the crystal structure of the gst-like domain of elongation factor

1

The Crystal Structure of the GST-like domain

of Elongation Factor 1Bγ from Saccharomyces cerevisiae

Mads Gravers Jeppesen1, Pedro Ortiz2, William Shepard3, Terri Goss Kinzy2, Jens Nyborg1

and Gregers Rom Andersen1*.

1 Department of Molecular Biology, Gustav Wieds vej 10 C, 8000 Århus C, University of Århus,

Denmark.

2 UMDNJ, Robert Wood Johnson Medical School, Department of Molecular Genetics,

Microbiology and Immunology, Piscataway, New Jersey, USA.

3ESRF, 6, rue Jules Horowitz, BP 220, F-38043 Grenoble Cedex, France

* To whom correspondence should be addressed: [email protected]. Tel: (+45) 89425024. Fax:

(+45) 86123178.

Abbreviations: EF, elongation factor; GST, glutathione transferase; GSH, glutathione;

Running title: Crystal Structure of the N-terminal domain of yeast eEF1Bγ.

Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on September 12, 2003 as Manuscript M306630200 by guest on February 13, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

2

SUMMARY

The crystal structure of the N-terminal 219 residues (domain 1) of the conserved

eukaryotic translation elongation factor 1Bγ (eEF1Bγ), encoded by the TEF3 gene in

Saccharomyces cerevisiae, has been determined at 3.0 Å resolution by the single-wavelength

anomalous dispersion technique. The structure is overall very similar to the glutathione S-

transferase (GST) proteins, and contains a pocket with architecture highly homologous to what is

observed in GST-enzymes. The TEF3-encoded form of eEF1Bγ has no obvious catalytic residue.

However, the second form of eEF1Bγ encoded by the TEF4 gene contains serine11, which may

act catalytically. Based on the X-ray structure and gel filtration studies, we suggest that the yeast

eEF1 complex is organized as an [eEF1A·eEF1Bα·eEF1Bγ]2 complex. A 23 residue sequence in

the middle of eEF1Bγ is essential for the stable dimerization of eEF1Bγ and the quaternary

structure of the eEF1 complex.

INTRODUCTION

The protein biosynthesis process is divided into initiation, elongation and termination.

During initiation Met-tRNAiMet is bound to the ribosomal P-site and basepaired with an initiator

AUG codon on the mRNA. In the elongation cycle, the aminoacylated tRNA (aa-tRNA) is

brought to the ribosomal A-site by eukaryotic elongation factor 1A (eEF1A), a 50 kDa G-

protein. The ribosome acts as a GTPase activator for eEF1A in the presence of a correct codon-

anticodon match between the aa-tRNA and the A-site codon of mRNA. eEF1A hydrolyses its

bound GTP and eEF1A·GDP leaves the ribosome (reviewed in (1)). The yeast elongation factor

by guest on February 13, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

3

1 complex (eEF1) consists of eEF1A and elongation factor 1B (eEF1B), which is the guanine

nucleotide exchange factor (GEF) for eEF1A. In all eukaryotes eEF1B contains at least two

subunits, α and γ. In metazoans a third subunit, eEF1Bβ, which shares high sequence similarity

to eEF1Bα is present(2,3). eEF1Bα and eEF1Bβ are catalytic subunits of the exchange factor

and eEF1Bα is essential for viability in S. cerevisiae (4). The interaction between eEF1Bγ and

eEF1Bα involves the N-terminal portion of both proteins (5). The eEF1Bγ subunit in Artemia

salina enhances the activity of the eEF1Bα subunit by 100% when added in a 1:1 molar ratio in

vitro (6).

There are unique aspects of eEF1Bγ function other than association with eEF1Bα. In A.

salina 5% of the eEF1Bα·eEF1Bγ complex in the cell is associated with membranes and eEF1Bγ

can associate with tubulin (6). Studies in human fibroblasts indicated that the eEF1 complex is

predominantly associated with the endoplasmatic reticulum, possibly anchored via eEF1Bγ (7).

Association between eEF1Bγ and mRNA has also been reported (8). eEF1Bγ in S. cerevisiae was

identified through a screen for calcium-dependent membrane binding proteins (9). From the

protein sequence a gene was identified named CAM1 (calcium and membrane binding) and its

disruption does not affect the viability of the cell. The same gene was later identified as acting as

a dosage extragenic suppressor of a cold-sensitive mutant, and named drs2 (deficient for

ribosomal subunits), which is deficient in the assembly of 40S ribosomal subunits (10). The gene

identified was named TEF3 and the protein it encodes Tef3p. A second isoform of eEF1Bγ

encoded by the TEF4 gene in S. cerevisiae has also been identified (11). The sequence identity

between Tef3p and Tef4p is only 64.5%, with the highest conservation in the C-terminus. It is

further believed that protein synthesis is under the control of the cell cycle during meiosis and

mitosis. eEF1Bγ from Xenopus laevis and Carassius auratus was found to be a substrate both in


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

4

vivo and in vitro for the cell division control M-phase promoting factor (MPF) (12,13). Taken

together these results may indicate additional functions for this protein. Very recently Tef3p has

been identified in a complex binding to the msrA promoter suggesting a function in regulation of

expression of methionine sulfoxide reductase (14).

The N-terminal domain of eEF1Bγ has sequence motifs characteristics of the theta class

glutathione transferases (GST) and in accordance with this was suggested to form homodimers

and be enzymatically active (15). Recently, GST activity was observed towards the model

substrate 1-Chloro-2,4-dinitrobenzene (CDNB) with the recombinant eEF1Bγ subunit from

Oryza sativa expressed in Eschericia coli, and for the full native eEF1B complex (16). Likewise,

the silk worm (Bombyx mori) eEF1Bγ has been observed to bind to glutathione (GSH) Sepharose

(17).

Soluble glutathione-S-transferases (GST, EC 2.5.1.18) are proteins involved in the

cellular three-phase metabolism of exogenous and endogenous xenobiotics (18,19). The GSTs

belong to the phase II system of proteins and catalyze the conjugation of the nucleophilic

sulfhydryl group of GSH to a number of electrophilic compounds. The GSTs function by

decreasing the pKa of GSH, thereby allowing its deprotonation and the formation of a more

reactive thiolate anion. In the α, µ, π and σ GST classes this anion is maintained in the active site

through an interaction with a tyrosine residue. In contrast, theta and theta-like GSTs utilize a

conserved serine residue as the primary catalytic active site residue (20). Two GST enzymes,

Gtt1p and Gtt2p, have been identified and characterized in S. cerevisiae (21). Recombinant

protein expressed in E. coli exhibited GST activity towards CDNB.

