lable at ScienceDirect

Anaerobe 16 (2010) 533e539

Contents lists avai

Anaerobe

journal homepage: www.elsevier .com/locate/anaerobe

Pathogenesis and Toxins

The ability of disease and non-disease producing strains of Clostridiumperfringens from chickens to adhere to extracellular matrix moleculesand Caco-2 cells

Thomas G. Martin, Joan A. Smyth*

Department of Pathobiology and Veterinary Science, University of Connecticut, 61 North Eagleville Road, Storrs, CT 06269, USA

a r t i c l e i n f o

Article history:Received 27 January 2010Received in revised form20 May 2010Accepted 8 July 2010Available online 21 July 2010

Keywords:Clostridium perfringensNecrotic enteritisAdhesionnetBChickenPoultryExtracellular matrix moleculesCaco-2

* Corresponding author. Tel.: þ1 860 486 0820; faxE-mail address: joan.smyth@uconn.edu (J.A. Smyth

1075-9964/$ e see front matter � 2010 Elsevier Ltd.doi:10.1016/j.anaerobe.2010.07.003

a b s t r a c t

Clostridium perfringens is a major enteric pathogen that is responsible for causing necrotic enteritis ofpoultry. The ability to adhere to the host’s intestinal epithelium and to extracellular matrix molecules(ECMM) in the gut, are strategies used by numerous bacterial enteropathogens, however, C. perfringenshas received comparatively little attention in this respect. The present study investigated sixteen typeA C. perfringens isolates from chickens, with varying disease producing ability with respect to necroticenteritis in chickens, for their ability to adhere to nine different extracellular matrix molecules (ECMM)and to the intestinal epithelial cell line Caco-2. C. perfringens strains were able to bind to ECMMs andthere was strain variation. Strains of C. perfringens that produced severe disease, were capable of bindingto collagen type III, IV and V, fibrinogen, laminin and vitronectin at higher levels than less severe diseaseproducing strains, suggesting that the ability to adhere to ECMMs might enhance virulence with respectto induction of necrotic enteritis. In addition, severe disease producing strains also bound betterto collagen type III and IV and fibrinogen, than non-disease producing strains. The present study alsoshowed that some strains of C. perfringens possessed the ability to adhere to Caco-2 cells; however norelationship was found between the ability to adhere to Caco-2 cells and disease producing ability.

� 2010 Elsevier Ltd. All rights reserved.

1. Introduction

Clostridium perfringens is a major enteric pathogen in bothanimals and humans [1,2]. It is responsible for causing foodpoisoning and enteritis necroticans in humans, hemorrhagicenteritis in calves, enterotoxemia in horses, piglets and sheep, andnecrotic enteritis (NE) of poultry [1e6]. Necrotic enteritis isa serious economic disease of poultry, and it has been estimatedthat NE cost the world poultry industry roughly two billion dollarsin 2000 [7]. Much of the current research on NE has focused onfinding a definitive toxin that is responsible for causing disease[8e12]. The investigation of other potential virulence factors hasreceived comparatively little attention.

The ability to adhere to host intestinal epithelium and toextracellular matrix molecules (ECMM) in the gut, are strategiesused by numerous bacterial enteropathogens [13e16]. In spite ofthis, there is a limited amount of data regarding the ability ofenteric strains of C. perfringens to adhere to epithelial cells [17]. In

: þ1 860 486 2794.).

All rights reserved.

fact, it is generally accepted that C. perfringens does not adhere tohealthy intestinal epithelium [2].

Experimental studies in our laboratory [18] and by others[19,20], have shown that the ability of C. perfringens to produce NEis strain dependent. Histological observations (Smyth, unpub-lished), [21] show that in experimentally derived and naturallyoccurring cases of NE, villi that are undergoing necrosis are coatedwith a thick mat of organisms, raising the possibility that diseaseproducing isolates of C. perfringens are adhering to the gut, and thatnecrosis maybe due to direct diffusion of toxins from the adherentorganisms. Furthermore, during the study of early lesions it oftenappeared that the organisms adhered directly to either the base-ment membrane or the lamina propria, although the possibility ofadherence to the basal aspects of epithelial cells could not beexcluded (Smyth, unpublished observation).

