation in either site, but in particular U308, greatly reduced the binding activity of hnRNP C1 to the p53 mRNA (Fig. 12 B).

65

Fig. 12 The mapping of the hnRNP C1/C2 binding sites. (A) The 258 nt sequence used to make the probes in UV cross-linking experiments. The 5’ UTR is indicated by italics, and the first known translational start codon for p53 is indicated. The locations of mutations A, B (identical with U308C), and C are indicated in bold. The critical point mutation for cytoplasmic binding, mutation U308C, is circled. (B) UV cross-linking experiments using the mutated sequences and Act D-induced cy-toplasmic (Cyt) or nuclear (Nuc) extracts. The complexes formed with equimolar amounts of the radioactive non-mutated probe (WT), and probes containing muta-tion A, B or C are indicated.

66

The Function of the hnRNP C1/C2 Binding Sites on p53 mRNA (Papers III-IV)

Site directed mutation of the major binding site down-regulates expression of a chimeric reporter gene (Paper III). We created a chimeric reporter gene by cloning the luciferase gene in frame downstream of 258 bp of the p53 cDNA sequence (Fig. 13 A). This se-quence contains the 5’ UTR and part of the p53 coding region, including the two previously identified hnRNP C1/C2 binding sites. We found that the silent point mutations which cause a loss of hnRNP C binding activity also caused decreased expression of the luciferase reporter gene (Fig. 13 B). Mutation of U308 had the greatest impact, decreasing overall expression by 50%. Therefore, the data suggest that these hnRNP C1/C2 binding sites, in particular U308, are positive expression elements for the p53 mRNA.

luciferasep53N C

57 aa

Chimeric p53-luc protein

luciferasep53 3’5’ CMV Promoter

258 bp

luciferasep53

nucleotide U308

Cap AAAA(n)

A.

B.

0

0.5

1

1.5

2

2.5

Act D siRNA siRNA + Act D

Treatment

Fold

Cha

nge

vs U

ntre

ated

WTMut

Mutation

C.

Fig. 13 The effect of point mutation and hnRNP C1/C2 knockdown on the expres-sion of a chimeric p53-luciferase reporter gene. (A) A scheme representing the plasmid (5’p53luc), mRNA transcript, and chimeric protein product of the luciferase

67

reporter. The location of the silent point mutation U308C, a major binding site for hnRNP C1/C2 in the p53 coding region, is indicated. (B) The effect of site directed mutations on reporter expression in HepG2 cells. 24 hrs after reporter transfection, HepG2 cells were treated with Act D for 6 hrs. The non-mutated reporter gene is indicated by “WT”. “A”, “B”, and “C” refer to the previously described mutants (see Fig. 12). (C) Two distinct mechanisms exist for induction of p53 via hnRNP C1/C2. Fold induction of luciferase activity in response to various treatments is shown. The reporter containing an intact hnRNP C1/C2 binding site is indicated by “WT”. The reporter containing the point mutation U308C, which destroys binding, is indicated “Mut”. The cells were treated with either non-targeting siRNA for 60 hours, fol-lowed by 5 hours treatment with Act D (Act D), siRNA against hnRNP C1/C2 fol-lowed by vehicle only (siRNA) or siRNA against hnRNP C followed by Act D (siRNA + Act D). Each respective reporter is normalized to its own control (non-targeting siRNA only) luciferase activity.

The role of hnRNP C1/C2 is to repress p53 expression through two, distinct, mechanisms (Paper III and IV).

In order to elucidate the role of hnRNP C1/C2 on p53 expression, we chose a strategy using knockdown of hnRNP C1/C2 by small interfering RNA (siR-NA), followed by measurement of native p53 mRNA levels via quantitative RT-PCR, and protein levels with western blot. Further mechanistic data was obtained by measuring the luciferase expression of two reporter genes. The first contained a wild type hnRNP C1/C2 binding site at U308, and the other contained the silent point mutation U308C, which destroys the hnRNP C1 /C2 binding activity at this site (Fig 13 A). We found that hnRNP C1/C2 knockdown significantly increased both the mRNA and the protein levels of native p53 in HepG2 cells (Fig. 14, B and C). The reporter gene experi-ments suggested that this effect was mediated by the first 258 nt of the p53 mRNA, as the luciferase reporter gene containing this sequence was induced in an identical fashion to the native p53 (Fig. 13 C, “siRNA”). Importantly, both wild type (WT) and mutant (Mut) reporter genes were induced identi-cally, thus, the effect was dependent upon another site within this sequence rather than U308.

68

HSP-90

p53

Time (h) 24 48 72

siRNA - + - + - +

B. C.

A.

0

1

23

4

5

6

78

9

10

CTR siRNA

Fold

Cha

nge

p53

Prot

ein

0

1

2

3

4

5

6

7

8

CTR siRNA

Fold

Cha

nge

mR

NA

24 hours48 hours72 hours

24 hours48 hours72 hours

0

1000

2000

3000

4000

5000

6000

7000

CTR CHX Act D

Cel

l Via

bilit

y (a

rbitr

ary

units

)

- CTR

siRNA

(**)(*)

D.

Fig. 14 Knockdown of hnRNP C1/C2 induces p53 mRNA and protein. (A) West-ern blot of HepG2 cells treated with siRNA against hnRNP C1/C2 (+) or non-targeting siRNA (-) for the indicated times. The location of the loading control (HSP-90) and p53 are indicated. Fold change in protein levels (B) measured via western blot or mRNA levels of p53 (C) measured with quantitative RT-PCR. (D) siRNA knockdown of hnRNP C1/C2 reduces cell survival dependent upon denovo translation. Cells were treated for 48 hours with non-targeting siRNA (-CTR) or siRNA against hnRNP C1/C2 (siRNA), followed by 20 hours of treatment with 1μM of the translational inhibitor cycloheximide (CHX), or Act D (Act D) and cell viabil-ity measured via ATP levels.

69

We were interested in how hnRNP C regulates p53 during conditions of transcriptional disturbance, as it is during these conditions that the highest binding activity of hnRNP C towards p53 mRNA is observed (see Fig. 11, “UVXL”). We treated HepG2 cells with Act D for 5 hours and observed, as expected, the post- transcriptional induction of native p53 protein levels (Fig. 15 B). Strikingly, neither reporter gene was inducible by Act D in the same manner as native p53, suggesting they are not subject to the HDM-2/ubiquitin pathway (Fig. 13 C “Act D”).

Notably, knocking down hnRNP C prior to Act D treatment resulted in a 2 fold additional increase in native p53 protein levels (Fig 15 B, “siR-NA+Act D”). This extra induction, above and beyond that observed with Act D alone, was echoed by the reporter gene system (Fig. 13 C). However, the reporter gene containing the wild type U308 binding site was induced identically to wild type p53, while the reporter containing the mutant binding site (U308C) was not induced (Fig. 13 C “siRNA+Act D”). This induction is highly dependent upon the mRNA, but not the protein sequence because the point mutation U308C is silent and therefore, both reporters lead to iden-tical protein products.

Act D - + +- - +siRNA

HSP-90

p53

B.

A.

C.

00.5

11.5

22.5

33.5

44.5

CTR Act D siRNA +Act D

Fold

Cha

nge

p53

prot

ein

leve

l

0

0.25

0.5

0.75

1

1.25

CTR Act D siRNA + Act D

Fold

Cha

nge

mR

NA

Fig. 15 hnRNP C1/C2 knockdown induces p53 protein levels post-transcriptionally. (A) Western blot of HepG2 cells treated with siRNA (+) or non-targeting siRNA (-) for 72 hours followed by Act D (+) or carrier only (-) for 5 hours. The location of the loading control (HSP-90) and p53 are indicated. Fold change in protein levels (B) and mRNA levels (C) of p53 after treatment with carrier only plus non-targeting siRNA (CTR), Act D and non-targeting siRNA (Act D), or Act D in combination with hnRNP C1/C2 knockdown (siRNA + Act D).

