0 1994 by The American Society for Biochemistry and Molecular Biology, Inc. THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 269, No. 10, Issue of March 11, pp. 7527-7531, 1994

Printed in U.S.A.

Induction of Peripheral-type Benzodiazepine Receptors during Differentiation of Mouse Erythroleukemia Cells A POSSIBLE INVOLVEMENT OF THESE RECEPTORS IN HEME BIOSYNTHESIS*

(Received for publication, October 11, 1993, and in revised form, November 15, 1993)

Shigeru TaketaniS, Hirao Kohno, Masahiro Okuda, Takako Furukawa, and Rikio Tokunaga From the Department of Hygiene, Kansai Medical University, Moriguchi, Osaka 570, Japan

To search for a possible role for peripheral-type ben- zodiazepine receptors (PBR) during erythroid differen- tiation, we cloned the PBR isoquinoline carboxamide- binding protein (PBFUIBP), an 18-kDa protein on PBR, from a mouse erythroleukemia (MEL) cell cDNA library. Sequence analysis revealed that PBWIBP comprises 169 amino acid residues (M, 18,8281, and has a high homol- ogy with PBFUIBP from other sources. The cDNA allows for the expression of active PBFUIBP, exhibiting a high affinity for isoquinoline carboxamide, [sH1PK11195, with Kd of 0.80 and 1.56 MI. RNA blot analysis revealed that treatment of MEL cells with dimethyl sulfoxide led to an increase in PBFUIBP mRNA (A1.0 kilobases) for up to 72 h, with a concomitant induction of mRNAs for heme biosynthetic enzymes, coproporphyrinogen oxi- dase and ferrochelatase. The induction of PBFUIBP mRNA was also observed in MEL cells induced with di- azepam. The binding activity of [SH]PK11195 in MEL cells showed a high affinity with Kd of 0.69-2.13 n ~ , and increased during erythroid differentiation. The order of potency of different ligands to compete against [sH]PKll195 binding in induced MEL cells was PK11195 > protoporphyrin M > diazepam > coproporphyrinogen I11 > coproporphyrin I11 > estazolam. In contrast to the induction of PBWIBP in induced MEL cells, the voltage- dependent anion channel (mitochondrial porin) associ- ated with PBR remained unchanged. These results sug- gest that PBWIBP on PBR may be involved in porphyrin transport and may even be a critical factor in erythroid- specific induction of heme biosynthesis.

Peripheral-type benzodiazepine receptors (PBR)’ are present in adrenals, kidney, and heart. These receptors differ from the central benzodiazepine receptors which are coupled to y-ami- nobutyric acid receptors, and related to the classical sedative, anxiolytic, and anticonvulsant properties of benzodiazepines. PBR are localized primarily on the outer membrane of mito- chondria in most species of cells, with the highest density pres- ent in steroid-forming tissues (1-3). The precise physiological functions of PBR have remained unclear.

Foundation and the Scientific Research Promotion Fund of the Japan * This study was supported in part by grants from Nissan Science

Private School Promotion Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

to the GenBankmIEMBL Data Bank with accession number(s) 021207. The nucleotide sequence(s1 reported in this paper has been submitted

(ext. 2504); Fax: 81-6-992-3522. j: To whom correspondence should be addressed. Tel.: 81-6-992-1001

receptors; PBFUIBP, peripheral-type benzodiazepine receptors-isoquino- The abbreviations used are: PBR, peripheral-type benzodiazepine

line carboxamide-binding protein; MEL cells, mouse erythroleukemia cells; Me,SO, dimethyl sulfoxide; PCR, polymerase chain reaction.

Purification of PBR in a form retaining reversible ligand binding yielded a complex containing the voltage-dependent anion channel (mitochondrial porin), the adenine nucleotide carrier and an 18-kDa protein (4, 5). PBR can bind to benzodi- azepines as well as to the isoquinoline carboxamide, PK11195. Photolabeling with [3HlPK14105, a p-fluoronitrophenyl analog of PK11195, identified the 18-kDa protein, PBFUIBP, in various cells (5). cDNA cloning for rat (6), human (71, and bovine (8 ) PBFUIBP has been done. Expression of the PBFUIBP in mam- malian cells (6) and yeast (9) showed that the recombinant receptors bound to peripheral-type benzodiazepine ligands.