The confirmation that some strains of C. perfringens producea type I collagen binding protein (CpCna) and two fibronectinbinding proteins (FbpA, FbpB) [22e24] supports the possibility thatthis organism may posses adhesive properties, which could playa potential role in virulence. Another clostridial enteric pathogen,Clostridium difficile, has been shown to adhere to Caco-2 cells and toECMM in several studies [13,25]. Moreover, Borriello et al. [26]

T.G. Martin, J.A. Smyth / Anaerobe 16 (2010) 533e539534

clearly demonstrated that C. difficile can associate with the intes-tinal mucosa of hamsters and that here was a positive correlationbetween the ability to adhere and virulence in vivo.

The present study investigates the ability of sixteen, type AC. perfringens isolates of known disease producing ability withrespect to NE, to adhere to nine ECMMs and to the intestinalepithelial cell line Caco-2.

2. Methods

2.1. Bacterial strains and growth conditions

Seventeen strains of C. perfringens were used in this study. Allwere type A. C. perfringens strain ATCC 10543 was obtained fromthe American Type Culture Collection (ATCC), for use as a positivecontrol for polymerase chain reaction (PCR) for the collagenbinding and fibronectin binding genes, cna, fbpA and fbpB. Thesixteen C. perfringens test strains were clinical isolates which hadbeen recovered from chickens. These strains have previously beengenotyped [27] and have also been characterized for ability toproduce NE in chickens by testing in a disease challenge model[18]. Strains, additional genotype information and diseaseproducing ability are detailed in Table 1. For the purpose of anal-ysis, C. perfringens isolates that produced severe NE lesions in 70%or more of chickens exposed to the disease model are consideredas severe disease producing strains, while strains that producedsevere NE lesions in less than 40% of chickens are classed as lesssevere or ‘milder’ disease producing strains [18] (Table 1). Allstrains classified as severe disease producing, produced a signifi-cantly higher (p < 0.05) percentage of chickens with severelesions (Grade >2) than less severe disease producing strains.Thus, Strains 1e3 were grouped as severe disease producing,Strains 4e6 as milder disease producing and Strains 7e16 as non-disease producing (Table 1).

All C. perfringens strains were grown in brain heart infusionbroth containing 5% yeast extract and 0.5% L-cysteine (BHI broth)(Becton, Dickinson and Company, Franklin Lakes, NJ) or on trypticsoy agar plates (TSAB) containing 5% sheep blood at 37 �C underanaerobic conditions (10% H2:5% CO2:85% N2).

Lactobacillus rhamnosus GG strain ATCC 53103, was obtainedfrom the ATCC for use as a positive control for the cell adhesion

Table 1Strains of Clostridium perfringens used in this study and results of PCR for collagentype I and fibronectin binding genes.

Strain number Strain and ability toproduce NEa

cna � fbpA � fbpB �

1 Severe disease producingb e e þ2 Severe disease producingb þ e þ3 Severe disease producingb e e þ4 Milder disease producingb þ þ þ5 Milder disease producingb e e þ6 Milder disease producingb e e þ7 Non-disease producing e e þ8 Non-disease producing e þ þ9 Non-disease producing þ e þ10 Non-disease producing e þ þ11 Non-disease producing e e þ12 Non-disease producing e þ þ13 Non-disease producing e e þ14 Non-disease producing e þ þ15 Non-disease producing e e e

16 Non-disease producing e þ þATCC 10543 Not tested þ þ þa All strains were previously tested in a disease model for their ability to produce

necrotic enteritis [18]. See Material and Methods for classifications of severe andmilder disease producing strains.

b Strains were positive for netB.

assay [28]. It was grown on TSAB and in de Man, Rogosa and Sharpebroth (MRS) (Becton, Dickinson and Company, Franklin Lakes, NJ)at 37 �C under anaerobic conditions [28].

2.2. Polymerase chain reaction (PCR) for detection of cna, fbpAand fbpB

All C. perfringens strains were examined for the presence ofthe cna, fbpA, and fbpB genes using PCR. Primers were designed forfbpA and fbpB (Table 2) using published sequence data for C. per-fringens strain 13 [29] (GenBank accession no. BA000016). Pub-lished primers were used for detection of cna ([22], Table 2).

