The New York Stem Cell Foundation Accelerating Cures Through Stem Cell Research

New York Pharma Forum

Susan Solomon December 6, 2013

The New York Stem Cell Foundation

Stem Cell Research in the United States

• 1996 – Dickey Wicker Amendment

• 1998 – James Thompson and colleagues isolate hESCs

• 1999 – NIH Director Harold Varmus says NIH can fund human pluripotent stem cells per HSS General Counsel

• 2000 – NIH guidelines released for hESC research

• 2001 – Bush Executive Order

• 2006 – Senate passes Stem Cell Research Enhancement Act; vetoed

• 2006 – NYSCF’s privately funded, safe-haven laboratory opens

The New York Stem Cell Foundation

Stem Cell Research in the United States (cont’d)

• 2006 – Shinya Yamanaka derives first ever induced pluripotent stem (iPS) cells

• 2008 – NYSCF supported scientist derives first patient iPS lines (ALS)

• 2009 – Obama Executive Order and final NIH guidelines

• Allows NIH to fund some research on, but not derivation of hESCs

• Lines that were eligible under Bush era must be reviewed by a Working Group

• NIH funds cannot be used for research on stem cell lines derived from SCNT or parthenogenesis

The New York Stem Cell Foundation

Public Supports Stem Cell Research

• 73% of Americans favor expanding ESC research

• A vocal minority has controlled the message

Source: Research!America

The New York Stem Cell Foundation

Stem Cell Programs

• States responded with their own programs

• California – $3 billion over 10 years

• New York – $600 million over 11 years

• Connecticut – $100 million over 10 years

• Maryland – approximately $10 million per year

• NIH: FY12 - $1.5B for stem cell research

• $146.5M for hESC ~ 13%

• Private Funding

• New York Stem Cell Foundation Research Institute - $100 million

NYSCF Mission

Accelerating cures for the major diseases of our time through stem cell research

BEN

NYSCF Programs

NYSCF Innovators: Fellows and Investigators

NYSCF Conference and Symposia

NYSCF Research Laboratory

NYSCF Conferences and Symposia

Annual Conferences

Panels Seminar Series

NYSCF Innovators

$53M dedicated to building the next generation of top stem cell researchers

• 55 3-year NYSCF Fellowships over 12 years ($12M) at 17 institutions

• 28 NYSCF Early-career Investigators over 6 years ($41M) at 10 institutions

In just eight years, NYSCF has achieved several breakthroughs in the field

NYSCF’s Proven Track Record

2013 – New therapeutic approach for diabetes • Discovery of compound that restores beta cell function in genetic

form of diabetes, may be applicable to all forms of diabetes. 2013 - Personalized bone graft advance • NYSCF Research Laboratory team engineers bone from

skin cells

2013 – First monogenic diabetes model • Mutated genes genetically corrected

2012 - Stopping mitochondrial disease • NYSCF Research Lab team develops clinical cure for inherited

disease that impacts children

2011 - Pioneering cell replacement therapy • NYSCF Research Lab team derives first ever human embryonic

stem cell from human eggs - Time magazine #1 medical breakthrough of the year

2008 - Creating first-ever disease model (ALS) • NYSCF scientist has Time and Science magazines #1 medical

breakthrough of the year

Why NYSCF Research Institute is Unique

• Focus only on translational research – translating research into cures

• Fund high-risk, high-reward “tipping point” experiments that traditional funding mechanisms won’t support

• Independent and unencumbered by bureaucracy or federal restrictions

• Leverage our proprietary research in collaboration with institutions around the world

NYSCF Research Institute

Laboratory

•45 full time researchers

•Raised and invested $100M for stem cell research

•Leader in developing stem cell technologies and disease modeling

•An international community of over 100 scientists collaborating to cure disease

NYSCF GLOBAL STEM CELL ARRAY™:AUTOMATED STEM CELL PRODUCTION, DIFFERENTIATION, MANIPULATION, AND CHARACTERIZATION

Representative

Stem Cell Lines

Reproducible stem cell production by automation

Fully quality controlled

Genetically diverse patient populations

Industrial production scale

Full GLP tracking

Array Features

Integration-free reprogramming

Defined media

Standardized substrates

Reprogramming Technology

Karyotyping

Genome analysis for identification tracking with SNP arrays

Gene expression analysis via direct mRNA

measurement (score card assays), 25 genes on

undifferentiated clones, and 100 genes on EBs

Quality Control

Produces hundreds of iPSC lines per month

Accepts up to 360 tissue samples at a time (skin [default] or

blood)

Utilizes ESCs and/or iPSCs as starting material for

expansion, differentiation, and analysis

Capacity

Partnership Opportunities

Production of iPSC lines

Large-scale parallel differentiation from and genomic

engineering of ESC/iPSCs

Assay development, validation, and scale-up

Access to NYSCF repositor y of ESC/iPSC lines

(genetically diverse and diseased populations)

Adaptation and optimization of existing diff erentiation

protocols to automation, which include:

For more information

please email: array@nyscf.org

Scale-up stem cell research

Establish stem cell-based dr ug discovery platforms

Functionalize human genetics to accelerate the

development of stem cell-der ived interventions

Objectives

Dopaminergic Neurons OligodendrocytesRemoves manual manipulation

Massively parallel processing of samples

Produces reproducible panels of differentiated cell lines

Automation

Beta Cells Cardiomyocytes Forebrain Neurons

CTnT/Nuclei NKx2.1/Map2/DNAC-peptide/DAPI

Objectives:

• Reproducible stem cell production

• Parallel derivation & culture at scale

• Quantitative quality control assays

• Reproducible panels of differentiated cells

• Diverse and disease populations

Connect Genotype to phenotype:

• in vitro GWAS

• “Clinical trials in a dish”

NYSCF Research Institute Building infrastructure to industrialize stem cell research

• Bone regeneration

• Diabetes / auto-immune diseases

• Heart disease

• Neural disorders

• Alzheimer’s disease

• Autism

• Parkinson’s disease

• Multiple Sclerosis

• Mental Illness

NYSCF Disease Programs

Why Do Cures Take So Long?