In attempts to identify an endogenous ligand in various tis- sues, Snyder and co-workers (10, 11) found that peripheral- benzodiazepine binding activity can be fully accounted for by porphyrins, and they suggested that porphyrins appear to be endogenous ligand for PBR. The possibility that PBR located on the outer membrane of mitochondria could interact with por- phyrins led to our examination of the regulation of PBR gene expression during erythroid differentiation of MEL cells in vitro. MEL cells are a useful model since, upon the addition of an inducer such as Me2S0, these cells differentiate to synthe- size hemoglobin with a concomitant loss of proliferative capac- ity (12, 13). The differentiation program is characterized by a n increase in the levels of the enzymes of the heme biosynthetic pathway (13, 14). We cloned cDNA and characterized mouse PBFUIBP. The inductions of mRNA as well as cellular density of PBFUIBP during MEL cell differentiation were also given at- tention.

EXPERIMENTAL PROCEDURES Materials-N-[methyl-3HlPKll195 (60-90 Ci/mmol) was purchased

from DuPont-New England Nuclear. [ C Y - ~ ~ P I ~ C T P and nylon mem- branes were from Amersham Corp. Restriction endonucleases and other nucleic acid-modifying enzymes were obtained from Toyobo Co. PK11195 was from Wako Pure Chemicals Co. Diazepam and estazolam were kind gifts from Dr. C. Inagaki of our university. Protoporphyrin M and coproporphyrin I11 were from Porphyrin Products Co. Copropor- phyrinogen was prepared from coproporphyrin I11 by reduction with sodium amalgam immediately before use (14). Monkey kidney Cos-1 cells were obtained from the Japan Cell Bank and were grown as de- scribed elsewhere (14). Oligonucleotides were synthesized on an Ap- plied Biosystem Model 381A DNA synthesizer. All other chemicals used were of analytical-grade.

cDNA Cloning of the Mouse PBRIIBP-For acquisition of a probe to screen a mouse cDNA library, the fragment of the mouse PBFUIBP cDNA was amplified by PCR, based on the rat PBIUIBP cDNA reported by Sprengel et al. (6). The primers used for amplification were 5’-GGC- TTC-ATG-GGN-GCC/T-TAC/T-TT-3’ (codon Glyl9-PheZ5, sense) and 5’- TC-TCT-CCA-G/CAC-A/GTA-AlGTA-G/A’lT-3’ (codon A ~ n ’ ~ ~ - A s p ’ ~ ~ , antisense). To prepare the template for PCR, 5 pg of poly(A)+ RNA from MEL cells was used for first strand cDNA synthesis, according to the method of Gubler and Hoffman (15). PCR conditions were essentially the same as those described previously (14). After PCR, the reaction products were separated by 1.2% agarose gel electrophoresis and DNAs of about 400 base pairs were extracted. These DNAs were directly ligated into pGEM-T vector (Promega) for sequencing. AMEL cell Agt 11

7527

7528 Mitochondrial (Peripheral-type) Benzodiazepine Receptors

mouse PBRWP cDNA and deduced FIG. 1. Nucleotide sequence of

amino acid sequence. Nucleotides are numbered starting from the first residue of the initiation ATG codon, using nega- tive numbers for residues in the 5'-un- translated region. Amino acids are num- bered, taking the initiator methionine as 1. The possible polyadenylation signal is underlined.