DNA templates were prepared for each C. perfringens strain, asdescribed by Songer and Bueschel (1999) [30]. PCR amplification foreach gene was performed in separate 25 ul reaction mixtures con-taining GoTaq Green Master Mix (Promega, Madison, WI), 1 uM ofeach oligonucleotide primer (Table 2) and 5 ul of DNA template.Cycle conditions for PCR were as follows: 2 min initial denaturationat 94 �C, 35 cycles of 1min at 94 �C,1min at 50 �C and 1min at 72 �C,and a final extension of 10min at 72 �C. PCR products were separatedby electrophoresis in a 1.5% agarose gel containing 1.0 mg/ml ofethidium bromide and visualized by UV transillumination. Theexpected PCR product size for cna is 621 base pairs, however a 348base pairs product is also possible due to an in-frame deletion insome strains [22]. The expected product size for fbpA and fbpB is 456and 794 base pairs respectively. C. perfringens ATCC reference stain10543 served as the positive control for PCR. Negative controlsamples were included in each round of reactions.

2.3. Enzyme-linked immunosorbent assay (ELISA) to test for theability of C. perfringens to bind to extracellular matrix molecules

The conditions described below for the ELISA were based onoptimization studies that tested various blocking buffers (5% bovineserum albumin (BSA), 5% skim milk, SynBlock (ImmunoChemistryTechnologies, Bloomington, MN)), concentrations of C. perfringens(OD600 ¼ 0.3e0.5), incubation times (1e2 h) and antibodyconcentrations (1:250 to 1:5000) (data not shown).

Microtiter plates (Immulon 1B, Thermo Scientific, Waltham,MA) were separately coated with the following extracellular matrixmolecules (ECMM): collagen type I1, III2, IV1, V2, fibrinogen2,fibronectin1, laminin1, proteoglycan2 and vitronectin1 (1Becton,Dickinson and Company, Franklin Lakes, NJ and 2SigmaeAldrich,Saint Louis, Missouri) according to the method described by Cer-quetti et al. [13]. Each ECMM was added at concentrations of 0.4, 2,10 and 50 mg ml�1, based on the work by Cerquetti et al. [13]. Aftercoating, wells were washed three times with phosphate bufferedsaline containing 0.05% Tween 20 (PBST). Wells were blocked with300 ul of SynBlock Buffer for 2.5 h at 37 �C and then washed threetimes with PBST. Overnight broth cultures of C. perfringens werepelleted by centrifugation at 4000 g for 10 min, washed twice withPBST and adjusted to a specific turbidity (OD600 ¼ 0.4) in PBST.

Table 2Primer sequences and expected amplicon sizes.

Protein Gene Sequence (50e30) PCR productsize (bp)

Reference

CpCna Can GTTGTTAATACAGTAAAAACTGG 621, 348 [22]CCCCTCAATTATTCTACCATCAG [22]

FbpA fbpA GCAGAGTGCTGAAACAAATGCT 456 This Studya

ACCCTAAGAAACTGTACTGACCA This Studya

FbpB fbpB CCCTGGTGTAAGCTATGTATTCCC 794 This Studya

CTGCAACCTGTATGCTTGAGGA This Studya

a Primers were designed based on sequence data from Clostridium perfringensstrain 13 (GenBank accession no. BA000016, [28]).

T.G. Martin, J.A. Smyth / Anaerobe 16 (2010) 533e539 535

100 ul of the resuspended bacteria was added to each well, andplates were incubated in an anaerobic environment at 37 �C for 2 h.Wells were thenwashed four times with PBST, and 100 ul of 1:1000rabbit anti-C. perfringens polyclonal IgG antibody (AbD Serotec,Oxford, UK) was added to the wells. Plates were incubated for 1 h at37 �C, washed four times with PBST, and then 100 ul of 1:1000peroxidase labeled goat anti-rabbit IgG antibody (Kirkegaard andPerry (KPL), Gaithersburg, MD) was added to each well. Followingincubation for 1 h at 37 �C, wells werewashed four times with PBSTand bound labeled antibodies were detected by adding 2,20-azino-di-(3- ethylbenzthiazoline-6-sulfonate (ABTS) peroxidase substrate(KPL, Gaithersburg, MD) for 30 min. Reactions were stopped byadding ABTS peroxidase stop solution (KPL, Gaithersburg, MD) toeach well. Absorbance was measured at 405 nm using a microplatereader (SPECTRAmax 250, Molecular Devices Crop., Sunnyvale, CA).All experiments were performed in triplicate.

In each assay, wells which were not coated with ECMM, butwere blocked, were used to control for non-specific binding ofbacteria to the plates. The Absorbance readings from these wells,were subtracted from the readings for test wells, to give a ‘cor-rected’ Absorbance reading. Additional negative controls includedon each plate were, wells that were coated with ECMM but did notreceive bacteria, and wells that were coated with bovine serumalbumin (BSA) or fetuin, which is highly glycosylated, at the sameconcentrations as the ECMMs (0.4, 2, 10 and 50 mg ml�1).