70

Taken together, these data suggest that hnRNP C1/C2 down-regulates p53

induction through two distinct mechanisms. One mechanism, active during normal cellular conditions, is not dependent upon U308 and is instead de-pendent upon the 258 nt p53 fragment included in the reporter gene. The other mechanism, active during transcriptional inhibition, is highly depend-ent on U308. Of note, it is during these conditions that the cytoplasmic lev-els of hnRNP C1/C2 are increased (paper III), and the hnRNP C1 binding to U308 is induced (see Fig. 11 B).

In summary, the combined evidence suggests that hnRNP C1/C2 re-presses p53 expression using two distinct mechanisms, the choice of which depends upon the transcriptional state of the cell.

A Working Model of hnRNP C1/C2 Dependent Regulation of Cell Survival (Paper III and IV).

Although further study is needed to completely describe the stress in-duced repression mechanism centered on the U308 site, many points are clear. For example, the mechanism takes place post-transcriptionally, and appears to be independent of protein stabilization pathways, because it is solely dependent upon the reporter gene mRNA sequence, but not that of the protein product. Further, unlike native p53, neither reporter displays induc-tion by Act D alone (Fig. 13 C). The mechanism is hnRNP C1/C2 depend-ent, as the wild type reporter, like native p53, displays an induction when hnRNP C levels are reduced and simultaneous transcriptional disturbance occurs. The data from the measurement of native p53 mRNA levels (Fig. 15 C) during these conditions rules out a repression mechanism based on mRNA stability changes. Therefore, two possible hnRNP C dependent mo-lecular mechanisms must be considered; decreased mRNA transport to the cytoplasm of the existing pool of p53 mRNA, or decreased translation of p53 mRNA. It is possible that both repression mechanisms exist simultaneously. However, cell survival data presented in paper IV (Fig. 14 D), and the in-creased cytoplasmic levels and binding activity of hnRNP C1/C2 during these conditions (paper III) strongly suggest that translational processes may play a role in the mechanism(s) involved.

Several other pieces of evidence, combined with the results in papers III and IV, allow us to propose a working model of regulation of cell survival via hnRNP C1/C2 dependent down-regulation of p53. According to this model, one function of hnRNP C1/C2 would be to keep p53 expression in check during the initial stages of genotoxic stress, known to cause distur-bances in RNA pol II dependent transcription [144]. The proposed model would theoretically have the advantage of not relying upon transcription

71

during conditions where it is disturbed, and would provide time for DNA damage repair to take place by delaying apoptosis. During normal transcrip-tional conditions, (Fig. 16 A) p53 mRNA levels would be kept low by nu-clear hnRNP C1/C2 acting via the 258 nt mRNA sequence, and independ-ently of the coding region binding site U308 (paper IV). Although the exact mechanism for the hnRNP C dependent repression of p53 during normal conditions requires further research, the subcellular localization of hnRNP C (paper III and [50]) and the mRNA measurements of native p53 in paper IV (Fig. 14 C) suggest that during normal conditions, down-regulation of p53 mRNA levels in the nucleus are involved. Simultaneously in the cytoplasm (Fig. 16 A), HDM-2 would reduce the levels of p53 via increased ubiquitina-tion [13], independently of hnRNP C1/C2. During conditions of genotoxic stress, however, the regulation of p53 via hnRNP C1/C2 would shift to post-transcriptional dependence on U308 (paper IV and Fig. 16 B), possibly through decreased translational activity of p53 mRNA. As cytoplasmic lev-els of hnRNP C1/C2 are increased by genotoxic stress (paper III, IV, and [97, 170]), and the binding of hnRNP C1/C2 towards p53 mRNA is induced (paper III, and Fig. 11 B “UVXL”) a negative feedback loop would be estab-lished which would prevent the full induction of p53, thus delaying the onset of apoptosis. Simultaneously, increased IRES-dependent translation of XIAP by hnRNP C1/C2 would further potentiate the anti-apoptotic effect [47, 98]. Once apoptosis is initiated, however (Fig. 16 C), massive decreases in hnRNP C1/C2 levels by caspase-3 and ICE proteases [64, 65] would re-lease this block, thus ensuring the continued expression of p53 and the am-plification of the apoptotic process. Cytoplasmic p53 activity at the mito-chondria [140, 162], in combination with the reduction of IRES-dependent translation of XIAP due to loss of hnRNP C1/C2, [47, 98, 154] would simul-taneously lead to accelerated apoptosis, thereby even further reducing hnRNP C1/C2 levels. Thus, a positive apoptotic feedback loop would ulti-mately be established due to the loss of hnRNP C1/C2.

It should be noted that this model, although consistent with the data in paper III and IV, as well as the known functions of hnRNP C1/C2, is a work in progress. It is meant to consolidate what is known about the cell survival and anti-apoptotic roles of hnRNP C1/C2 with the work presented in this thesis.

72

AAA(n)

+

+

Nucleus Cytoplasm

Normal State

DNA

hnRNPC

p53 mRNA

AAA(n)

AAA(n)

Ribosome

NH3

p53 HDM-2

Ubiquitin

p53 Proteolysis via Proteosome[13]

A.

B.

C.

p53 mRNA levels decreased (paper IV)

Nucleus Cytoplasm

AAA(n)

AAA(n)

NH3

XP

P

P

P AAA(n)

hnRNP C1/C2 binds to U308 site,

inhibits p53 expression(paper III,IV)

AAA(n)

Transcriptional Disturbance

Apoptosis

Nucleus Cytoplasm

AAA(n)

NH3

X

P

P

P

AAA(n)

Caspase 3 Destroys hnRNP C1/C2(paper III,[64,65])

Caspase-3

P

Mechanism ?

HDM-2 release

Protein Stabilization

Cytochrome C release

Caspase 9 activation

Caspase 3,6,7 activation

P

Translation induced(paper IV)

? p53 levels maintained/induced

(paper IV)

Positive Apoptotic Feedback Loop

P

p53 Induces cytoplasmic levels of hnRNPC1/C2 (paper III, IV, [97,171])

hnRNP C1/C2 induces IRES translation of XIAP

[47,98]

Inhibition of Cytochrome C Release

XIAP

Negative Feedback Loop

p53

XIAP levels decreased

X

Activated p53 translocates to nucleus, attempts to act as a transcription factor.

+

+

++

Putative positive regulator

P

(paper IV)

?

?

hnRNP C1/C2 inhibits translation(paper IV)

Nuclear binding. Function ? (paper III, IV)

?

[140,162]

Fig. 16 A working model of hnRNP C1/C2 dependent regulation of cell survival. (A) Normal state of the cell. hnRNP C1/C2 would repress mRNA levels of p53 in the nucleus. Simultaneously, p53 protein is degraded in the cytoplasm via the HDM-2 pathway. (B) Early transcriptional disturbance, as would be encountered by treatment with genotoxic agents. Cytoplasmic levels of hnRNP C1/C2 are in-creased, XIAP translation increased via hnRNP C1/C2, and hnRNP C1/C2 simulta-neously prevents full induction of p53 by binding the U308 site. The proposed neg-ative feedback loop tempering p53 induction is indicated. (C) Apoptosis. The hnRNP C1/C2 proteins are destroyed by ICE related and caspase-3 proteases. The control of p53 and XIAP via hnRNP C1/C2 is released, and a positive apoptotic feedback loop is created which would result in further amplification of apoptotic signals.

73

Conclusions

The findings included in this thesis uncover novel roles for the hnRNP C1/C2 and hnRNP A1 proteins in the regulation of two stress responsive genes. In summary:

� The data are consistent with a model whereby hnRNP A1 controls

not only the mRNA stability of the CYP2A5 transcript, but also the transcription of the Cyp2a5 gene in the proximal promoter. The choice of regulatory mechanism appears to be dependent on the transcriptional state of the cell.