-65 -60

1 1

6 1 2 1

121 41

1 8 1 61

24 1 8 1

301 1 0 1

361 1 2 1

421 141

481 161

541 601 661 721 781

ACAACCAGCGACTGCGTGAGCGGGGCTGTGGATCTTTCCAGAACATCAGTTGCAATCACC GGGGA

ATGCCTGAATCCTGGGTGCCTGCCGTGGGCCTCACTCTGGTGCCCAGCCTGGGGGGCTTC M P E S W V P A V G L T L V P S L G G F

ATGGGAGCCTACTTTGTACGTGGCGAGGGCCTCCGGTGGTATGCTAGCTTGCAGAAACCC M G A Y F V R G E G L R W Y A S L Q K P

TCTTGGCATCCGCCTCGCTGGACACTGGCTCCCATCTGGGCAACACTGTATTCAGCCATG S W H P P R W T L A P I W A T L Y S A M

GGGTATGGCTCCTACATAGTCTGGAAAGAGCTGGGAGGTTTCACAGAGGACGCTATGGTT G Y G S Y I V W K E L G G F T E D A M V

CCCTTGGGTCTCTACACTGGTCAGCTGGCTCTGAACTGGGCGTGGCCCCCCATCTTCTTT P L G L Y T G Q L A L N W A W P P I F F

GGTGCCCGGCAGATGGGCTGGGCCTTGGCCGATCTTCTGCTTGTCAGTGGGGTGGCAACT G A R Q M G W A L A D L L L V S G V A T

GCCACAACCCTGGCTTGGCACCGAGTGAGCCCGCCCGCTGCCCGCTTGCTGTACCCTTAC A T T L A W H R V S P P A A R L L Y P Y

CTGGCCTGGCTGGCTTTTGCCACCGTGCTCAACTACTATGTATGGCGTGATAACTCTGGC L A W L A F A T V L N Y Y V W R D N S G

CGGCGAGGGGGCTCCCGGCTCGCAGAGTGAAGGCACCCAGCCATCAGGAATGCAGCCCTG R R G G S R L A E

CCAGCCAGGCACCATGGGTGGCAGCCATCATGCTTTCATGACCATTGGGCCTGCTGGTCT ACCTGGTCTTAGCCCAGGAAGCCACCAGGTAGGTTAGGGTGGTCAGTGCCGAGTCTCCTG CAGACACAGTTATACCTGCCTTTCTGCACTGCTCCAGGCATGCCCTTAGAGCATGGTGTT TTAAAGCTAAATAAAGTCTCTAACTTCACCATGGTACCCGGATCCTCGAATCGAGGATCC G C G T A C C A T G G

cDNA library (16) was screened with 32P-labeled cDNA probe, mouse PBR/IBP clone (IBP 1-3) obtained by means of PCR, using a plaque hybridization method (17). The positive clones were plaque-purified and the inserts were cut out and subcloned into the pUC vector for sequenc- ing. Sequencing of DNAs was carried out, using the dideoxynucleotide chain termination method of Sanger et al. (18).

Cell Culture-MEL cells (clone 745A) were grown in RPMI 1640 medium supplemented with 10% (v/v) fetal calf serum. To induce ery- throid differentiation, cells at an initial cell density of 1 x 105/ml were grown for 3 days in medium containing 2% (v/v) Me2S0 or 100 p~ diazepam. For uninduced control, cells were seeded at a density of 0.5 x 105/ml in culture medium without Me2S0. PK11195 Binding Assay-Cells were collected and washed twice with

phosphate-buffered saline. The cell pellets were suspended in 50 m~ "is-HC1 buffer, pH 7.4, containing 120 m~ NaCl, and homogenized with a Teflon homogenizer for 6 strokes. The homogenates (100-180 pg of protein), obtained by centrifugation at 600 x g for 10 min, were incubated with [3HlPK11195 (0.5-100 m) for 1.5 h a t 4 "C, in a volume of 0.2 ml. The mixtures were then passed through Whatman GF/C filters and washed with 30 ml of ice-cold phosphate-buffered saline. The filters were counted in a Packard liquid scintillation spectrophotometer. Nonspecific binding was determined in the presence of an excess amount of nonradioactive PK11195 at a concentration of 10 p ~ . Protein concentration was determined by the method of Lowry et al. (19).

Northern Blot Analysis-Total RNA was isolated from lo7 MEL cells by the guanidium isothiocyanate method (16). Fifteen pg of RNA were applied to a 1% agarose/formaldehyde gel, electrophoresed and then transferred onto a nylon filter (Amersham, Hybond N') for hybridiza- tion with DNA probes. Hybridized filters were washed, as described (16). mRNA concentrations were quantitated using an Advantec DMU- 33c densitometer.

Expression of Cloned Mouse PBRlIBP-The insert of cloned PBW IBP was ligated into the pCD vector. The resulting plasmid (pCD-IBP) was transfected into Cos-1 cells, using the DEAE-dextran method (17). After 48 h incubation, the cells were collected, washed twice with phos- phate-buffered saline, and used for the binding assay of PHIPK11195.