Limited proteolysis demonstrates that yeast and human eEF1Bγ consists of two structural

domains connected by a flexible linker (this article, (22)). We here present the first


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

5

crystallographic structure of the eEF1Bγ N-terminal domain 1 (residues 1-219) from the yeast S.

cerevisiae determined by the single anomalous dispersion (SAD) technique at 3.0 Å resolution.

Consistent with predictions of a GSH-binding motif (15), the structure of domain 1 is very

similar to those of GST enzymes. Importantly, structural details of the catalytic site are

conserved in the yeast eEF1Bγ domain 1. Both domain 1 and the slightly longer domain 1’

(residues 1-242) were not able to bind to a GSH-matrix, nor did they show any activity towards

the GST model substrate CDNB. A model for the eEF1 complex in S. cerevisiae is suggested

based on this structure and the previously reported structure of eEF1A in complex with the

catalytically active fragment of eEF1Bα (23).

EXPERIMENTAL PROCEDURES

Expression of Full-length eEF1Bγ : Plasmid pTKB532 containing the full-length S. cerevisiae

TEF3 gene with an N-terminal histidine tag and inserted into a pET9d plasmid was transformed

into E. coli BL21 cells. The cells were grown in LB media containing 50 µg/mL kanamycin at

37°C until an OD600 of 0.6-0.8 and protein expressed with 0.25 mM isopropyl-beta-D-

thiogalactopyranoside (IPTG) for 3-4 hours. The cells were harvested by centrifugation. The

following purification steps were performed at 0-6°C. The cells were resuspended in lysis buffer

(250 mM KCl, 40 mM Tris-HCl pH 7.6, 5 mM MgCl2, 0.5 mM EDTA-NaOH pH 7.5, 5 mM β-

mercaptoethanol and 0.1 mM phenylmethylsulfonyl flouride (PMSF)) and sonicated. The lysate

was centrifuged at 50,000 rpm for 75 minutes and the pH of the supernatant was adjusted to at

least 7.6 and loaded on a 5 mL charged HiTrap chelating column (Amersham) equilibrated in

lysis buffer. The column was washed and protein eluted with lysis buffer containing 50 and 120


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

6

mM Imidazole-HCl pH 7.8, respectively. The eluted protein was concentrated in an YM-30

Centricon (Millipore) and loaded on a 120 mL (2 x 60 cm) Superdex 200 Prep Grade gel

filtration column (Amersham) equilibrated in 250 mM KCl, 20 mM Hepes-KOH pH 7.2, 5 mM

DTT and 1 mM PMSF.

Limited Proteolysis of Full-length eEF1Bγ : Full-length eEF1Bγ was mixed with trypsin

(Sigma) in a 640:1 weigth ratio and kept on ice for 16 hours. The reaction was stopped by adding

1 mM PMSF and the result was analyzed by SDS-PAGE. The salt concentration was lowered to

approximately 100 mM by mixing with 20 mM Hepes 7.2. Ion exchange chromatography on a 1

mL Mono-S column (Amersham) lead to the isolation of two distinct domains of eEF1Bγ. The

column was equilibrated in buffer A (100 mM KCl, 20 mM Hepes-KOH pH 7.2 and 0.5 mM

DTT) and eluted with a gradient from buffer A to buffer B (700 mM KCl, 20 mM Hepes-KOH

pH 7.2 and 0.5 mM DTT). In agreement with the predicted high pI of 9.1 for residues 1-219, the

N-terminal basic fragment bound to the column, while the acidic C-terminal fragment was in the

flow through.

Subcloning: Plasmid pTKB176 containing the S. cerevisiae TEF3 gene encoding eEF1Bγ

was used as a template for PCR amplification of the eEF1Bγ (1-219) fragment using primers 5´-

CATGCCATGGCACATCACCATCACCATCACTCTCAAGGTACTTTATATGCT-3´ and 5´-

GAAGATCTTTATTATTGAGGGGGACTCAATGG– 3´. The primers introduce a His6-tag and

a NcoI restriction site at the AUG and a BglII restriction site 3´ of the new stop codon. Bold face

letters marks the restriction sites, and the His6-tag is underlined. The PCR product was digested

with NcoI and BglII and cloned into plasmid pET11d digested with NcoI and BamH I producing

plasmid pTKB588. Based on the observations made with the eEF1Bγ (1-219) construct, a second

construct containing residues 1-242 of eEF1Bγ was made with the same 5´ primer and the 3´


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

7

primer 5´-GAAGATCTTTATTATGGCTTGGCTTCCTCCTT-3´, producing plasmid

pTKB611.

Expression and Purification of SeMet Substituted Protein: Plasmids were transformed

into electrocompetent BL21(DE3)B834 E. coli cells. The SeMet media contained 1 mg/L of

vitamins (riboflavin, niacinamide, pyridoxine monohydrochloride and thiamine), 40 mg/L of all

amino acids except methionine, 40 mg/L of seleno-L-methionine, 25 mg/L FeSO4, 4 g/L glucose,

2 mM MgSO4, 2 g/L NH4Cl, 6 g/L KH2PO4, 25.6 g/L Na2HPO4·7H2O and 100 µg/mL ampicilin.

All amino acids, vitamins and glucose were filtered through a 0.45 µm filter (Sartorius). The rest

of the ingredients were autoclaved prior to mixing (24). An overnight bacterial culture was used

to inoculate SeMet media and after 24 hours of growth at 37°C, an OD600 of approximately 1.0

was achieved. Protein expression was induced with IPTG at a final concentration of 0.5 mM for

6 hours and cells were harvested by centrifugation. All purification steps were performed at 0-

6°C. The cells were resuspended in lysis buffer (250 mM KCl, 50 mM Tris-HCl pH 7.6, 5 mM

MgCl2, 5 mM β-mercaptoethanol and 0.1 mM PMSF) and sonicated. The rest of the protocol is

identical to that of the full-length protein, except that gel filtration was omitted.

Gel Filtration Assay: A 24 mL (0.8 x 30 cm) Superdex 75 HR column (Amersham) was

equilibrated in gel filtration buffer (250 mM KCl, 50 mM Tris-HCl pH 7.6, 1.0 mM DTT and 0.1

mM PMSF). Samples with 200-300 µg of protein were centrifuged before loading on the

column. The flow rate was 0.5 mL/min and 0.5 mL fractions were collected.