2.4. Cell culture conditions and cell adhesion assay

The human colon adenocarcinoma cell line Caco-2 (ATCC HTB-37) was obtained from the ATCC. Caco-2 were grown in Eagle’sminimum essential medium (MEM) supplemented with 10% fetalbovine serum (FBS) and were maintained in a humidified envi-ronment with an atmosphere of 5% CO2 at 37 �C.

The conditions described below for cell adhesion assays werebased on optimization studies that tested several incubation times(1e3 h) and conditions (mircoaerophilic vs anaerobic), bacterialconcentrations (OD600 ¼ 0.3 to 0.5), and the number of washes(1e3) (data not shown). For adhesion assays, 24 well tissueculture plates (Becton, Dickinson and Company, Franklin Lakes, NJ)were seeded with Caco-2 cells, at 4 � 104 viable cells per well. Theculture medium was changed every two days. Caco-2 cell mono-layers were used at either 4 days (undifferentiated), or 15-days(differentiated) post seeding [13,32]. Fifteen day-old monolayerswere used as either intact monolayers or after treatment withethylene glycol-bis(b-aminoethyl ether)-N,N,N0,N0, tetraacetic acid(EGTA) to disrupt tight junctions according to Cerquetti et al. [13].Overnight bacterial cell cultures were washed and resuspended incell culture medium to give an OD600 of 0.3. Bacterial suspensionswere added to wells with cell monolayers, and incubated for 1 h at37 �C anaerobically. Following incubation, cell monolayers werewashed 2 times with 1 ml of PBS to remove unbound bacteria.

Wells were then treated with 1 ml of 0.05% trypsin containing0.5mMEDTA, for 10min at 37 �Cwith gentlemixing (pipetting) andthe number of bacteria released [31] per well was determined byplating serial 10-fold dilutions of the cell suspension onto TSABplates, followed by incubation at 37 �C under anaerobic conditionsfor 24 h. Negative controls included 1) wells with no Caco-2 cellsthat were given bacteria and 2) wells to which no bacteria wereadded to Caco-2 cells. For positive control purposes, L. rhamnosusstrainATCC53103whichhasbeen shownpreviously to bind toCaco-2 cells [28] was used. All experiments were performed in triplicate.

An adhesion index for bacterial binding to monolayers wasdetermined by 3 different methods. 1) Method of Cerquetti et al.[13] 2) Method of Le Blay et al. [31] and 3) the method describedbelow, which takes into account potential non-specific binding of

bacteria to the wells. In this method, the number of bacteriarecovered from the wells without Caco-2 cells is subtracted, fromthe number of bacteria recovered fromwells with Caco-2 cells, anddivided by the total number of bacteria added to the wells. Figuresare presented as percentage of bacteria adhering.

2.5. Statistical analysis

For each ECMM, the corrected Absorbance values of all diseaseproducing strains were compared to the corrected Absorbancevalues of non-disease producing strains using an unpaired t test. Totest for the possibility that disease producing strains may need theability to adhere to two or more ECMM in order to be able toproduce disease, a multivariate analysis of variance (MANOVA)with a Wilks’ Lambda criterion was used to compare the ability ofdisease producing strains to bind to combinations of ECMMs, to theability of non-disease producing strains to adhere to these samecombinations. Every possible combination of ECMM was testedincluding pairs, triplets, quartets and so on through to the group ofall 9 ECMMs.

One-way analysis of variance (ANOVA) followed by the Tukeypost hoc test was used to compare the ability of severe diseaseproducing strains, milder disease producing strains, and non-disease producing strains to adhere to each ECMM.

Unpaired t tests were used to examine differences in the abilityof C. perfringens strains to adhere to 4 and 15-day-old Caco-2 cells.Unpaired t tests were used to examine differences in the ability ofC. perfringens strains to adhere to 15-day-old Caco-2 cells that weretreated or not treated with EGTA. A one-way analysis of variance(ANOVA) followed by the Dunnett post hoc test was used tocompare the adhesion index of the L. rhamnosus positive controlstrain to the C. perfringens test strains.

3. Results

3.1. Detection of cna, fbpA and fbpB

As expected, positive control strain ATCC 10543 yielded ampli-cons for cna, fbpA, and fbpB. No products were found in the negativecontrols. Of the sixteen C. perfringens test strains, only three (18.8%)were positive for cna; these were, two of six disease producingstrains and one of ten non-disease producing isolates. All PCRproducts were 621 base pairs in length, which corresponds to thefull length product [22].