� The findings suggest that the human CYP2A6 mRNA is post-

transcriptionally stabilized in a manner similar to its murine ortholog, by conditions known to activate hnRNP A1. The hnRNP A1 protein interacts with the 3’ UTR via two AG rich cis sites in re-sponse to treatment with Act D treatment of human hepatocytes.

� We found that hnRNP C1/C2 strongly interacts with the p53 mRNA

in response to DNA damaging agents or transcriptional disturbance on two sites; one within the 5’ UTR, and a second, major site, down-stream of the translational start site. These sites appear to be impor-tant for the overall expression of p53, as well as sites of hnRNP C binding activity.

� The results are consistent with a role of hnRNP C1/C2 as a repressor

of p53 expression via two distinct mechanisms. The choice of mechanism appears to be dependent upon the transcriptional state of the cell. One of these repressive mechanisms appears to be highly dependent upon the major cis binding site for hnRNP C1/C2, U308, but the other is independent of this site.

� The data suggest that the interruption of ongoing translation is suffi-

cient to partly reverse the loss of cell viability we observed when hnRNP C1/C2 is knocked down, implicating de novo translational processes in the mechanisms above.

74

� We propose a working model whereby p53 and hnRNP C1/C2 con-trol each other in a negative post-transcriptional feedback loop, which may serve to temper the initial p53 induction response until the onset of apoptosis.

75

Acknowledgements

The work presented in this thesis was carried out at the Department of Phar-maceutical Biosciences, Division of Biochemistry, Faculty of Pharmacy, Uppsala University, Sweden.

Several people have contributed to this work, to whom I would like to ex-

press my gratitude: Professor Matti Lang, for taking a chance by accepting me into his lab,

and never balking at a high risk project. I thank you for your positive atti-tude, discussions and insight into not only science, but also the world around us. Your guidance has allowed me to reach where I am today.

Dr. Françoise Raffalli-Mathieu, for being a wonderful co-supervisor.

Your help has been invaluable on my road towards a Ph.D. You have been a wonderful sounding board for molecular mechanistic ideas, as few grasp complicated mechanisms in the way that you do.

I thank the both of you for an ability to resist the temptation to lock scien-

tific ideas into a rigid box, and for instead keeping an open mind. This abil-ity has been of great importance for several portions of the project. Not to mention that without your help, my articles would have been the length of phonebooks!�

Dr. Tina Glisovic deserves special thanks as a co-author, for introducing

me to CYP enzymes, and allowing me to be a part of studies that comprise the first paper in this thesis.

My former roommate Dr. Malin Söderberg, for being a co-author, and

many interesting discussions. Your support has been appreciated! (soon to be Dr.) Silvia Visoni, for always being willing to share your muf-

fin during coffee breaks, your support, and just plain being a nut. � Angela Lannerbro, for keeping the wheels of the lab turning, as well as

your technical assistance.

76

Hanna Pettersson, for a great attitude and helping to fix my “Swenglish”. All the other present members of the Division of Biochemistry, in no par-

ticular order; Dr. Ronnie Hansson, Prof. Kjell Wikvall, Dr. Maria Norlin, Maria Ellfolk, and Johan Lundqvist for nice discussions.

The former members of the department: Dr. Fardin Hosseinpour, Dr. Mo-

nica Lindell, Dr. Kerstin Lundell, and last but not least Dr. Wanjin Tang. May your careers be fruitful.

Magnus Jansson, for not only helping me out with my computer, but also

proving to be a worthy opponent in the never ending debate about PC vs. Mac. (By the way, because I get to write what I want here, PC is definitely the way to go!). �

I would also like to thank all of the research students I met during my

time in the department for a great experience, allowing me to develop my supervisory skills, and helping me to realize that sometimes the simplest questions were actually the most important.

The students I have met during my lectures, for showing me a side of my-

self that I never thought existed; a love for teaching. My thanks go out to my friends in Sweden, for your support and good

times. Everyone else who cared, supported, or was involved in this thesis, or my

Ph.D. project in any way. You know who you are. My partner, Damla Ba�ak Altu for your support, and for putting up with

me during this thesis (not an easy feat �). A special thanks also goes out to a fellow scientist and fervent supporter, Ilkay Altu.

Last, but definitely not least, a great deal of gratitude goes out to my fam-

ily, especially my father Herb, my mother Carol, and my little sister Cate, for being there for me, through good times and bad, and loving me uncondition-ally. I couldn’t have done it without you. Love you guys!

Uppsala, Sweden, April 2008 Kyle

77

Abstract

The family of proteins known as heterogeneous nuclear ribonucleoproteins (hnRNPs) is large and diverse. Often, one and the same hnRNP will perform multiple cellular functions, leading to their description as “multifunctional proteins”. The two hnRNPs known as hnRNP A1 and hnRNP C1/C2 are multifunctional proteins found to affect the transcription, splicing, stability, and translation of specific genes’ mRNA. They are implicated in carcino-genesis, apoptosis, and DNA damage response mechanisms.

The aims of this thesis were to study the hnRNP A1 and hnRNP C1/C2 dependent regulation of two highly stress responsive genes, the tumor sup-pressor p53 and the cytochrome P450 enzyme Cyp2a5/CYP2A6. We identi-fied hnRNP C1/C2 as a DNA damage induced binding protein towards the coding region of p53 mRNA, and found that while a specific cis binding site appears to have a positive function in p53 expression, interaction of hnRNP C1/C2 with this site represses the expression. The data suggest that two distinct molecular mechanisms exist for the down-regulation of p53 by hnRNP C1/C2. One mechanism, active during transcriptional stress, is de-pendent upon the aforementioned site, and the other, independent. We dis-cuss how hnRNP C1/C2 dependent repression of p53 may play a role in apoptosis.

The data presented here further suggest that the transcriptional and post-transcriptional processes controlling the expression of the murine Cyp2a5 gene are linked via hnRNP A1, by performing functions in the nucleus as a transcription factor, or in the cytoplasmic compartment as a trans-acting factor bound to the 3’ UTR of the mRNA as needed. Our studies of the hu-man ortholog of this gene, CYP2A6, suggest that this gene is regulated post-transcriptionally in a manner similar to that of its murine counterpart, via changes in mRNA stability and interaction of hnRNP A1 with its 3’ UTR.

78

Populärvetenskaplig Sammanfattning

hnRNP (heterogeneous nuclear ribonucleoprotein) proteiner har visat sig vara viktiga innom en mängd olika cellulära processer. Det är känt sedan länge att dessa återfinns och verkar i cellkärnan där de hjälper till med bil-dandet av budbärande RNA (mRNA). På senare tid har vetenskapen förståt att dessa proteiner även har ett flertal viktiga genreglerande funktioner, både inuti kärnan och utanför. hnRNP proteiner kan till exempel ändra på uttryck av våra gener genom att binda till DNA, eller genom att binda till mRNA:t och på så sätt påverka hur mycket protein skapas från en specifik gen.

För att förstå dessa multifunktionella proteiner bättre har vi använt oss av två olika gener som modell, tumörsuppressorn p53 och det läkemedelsmeta-boliserande enzymet CYP2A5/2A6. Dessa modellgener är speciella i.o.m att de ökar sitt uttryck om cellen blir stressad av t.ex DNA skada, UV- ljus, eller oxidativ stress, m.m. Samma typ av förhållanden har även visat sig aktivera hnRNP proteiner.

Tumörsuppressorn p53 är viktig för att förhindra upkomsten av cancer i människa. Om en människa födds utan en fungerande p53 gen, eller genen slås av på annat sätt, ökar dramatiskt risken att utveckla cancer under livsti-den. Det är därför viktigt att förstå hur denna gen slås av och på samt de molekylära mekanismerna som ligger bakom.

Vi har upptäckt att ett hnRNP protein, hnRNP C1/C2, binder till p53’s mRNA och att detta tycks leda till att en lägre mängd p53 produceras. Detta fenomen kan ha viktiga implicationer i uppkomsten av cancer och cellöver-levnad.