Antibodies and Immunoblot Analysis-Anti-coproporphyrinogen oxi- dase antibodies were prepared as follows. The cDNA corresponding to mouse coproporphyrinogen oxidase (14) was prepared by PCR and sub- cloned into BamHI-Hind111 site of an expression vector pMAL-cRI (New England Biolabos) in the correct reading frame. The plasmid DNAs were then introduced into JM 103 cells. The fusion proteins were in- duced by the addition of isopropyl-6-D-thiogalactopyranoside and were

purified from extracts by amylose-resin affinity chromatography, as described by the manufacturer (New England Biolabos). The antibodies against coproporphyrinogen oxidase were prepared by injecting into a rabbit 0.5 mg of coproporphyrinogen oxidase fusion protein in Freund's complete adjuvant. After three subsequent injections at 2-week inter- vals, the resulting antisera were collected and the antibodies were purified as described (20). Anti-ferrochelatase antibodies were prepared as described (16) and anti-rat porin antibodies were kind gifts from Dr. A. Yamamoto of our university. For immunoblotting, cells were lysed with Laemmli's sample buffer (21). The lysate was then sonicated and heated to 100 "C for 1 min. Cellular proteins were resolved on 10% polyacrylamide gels. After the electrophoretic run, proteins in the gel were electroblotted onto a polyvinylidene difluoride membrane. Condi- tions of immunoblotting and detection of the cross-reactive antigen were, as described (22).

RESULTS

Cloning and Sequencing of Mouse PBRIIBP cDNA-Two primers, based on the nucleotide sequence of rat PBFUIBP cDNA (6) were used to amplify the mouse PBFUIBP cDNA, using a cDNA library from MEL cell mRNA. Sequencing of a clone IBP 1-3 showed a high homology with the sequence of rat PBFUIBP cDNA. Of 1 x lo5 recombinant plaques, 2 positive clones of a similar size were obtained, using the fragment of IBP 1-3. Two clones contained the same sequences of which the longer cDNA clone had an insert size of 856 base pairs. Fig. 1 shows the nucleotide sequence and deduced amino acid se- quence of the mouse PBFUIBP clone. The open reading frame of the mouse cDNA encodes a polypeptide of 169 amino acids with a calculated molecular weight of 18,828. This molecular mass was consistent with the molecular mass (18 kDa) of the rat purified PBIUIBP (4). Hydropathy profiles derived from the deduced amino acid sequence of mouse PBFUIBP led to the hypothesis that the protein contains five potential transmem- brane domains, and this was the same as profiles of rat and bovine PBFUIBP. Comparison of amino acid sequences of the mouse PBFUIBP with other PBFUIBP showed a 94% identity in rat (6), 76% in bovine (7), and 80% in human (8).

Expression of the Cloned Mouse PBRIIBP in Cos-1 Cells-

Mitochondrial (Peripheral-type) Benzodiazepine 7529

2 ' 7

O n

FIG. 2. Scatchard analysis of ["HlPK11195 binding in Cos-1 cells. Homogenates of Cos-1 cells transfected without (0) or with mouse PRRnBP cDNA (0) were incubated in the presence of increasing con- centrations of 13HlPK11195 (0.5-100 nM) a t 4 "C for 1.5 h. Nonspecific binding was determined in the presence of 10 PM PK11195. The values of the specific binding are means of duplicate experiments.

The full-length cDNA encoding the mouse PBFUIBP (pCD-IBP) was transfected into Cos-1 cells to determine the ligand binding properties of the recombinant PBFUIBP. Scatchard plots re- vealed that ["HlPK11195 binding to the homogenates showed two populations of binding with Kd of 0.8 and 1.56 nM (Fig. 2). Assuming that the binding site with a higher affinity reflects the number of PBFUIBP, B,,, of the binding site in pCD-IBP transfected cells was 1.35 pmoVmg protein, a value 3-fold greater than that in untransfected cells. The binding activity in untransfected cells was similar to that in cells transfected with antisense PBFUIBP insert in the pCD vector. Diazepam, a ben- zodiazepine derivative, competed against ["H]PK11195 binding (10 nM) to the homogenates of pCD-IBP transfected cells with 50% inhibitory concentration of 180 nM, suggesting that diaz- epam may exhibit affinity for the recombinant PBlUIBP.