Of the sixteen clinical isolates examined, all except one non-disease producing isolate (Strain 15), were positive for the fbpBgene (93.8%). Only six of the sixteen isolates were positive for fbpA(37.5%); these were five of ten (50%) non-disease producing isolatesand one of six (16.7%) disease producing strains. Only one strain,which was a milder disease producing strain, was positive for allthree genes (Table 1).

3.2. ELISA testing for the ability of C. perfringens strains to bind toextracellular matrix molecules

All C. perfringens strains bound very poorly to the negativecontrols (BSA and fetuin) (Table 3), and no antibody reactivity withthe different ECMMs was detected in the control wells to which nobacteria had been added. C. perfringens test strains were capable ofbinding to some degree, to all ECMMs (Table 3) except proteo-glycan. For proteoglycan, the corrected Absorbance values were lessthan 0.02, which was lower than the BSA and fetuin negativecontrols. The numbers of bound C. perfringens increased with theconcentration of ECMM used, however Absorbance readings lev-eled off for most ECMMs at 10 and 50 mg/ml (data not shown).

Table 3Ability of severe disease producing, milder disease producing and non-disease producing strains of C. perfringens to bind to extracellular matrix molecules at a concentration of50 mg/ml as determined by ELISAa.

DiseaseStatus (nb)

Collagentype I

Collagentype III

Collagentype IV

Collagentype V

Fibrinogen Fibronectin Laminin Vitronectin BSAf Fetuinf

Severe-DPc(3) 0.42 � 0.21 0.80 � 0.31AB 1.82 � 0.55AB 0.10 � 0.04A 0.73 � 0.26AB 0.87 � 0.23 0.60 � 0.26A 0.12 � 0.02A 0.04 � 0.03 0.05 � 0.03Milder-DPd (3) 0.12 � 0.09 0.30 � 0.17A 0.60 � 0.40A 0.03 � 0.01A 0.14 � 0.11AC 0.57 � 0.23A 0.19 � 0.22A 0.03 � 0.02AB 0.02 � 0.02 0.03 � 0.02Non-DPe(10) 0.30 � 0.27 0.44 � 0.27B 1.00 � 0.41B 0.07 � 0.05 0.42 � 0.24BC 1.29 � 0.72A 0.41 � 0.27 0.08 � 0.04B 0.02 � 0.01 0.04 � 0.02

AeC Values with matching superscript letters are significantly different (p < 0.05).a Values are the corrected mean Absorbance readings of test strains � standard deviation of three separate experiments.b n, number of test strains per group.c Severe-DP, Severe disease producing strain.d Milder-DP, Milder disease producing strain.e Non-DP, Non-disease producing strain.f Negative controls.

T.G. Martin, J.A. Smyth / Anaerobe 16 (2010) 533e539536

In general, C. perfringens strains bound better (highest Absor-bance readings) to fibronectin and collagen type IV (Table 3). Theability of C. perfringens strains to bind to collagen type V andvitronectin was considerably lower than the ability to bind to allother ECMMs except proteoglycan, although binding was stillhigher than to the BSA and fetuin controls (Table 3).

The mean Absorbance value for disease producing isolates(Strains 1e6) was greater for each ECMM except fibronectin, whencompared to non-disease producing isolates (Strains 7e16).However there was considerable overlap in the range of each cate-gory, and the differences were not statistically significant (p > 0.05).Comparisons between the ability of disease producing and non-disease producing strains to bind to multiple ECMMs in all possiblecombinations and permutations, revealed no associations.

When disease producing strains were separated into severedisease producing (Strains 1e3) strains and milder diseaseproducing (Strains 4e6) strains, statistical analysis showed thatsevere disease producing strains bound better (p< 0.05) to collagentype III, IV and V, fibrinogen, laminin and vitronectin than milderdisease producing strains (Fig. 1 and Table 3). In addition, severedisease producing strains also bound better (p < 0.05) to collagentype III and IV and fibrinogen, than non-disease producing strains(Fig. 1 and Table 3).

3.3. Ability of C. perfringens to adhere to Caco-2

Three methods were used to calculate the Adhesion index (SeeMaterial and Methods). However, there were no substantivedifferences in the results between methods. The results describedbelow and in Table 4 were calculated using Method 3, which tookinto account non-specific binding of bacteria to the wells.