Det läkemedelsmetaboloserande enzymet CYP2A6 bryter ned bland annat nikotin och vissa carcinogeniska substanser i människa. I mus återfinns detta enzym men heter då CYP2A5. I denna avhandlig presenteras arbeten som visar att proteinet hnRNP A1 spelar en dubbelsidig roll i uttrycket av mus-genen Cyp2a5, både i kärnan och i cytoplasman. Resultaten visar också på att den humana versionen, CYP2A6, regleras på ett liknande sätt som hos mus, genom interaction av hnRNP A1 med mRNA:t. Forskningen som presenteras i denna avhandling kan ha stora konsekvenser för förståelsen av hur våra gener slås av eller på i respons till stress samt även de molekylära processerna som leder till cancer.

79

References

1. Le Hir, H., et al., The spliceosome deposits multiple proteins 20-24 nucleotides upstream of mRNA exon-exon junctions. EMBO J, 2000. 19(24): p. 6860-9.

2. Isken, O. and L.E. Maquat, Quality control of eukaryotic mRNA: safeguarding cells from abnormal mRNA function. Genes Dev, 2007. 21(15): p. 1833-56.

3. Beelman, C.A. and R. Parker, Degradation of mRNA in eukaryotes. Cell, 1995. 81(2): p. 179-83.

4. Balatsos, N.A., et al., Inhibition of mRNA deadenylation by the nu-clear cap binding complex (CBC). J Biol Chem, 2006. 281(7): p. 4517-22.

5. Shaw, G. and R. Kamen, A conserved AU sequence from the 3' un-translated region of GM-CSF mRNA mediates selective mRNA deg-radation. Cell, 1986. 46(5): p. 659-67.

6. Pain, V.M., Initiation of protein synthesis in eukaryotic cells. Eur J Biochem, 1996. 236(3): p. 747-71.

7. Kozak, M., Structural features in eukaryotic mRNAs that modulate the initiation of translation. J Biol Chem, 1991. 266(30): p. 19867-70.

8. Yamasaki, S. and P. Anderson, Reprogramming mRNA translation during stress. Curr Opin Cell Biol, 2008.

9. Spriggs, K.A., et al., Internal ribosome entry segment-mediated translation during apoptosis: the role of IRES-trans-acting factors. Cell Death Differ, 2005. 12(6): p. 585-91.

10. Pyronnet, S., J. Dostie, and N. Sonenberg, Suppression of cap-dependent translation in mitosis. Genes Dev, 2001. 15(16): p. 2083-93.

11. Bonnal, S., et al., Heterogeneous nuclear ribonucleoprotein A1 is a novel internal ribosome entry site trans-acting factor that modulates alternative initiation of translation of the fibroblast growth factor 2 mRNA. J Biol Chem, 2005. 280(6): p. 4144-53.

12. Kim, J.H., et al., Heterogeneous nuclear ribonucleoprotein C modu-lates translation of c-myc mRNA in a cell cycle phase-dependent manner. Mol Cell Biol, 2003. 23(2): p. 708-20.

13. Honda, R., H. Tanaka, and H. Yasuda, Oncoprotein MDM2 is a ubiquitin ligase E3 for tumor suppressor p53. FEBS Lett, 1997. 420(1): p. 25-7.

14. Harper, J.W. and S.J. Elledge, The DNA damage response: ten years after. Mol Cell, 2007. 28(5): p. 739-45.

80

15. McGowan, C.H. and P. Russell, The DNA damage response: sensing and signaling. Curr Opin Cell Biol, 2004. 16(6): p. 629-33.

16. Canman, C.E., Checkpoint mediators: relaying signals from DNA strand breaks. Curr Biol, 2003. 13(12): p. R488-90.

17. Abraham, R.T., Cell cycle checkpoint signaling through the ATM and ATR kinases. Genes Dev, 2001. 15(17): p. 2177-96.

18. Bakkenist, C.J. and M.B. Kastan, DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature, 2003. 421(6922): p. 499-506.

19. Myers, J.S. and D. Cortez, Rapid activation of ATR by ionizing ra-diation requires ATM and Mre11. J Biol Chem, 2006. 281(14): p. 9346-50.

20. Cortez, D., et al., ATR and ATRIP: partners in checkpoint signaling. Science, 2001. 294(5547): p. 1713-6.

21. Lee, J.H. and T.T. Paull, ATM activation by DNA double-strand breaks through the Mre11-Rad50-Nbs1 complex. Science, 2005. 308(5721): p. 551-4.

22. An, W.G., et al., Inhibitors of transcription, proteasome inhibitors, and DNA-damaging drugs differentially affect feedback of p53 deg-radation. Exp Cell Res, 1998. 244(1): p. 54-60.

23. Ljungman, M., et al., Inhibition of RNA polymerase II as a trigger for the p53 response. Oncogene, 1999. 18(3): p. 583-92.

24. Jung, Y. and S.J. Lippard, RNA polymerase II blockage by cisplatin-damaged DNA. Stability and polyubiquitylation of stalled poly-merase. J Biol Chem, 2006. 281(3): p. 1361-70.

25. Anindya, R., O. Aygun, and J.Q. Svejstrup, Damage-induced ubiq-uitylation of human RNA polymerase II by the ubiquitin ligase Nedd4, but not Cockayne syndrome proteins or BRCA1. Mol Cell, 2007. 28(3): p. 386-97.

26. Green, D.M., et al., Treatment of wilms tumor relapsing after initial treatment with vincristine and actinomycin D: A report from the Na-tional Wilms Tumor Study Group. Pediatr Blood Cancer, 2006.

27. Hauer, J., et al., Effective treatment of kaposiform hemangioendo-theliomas associated with Kasabach-Merritt phenomenon using four-drug regimen. Pediatr Blood Cancer, 2006.

28. Sobell, H.M., Actinomycin and DNA transcription. Proc Natl Acad Sci U S A, 1985. 82(16): p. 5328-31.

29. Perry, R.P. and D.E. Kelley, Inhibition of RNA synthesis by actino-mycin D: characteristic dose-response of different RNA species. J Cell Physiol, 1970. 76(2): p. 127-39.

30. Blagosklonny, M.V., Z.N. Demidenko, and T. Fojo, Inhibition of transcription results in accumulation of Wt p53 followed by delayed outburst of p53-inducible proteins: p53 as a sensor of transcrip-tional integrity. Cell Cycle, 2002. 1(1): p. 67-74.

31. Dreyfuss, G., V.N. Kim, and N. Kataoka, Messenger-RNA-binding proteins and the messages they carry. Nat Rev Mol Cell Biol, 2002. 3(3): p. 195-205.

81

32. Dreyfuss, G., et al., hnRNP proteins and the biogenesis of mRNA. Annu Rev Biochem, 1993. 62: p. 289-321.

33. Krecic, A.M. and M.S. Swanson, hnRNP complexes: composition, structure, and function. Curr Opin Cell Biol, 1999. 11(3): p. 363-71.

34. Stone, J.R. and T. Collins, Rapid phosphorylation of heterogeneous nuclear ribonucleoprotein C1/C2 in response to physiologic levels of hydrogen peroxide in human endothelial cells. J Biol Chem, 2002. 277(18): p. 15621-8.

35. Municio, M.M., et al., Identification of heterogeneous ribonucleo-protein A1 as a novel substrate for protein kinase C zeta. J Biol Chem, 1995. 270(26): p. 15884-91.

36. Giles, K.M., et al., The 3'-untranslated region of p21WAF1 mRNA is a composite cis-acting sequence bound by RNA-binding proteins from breast cancer cells, including HuR and poly(C)-binding pro-tein. J Biol Chem, 2003. 278(5): p. 2937-46.

37. Campillos, M., et al., Specific interaction of heterogeneous nuclear ribonucleoprotein A1 with the -219T allelic form modulates APOE promoter activity. Nucleic Acids Res, 2003. 31(12): p. 3063-70.