Znductian of PBRIZBP, Coproporphyrinogen Oxidase, and Ferrochelatase mRNAs Levels during MEL Cell Differentia- tion-MEL cells were induced to differentiate with 2% Me2S0, then the heme content in the cells began to increase within 24 h and over 90% of the cells synthesized large quantities of hemoglobin in 4 days. Total cellular RNA was obtained from MEL cells a t various times after induction, and was examined by Northern blot analyses using cDNA probes for PBFUIBP, and the heme biosynthetic enzymes coproporphyrinogen oxidase and ferrochelatase. As shown in Fig. 3, the levels of all the mRNAs examined increased during MEL cell differentiation: PBFUIBP mRNA corresponding to about 1.0 kilobase pair in- creased gradually with time up to 72 h. Ferrochelatase mRNAs corresponding to 2.2 and 3.0 kilobase pairs (16) increased after 12 h induction, these findings being consistent with previous observations (16,23). Coproporphyrinogen oxidase mRNA (3.0 kilobase pairs) increased markedly by 24 h and decreased thereafter.

Diazepam is an inducer of MEL cell differentiation (24, 25). We next examined the induction of PBFUIBP mRNA in MEL cells treated with 100 p~ diazepam. Treatment of the cells with 100 p~ diazepam resulted in an increase in the content of cellular heme, but to a lesser extent compared to findings in cells treated with Me2S0. During the differentiation, PBFUIBP mRNA increased within 12 h, then gradually increased with time (Fig. 4). The inductions of ferrochelatase and copropor- phyrinogen oxidase mRNAs were similar to those in MEL cells treated with Me2S0. Thus, PBlUIBP mRNA was induced in parallel with mRNAs for the heme biosynthetic enzymes.

Binding Activity of ['H]PKlll95 during MEL Cell Differentiation-Binding of ["H]PK11195 was examined with homogenates of Me2SO-treated MEL cells. The homogenates showed high affinities for PK11195 with the dissociation con- stant (Kd), as calculated from the Scatchard plots of 0.69-2.13

Receptors 1 2 3 4 5

- 285

- 18s

o a

PBR

Coprogen Oxidase "c

Ferrochelatase e a r * *

FIG. 3. RNAblot analysis of mouse PBFUIBP, coproporphyrino- gen oxidase, and ferrochelatase in MEL cells treated with Me2S0. Total RNA (20 pg) from MEL cells were electrophoresed on a formaldehyde-agarose gel and transferred to a nylon membrane. The resulting filters were hybridized with :'2PP-labeled insert of mouse PBlU

chelatase cDNA (16), and rat p-actin cDNA. RNA preparations were: IRP clone, mouse coproporphyrinogen oxidase cDNA (14), mouse ferro-

uninduced MEL cells (lane 1 ); induced MEL cells treated with 2% Me2S0 for 12 (lane 2) , 24 (lane 3 ) , 48 (lane 4 ) , and 72 h (lane 5).

1 2 3 4

.. ,. . PBR

Coprogen Oxidase - -

Ferrochelatase 2 1 aD

FIG. 4. RNA blot analysis of mouse PBR/IBP, coproporphyrino- gen oxidase, and ferrochelatase in MEI, cells treated with diaz- epam. The conditions of RNA blotting werr similar to those described in legend of Fig. 3. RNA preparations were: uninduced MEL cells (lane 1 ); induced MEL cells treated with 100 pv diazepam for 12 (lane 2 ), 24 (lane 3 ). and 48 h (lane 4 ).

nM (Fig. 5). The specific binding of [:'HIPK11195 to the homog- enates increased during the differentiation, and B,,,, of higher affinity binding sites in cells treated with MezSO for 48 h showed a value of 0.48 pmoVmg protein, that is 1.4-fold more than that in uninduced cells. After 72 h incubation, the density of PBFUIBP increased by 1.8-fold. Thus, the augmentation of PBFUIBP mRNA apparently led to that of the density of PBW IBP during MEL cell differentiation.

We further characterized PBFUIBP in MEL cells in competi- tive ligand binding experiments. Fig. 6 shows the competition curves of benzodiazepine derivatives and porphyrins for the binding of ["H]PK11195 to the homogenates of MEL cells in- duced with MezSO for 72 h. The order of potency of the appar- ent inhibition was PK11195 > protoporphyrin > diazepam > coproporphyrinogen > coproporphyrin. No inhibition was ob- served by adding estazolam up to 10 p ~ . Thus, the porphyrin compounds exhibited affinity for PBR.