EGTA treatment of 15-day-old monolayers had no effect onbinding of either the L. rhamnosus GG (positive control) or C.perfringens test strains (data not shown). The positive controlstrain, L. rhamnosus GG was capable of binding to both 4 and 15-day-old Caco-2 monolayers, to similar levels (p > 0.05) (Table 4).Nine of the sixteen C. perfringens test strains bound better(p < 0.05) to 15-day-old monolayers than 4-day-old monolayers(Table 4). One strain (Strain 13) bound less (p< 0.05) to 15-day-oldmonolayers than 4-day-old monolayers. There was no differencein binding abilities to different ages of monolayers for theremaining six strains (Table 4). Based on these results, thecomparisons of the binding ability of C. perfringens were madebased on adhesion to 15-day-old monolayers.

Four of the C. perfringens test strains bound to a similar (p> 0.05)or better level (p < 0.05) than the positive control strain (Table 4).These were two disease producing strains (Strain 2 & 5) and twonon-disease producing strains (Strain 9 & 11). The remaining teststrains bound to significantly lesser levels (p < 0.05) than the posi-tive control strain. There was no correlation between the ability of C.

perfringens to adhere to Caco-2 cells and ability to produce disease,as adhesion indexes were similar across all groups.

4. Discussion

C. perfringens is a serious enteric pathogen that is capable ofcausing disease in humans and animals. Many enteric pathogenscan adhere to gut epithelium or ECMMs [13e16,26]. However, eventhough it has been recognized in recent years that some diseaseproducing strains of C. difficile can adhere to epithelial cells orECMMs [13,25,33], there has only been one study examining theability of some enteric strains of C. perfringens to adhere toepithelial cells [17]. The present study investigated the ability ofknown NE disease producing and non-disease producing strains ofC. perfringens recovered from chickens, to determine if there wasany association between ability to bind to collagen type I, III, IV, V,fibrinogen, fibronectin, laminin, proteogylcan and ability to induceNE in chickens. In addition, the ability of C. perfringens to adhere tothe human colon adenocarcinoma cell line Caco-2was investigated.

Caco-2 cells were chosen for adhesion assays for four reasons. A)There are no commercially available continuous poultry intestinalepithelial cell lines and cultivation of primary poultry intestinalcells has met with limited success and furthermore, they are shortlived [34]. B) Caco-2 cells, closely resemble small intestinalepithelial cells and have the ability to differentiate and expresscharacteristics of mature enterocytes, under standard cultureconditions, by 14-days post seeding [13,32]. C) Caco-2 cells havecommonly been used in studies on mechanism of adherence andinvasion of enteropathogens, including C. difficile [13,15,35,36] D)Preliminary studies in our laboratory using Vero cells, which havebeen used to study enteropathogens including, C. difficile [36,37],showed that the C. perfringens test strains were either unable toadhere or they adhered poorly to Vero cells (unpublishedobservations).

Adhesion to Caco-2 cells was tested at two stages of differenti-ation since Cerquetti et al. [13] found C. difficile adhered better to4-day-old Caco-2 cells than to 15-day-old cells. They also found thatadhesion of Clostridium diffiicle to 15-day-old Caco-2 increased,when the cells were treated with EGTA to expose the basolateralsurface of the cells [13]. However, in the present study of C. per-fringens, adhesion was better to 15-day-old Caco-2 cells than to4-day-old Caco-2, and treatment with EGTA had no effect on theability to adhere. This suggests that unlike human strains ofC. difficile, strains of C. perfringens from chickens do not preferen-tially adhere to undifferentiated cells or to the basolateral aspect ofCaco-2 cells.

Two disease producing and two non-disease producing strainsof C. perfringens adhered to 15-day-old Caco-2 cell monolayersat similar or better levels than the positive control strain, L. rham-nosus. This demonstrates for the first time that some C. perfringens

Fig. 1. Select scatter plots of severe disease producing, milder disease producing and non-disease producing strains of C. perfringens binding to ECMMs at 50 mg/ml. A) Collagen typeIII B) Fibrinogen C) LamininNon-DP Non-disease producing strainM-DP Milder disease producing strainS-DP Severe disease producing strainDiamonds represent the mean Absorbance readings for each strain from three experiments. Error bars indicate standard deviations.