GST Activity Assay: The proteins to be used in the assay were dialyzed overnight against

PBS buffer (140 mM NaCl, 2.7 KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4 pH 7.3). The

absorbance was recorded at one-minute intervals for 5 minutes on a LKB Biochrom Ultrospec II

spectrophotometer at a wavelength of 340 nm. The reaction mixture consisted of a total volume


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

8

of 1 mL containing 100 mM KH2PO4 pH 6.5 or 100 mM Tris-HCl pH 7.6, 1 mM of CDNB and

GSH, and a given amount of protein. As a reference, the absorbance at 340 nm was measured

using the reaction mixture and a volume of PBS equal to the volume of protein sample used in

the other sample mixtures. The activity of the proteins were compared to the activity of GST

from Schistosoma japonicum (Sj26) encoded in a pGEX-1 vector (25).

Crystallization: The SeMet substituted protein was crystallized at 6°C by the sitting drop

vapour diffusion technique by mixing 4 µL of reservoir solution (2.36-2.4 M (NH4)2SO4 , 2 mM

reduced GSH, 3 mM DTT, 1 mM NaN3, 0.1 mM EDTA-NaOH pH 7.5, 25 mM Mes-NaOH pH

6, and 25 mM Hepes-NaOH pH 7) with 4 µL of protein solution at 8.4 mg/mL. The protein

concentration was determined by the Bradford method using a BSA standard (26). Crystals

appeared within two days and had dimensions of approximately 500 x 500 x 500 µm.

Data Collection and Processing: Crystals were transferred to stabilization buffer (2.48 M

(NH4)2SO4, 2 mM reduced GSH, 3 mM DTT, 1 mM NaN3, 0.1 mM EDTA-NaOH pH 7.5, 25

mM Mes-NaOH buffer pH 6, and 25 mM Hepes-NaOH buffer pH 7) and stored for two days.

The crystals were then transferred to cryobuffer (stabilization buffer + 20 % glycerol) and frozen

immediately in a stream of nitrogen gas at 100 K. A three-wavelength MAD data set was

collected at the selenium K-edge on the beamline ID29 ESRF, France. The data were processed

and reduced with MOSFLM and SCALA (27). The selenium sites were located with SHELXD

(28), and SAD phases to 3 Å resolution were calculated with CNS (29) using the data collected at

the X-ray wavelength corresponding to the peak of the X-ray fluorescence spectrum. After

density modification an initial model was constructed with O (30). An initial refinement with a

model containing residues 2 to 210 in CNS (29) resulted in the drop of Rfree from 40% to 26%.

Iterative cycles of manual model building and refinement with the experimental phases as


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

9

restraints resulted in a structure with all 219 amino acids (Table 1). Due to the presence of

selenomethionine, and the use of MAD phases as restraints, anomalous pairs were used for

refinement. The quality of the structure was inspected during rebuilding with OOPS2 (31) and

finally with PROCHECK (32). The secondary structure was assigned with DSSP (33). All

figures were made with PyMOL (34). The coordinates have been deposited in the RCSB Protein

Data Bank with ID 1NHY.

RESULTS

Expression of eEF1Bγ Fragments: In order to study the organization of the eEF1

complex in yeast, we initially expressed full-length TEF3-encoded eEF1Bγ in E. coli. However,

this protein showed undesirable properties for structural studies such as a strong tendency to

aggregate at physiological salt conditions (results not shown). Based on limited trypsin digestion

and sequence alignment, we constructed two deletion mutants. The smallest comprised residues

1-219, domain 1, which has clear sequence homology to GST proteins (15). Based on sequence

alignment with the human GST T2-2 sequence we also expressed residues 1-242, domain 1’.

Both recombinant fragments of eEF1Bγ were highly soluble (data not shown).

In gel filtration assays domain 1 eluted at a position similar to carbonic anhydrase (29

kDa) indicating a monomer, while domain 1’ eluted at a position similar to bovine serum

albumin (66 kDa) indicating a dimer (Figure 1). These results suggest that residues 220 to 242

are required for the stable dimerization of Tef3p eEF1Bγ in S. cerevisiae. Proteolytic studies of

the full-length S. cerevisiae Tef3p showed that the protein could be cleaved into two stable

fragments of molecular weights 26 and 21 kDa, respectively, as assessed by SDS-PAGE. The C-


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

10

terminal domain 2, residues 237-415, elutes as a monomer from a gel filtration column (Figure

1). Domain 2 does not interact with eEF1Bα and can be separated from the N-terminal fragment

by ion exchange (data not shown). Both domain 1 and 1’ were able to form stable complexes

with eEF1Bα (data not shown). Although the amino acid sequence suggests homology to the

GSH-binding motif of GST proteins, no such enzymatic activity was observed with domain 1 or

1’ towards the GST marker substrate CDNB, whereas activity was demonstrated for a

recombinant GST (data not shown).

The Structure of Domain 1: Although large single crystals of domain 1’ were obtained,

they diffracted only weakly to approximately 4.5 Å. Crystals of selenomethionated domain 1

diffracted better and a three wavelength dataset was collected at 3 Å resolution. The density map

obtained from SAD phases was superior to that obtained from MAD phases, most likely due to

radiation damage during data collection at the remote and inflection wavelengths. Initially the

crystals were believed to be tetragonal and 100 degrees of data were collected for each

wavelength. Radiation damage was observed already within the peak wavelength collected first,

and only the first 50 degrees of data were used, but due to the high symmetry this was sufficient

to obtain a redundancy of 10.7 (Table 1). The asymmetric unit contains one molecule of domain

1 and a sulfate ion, and has a solvent content of 63%. The experimental map obtained after

density modification was easily interpretable over almost the full length of the protein (Figure 2).

The mean residue realspace correlation calculated with O between the refined model and the

experimental map is 0.83. For comparison the correlation is 0.91 between the model and the final

2Fo-Fc map, but this map inevitably suffers to some degree from model bias, so the correlation to

this map is likely to be artificially high. Visually there is rather little difference between the two

maps indicating a very high quality of the input SAD phases. These phases were used as MLHL


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

11

restraints in all cycles of refinement. Despite that the same test set were used in all refinement

steps, there is an unusual small difference between R and Rfree (Table 1). However, it has been

demonstrated that there is a strong correlation between Rfree and the phase error, and with good

experimental phases the MLHL target is superior for refinement (35). Our structure fully

confirms the power of using good experimental phases as restraints with respect to obtaining low

values of Rfree.

The refined crystal structure of S. cerevisiae eEF1Bγ domain 1 contains all 219 amino

acids and a sulfate ion (Figure 3A).The structure shows striking similarity to GST proteins, and

one of the crystallographic dimers is organized as known GST dimers (Figure 3). Like GST-

enzymes the monomer consists of two subdomains. Subdomain 1N, residues 1-74, has a central

four-stranded β-sheet flanked on one side by the parallel helices α1 and α3 and on the other

solvent exposed side by the α2 helix. A linker of fifteen residues (75-89), of which residues 77-

83 forms a helix, connects subdomain 1N to subdomain 1C containing residues 90-219. As in

GST structures we name the helix in the linker α3B. This helix formation is not seen in the

human theta class GST T2-2 structure, the Arabidopsis thaliana GST theta class structure or the

Australian sheep blowfly Lucilia cuprina GST structure (20,36,37). However, a short 310 helix is

found in the linker connecting subdomains 1N and 1C in the structures of maize GST 1-3 and

GST 1-4 from the mosquito Anopheles dirus (38,39).