38. Chen, H., M. Hewison, and J.S. Adams, Functional characterization of heterogeneous nuclear ribonuclear protein C1/C2 in vitamin D resistance: a novel response element-binding protein. J Biol Chem, 2006. 281(51): p. 39114-20.

39. Rajagopalan, L.E., et al., hnRNP C increases amyloid precursor protein (APP) production by stabilizing APP mRNA. Nucleic Acids Res, 1998. 26(14): p. 3418-23.

40. Carpenter, B., et al., The roles of heterogeneous nuclear ribonucleo-proteins in tumour development and progression. Biochim Biophys Acta, 2006. 1765(2): p. 85-100.

41. Guil, S., et al., Roles of hnRNP A1, SR proteins, and p68 helicase in c-H-ras alternative splicing regulation. Mol Cell Biol, 2003. 23(8): p. 2927-41.

42. Dreyfuss, G., Structure and function of nuclear and cytoplasmic ribonucleoprotein particles. Annu Rev Cell Biol, 1986. 2: p. 459-98.

43. Barnett, S.F., T.A. Theiry, and W.M. LeStourgeon, The core pro-teins A2 and B1 exist as (A2)3B1 tetramers in 40S nuclear ribonu-cleoprotein particles. Mol Cell Biol, 1991. 11(2): p. 864-71.

44. Wilk, H.E., et al., The core proteins of 35S hnRNP complexes. Characterization of nine different species. Eur J Biochem, 1985. 146(1): p. 71-81.

45. Pollard, A.J., et al., Alternative splicing of the adenylyl cyclase stimulatory G-protein G alpha(s) is regulated by SF2/ASF and het-erogeneous nuclear ribonucleoprotein A1 (hnRNPA1) and involves the use of an unusual TG 3'-splice Site. J Biol Chem, 2002. 277(18): p. 15241-51.

46. Raffalli-Mathieu, F., et al., Heterogeneous nuclear ribonucleopro-tein A1 and regulation of the xenobiotic-inducible gene Cyp2a5. Mol Pharmacol, 2002. 61(4): p. 795-9.

82

47. Holcik, M., B.W. Gordon, and R.G. Korneluk, The internal ribo-some entry site-mediated translation of antiapoptotic protein XIAP is modulated by the heterogeneous nuclear ribonucleoproteins C1 and C2. Mol Cell Biol, 2003. 23(1): p. 280-8.

48. Stone, J.R., J.L. Maki, and T. Collins, Basal and hydrogen peroxide stimulated sites of phosphorylation in heterogeneous nuclear ribo-nucleoprotein C1/C2. Biochemistry, 2003. 42(5): p. 1301-8.

49. Wan, L., et al., Mutational definition of RNA-binding and protein-protein interaction domains of heterogeneous nuclear RNP C1. J Biol Chem, 2001. 276(10): p. 7681-8.

50. Nakielny, S. and G. Dreyfuss, The hnRNP C proteins contain a nu-clear retention sequence that can override nuclear export signals. J Cell Biol, 1996. 134(6): p. 1365-73.

51. Buvoli, M., et al., Alternative splicing in the human gene for the core protein A1 generates another hnRNP protein. EMBO J, 1990. 9(4): p. 1229-35.

52. Burd, C.G., et al., Primary structures of the heterogeneous nuclear ribonucleoprotein A2, B1, and C2 proteins: a diversity of RNA bind-ing proteins is generated by small peptide inserts. Proc Natl Acad Sci U S A, 1989. 86(24): p. 9788-92.

53. McAfee, J.G., et al., Proteins C1 and C2 of heterogeneous nuclear ribonucleoprotein complexes bind RNA in a highly cooperative fash-ion: support for their contiguous deposition on pre-mRNA during transcription. Biochemistry, 1996. 35(4): p. 1212-22.

54. Siomi, H. and G. Dreyfuss, A nuclear localization domain in the hnRNP A1 protein. J Cell Biol, 1995. 129(3): p. 551-60.

55. Weighardt, F., G. Biamonti, and S. Riva, Nucleo-cytoplasmic distri-bution of human hnRNP proteins: a search for the targeting do-mains in hnRNP A1. J Cell Sci, 1995. 108 ( Pt 2): p. 545-55.

56. van der Houven van Oordt, W., et al., The MKK(3/6)-p38-signaling cascade alters the subcellular distribution of hnRNP A1 and modu-lates alternative splicing regulation. J Cell Biol, 2000. 149(2): p. 307-16.

57. Pinol-Roma, S. and G. Dreyfuss, Shuttling of pre-mRNA binding proteins between nucleus and cytoplasm. Nature, 1992. 355(6362): p. 730-2.

58. Vautier, D., et al., Transcription-dependent nucleocytoplasmic dis-tribution of hnRNP A1 protein in early mouse embryos. J Cell Sci, 2001. 114(Pt 8): p. 1521-31.

59. Pinol-Roma, S. and G. Dreyfuss, Transcription-dependent and tran-scription-independent nuclear transport of hnRNP proteins. Science, 1991. 253(5017): p. 312-4.

60. Lee, H.H., et al., Nuclear efflux of heterogeneous nuclear ribonu-cleoprotein C1/C2 in apoptotic cells: a novel nuclear export de-pendent on Rho-associated kinase activation. J Cell Sci, 2004. 117(Pt 23): p. 5579-89.

83

61. Johnstone, R.W., A.A. Ruefli, and S.W. Lowe, Apoptosis: a link between cancer genetics and chemotherapy. Cell, 2002. 108(2): p. 153-64.

62. Kerr, J.F., A.H. Wyllie, and A.R. Currie, Apoptosis: a basic biologi-cal phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer, 1972. 26(4): p. 239-57.

63. Nunez, G., et al., Caspases: the proteases of the apoptotic pathway. Oncogene, 1998. 17(25): p. 3237-45.

64. Brockstedt, E., et al., Identification of apoptosis-associated proteins in a human Burkitt lymphoma cell line. Cleavage of heterogeneous nuclear ribonucleoprotein A1 by caspase 3. J Biol Chem, 1998. 273(43): p. 28057-64.

65. Waterhouse, N., et al., Heteronuclear ribonucleoproteins C1 and C2, components of the spliceosome, are specific targets of inter-leukin 1beta-converting enzyme-like proteases in apoptosis. J Biol Chem, 1996. 271(46): p. 29335-41.

66. Lazebnik, Y.A., et al., Cleavage of poly(ADP-ribose) polymerase by a proteinase with properties like ICE. Nature, 1994. 371(6495): p. 346-7.

67. Aznar, S. and J.C. Lacal, Rho signals to cell growth and apoptosis. Cancer Lett, 2001. 165(1): p. 1-10.

68. Pino, I., et al., Altered patterns of expression of members of the het-erogeneous nuclear ribonucleoprotein (hnRNP) family in lung can-cer. Lung Cancer, 2003. 41(2): p. 131-43.

69. Ushigome, M., et al., Up-regulation of hnRNP A1 gene in sporadic human colorectal cancers. Int J Oncol, 2005. 26(3): p. 635-40.

70. Sun, W., et al., Proteome analysis of hepatocellular carcinoma by two-dimensional difference gel electrophoresis: novel protein mark-ers in hepatocellular carcinoma tissues. Mol Cell Proteomics, 2007. 6(10): p. 1798-808.

71. Hossain, M.N., et al., Downregulation of hnRNP C1/C2 by siRNA sensitizes HeLa cells to various stresses. Mol Cell Biochem, 2007. 296(1-2): p. 151-7.

72. Ito, Y., T. Ide, and Y. Mitsui, Expressional changes in alternative splicing affecting genes during cell passage of human diploid fibro-blasts. Mech Ageing Dev, 1998. 105(1-2): p. 105-14.

73. Zhu, D., et al., Modulation of the expression of p16INK4a and p14ARF by hnRNP A1 and A2 RNA binding proteins: implications for cellular senescence. J Cell Physiol, 2002. 193(1): p. 19-25.