Identify Disease Causes

Publish Research Papers

Academic Institutions Pharmaceutical & Biotech Companies

• Mainly work on large disease markets (changing)

• Public companies - generally risk averse

• Screen on mice and cells unrelated to the disease

• Use small collections of cell lines from a narrow group of patients ?

Then what?

Drug Development • 13 Years • $4 Billion • 99% Fail

NYSCF Provides a Bridge to Cures

Academic Institutions

can scale their

discoveries

reduces time, cost, and risk

Biotech & Pharmaceutical

Companies

connecting research to cures and treatments

The stages of development of a ‘typical’ new drug

DRUG DISCOVERY

PRECLINICAL DEVELOPMENT

CLINICAL DEVELOPMENT

Phase I Phase II Phase III Phase IV

1.5 years 5-7 years 2-5 years

Target selection

Lead-finding

Lead optimization

Pharmacological profiling

Pharmacokinetics

Short-term toxicology

Formulation

Synthesis scale-up

Pharmacokinetics, tolerability, side-effects in healthy volunteers

Small-scale trials in patients to assess efficacy & dosage

Long-term toxicology studies

Large-scale controlled clinical trials

Postmarketing surveillance

1 �50 projects 12 compounds 1.7 3 5

Drug candidate

Development compound

Drug approval for marketing

Paul et al., Nature Rev Drug Discovery, 2010

This process is amazingly inefficient and shockingly expensive

First time a drug may see a human cell

Pluripotent Stem Cells

NYSCF Research Institute Goals

21

• Model diseased tissue

iPS Cell Disease Modeling

• Test drugs on diseased tissue

Functional Cells in a Dish

Alzheimer’s Neurons

Dopamine Producing Neurons

Cardiac Cells Insulin Producing Cells

Existing Challenges with iPS cells

• Artisanal product via various methods with variable quality

• Few cell lines from relatively homogeneous populations

• Lack of standardization

• Limited scalability and slow production

A New Technology Platform: The NYSCF Global Stem Cell Array

• Automated robotic systems for iPS cell generation, differentiation, and analysis

• Minimize manual manipulation

• Massive parallel processing (100s-1000s)

• Produce reproducible panels of differentiated cell lines

• Cell line collection

• 95% of genetic diversity

• Major and rare diseases

NYSCF Global Stem Cell ArrayTM

26

Automated differentiated cells

Differentiated Cells:

•Other iPSC derived cell types produced at NYSCF: astrocytes, endothelial cells, osteoblasts, oligodendrocytes, and others.

Cholinergic Neurons Tuj1/CHAT/DNA

Cardiomyocytes cTnT/Nuclei

Beta Cells Insulin/Glucagon/Nuclei

ATCGTACGTTGCATGCATCGTACGTTACCGCAACCTGCATGCCACGTACGCATGCATGCATGCATGCACTGCATGCATTGCATCTAACGTACGTATACGGCGCATGTATAGTGTACGTACGTACGTACGTATGCCAGTTGCATGGCATGCATTGCATGCTTACGT

ATCGTACGTTGCATGCATCGTACGTTACCGCAACCTGCATGCCACGTACGCATGCATGCATGCATGCACTGCATGCATTGCATCTAACGTACGTATACGGCGCATGTATAGTGTACGTACGTACGTACGTATGCCAGTTGCATGGCATGCATTGCATGCTTACGT

Puts the human genome into biological context

•Current genomic analysis allows scientists to see a connection between DNA and disease

• With the addition of NYSCF’s Stem Cell Array, scientists can see how the DNA actually functions in the disease.

Finding the Genetic Causes of Disease The NYSCF Global Stem Cell Array

28

• Replicate diseases in a dish using actual diseased human cells (not mouse cells)

• Anticipate how people from genetically diverse backgrounds will respond to different drugs before clinical trials

• Predict drug toxicity in the dish

“Clinical Trials in a Dish” The NYSCF Global Stem Cell Array

Scaling the Research The NYSCF Global Stem Cell Array

Allows scientists to:

•Scale their discoveries

•Test their findings in a large population

•Translate their research into medicine and cellular treatments for disease

30

Extensive Institutional Collaborations & Key Relationships (50+)

Other Countries Australia Israel Qatar Sweden United Kingdom

Select large scale collaborations:

Michael J. Fox Foundation

NIH Undiagnosed Disease Program

Cure Alzheimer’s Fund Stem Cell Consortium

Personal Genomes Project

Tissue samples

Banking

iPS production

Distribution

NYSCF Array Distribution Team Full Documentation MTA [Academic / Government / Commercial]

NYSCF Global Stem Cell ArrayTM

Freedom to Operate - Robust Management

NYSCF Collection Sites (clinical data), SCRO Committee, and Human Subjects Team

In-house US Collaborator International

IRB Protocols MTA USDA / Customs

Consent Forms MTA

NYSCF Production Management Team SOPs – Freedom to Operate – Licensing LIMS Tracking and batch records Bank QC

Partnership Opportunities

•Large-scale production, differentiation and genomic engineering of iPS cells

• Adaptation of existing protocols to automation

• Development of new protocols

• Optimization and validation across genetically diverse populations

•Assay development and validation

•Access to repository of iPS cell lines - controls with wide genetic diversity and disease cohorts (PD, AD, MS, Diabetes, others)

•Establishment of collaborative production sites

NYSCF Research Institute