Subdomain 1C contains five helices: α4, α5, α6, α6B and α7 (Figures 3 and 4). As in the

human GST T2-2 structure, helix α4 is irregular and is more accurately described as three

helices; α4A, α4B and α4C. The three helices of eEF1Bγ, however are almost coaxial. Helix α5

runs antiparallel with almost the full length of α4 and is slightly bent. Helix α6 contains at its

start the N-capping box (S/TXXD) and a hydrophobic staple motif, both of which are highly


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

12

conserved among GSTs and appear to greatly stabilize their fold (40). This helix runs parallel to

helix α4 and bends away from the subdomain 1N of the protein at its C-terminal end. Compared

to the human GST T2-2 structure there is an additional 310 helix between helices α6 and α7,

termed α6B. A similar helix is seen in the A. thaliana GST theta class structure (37). Subdomain

1C has a hydrophobic core created by an intricate ring stacking of the side chains of residues

Trp99(α4A), Phe143(α5), Phe169(α6), Phe173(α6), Trp181(α6B), Trp191(α7) and Phe192(α7).

Although present in the crystallization solution and in the cryobuffer, no electron density

for GSH was observed in the electron density maps. A large spherical piece of electron density

surrounded by Arg11, Arg13, and Arg171 was observed at the N-terminus of helix α1, which

cannot be attributed to protein. Given the fact that the protein was crystallized in ammonium

sulphate, the basic environment, and that the human GST T2-2 and the maleylacetoacetate

isomerase/glutathione transferase zeta, MAAI/GST Z1-1 structures have a sulfate ion in a similar

position (36,41), this density was modelled as a sulfate ion (Figure 5).

The eEF1Bγ Dimer: Although in solution domain 1 does not dimerize, the crystallization

conditions induce dimer formation around a crystallographic two-fold axis (Figure 3B). The A

and B monomers interact primarily by contacts between β4 and α3 from the subdomain 1N of

one subunit and α4 from the subdomain 1C of the adjacent subunit. This interaction decreases the

solvent accessible surface by 1237 Å2 per monomer. The interactions between the monomers in

the dimer are both hydrophobic and polar. The side chains of Leu60A(β4), Ala65A(α3),

Tyr68A(α3) and Tyr69A(α3) form the hydrophobic core of the dimerization interactions with

Leu90B, Gln93B, Ala94B, Ile97B, all from α4A. The methylene groups of Glu62A, Met64A (α3),

Lys72A (α3) and Arg98B (α4A) all contribute to the dimerization through their side chain

methylene groups at the periphery of this hydrophobic core. The polar and charged residues


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

13

Tyr68, Lys72, Asp87 and Gln93 and their symmetrically equivalents from the other monomer all

points towards the two-fold symmetry axis of the dimer, creating a polar/charged pocket in the

dimer interface. At the 3 Å resolution of the structure water mediated contacts can not be

observed. The hydrophobic “lock-and-key” motif described for mammalian GST structures is

not present in eEF1Bγ Tef3p (42). This involves a hydrophobic key, usually Phe or Tyr, from the

loop preceding β3 and a lock composed of residues from α4 and α5 of the other monomer. The

hydrophobic key in this structure is represented by Leu46, but the side-chain of this residue is

too short and not near a putative lock motif. The bacterial (Proteus mirabilis) β and squid σ class

GSTs both have a polar rather than a hydrophobic dimeric interface and also lacks the lock and

key motif (43,44). In contrast to the classical V-shaped dimer interface observed in other GST

structures, as well as the two theta-like structures, a more close-packed interface is observed in

eEF1Bγ. Finally, the stacking of symmetry related arginine guanidinium groups in the dimer

interface of α, µ, π and σ GST classes (42,44-46) is not observed in the structure presented here.

This is consistent with the observations in the L. cuprina GST structure (20). The only Arg

residue near the dimeric interface, Arg98 from helix α4A, points away from the two-fold axis of

the dimer and towards the solvent. With respect to the interface and the lack of stacked residues,

eEF1Bγ is similar to the bacterial GST β-class protein (43).

Domain 1’ of eEF1Bγ has a lower level of identity (27.9%) compared to domain 2

(57.9%) when comparing the two S. cerevisiae forms with those from human, X. laevis and A.

salina (11). An alignment of the GST homology regions from 20 eEF1Bγ sequences resulted in

the identification of 12 conserved residues (Figure 4A). Two of the conserved residues, cis-

Pro50 and Glu62 from S. cerevisiae eEF1Bγ, are conserved in the GST proteins and are involved

in the positioning and binding of glutathione in the active site (47). Three other identical


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

14

residues, Thr151, Arg190 and Thr194 from subdomain 1C, form an accessible surface patch

opposite to the dimer interface (Figure 6). The largest region of conserved residues between the

aligned eEF1Bγ sequences are found around the hydrophobic staple motif located between α5

and the start of α6, and involved in the proper folding of this motif (40).

A consensus pattern derived for the theta class GSTs showed that the residues unique to

this class mainly cluster on the hydrophilic surface and flanking loops of helix α2 (47). This

region contains the largest difference between GST classes, so it possibly plays a class-specific

role in the reaction mechanism. The largest discrepancies between the eEF1Bγ sequences are

seen in the region around the C-terminus of helices α3 and α3B in the linker region between

subdomains 1N and 1C. A short sequence between these two domains is common in mammalian

GSTs. Another notable fact is the lack of sequence conservation at helix α4B, which in our

structure forms a 310 helix. Surprisingly, there are no strictly conserved residues at the eEF1Bγ

dimer interface. This feature has also been suggested to be a theta class GST characteristic (48).

The dimerization region contains only partly conserved residues, such as Ala94 from α4A and

Ala65 from α3.

The Putative Active Site: The backbone density for the region homologous to the active

site of GSTs is continuous in the initial SAD electron density map, but some of the side chain

densities are weak. The side chain of a potential catalytic residue, Tyr7, is oriented away from

the active site, and no rotamer could bring it near the putative active site. Residues Arg11 and

Arg13 have weak side chain density, which suggest high mobility. The side chain of Arg13 is

within hydrogen bonding distance of the backbone carbonyl group between Val49 and cis-Pro50

(Figure 5). This carbonyl group is coordinating the amino group of the sulfhydryl moiety of

active site bound GSH in GSTs. The backbone density for Val49 and Pro50 is good, and only a


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

15

cis-Pro could be modelled at this position in agreement with a cis-Pro in all other GST structures.