T.G. Martin, J.A. Smyth / Anaerobe 16 (2010) 533e539 537

strains can adhere to intestinal epithelial cells. While the remainingdisease producing and non-disease producing strains of C. per-fringens bound significantly less (p< 0.05) than the positive controlstrain to 15-day-old Caco-2 monolayers, it remains possible thatthe lesser binding by some of these strains could potentially havebiological significance. Although no associationwas found betweenthe disease producing ability of C. perfringens isolates fromchickens, and the ability to adhere to Caco-2 cells, no finalconclusion can be drawn with respect to NE, since Caco-2 cells area human intestinal cell line and may have different surface recep-tors than intestinal cells of chickens.

The detection of fbpA and fbpB in 6/16 and 15/16 of C. perfringenstest strains respectively, confirms the report by Katayama et al. [24]that fibronectin binding genes of C. perfringens are likely widelydistributed in C. perfringens strains. The finding that the collagentype I binding gene cnawas found in only 3 of 16 test strains, whilethe majority of strains were capable of binding to collagen type Isuggests that there are likely additional collagen type I bindingproteins present in C. perfringens.

The ECMMs used in the present study were selected for threereasons. A) It has been shown that pathogenic bacteria such asC. difficile, Arcanobacterium pyogenes, Enterococcus faecalis, Listeriaspp, Mycoplasma spp, Mycobacterium spp, Staphylococcus spp,Streptococcus spp and Yersinia spp [14,22,23,38e40] frequently

express surface proteins with affinity towards ECMMs such ascollagens, fibrinogen, fibronectin, laminin, proteogylcan andvitronectin, and are thought to play a role in colonization of thehost. B) Histological examination of NE cases raised the possibilitythat C. perfringens adheres to the basement membrane orsubstances in the laminia propria. Collagen type IV and laminin aremajor components of the basementmembranewhile, collagen typeI, III, and IV, fibronectin, proteoglycans and vitronectin are found inthe extracellular matrix [41]. The plasma protein fibrinogen waschosen because it leaks from damaged blood vessels and associateswith the extracellular matrix during tissue repair [41]. C) The workof Cerquetti et al. [13] showed that a pathogenic strain of C. difficilewas capable of binding collagen type I, III, IV and V, fibrinogen,fibronectin and vitronectin [13].

Examination of the ability of C. perfringens strains to bind toECMMsrevealed thatseverediseaseproducingstrainsofC.perfringenswere better at binding to collagen type I, III, IV and V, fibrinogen,laminin and vitronectin than milder disease producing strains(p<0.05). Theabilityof severediseaseproducingstrains tobindbetterto these ECMMs than less virulent strains suggests that the ability toadhere, may enhance virulence. C. perfringens strains adhered best tocollagen type IV, which is the most abundant protein found in thebasement membrane [41]. While statistically significant differenceswere found betweenmild- and severe- disease producing strains, the

Table 4Ability of Clostridium perfringens strains to adhere to 4 and 15-day-old Caco-2monolayers.

Strainnumber

DiseaseproducingStatus

Adhesion Index (%)4-day-old Caco-2Cellse

Adhesion Index (%)15-day-old Caco-2Cellse

Lactobacillusrhamnosusa

N/A 4.28 � 0.46 4.06 � 0.21

1 Severe-DPb 0.96 � 0.30 2.59 � 0.33AD

2 Severe-DP 1.47 � 0.32 3.82 � 1.06AB

3 Severe-DP 0.30 � 0.13 0.93 � 0.62D

4 Milder-DPc 1.26 � 0.26 2.86 � 0.05AD

5 Milder-DP 1.06 � 0.26 3.12 � 0.57AB

6 Milder-DP 0.73 � 0.34 0.53 � 0.15D

7 Non-DPd 2.22 � 0.48 2.00 � 0.75D

8 Non-DP 0.83 � 0.33 0.58 � 0.03D

9 Non-DP 1.99 � 0.13 5.54 � 0.76AC

10 Non-DP 0.86 � 0.33 0.97 � 0.12D

11 Non-DP 0.79 � 0.06 3.77 � 0.85AB

12 Non-DP 1.23 � 0.34 2.39 � 0.64AD

13 Non-DP 2.67 � 0.51 1.26 � 0.49AD

14 Non-DP 0.57 � 0.11 2.82 � 0.31AD

15 Non-DP 0.17 � 0.12 0.52 � 0.03AD

16 Non-DP 0.50 � 0.25 0.53 � 0.15D

A Indicates a significant difference in the ability to bind to 4-day and 15-daymonolayers *p < 0.05.B Indicates the AI was similar to positive control strain p > 0.05.C Indicates the AI was higher than the positive control strain p < 0.05.D indicates the AI was significantly lower (p < 0.05) than the positive control strain.

a Positive control.b Severe-DP, Severe disease producing strain.c Milder-DP, Mild disease producing strain.d Non-DP, Non-disease producing strains.e Values are expressed as the mean Adhesion Indexes (AI) � standard deviation

(See Material and Methods, AI Method 3) of three experiments.