74. White, M.A., et al., Multiple Ras functions can contribute to mam-malian cell transformation. Cell, 1995. 80(4): p. 533-41.

75. Cohen, J.B., S.D. Broz, and A.D. Levinson, Expression of the H-ras proto-oncogene is controlled by alternative splicing. Cell, 1989. 58(3): p. 461-72.

76. Gordon, M.Y., Biological consequences of the BCR/ABL fusion gene in humans and mice. J Clin Pathol, 1999. 52(10): p. 719-22.

84

77. Iervolino, A., et al., hnRNP A1 nucleocytoplasmic shuttling activity is required for normal myelopoiesis and BCR/ABL leukemogenesis. Mol Cell Biol, 2002. 22(7): p. 2255-66.

78. Bikfalvi, A., et al., Biological roles of fibroblast growth factor-2. Endocr Rev, 1997. 18(1): p. 26-45.

79. Bonnal, S., et al., A single internal ribosome entry site containing a G quartet RNA structure drives fibroblast growth factor 2 gene ex-pression at four alternative translation initiation codons. J Biol Chem, 2003. 278(41): p. 39330-6.

80. Dang, C.V., c-Myc target genes involved in cell growth, apoptosis, and metabolism. Mol Cell Biol, 1999. 19(1): p. 1-11.

81. Lee, S.Y., et al., A proteomics approach for the identification of nucleophosmin and heterogeneous nuclear ribonucleoprotein C1/C2 as chromatin-binding proteins in response to DNA double-strand breaks. Biochem J, 2005. 388(Pt 1): p. 7-15.

82. Zhang, S., et al., DNA-dependent protein kinase (DNA-PK) phos-phorylates nuclear DNA helicase II/RNA helicase A and hnRNP pro-teins in an RNA-dependent manner. Nucleic Acids Res, 2004. 32(1): p. 1-10.

83. Ishikawa, F., et al., Nuclear proteins that bind the pre-mRNA 3' splice site sequence r(UUAG/G) and the human telomeric DNA se-quence d(TTAGGG)n. Mol Cell Biol, 1993. 13(7): p. 4301-10.

84. LaBranche, H., et al., Telomere elongation by hnRNP A1 and a de-rivative that interacts with telomeric repeats and telomerase. Nat Genet, 1998. 19(2): p. 199-202.

85. Mir, B., et al., UP1 extends life of primary porcine fetal fibroblasts in culture. Cloning Stem Cells, 2003. 5(2): p. 143-8.

86. Ford, L.P., W.E. Wright, and J.W. Shay, A model for heterogeneous nuclear ribonucleoproteins in telomere and telomerase regulation. Oncogene, 2002. 21(4): p. 580-3.

87. Ford, L.P., et al., Heterogeneous nuclear ribonucleoproteins C1 and C2 associate with the RNA component of human telomerase. Mol Cell Biol, 2000. 20(23): p. 9084-91.

88. Li, T., et al., Sumoylation of heterogeneous nuclear ribonucleopro-teins, zinc finger proteins, and nuclear pore complex proteins: A proteomic analysis. Proc Natl Acad Sci U S A, 2004.

89. Vassileva, M.T. and M.J. Matunis, SUMO modification of heteroge-neous nuclear ribonucleoproteins. Mol Cell Biol, 2004. 24(9): p. 3623-32.

90. Verger, A., J. Perdomo, and M. Crossley, Modification with SUMO. A role in transcriptional regulation. EMBO Rep, 2003. 4(2): p. 137-42.

91. Pichler, A. and F. Melchior, Ubiquitin-related modifier SUMO1 and nucleocytoplasmic transport. Traffic, 2002. 3(6): p. 381-7.

92. Seeler, J.S. and A. Dejean, Nuclear and unclear functions of SUMO. Nat Rev Mol Cell Biol, 2003. 4(9): p. 690-9.

85

93. Schwartz, D.C. and M. Hochstrasser, A superfamily of protein tags: ubiquitin, SUMO and related modifiers. Trends Biochem Sci, 2003. 28(6): p. 321-8.

94. Sachdev, S., et al., PIASy, a nuclear matrix-associated SUMO E3 ligase, represses LEF1 activity by sequestration into nuclear bodies. Genes Dev, 2001. 15(23): p. 3088-103.

95. Kim, S., G.H. Park, and W.K. Paik, Recent advances in protein me-thylation: enzymatic methylation of nucleic acid binding proteins. Amino Acids, 1998. 15(4): p. 291-306.

96. Biamonti, G., et al., Human hnRNP protein A1 gene expression. Structural and functional characterization of the promoter. J Mol Biol, 1993. 230(1): p. 77-89.

97. Rahman-Roblick, R., et al., p53 targets identified by protein expres-sion profiling. Proc Natl Acad Sci U S A, 2007. 104(13): p. 5401-6.

98. Spahn, A., et al., Concomitant Transitory Up-Regulation of X-Linked Inhibitor of Apoptosis Protein (XIAP) and the Heterogeneous Nuclear Ribonucleoprotein C1-C2 in Surviving Cells During Neu-ronal Apoptosis. Neurochem Res, 2008.

99. Camus-Randon, A.M., et al., Liver injury and expression of cyto-chromes P450: evidence that regulation of CYP2A5 is different from that of other major xenobiotic metabolizing CYP enzymes. Toxicol Appl Pharmacol, 1996. 138(1): p. 140-8.

100. Kirby, G.M., et al., Induction of specific cytochrome P450s involved in aflatoxin B1 metabolism in hepatitis B virus transgenic mice. Mol Carcinog, 1994. 11(2): p. 74-80.

101. Jounaidi, Y., et al., Overexpression of a cytochrome P-450 of the 2a family (Cyp2a-5) in chemically induced hepatomas from female mice. Eur J Biochem, 1994. 219(3): p. 791-8.

102. Koskela, S., et al., Expression of CYP2A genes in human liver and extrahepatic tissues. Biochem Pharmacol, 1999. 57(12): p. 1407-13.

103. Negishi, M., et al., Mouse steroid 15 alpha-hydroxylase gene family: identification of type II P-450(15)alpha as coumarin 7-hydroxylase. Biochemistry, 1989. 28(10): p. 4169-72.

104. Kirby, G.M., et al., Overexpression of cytochrome P-450 isoforms involved in aflatoxin B1 bioactivation in human liver with cirrhosis and hepatitis. Toxicol Pathol, 1996. 24(4): p. 458-67.

105. Camus, A.M., et al., High variability of nitrosamine metabolism among individuals: role of cytochromes P450 2A6 and 2E1 in the dealkylation of N-nitrosodimethylamine and N-nitrosodiethylamine in mice and humans. Mol Carcinog, 1993. 7(4): p. 268-75.

106. Nakajima, M., et al., Role of human cytochrome P4502A6 in C-oxidation of nicotine. Drug Metab Dispos, 1996. 24(11): p. 1212-7.

107. Abu-Bakar, A., M.R. Moore, and M.A. Lang, Evidence for induced microsomal bilirubin degradation by cytochrome P450 2A5. Bio-chem Pharmacol, 2005. 70(10): p. 1527-35.

108. Lavery, D.J., et al., Circadian expression of the steroid 15 alpha-hydroxylase (Cyp2a4) and coumarin 7-hydroxylase (Cyp2a5) genes

86

in mouse liver is regulated by the PAR leucine zipper transcription factor DBP. Mol Cell Biol, 1999. 19(10): p. 6488-99.

109. Ulvila, J., et al., Regulation of Cyp2a5 transcription in mouse pri-mary hepatocytes: roles of hepatocyte nuclear factor 4 and nuclear factor I. Biochem J, 2004. 381(Pt 3): p. 887-94.

110. Jover, R., et al., Cytochrome P450 regulation by hepatocyte nuclear factor 4 in human hepatocytes: a study using adenovirus-mediated antisense targeting. Hepatology, 2001. 33(3): p. 668-75.