The side chain of Lys48, conserved as Lys53 in the hGST T2-2 structure, has weak side chain

density, indicating high mobility. In the presence of a ligand molecule such as GSH it might

recognize the side chain carbonyl group of the glutamyl moiety, as in the hGST T2-2 structure,

or the glycine-carboxylate group of GSH. The density for Glu62 was also of good quality and

could easily be modeled. Residue Glu62 lies in a generously allowed region of the

Ramachandran plot. This residue is involved in the binding of GSH in GST proteins and lies in a

similar position in the Ramachandran plots of all GSTs. Asp106 from monomer B appears to be

able to coordinate GSH in the active site of monomer A. This is as far as we know in accordance

with all other GST structures except human ω class, squid σ class and the two theta-like GSTs

from A. thaliana and L. cuprina (20,37,44,49).

In the hGST T2-2 structure a sulfate ion is bound in a tetrahedral fashion to Gln12,

Arg107 and Trp115, Arg239 and a water molecule. In our structure it is coordinated to the

backbone amide of the Ile12 peptide bond and the guanidinium group of Arg171 (Figure 5). The

positive dipole moment of helix α1 also contributes to the affinity for the ion at this position.

Due to the low resolution of the structure no water molecules could be modeled, but water

molecules are likely to be involved in the coordination of this ion.

The hydrophobic binding pocket, or H-site, is the binding site for the secondary substrate

in GSTs, i.e. the cellular toxic compound. Due to the coaxial nature of helices α4A, α4B and

α4C in our structure, the residues corresponding to helix α4C in the hGST T2-2 structure that are

responsible for forming part of the H-site, are not near a putative H-site in the isolated domain 1

and they are not conserved. The loop between β2 and α2 responsible for forming the other part

of the H-site in hGST T2-2, is too short and positioned too far from a possible H-site in eEF1Bγ


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

16

domain 1. Crystal contacts around the loop region preceding helix α2 may be responsible for

dislocating this region.

DISCUSSION

The Quaternary Structure of eEF1: The characterization of an eEF1 complex in S.

cerevisiae was first performed by Saha and Chakraburtty (2). They determined the ratio of

eEF1A·eEF1Bγ·eEF1Bα subunits to be 2:1:1, and estimated the molecular weight of the complex

to be approximately 200 kDa. Based on the crystal structure and the gel filtration studies

presented here together with the structure of the eEF1A·eEF1Bα complex (23) a model for eEF1

in yeast can be proposed, (Figure 7). This results in a 2:2:2 stoichiometric composition of the

three yeast components eEF1A, eEF1Bα and eEF1Bγ for the eEF1 complex, yielding a

theoretical molecular weight of 240 kDa in agreement with the organization of the eEF1Bβ

deficient eEF1 complex II from Artemia (50). In the hGST T2-2 dimer the two C-terminal

helices are oriented in an anti-parallel fashion resulting in the two C-terminal residues from each

monomer being almost in hydrogen bonding distance. If eEF1Bγ in its full-length form adopts a

similar secondary structure in this region, the stabilization of an eEF1Bγ dimer could be due to a

coiled coil structure in this region possibly formed by some of the residues 220-242. The size of

the N-terminal fragment originally isolated after limited trypsinolysis, and which formed a dimer

in a gel filtration assay, seem to have an intermediate size between recombinant domain 1 and

domain 1’ when analyzed by SDS-PAGE. It is therefore likely that not all of residues 220-242

are required for the stable dimerization.

Several other models for eEF1 have been proposed (50-54). The one that is most

consistent with the model presented here is the A. salina model in which


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

17

[eEF1A·eEF1Bα·eEF1Bγ·eEF1Bβ·eEF1A]2, with a molecular weight of 408 kDa, constitutes the

eEF1 complex (50). To elaborate on this model, we can say that the GST-like domain 1’ of

eEF1Bγ mediates the dimerization of the complex and that the C-terminal part of eEF1Bα

interacts with the N-terminus of eEF1A (23). eEF1Bβ has been suggested to mediate the

dimerization in two mammalian models (51,54). The only other model in which eEF1Bγ is

explicitly suggested to dimerize is in the rabbit eEF1 model (53), in which eEF1Bα also is

suggested to dimerize. The Xenopus model in which eEF1Bγ is suggested to form a trimers that

dimerize (52), seems less likely based on the structure presented here.

The conserved patch on the solvent exposed side of eEF1Bγ may be part of an

interaction area with eEF1Bα (Figures 6 and 7). An interaction site for eEF1Bα close to the

putative active site of eEF1Bγ (see below) may help facilitate communication between the

exchange activity and the putative GST-like activity of eEF1Bγ. However, until the proper

substrate for the latter has been identified, in vitro experiments demonstrating such a linkage are

not feasible. Based on sequence alignment it appears that eEF1Bγ from many species have a

longer loop region between β2 and α2 (Figure 4B), and this appears to correlate with the

presence of eEF1Bβ. Hence, this loop could be important for the interaction between eEF1Bγ

and eEF1Bβ in metazoans. This loop is well separated from the conserved surface patch, which

might be involved in interaction with eEF1Bα. Alternatively, it could form part of the

supposedly active site in eEF1Bγ, maybe adding flexibility to the region and allow induced fit

upon substrate binding and catalysis. An induced fit mechanism has been suggested for the

maize GST I enzyme (38), which was suggested to belong to the theta class (55). This solvent

exposed loop region is involved in the formation of the H-site in GST proteins, so this region


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

18

may also define specificity for the putative substrate. The consensus sequence derived from

sequences containing the long loop is F38XXGX(T/S)N(K/R)(T/S)46 (Figure 4B). The boldface

letters indicates conserved residues, X indicates any residue and the numbers corresponds to the

human sequence. The animal sequences seem to be slightly longer in this region as compared to

plant sequences, but these seem to have slightly longer sequence around α3B. One exception is

eEF1Bγ from the protozoans Trypanosoma cruzi and Leishmania infantum, which have a Cys

residue instead of the conserved Phe residue at position 38.