Zmmunoblotting of Porin, Coproporphyrinogen Oxidase, and Ferrochelatase in MEL Cells Induced with Me,SO-It is known that mitochondrial porin and adenine nucleotide carrier can be associated with 18-kDa PK11195 binding subunit in the intact PBR complex. We next examined variations of the density of porin during MEL cell differentiation. As shown in Fig. 7, immunoblot analysis showed that porin corresponding to a mo- lecular mass of 33 kDa remained unchanged in cells induced for 72 h, while coproporphyrinogen oxidase (37 kDa) and ferroche- latase (41 kDa) increased, accompanied by an increase of the

7530 Mitochondrial (Peripheral-type) Benzodiazepine Receptors

BMd 9 t P K m p 5 ( p n o v m g ~ )

FIG. 5. Scatchard analysis of [“H]PK11195 binding to homoge- nates of MEL cells during differentiation. MEL cells were induced with 2% MepSO for 0 (O), 48 (A), and 72 h (0). After the cells were lysed, homogenates were obtained, and incubated with [:’HlPK11195 as de- scribed in the legend of Fig. 2. The values are means of duplicate experiments.

“4

FIG. 6. Inhibition of [“H]PK11195 binding in induced MEL cells. Nonradioactive PK11195 (O), protoporphyrin (A), diazepam (3). coproporphyrinogen (A), coproporphyrin (0). and estazolam (x) were tested for inhibition of specific binding of [“HlPK11195 (10 nM) to ho- mogenates of induced MEL cells with 2% Me2S0 for 72 h. Data are means of duplicate experiments.

1 2 3 4 5

Coprogen Oxldase

Ferrochelatase - - - - - oxidase, and ferrochelatase in MEL cells induced with Me2S0.

FIG. 7. Immunoblot analysis of porin, coproporphyrinogen

The cells were treated with 2% Me2S0 for 0 (lane 1). 12 (lane 2 ), 24 (lane 3 ) , 48 (lane 4 ) , and 72 h (lane 5 ). The cells were washed, lysed as described, and the cellular proteins were analyzed by SDS-polyacryl- amide gel electrophoresis. Immunoblotting was done using anti-porin, anti-coproporphyrinogen oxidase, and anti-ferrochelatase antibodies.

content of cellular heme. The amount of porin in MEL cells was probably segregated from induction of the 18-kDa PBFUIBP protein molecule.

DISCUSSION

We obtained the first evidence for PBFUIBP in erythroid cells. Comparison of the deduced amino acid sequence of the mouse PBFUIBP with those of other species showed a high homology

(6-8). Transfection of Cos-1 cells with a transient expression vector containing the PBFUIBP insert resulted in a 3-fold in- crease in the density of binding site for PK11195. The binding characteristics of mouse PBFUIBP are similar to those of un- transfected Cos-1 cells (Fig. 2), and those seen in case of Cos-7 cells transfected with rat PBFUIBP (6).

Northern blot analysis using the PBFUIBP cDNA probe dem- onstrated that MEL cells express the transcript of PBFUIBP, treatment of the cells with MezSO led to an increase in PBW IBP mRNA, with concomitant increases in mRNAs of the ter- minal enzymes of heme biosynthetic pathway, coproporphy- rinogen oxidase, and ferrochelatase (Fig. 3). The density of PBFUIBP in the MEL cells treated with Me2S0 for 48 and 72 h increased by 1.4- and 1.8-fold, respectively, as compared with the density of control. These observations provide evidence to support the proposal that the intracellular quantities of PBW IBP are regulated at the level of PBFUIBP gene expression.

The significance of the induction of PBFUIBP during MEL cell differentiation is unclear, but it is striking that steroid-forming tissues possess high levels of mitochondrial PBR selectively localized to the steroid-forming zona glomerulose and Leydig cells of adrenal gland and testes (26,27). Stimulation of PBR by R05-4864, one of the ligands, enhanced progesterone produc- tion in intact cells and the conversion of cholesterol to pregrenolone is enriched in the mitochondrial fraction (26). Thus, the expression of PBR in steroid-forming cells can be closely related to the extent of steroidogenesis. On the other hand, many benzodiazepine derivatives are capable of inducing differentiation of MEL cells (24, 25). Diazepam, one of the li- gands for PBR, induced heme synthesis and the induction of PBFUIBP mRNA was observed during the differentiation (Fig. 4). Considering that MEL cell differentiation is presumably free from steroidogenesis, an increase of PBFUIBP during MEL cell differentiation may contribute to the intracellular trans- port of porphyrins. Alternatively, Verma et al. (10, 11) reported that hemin can interact with PBFUIBP of rat kidney mitochon- dria. It is possible that PBFUIBP may be involved in the export of heme from mitochondria, and the heme is then associated with newly synthesized globin in differentiated MEL cells.