111. Pitarque, M., et al., Transcriptional regulation of the human CYP2A6 gene. J Pharmacol Exp Ther, 2005. 313(2): p. 814-22.

112. Arpiainen, S., et al., Regulation of the Cyp2a5 gene involves an aryl hydrocarbon receptor-dependent pathway. Mol Pharmacol, 2005. 67(4): p. 1325-33.

113. Abu-Bakar, A., et al., Acute cadmium chloride administration in-duces hepatic and renal CYP2A5 mRNA, protein and activity in the mouse: involvement of transcription factor NRF2. Toxicol Lett, 2004. 148(3): p. 199-210.

114. Hahnemann, B., et al., Effect of pyrazole, cobalt and phenobarbital on mouse liver cytochrome P-450 2a-4/5 (Cyp2a-4/5) expression. Biochem J, 1992. 286 ( Pt 1): p. 289-94.

115. Glisovic, T., et al., Interplay between hnRNP A1 and a cis-acting element in the 3' UTR of CYP2A5 mRNA is central for high expres-sion of the gene. FEBS Lett, 2003. 535(1-3): p. 147-52.

116. Tilloy-Ellul, A., F. Raffalli-Mathieu, and M.A. Lang, Analysis of RNA-protein interactions of mouse liver cytochrome P4502A5 mRNA. Biochem J, 1999. 339 ( Pt 3): p. 695-703.

117. Gilmore, W.J. and G.M. Kirby, Endoplasmic reticulum stress due to altered cellular redox status positively regulates murine hepatic CYP2A5 expression. J Pharmacol Exp Ther, 2004. 308(2): p. 600-8.

118. Masso, E.L., L. Corredor, and M.T. Antonio, Oxidative damage in liver after perinatal intoxication with lead and/or cadmium. J Trace Elem Med Biol, 2007. 21(3): p. 210-6.

119. Abu-Bakar, A., et al., Regulation of CYP2A5 gene by the transcrip-tion factor nuclear factor (erythroid-derived 2)-like 2. Drug Metab Dispos, 2007. 35(5): p. 787-94.

120. Wang, J., M. Pitarque, and M. Ingelman-Sundberg, 3'-UTR poly-morphism in the human CYP2A6 gene affects mRNA stability and enzyme expression. Biochem Biophys Res Commun, 2006. 340(2): p. 491-7.

121. Kress, M., et al., Simian virus 40-transformed cells express new species of proteins precipitable by anti-simian virus 40 tumor serum. J Virol, 1979. 31(2): p. 472-83.

122. Crawford, L., The 53,000-dalton cellular protein and its role in transformation. Int Rev Exp Pathol, 1983. 25: p. 1-50.

123. Vogelstein, B., et al., Allelotype of colorectal carcinomas. Science, 1989. 244(4901): p. 207-11.

87

124. Chi, S.W., et al., Structural details on mdm2-p53 interaction. J Biol Chem, 2005. 280(46): p. 38795-802.

125. Chang, J., et al., Transactivation ability of p53 transcriptional acti-vation domain is directly related to the binding affinity to TATA-binding protein. J Biol Chem, 1995. 270(42): p. 25014-9.

126. Candau, R., et al., Two tandem and independent sub-activation do-mains in the amino terminus of p53 require the adaptor complex for activity. Oncogene, 1997. 15(7): p. 807-16.

127. Kim, E. and W. Deppert, The versatile interactions of p53 with DNA: when flexibility serves specificity. Cell Death Differ, 2006. 13(6): p. 885-9.

128. Walker, K.K. and A.J. Levine, Identification of a novel p53 func-tional domain that is necessary for efficient growth suppression. Proc Natl Acad Sci U S A, 1996. 93(26): p. 15335-40.

129. Zhu, J., et al., Definition of the p53 functional domains necessary for inducing apoptosis. J Biol Chem, 2000. 275(51): p. 39927-34.

130. Ko, L.J. and C. Prives, p53: puzzle and paradigm. Genes Dev, 1996. 10(9): p. 1054-72.

131. el-Deiry, W.S., et al., Definition of a consensus binding site for p53. Nat Genet, 1992. 1(1): p. 45-9.

132. Shaulsky, G., et al., Nuclear localization is essential for the activity of p53 protein. Oncogene, 1991. 6(11): p. 2055-65.

133. Stommel, J.M., et al., A leucine-rich nuclear export signal in the p53 tetramerization domain: regulation of subcellular localization and p53 activity by NES masking. EMBO J, 1999. 18(6): p. 1660-72.

134. Liu, G. and X. Chen, Regulation of the p53 transcriptional activity. J Cell Biochem, 2006. 97(3): p. 448-58.

135. Giaccia, A.J. and M.B. Kastan, The complexity of p53 modulation: emerging patterns from divergent signals. Genes Dev, 1998. 12(19): p. 2973-83.

136. Rodriguez, M.S., et al., Multiple C-terminal lysine residues target p53 for ubiquitin-proteasome-mediated degradation. Mol Cell Biol, 2000. 20(22): p. 8458-67.

137. Harms, K.L. and X. Chen, The C terminus of p53 family proteins is a cell fate determinant. Mol Cell Biol, 2005. 25(5): p. 2014-30.

138. Harms, K.L. and X. Chen, The functional domains in p53 family proteins exhibit both common and distinct properties. Cell Death Differ, 2006. 13(6): p. 890-7.

139. Hainaut, P., et al., IARC Database of p53 gene mutations in human tumors and cell lines: updated compilation, revised formats and new visualisation tools. Nucleic Acids Res, 1998. 26(1): p. 205-13.

140. Moll, U.M., et al., Transcription-independent pro-apoptotic func-tions of p53. Curr Opin Cell Biol, 2005. 17(6): p. 631-6.

141. Ryan, K.M., A.C. Phillips, and K.H. Vousden, Regulation and func-tion of the p53 tumor suppressor protein. Curr Opin Cell Biol, 2001. 13(3): p. 332-7.

88

142. Kastan, M.B., et al., Participation of p53 protein in the cellular re-sponse to DNA damage. Cancer Res, 1991. 51(23 Pt 1): p. 6304-11.

143. Achanta, G. and P. Huang, Role of p53 in sensing oxidative DNA damage in response to reactive oxygen species-generating agents. Cancer Res, 2004. 64(17): p. 6233-9.

144. Ljungman, M. and D.P. Lane, Transcription - guarding the genome by sensing DNA damage. Nat Rev Cancer, 2004. 4(9): p. 727-37.

145. Shen, Y. and E. White, p53-dependent apoptosis pathways. Adv Cancer Res, 2001. 82: p. 55-84.

146. Chowdary, D.R., et al., Accumulation of p53 in a mutant cell line defective in the ubiquitin pathway. Mol Cell Biol, 1994. 14(3): p. 1997-2003.

147. Mansur, C.P., The regulation and function of the p53 tumor suppres-sor. Adv Dermatol, 1997. 13: p. 121-66.

148. Miyashita, T. and J.C. Reed, Tumor suppressor p53 is a direct tran-scriptional activator of the human bax gene. Cell, 1995. 80(2): p. 293-9.

149. Oda, E., et al., Noxa, a BH3-only member of the Bcl-2 family and candidate mediator of p53-induced apoptosis. Science, 2000. 288(5468): p. 1053-8.

150. Sax, J.K., et al., BID regulation by p53 contributes to chemosensitiv-ity. Nat Cell Biol, 2002. 4(11): p. 842-9.

151. Di Leonardo, A., et al., DNA damage triggers a prolonged p53-dependent G1 arrest and long-term induction of Cip1 in normal hu-man fibroblasts. Genes Dev, 1994. 8(21): p. 2540-51.

152. Sherr, C.J., Principles of tumor suppression. Cell, 2004. 116(2): p. 235-46.

153. Donehower, L.A., et al., Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature, 1992. 356(6366): p. 215-21.

154. Harris, C.C. and M. Hollstein, Clinical implications of the p53 tu-mor-suppressor gene. N Engl J Med, 1993. 329(18): p. 1318-27.