Is eEF1Bγ Catalytically Active?: The overall structure of the Tef3p dimer and especially

the conserved cis-Pro50 and Glu62 all suggest that eEF1Bγ in yeast is catalytically active as a

GST protein as previously demonstrated for recombinant rice eEF1Bγ (16), despite our own

failure to demonstrate this with the fragments of yeast eEF1Bγ. The evolutionary maintenance of

such a specific structure for no reason seems very unlikely. Since the active site of eEF1Bγ

Tef3p has a high degree of homology to other GST active sites, and although no catalytic residue

could be identified, a novel GST activity mechanism with a very specific secondary substrate

should not be ruled out. Arginine is a conserved active site residue in class α GSTs except in a

chicken liver GST. The structural equivalent in eEF1Bγ Tef3p is Arg13, which is also conserved

in the Tef4p form of yeast eEF1Bγ. The conformation of Arg13 in eEF1Bγ Tef3p could explain

why neither of the two Tef3p constructs were able to bind to a GSH affinity matrix since it

overlaps with the putative GSH binding site. Mutational studies of the equivalent Arg15 from the

human alpha class GST, hGST A1-1, showed that alteration of this amino acid reduced the

catalytic activity of the enzyme (56). A conformation of eEF1Bγ Arg13 similar to the one in

hGST A1-1 could not only facilitate the binding of GSH in the active site, but could also at the

same time bring the charged δ-guanido group of Arg13 closer to the sulfate ion, thereby


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

19

stabilizing it further. The involvement of an Arg residue in the active site no longer seems to be

α-class specific. The squid σ class GST also has an Arg residue at a similar position (44).

Another residue conserved between the hGST A1-1 and Tef3p are Arg13 and Arg11,

respectively. Their function seems far from similar though. While the A1-1 Arg13 points away

from the active site, Arg11 from eEF1Bγ Tef3p points into the putative active site. In Tef4p this

residue is a Ser, which may be involved in the catalytic activity of Tef4p eEF1Bγ based on

alignment with the catalytic Ser residue in human GST T2-2. The human pi class GST hGST P1-

1 also has two Arg residues, Arg11 and Arg13 (46). The side chain of Arg11 points towards the

glutamyl-carboxylate moiety of GSH and its position thereby differs from both the equivalent

positions in hGST A1-1 and Tef3p. Chemical modification studies of Arg13 have confirmed its

involvement in binding of GSH in the active site (57).

Most of the eEF1Bγ proteins have a tyrosine or threonine residue in or near the putative

active site in eEF1Bγ. A Tyr at position 9 in the Tef3p can position its hydroxyl group in a

location very similar to that of the Ser11 hydroxyl group of the hGST T2-2 structure, suggesting

that this residue functions as the active site in the majority of the eEF1Bγ’s. However, yeast

Tef4p, C. albicans and S. pombe eEF1Bγ have a Ser residue in this position. Interestingly, rice

(Oryza sativa) eEF1Bγ, which showed GST activity towards the GST model substrate CDNB,

does not seem to posses a potential catalytic residue near the putative active site (16).

The existence of additional genes in S. cerevisiae coding for proteins with GST activity

has previously been excluded (21). Tef3p and Tef4p, and possible the related ORF YGR201C

similar to the N-terminus of eEF1Bγ (58), may in this context be thought of as GST-like proteins

which may catalyze highly specific reactions, perhaps also at specific locations in the cell. The

TEF3 and TEF4 genes are not essential for growth, but in contrast to extra copies of the TEF3


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

20

gene, extra copies of the TEF4 gene were not able to suppress the cold-sensitive growth of the

drs2 ribosome assembly mutant (11). These observations indicate that Tef3p and Tef4p have

different functions in the cell.

The crystal contacts in the region around the end of β2 and the loop preceding helix α2

may be responsible for the absence of secondary structure in the C-terminal 20 residues and

perhaps a dislocated α2 helix. These two regions are highly involved in the formation of the H-

and G-sites, respectively, in GST structures. If residues 200-242 in the full-length eEF1Bγ adopt

a conformation similar to that of hGST T2-2, Phe210 in Tef3p might form part of the

hydrophobic binding site. In the long random coil of the protein constituting the C-terminus of

our structure there is a proline rich area with residues Pro214, 217 and 218. This region may be

functional homologous to the Pro-rich linker region Pro226, 228 and 230, that spans the top of

the active site cavity connecting helix α8B and α9 in the human GST T2-2 theta class protein.

The GST-like domain of eEF1Bγ is of interest related to the in vivo effects of the loss of

eEF1Bγ in yeast. Deletion of either TEF3 or TEF4 results in increased resistance to oxidative

stress*. This effect is additive at least partially through the catalytic activity of the eEF1B

complex. Thus, this domain may play a novel role in regard to the activity of the eEF1B complex

and the response to oxidative stress.

Acknowledgements. TGK, PAO, GRA and JN were supported by NIH grant GM62789. GRA

and JN were also supported by DANSYNC and the Danish Science Research Council.

* O. Olarewaju and T.G. Kinzy, unpublished.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

21

References

1. Merrick, W. C., and Nyborg, J. (2000) The Protein Biosynthesis Elongation Cycle.

Translational Control of Gene Expression, Cold Spring Harbor Laboratory Press.

2. Saha, S. K., and Chakraburtty, K. (1986) J. Biol. Chem. 261, 12599-12603.

3. Morales, J., Cormier, P., Mulner-Lorillon, O., Poulhe, R., and Belle, R. (1992) Nucleic

Acids Res. 20, 4091.

4. Hiraga, K., Suzuki, K., Tsuchiya, E., and Miyakawa, T. (1993) FEBS Lett. 316, 165-169.

5. van Damme, H., Amons, R., Janssen, G., and Moller, W. (1991) Eur. J. Biochem. 197,

505-511.

6. Janssen, G. M., and Moller, W. (1988) Eur. J. Biochem. 171, 119-129.

7. Sanders, J., Brandsma, M., Janssen, G. M., Dijk, J., and Moller, W. (1996) J. Cell Sci.

109, 1113-1117.

8. Al-Maghrebi, M., Brule, H., Padkina, M., Allen, C., Holmes, W. M., and Zehner, Z. E.

(2002) Nucleic Acids Res. 30, 5017-5028.

9. Kambouris, N. G., Burke, D. J., and Creutz, C. E. (1993) Yeast 9, 151-163.

10. Ripmaster, T. L., Vaughn, G. P., and Woolford, J. L., Jr. (1993) Mol. Cell. Biol. 13,

7901-7912.

11. Kinzy, T. G., Ripmaster, T. L., and Woolford, J. L., Jr. (1994) Nucleic Acids Res. 22,

2703-2707.

12. Janssen, G. M., Morales, J., Schipper, A., Labbe, J. C., Mulner-Lorillon, O., Belle, R.,

and Moller, W. (1991) J. Biol. Chem. 266, 14885-14888.