Previous studies (28,29) demonstrated that the 18-kDa pro- tein, PBFUIBP, was labeled by isoquinoline carboxamide, PK11195, whereas the 30- and 32-kDa proteins were labeled by benzodiazepine ligands, flunitrazepam and AHN-086. The 30- and 32-kDa proteins were identified as mitochondrial porin and adenine nucleotide carrier, respectively. Other investiga- tors (5, 28) suggested that a ternary complex of the 18-kDa PBFUIBP, porin, and adenine nucleotide carrier form a trans- port assembly which interacts with both endogenous and ben- zodiazepine ligands mediating cellular function. We found that the density of porin remained unchanged during MEL cell dif- ferentiation (Fig. 7). Since porin is a major constituent of the outer mitochondrial membrane and the density of porin can be much more than that of the 18-kDa protein (28, 30), only a small part of porin may be involved in forming the PBR com- plex. Then, differentiation of MEL cells could well increase levels of PBR substantially with PBR including porin, but total levels of porin do not change.

It is of interest to determine how the receptor molecule fa- cilitates transport of porphyrin into mitochondrion and whether it interacts directly with porphyrin or proteins such as intracellular porphyrin-binding protein and endozepine, a di- azepam binding inhibitor (31). Of the porphyrin compounds tested, protoporphyrin exhibited a high affinity for mitochon- drial PBR in MEL cells, findings consistent with those of Sny- der’s group (11, 28) that porphyrins, especially the physiologi- cal dicarboxylic porphyrin including protoporphyrin, are putative endogenous ligands for a binding site on the outer

Mitochondrial (Peripheral-type) Benzodiazepine Receptors 7531

membrane of mitochondria, known as PBR. However, protopor- phyrin is a product of the inner membrane of mitochondria. In mammalian heme biosynthesis, the porphyrin precursor which traverses the outer membrane of the mitochondria is copropor- phyrinogen produced by cytosolic uroporphyrinogen decarbox- ylase. Thus, the formed coproporphyrinogen is converted to protoporphyrinogen by a intermembrane space enzyme, copro- porphyrinogen oxidase. Competitive inhibition experiments showed that coproporphyrinogen as well as coproporphyrin ex- hibited low affinities for PBR/IBP in MEL cells. Verma et al. (10) also noted that the binding of coproporphyrin to PBR/IBP of the rat adrenal gland was weak. Therefore, the interaction of coproporphyrinogen with PBR on the outer membrane of mito- chondria may not relate to a high affinity, but rather to a relatively high concentration of coproporphyrinogen present in the cytosol. The observation (32) that endogenous concentra- tions of the porphyrins are ample to provide substantial occu- pancy of the receptor under normal conditions supports the concept of coproporphyrinogen as an endogenous ligand for PBR. In this regard, Proulx et al. (33) reported that conversion of coproporphyrinogen to heme occurred when intact mitochon- dria were incubated with coproporphyrinogen in vitro, thereby indicating that coproporphyrinogen was taken up by mitochon- dria. We propose that the uptake may be mediated by PBR. Further studies on the regulation of PBR gene expression re- lated to heme biosynthesis are expected to shed more light on the precise role of these receptors.

Acknowledgments-We thank K. Yasaka for excellent technical as- sistance, M. Ohara for comments, and F. Shigenobu for secretarial ser- vices.

REFERENCES 1. Anhalt, R. R. H., De Souza, E. B., Oster-Granite, M. L., and Snyder, S. H.

2. Anhalt, R. R. H., Pederson P. L., De Souza, E. B., and Snyder, S. H. (1986) J.

3. Hirsch, J. D., Beyer, C. F., Malkowitz, L., Loullis, C. C., and Blume,A. J. (1989)

4. Antkiewicz-Michaluk, L., Mukhin, A. G., Guidotti, A,. and Krueger, K. E.

5. McEnery, M. W., Snowman, A. E., Trifiletti, R. R., and Snyder, S. H. (1992)

(19851 J. Pharmacol. Exp. Ther 233, 517-526

Biol. Chem. 261,57&583

Mol. Pharmacol. 35, 164-172

(1988) J. Biol. Chem. 263, 17317-17321

6. Sprengel, R., Warner, P., Seeburg, P. H., Mukhin, A. G., Santi, M. R., Grayson, Proc. Natl. Acad. Sci. U. S. A. 89, 3170-3174