155. Soengas, M.S., et al., Apaf-1 and caspase-9 in p53-dependent apop-tosis and tumor inhibition. Science, 1999. 284(5411): p. 156-9.

156. Schuler, M., et al., p53 induces apoptosis by caspase activation through mitochondrial cytochrome c release. J Biol Chem, 2000. 275(10): p. 7337-42.

157. Bao, Q. and Y. Shi, Apoptosome: a platform for the activation of initiator caspases. Cell Death Differ, 2007. 14(1): p. 56-65.

158. Zhao, R., et al., Analysis of p53-regulated gene expression patterns using oligonucleotide arrays. Genes Dev, 2000. 14(8): p. 981-93.

159. Nakano, K. and K.H. Vousden, PUMA, a novel proapoptotic gene, is induced by p53. Mol Cell, 2001. 7(3): p. 683-94.

160. Benchimol, S., p53-dependent pathways of apoptosis. Cell Death Differ, 2001. 8(11): p. 1049-51.

161. Schuler, M. and D.R. Green, Transcription, apoptosis and p53: catch-22. Trends Genet, 2005. 21(3): p. 182-7.

89

162. Mihara, M., et al., p53 has a direct apoptogenic role at the mito-chondria. Mol Cell, 2003. 11(3): p. 577-90.

163. Bartek, J., J. Bartkova, and J. Lukas, DNA damage signalling guards against activated oncogenes and tumour progression. Oncogene, 2007. 26(56): p. 7773-9.

164. Kulkarni, A.S. and K.C. Das, Differential roles of ATR and ATM in p53, Chk1 and histone H2AX phosphorylation in response to Hyper-oxia: ATR-dependent ATM activation. Am J Physiol Lung Cell Mol Physiol, 2008.

165. Pabla, N., et al., ATR-Chk2 Signaling in p53 Activation and DNA Damage Response during Cisplatin-induced Apoptosis. J Biol Chem, 2008. 283(10): p. 6572-83.

166. Svejstrup, J.Q., Mechanisms of transcription-coupled DNA repair. Nat Rev Mol Cell Biol, 2002. 3(1): p. 21-9.

167. Geneste, O., F. Raffalli, and M.A. Lang, Identification and charac-terization of a 44 kDa protein that binds specifically to the 3'-untranslated region of CYP2a5 mRNA: inducibility, subcellular dis-tribution and possible role in mRNA stabilization. Biochem J, 1996. 313 ( Pt 3): p. 1029-37.

168. Hamilton, B.J., et al., Association of heterogeneous nuclear ribonu-cleoprotein A1 and C proteins with reiterated AUUUA sequences. J Biol Chem, 1993. 268(12): p. 8881-7.

169. Weglarz, L., et al., Quantitative analysis of the level of p53 and p21(WAF1) mRNA in human colon cancer HT-29 cells treated with inositol hexaphosphate. Acta Biochim Pol, 2006. 53(2): p. 349-56.

170. Christian, K.J., M.A. Lang, and F. Raffali-Mathieu, Interaction of hnRNPC1/C2 with a novel cis-regulatory element within p53 mRNA as a response to cytostatic drug treatment. Mol Pharmacol, 2008.

171. Donev, R., et al., Recruitment of heterogeneous nuclear ribonucleo-protein A1 in vivo to the LMP/TAP region of the major histocom-patibility complex. J Biol Chem, 2003. 278(7): p. 5214-26.

172. Donev, R.M., et al., HnRNP-A1 binds directly to double-stranded DNA in vitro within a 36 bp sequence. Mol Cell Biochem, 2002. 233(1-2): p. 181-5.

173. Viitala, P., et al., cAMP mediated upregulation of CYP2A5 in mouse hepatocytes. Biochem Biophys Res Commun, 2001. 280(3): p. 761-7.

174. Raunio, H., et al., Cytochrome P4502A6 (CYP2A6) expression in human hepatocellular carcinoma. Hepatology, 1998. 27(2): p. 427-32.

175. Pascussi, J.M., et al., The expression of CYP2B6, CYP2C9 and CYP3A4 genes: a tangle of networks of nuclear and steroid recep-tors. Biochim Biophys Acta, 2003. 1619(3): p. 243-53.

176. Tishler, R.B., et al., Increases in sequence specific DNA binding by p53 following treatment with chemotherapeutic and DNA damaging agents. Cancer Res, 1993. 53(10 Suppl): p. 2212-6.

90

177. Qin, L.F. and I.O. Ng, Exogenous expression of p21(WAF1/CIP1) exerts cell growth inhibition and enhances sensitivity to cisplatin in hepatoma cells. Cancer Lett, 2001. 172(1): p. 7-15.

178. Courtois, S., C.C. de Fromentel, and P. Hainaut, p53 protein vari-ants: structural and functional similarities with p63 and p73 iso-forms. Oncogene, 2004. 23(3): p. 631-8.

179. Bourdon, J.C., et al., p53 isoforms can regulate p53 transcriptional activity. Genes Dev, 2005. 19(18): p. 2122-37.

180. Courtois, S., et al., DeltaN-p53, a natural isoform of p53 lacking the first transactivation domain, counteracts growth suppression by wild-type p53. Oncogene, 2002. 21(44): p. 6722-8.

181. Ray, P.S., R. Grover, and S. Das, Two internal ribosome entry sites mediate the translation of p53 isoforms. EMBO Rep, 2006. 7(4): p. 404-10.

182. Yang, D.Q., M.J. Halaby, and Y. Zhang, The identification of an internal ribosomal entry site in the 5'-untranslated region of p53 mRNA provides a novel mechanism for the regulation of its transla-tion following DNA damage. Oncogene, 2006. 25(33): p. 4613-9.

183. Sokolowski, M. and S. Schwartz, Heterogeneous nuclear ribonu-cleoprotein C binds exclusively to the functionally important UUUUU-motifs in the human papillomavirus type-1 AU-rich inhibi-tory element. Virus Res, 2001. 73(2): p. 163-75.

184. Shetty, S., Regulation of urokinase receptor mRNA stability by hnRNP C in lung epithelial cells. Mol Cell Biochem, 2005. 272(1-2): p. 107-18.

185. Gagne, J.P., et al., A proteomic approach to the identification of heterogeneous nuclear ribonucleoproteins as a new family of poly(ADP-ribose)-binding proteins. Biochem J, 2003. 371(Pt 2): p. 331-40.

186. Hay, D.C., et al., Interaction between hnRNPA1 and IkappaBalpha is required for maximal activation of NF-kappaB-dependent tran-scription. Mol Cell Biol, 2001. 21(10): p. 3482-90.

187. Cammas, A., et al., Cytoplasmic relocalization of heterogeneous nuclear ribonucleoprotein A1 controls translation initiation of spe-cific mRNAs. Mol Biol Cell, 2007. 18(12): p. 5048-59.

[184-187]

Acta Universitatis UpsaliensisDigital Comprehensive Summaries of Uppsala Dissertationsfrom the Faculty of Pharmacy 74

Editor: The Dean of the Faculty of Pharmacy

A doctoral dissertation from the Faculty of Pharmacy, UppsalaUniversity, is usually a summary of a number of papers. A fewcopies of the complete dissertation are kept at major Swedishresearch libraries, while the summary alone is distributedinternationally through the series Digital ComprehensiveSummaries of Uppsala Dissertations from the Faculty ofPharmacy. (Prior to January, 2005, the series was publishedunder the title “Comprehensive Summaries of UppsalaDissertations from the Faculty of Pharmacy”.)

Distribution: publications.uu.seurn:nbn:se:uu:diva-8722

ACTA

UNIVERSITATIS

UPSALIENSIS

UPPSALA

2008

the role of hnrnp a1 and hnrnp c1/c2 in the regulation of ...172034/fulltext01.pdf · dan...

Documents