13. Tokumoto, M., Nagahama, Y., and Tokumoto, T. (2002) DNA Seq. 13, 27-31.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

22

14. Hanbauer, I., Boja, E. S., and Moskovitz, J. (2003) Proc. Natl. Acad. Sci. U S A 100,

8199-8204

15. Koonin, E. V., Mushegian, A. R., Tatusov, R. L., Altschul, S. F., Bryant, S. H., Bork, P.,

and Valencia, A. (1994) Protein Sci. 3, 2045-2054.

16. Kobayashi, S., Kidou, S., and Ejiri, S. (2001) Biochem. Biophys. Res. Commun. 288, 509-

514.

17. Kamiie, K., Nomura, Y., Kobayashi, S., Taira, H., Kobayashi, K., Yamashita, T., Kidou,

S., and Ejiri, S. (2002) Biosci. Biotechnol. Biochem. 66, 558-565.

18. Sheehan, D., Meade, G., Foley, V. M., and Dowd, C. A. (2001) Biochem. J. 360, 1-16.

19. Ishikawa, T. (1992) Trends Biochem. Sci. 17, 463-468.

20. Wilce, M. C., Board, P. G., Feil, S. C., and Parker, M. W. (1995) EMBO J. 14, 2133-

2143.

21. Choi, J. H., Lou, W., and Vancura, A. (1998) J. Biol. Chem. 273, 29915-29922.

22. van Wetswinkel, S., Kriek, J., Andersen, G.R., Güntert, P., Dijk, J., Canters, G.W., and

Siegal G. (2003) in sdf

23. Andersen, G. R., Pedersen, L., Valente, L., Chatterjee, I., Kinzy, T. G., Kjeldgaard, M.,

and Nyborg, J. (2000) Mol. Cell 6, 1261-1266.

24. Doublie, S. (1997) Methods Enzymol. 276, 523-530

25. Smith, D. B., and Johnson, K. S. (1988) Gene 67, 31-40.

26. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254.

27. Leslie, A. G. W. (1992) Joint CCP4 + ESF-EAMCB Newsletter on Protein

Crystallography 26

28. Schneider, T. R., and Sheldrick, G. M. (2002) Acta Crystallogr. D 58, 1772-1779.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

23

29. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-Kunstleve,

R. W., Jiang, J. S., Kuszewski, J., Nilges, M., Pannu, N. S., Read, R. J., Rice, L. M.,

Simonson, T., and Warren, G. L. (1998) Acta Crystallogr. D 54, 905-921.

30. Jones, T. A., Zou, J. Y., Cowan, S. W., and Kjeldgaard. (1991) Acta Crystallogr. A 47,

110-119.

31. Kleywegt, G. J. (2002) Validation of protein crystal structures. Acta Crystallogr. D 56,

249-65.

32. Laskowski, R. A., MacArthur, M. W., Moss, D. S., and Thornton, J. M. (1993) J. Appl.

Cryst. 26, 283-291

33. Kabsch, W., and Sander, C. (1983) Biopolymers 22, 2577-2637.

34. DeLano, W. L. (2002) The PyMOL User's Manual, DeLano Scientific, CA, USA, San

Carlos.

35. Adams, P. D., Pannu, N. S., Read, R. J., and Brunger, A. T. (1999) Acta Crystallogr. D

55, 181-190.

36. Rossjohn, J., McKinstry, W. J., Oakley, A. J., Verger, D., Flanagan, J., Chelvanayagam,

G., Tan, K. L., Board, P. G., and Parker, M. W. (1998) Structure 6, 309-322.

37. Reinemer, P., Prade, L., Hof, P., Neuefeind, T., Huber, R., Zettl, R., Palme, K., Schell, J.,

Koelln, I., Bartunik, H. D., and Bieseler, B. (1996) J. Mol. Biol. 255, 289-309.

38. Neuefeind, T., Huber, R., Dasenbrock, H., Prade, L., and Bieseler, B. (1997) J. Mol. Biol.

274, 446-453.

39. Oakley, A. J., Harnnoi, T., Udomsinprasert, R., Jirajaroenrat, K., Ketterman, A. J., and

Wilce, M. C. (2001) Protein Sci. 10, 2176-2185.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

24

40. Stenberg, G., Dragani, B., Cocco, R., Mannervik, B., and Aceto, A. (2000) J. Biol. Chem.

275, 10421-10428.

41. Polekhina, G., Board, P. G., Blackburn, A. C., and Parker, M. W. (2001) Biochemistry

40, 1567-1576.

42. Ji, X., Zhang, P., Armstrong, R. N., and Gilliland, G. L. (1992) Biochemistry 31, 10169-

10184.

43. Rossjohn, J., Polekhina, G., Feil, S. C., Allocati, N., Masulli, M., De Illio, C., and Parker,

M. W. (1998) Structure 6, 721-734.

44. Ji, X., von Rosenvinge, E. C., Johnson, W. W., Tomarev, S. I., Piatigorsky, J.,

Armstrong, R. N., and Gilliland, G. L. (1995) Biochemistry 34, 5317-5328.

45. Sinning, I., Kleywegt, G. J., Cowan, S. W., Reinemer, P., Dirr, H. W., Huber, R.,

Gilliland, G. L., Armstrong, R. N., Ji, X., Board, P. G., and et al. (1993) J. Mol. Biol. 232,

192-212.

46. Reinemer, P., Dirr, H. W., Ladenstein, R., Huber, R., Lo Bello, M., Federici, G., and

Parker, M. W. (1992) J. Mol. Biol. 227, 214-226.

47. Rossjohn, J., Board, P. G., Parker, M. W., and Wilce, M. C. (1996) Protein Eng. 9, 327-

332.

48. Prade, L., Hof, P., and Bieseler, B. (1997) Biol. Chem. 378, 317-320.

49. Board, P. G., Coggan, M., Chelvanayagam, G., Easteal, S., Jermiin, L. S., Schulte, G. K.,

Danley, D. E., Hoth, L. R., Griffor, M. C., Kamath, A. V., Rosner, M. H., Chrunyk, B.

A., Perregaux, D. E., Gabel, C. A., Geoghegan, K. F., and Pandit, J. (2000) J. Biol. Chem.

275, 24798-24806.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

25

50. Janssen, G. M., van Damme, H. T., Kriek, J., Amons, R., and Moller, W. (1994) J. Biol.

Chem. 269, 31410-31417.

51. Bec, G., Kerjan, P., and Waller, J. P. (1994) J. Biol. Chem. 269, 2086-2092.

52. Minella, O., Mulner-Lorillon, O., Bec, G., Cormier, P., and Belle, R. (1998) Biosci. Rep.

18, 119-127.

53. Sheu, G. T., and Traugh, J. A. (1999) Mol. Cell. Biochem. 191, 181-186.

54. Mansilla, F., Friis, I., Jadidi, M., Nielsen, K. M., Clark, B. F., and Knudsen, C. R. (2002)

Biochem. J. 365, 669-676.