D. R., Guidotti, A,, and Krueger, K. E. (1989) J. Biol. Chem. 264, 20415- 20421

7. Riond, J. M. G., Mattei, M., Kaghad, X., Dumont, J. C., Guillemot, G., Le Fur, G., Caput, D., and Ferrara, P. (1991) Eur J. Biochem. 195, 305-311

8. Parola, A. L., Stump, D. G., Pepped, D. J., Krueger, K. E., Regan, J. W., and

9. Riond, J., Leplatois, P., Laurent, P., Le Fur, G., Caput, D., Loison, G., and Laird, H. E., I1 (1991) J. Biol. Chem. 266, 14082-14087

Ferrara, P. (1991) Eur J. Phamacol. 208,307-312 10. Verma, A., Nye, J. S., and Snyder, S. H. (1987) Proc. Natl. Acad. Sci. U. S. A.

64,225&2260 11. Verma, A,, and Snyder, S. H. (19891 Mol. Pharmacol. 34, 800-805 12. Friend, C., Scher, W., Holland, J. G., and Sato, T. 11971) Proc. Natl. Acad. Sci.

13. Sassa, S. (1976) J. Exp. Med. 143, 305-315 14. Kohno, H., Furukawa, T., Yoshinaga, T., Tokunaga, R., and Taketani, S. 11993)

J. Biol. Chem. 268, 21359-21363 15. Gubler, U., and Hoffman, B. J. (1983) Gene (Amst. ) 25, 263-269 16. Taketani, S., Nakahashi, Y., Osumi, T., and Tokunaga, R. (1990) J . Biol. Chem.

17. Sambrook, T., Fritsch, E. E., and Maniatis, T. (1989) in Molecular Cloning:A 265, 19377-19380

Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

18. Sanger, F., Nicklen, S., and Coulson, A. R. (1977)Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467

19. Lowry, 0. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) J. B id . Chem. 193, 265-275

20. Sano, K., Tanihara, H., Heimark, R. L., Obata, S., Davidson, M., St. John, T., Taketani, S., and Suzuki, S. (1993) EMBO J. 12,2249-2256

21. Laemmli, U. K. (19701 Nature 227, 680-685 22. Taketani, S., Kohno, H., Sawamura, T., and Tokunaga, R. 1199O)J. Biol. Chem.

23. Nakahashi, Y., Taketani, S., Sameshima, Y., and Tokunaga, R. (1990) Biochim.

24. Clarke, G. D., and Ryan, P. J. (1980) Nature 287, 160-161 25. Wang, J. K., Morgan, J. J., and Spector, S. (19841 Proc. Natl. Acad. Sci. U. S. A.

26. Mukhin, A. G., Papadopoulos, V., Costa, V., and Krueger, K. E. (19891 Proc.

27. Papadopoulos, V., Mukhin, A. G., Costa, V., and Krueger, K. E. 119901 J. B id .

28. Snyder, S. H., Verma, A,, and Trifiletti, R. R. (1987) FASEB J. 1, 282-288 29. McCabe, R. T., Schoenheimer, J. A,, Skolnick, P., Hauck-Newman, A,, Rice, K.

30. Ha, H., Hajek, P., Bedwell, D. M., and Burrows, P. D. 1199315. Biol. Chem. 268, C., Reig, J.-A., and Klein, D. C. (1989) FEBS Lett. 244,263-267

31. Guidotti, A,, Forchetti, C. M., Corda, M. G., Konkel, D., Bennet, C. D., and 12143-12149

32. Del Batelle, A. M., Wider De Xifra, E. A,, Stella, A. M., Bustos, N., and With, Costa, E. (19831 Proc. Natl. Acad. Sci. U. S. A. 80, 3531-3533

33. Proulx, K. L., Woodard, S. I., and Dailey, H. A. (1993) Protein Science 2, T. K. 11979) Clin. Sci. Mol. Med. 57, 63-70

1092-1098

U. S. A. 68, 378-382

265,13981-13985

Biophys. Acta 1037, 321-327

81,3770-3772

Natl. Acad. Sci. U. S. A. 86, 9813-9816

Chem. 265,3772-3779