55. Pemble, S. E., and Taylor, J. B. (1992) Biochem. J. 287, 957-963.

56. Bjornestedt, R., Stenberg, G., Widersten, M., Board, P. G., Sinning, I., Jones, T. A., and

Mannervik, B. (1995) J. Mol. Biol. 247, 765-773.

57. Xia, C., Meyer, D. J., Chen, H., Reinemer, P., Huber, R., and Ketterer, B. (1993)

Biochem. J. 293, 357-362.

58. Guerreiro, P., Barreiros, T., Soares, H., Cyrne, L., Maia e Silva, A., and Rodrigues-

Pousada, C. (1996) Yeast 12, 273-280.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

26

Figure legends

Figure 1: Gel filtration assays with three domains of eEF1Bγ. All three chromatograms have

been superimposed; domain 1’ (1-242) solid line, domain 1 (1-219) dashed line and domain 2

(237-415) dotted line. Bovine serum albumin (66 kDa) and carbonic anhydrase (29 kDa) were

used to calibrate the column. The recombinant domains 1’ and 1 elute almost identical to BSA

and carbonic anhydrase, respectively, indicating a dimeric and monomeric subunit organization.

Domain 2 of eEF1Bγ elutes slightly later than carbonic anhydrase suggesting a monomer.

Figure 2: Stereo view of the experimental electron density calculated by density modification

starting from SAD phases at 3Å resolution. The density is contoured at 1.5σ around residues

Glu62 (bottom) to Leu73 (top). The final model of helix α3 has been superimposed on the

electron density. SeMet64 is one of three sites identified by SHELXD.

Figure 3: A. The eEF1Bγ domain 1 monomer viewed from the dimer interface side. The N-

terminal subdomain 1N containing the sulfate ion is shown on the left and subdomain 1C on the

right. The N- and C-terminus are labeled along with the secondary structural elements and the

sulfate ion. The last 20 amino acids constituting the C-terminus of subdomain 1C have been

colored orange for clarity. B. The eEF1Bγ GST-like dimer viewed along the crystallographic

two-fold axis. Monomer A is shown on the left in cyan with subdomain 1N at the bottom

containing the sulfate ion and subdomain 1C at the top, and monomer B is shown on the right in

yellow. C. The human GST T2-2 monomer with 1-menaphthyl-GSH and a sulfate ion shown in


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

27

ball and stick bound in the active site (36)). Helices α8B and α9, shown in orange, completely

encapsulate the active site.

Figure 4: A. Amino acid sequence alignment between Tef3p eEF1Bγ domain 1 and hGST T2-2.

The sequences have been aligned based on their structure. The secondary structure elements of

the two proteins are indicated above and below the sequence, respectively. The eEF1Bγ sequence

has been colored based on an alignment between 20 eEF1Bγ sequences made with ClustalW.

Similar residues have a light grey background, residues identical in 50% or more of the

sequences have a dark grey background and strictly conserved residues a black background. The

active residue in hGST T2-2 have a black background and three other residues important for the

binding of GSH are boxed. The similarity between the two sequences is indicated below by :

(similar) and * (identical). B. Partial sequences of eEF1Bγ from different species with the

putative eEF1Bβ recognition loop. Same coloring as in A.

Figure 5: The putative active site of eEF1Bγ Tef3p. The side chains of key residues in and

around the active site of GST proteins are shown in ball and stick. See text for further discussion.

Figure 6: Surface representation of conservation as described in Figure 4 mapped on the eEF1Bγ

domain 1 monomer. Residues less than 50% identical are colored red, while blue indicates 100%

identity. Residues with between 50 and 100% identity are colored grey. A. eEF1Bγ viewed from

the dimer interface in the same orientation as Figure 3A. B. View from the solvent exposed face.

The three 100% conserved residues Thr151, Arg190 and Thr194 form a patch on the solvent

exposed side of the N-terminal of eEF1Bγ.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

28

Figure 7: Hypothetical model of yeast eEF1 based on structural studies and gel filtration

experiments. The three subunits eEF1A, eEF1Bα and eEF1Bγ are proposed to form an

[eEF1A·eEF1Bα·eEF1Bγ]2 complex. The crystal structure of eEF1A in complex with the C-

terminal catalytic fragment of eEF1Bα from S. cerevisiae (23) is shown at the bottom left and

right. The nucleotide binding domain I (purple) of eEF1A and domain II (blue) interacts with

eEF1Bα (green). Domain III of eEF1A is colored red. The GST-like domain of eEF1Bγ is

hypothesized to mediate the dimerization of the complex. The C-terminal of eEF1Bγ and the N-

terminal of eEF1Bα are indicated by the dashed spheres. The suggested interaction site for

eEF1Bα on eEF1Bγ, based on the high sequence identity in this region, is marked by *. The

theoretical molecular weight of the complex is 240 kDa.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

29

Table and figures

Table 1: Statistics for data collection and refinement.

Data SeMet (peak)

Space group I4132

Unit-cell parameters

a = b = c (Å) 164.52

α = β = γ (°) 90

Wavelength (Å) 0.9792

Resolution (Å)1 20-3.0 (3.17-3.0)

Completeness1 (%) 99.9 (99.6)

Mean I/σ(I)1 50.1 (7.7)

R merge (%)1,2 5.3 (36.2)

Redundancy1 10.7 (10.9)

Reflections

Used 12773

Free 974

Total atoms/waters 1752/0

R-factor (%)1,3 23.46 (43.2)

Rfree-factor (%)1,4 23.49 (42.0)

R.m.s. deviation

Bonds (Å) 0.009

Angles (°) 1.3

1 Values in brackets are for outer resolution shell.

2 Rmerge = (ΣhΣj = 1, N Ih – Ih (j) / ΣhN x Ih) for the


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

30

intensity of a reflection measured N times.

3 R = Σh F obs - k Fcalc/ Σh Fobs where Fobs and

Fcalc are the observed and calculated structure factor

respectively, and k is a scaling factor.

4 Rfree is identical to R on a subset of test reflections

not used in refinement.

Table 1


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Gregers Rom AndersenMads Gravers Jeppesen, Pedro Ortiz, William Shepard, Terri Goss Kinzy, Jens Nyborg and

saccharomyces cerevisiaThe crystal structure of the GST-like domain of elongation factor 1Bg from

published online September 12, 2003J. Biol. Chem.

10.1074/jbc.M306630200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M306630200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M306630200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/09/12/jbc.M306630200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2003/09/12/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/09/12/jbc.M306630200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

the crystal structure of the gst-like domain of elongation factor

Documents