T.G. Martin, J.A. Smyth / Anaerobe 16 (2010) 533e539538

numbers of such strains were small. If the relative disease producingcapability of more strains becomes established in the future, it wouldtherefore be useful to test these for their ability to adhere.

Non-disease producing strains of C. perfringens adhered tosimilar levels, or sometimes better, to ECMMs than milder diseaseproducing strains. However, all of the milder disease producingstrains in the present study possessed netB, which has been sug-gested to be a critical factor in the development of NE [11], whilenone of the non-disease producing strains possessed netB. Takentogether, the results show that ability to adhere alone is not suffi-cient to confer disease producing capability.

ECMMs are not normally exposed in healthy intestinal epithe-lium except during enterocyte turnover [42]. However, they can beexposed as a consequence of tissue damage by toxins secreted byC. perfringens or by other pathogens such as Eimeria species, whichare an important predisposing factor for NE development [43]. Inaddition, other factors such as gut pH or changes in dietarycompositions can also compromise the integrity of the epithelium[43], exposing ECMMs.

The intestinal tissue damage associated with NE of poultry isconsidered to be due to C. perfringens toxins such as NetB and/oralpha toxin [8,9,11,12]. However, if organisms adhere to ECMMs orintestinal epithelial cells, higher concentrations of toxins will reachtissues than if organisms are free in the lumen, where their toxinscan be diluted or neutralized by enzymes in the gut. Finally,organisms that are able to adhere also have a greater chance ofestablishing and colonizing the host

In conclusion, we have demonstrated that strains of C. per-fringens are capable of binding to ECMMs, and in some cases toCaco-2 cells. The results obtained with the ECMMs suggest, thatthe ability to adhere to ECMMs enhances virulence in strains ofC. perfringens that possess essential virulence factors suchas netB.

Acknowledgements

The authors gratefully acknowledge funding from the Universityof Connecticut Research Foundation.

References

[1] Duirre P. Handbook on clostridia. Taylor & Francis; 2005.[2] Songer JG. Clostridial enteric diseases of domestic animals. Clin Microbiol Rev

1996;9:216e34.[3] Lawrence G, Walker PD. Pathogenesis of enteritis necroticans in Papua New

Guinea. Lancet 1976;1976(17):125e6.[4] Hatheway CL. Toxigenic clostridia. Clin Microbiol Rev 1990;3:66e98.[5] Parish WE. Necrotic enteritis in the fowl (Gallus gallus domesticus). I. Histo-

pathology of the disease and isolation of a strain of Clostridium welchii.J Comp Pathol 1961;71:377e93.

[6] Sims LD, Tzipori S, Hazardi GH, Carroll CL. Haemorrhagic necrotising enteritisin foals associated with Clostridium perfringens. Aust Vet J 1985;62:194e6.

[7] McReynolds JL, Byrd JA, Anderson RC, Moore RW, Edrington TS, Genovese KL,et al. Evaluation of Immunosuppressants and dietary mechanisms in anexperiment disease model for NE. Poult Sci 2004;83:1948e52.

[8] Al-Sheikhly F, Truscott RB. The pathology of necrotic enteritis of chickensfollowing infusion of crude toxins of Clostridium perfringens into theduodenum. Avian Dis 1977;21:241e55.

[9] Al-Sheikhly F, Truscott RB. The interaction of Clostridium perfringens and itstoxins in the production of necrotic enteritis of chickens. Avian Dis1977;21:256e63.

[10] Keyburn AL, Sheedy SA, Ford ME, Williamson MM, Awad MM, Rood JI, et al.Alpha-toxin of Clostridium perfringens is not an essential virulence factor innecrotic enteritis in chickens. Infect Immun 2006;74:6496e500.

[11] Keyburn AL, Boyce JD, Vaz P, Bannam TL, Ford ME, Parker D, et al. NetB, A newtoxin that is associated with avian necrotic enteritis caused by Clostridiumperfringens. PLoS Pathog 2008;4:1e11.

[12] McCourt MT, Finlay DA, Laird C, Smyth JA, Bell C, Ball HJ. Sandwich ELISAdetection of Clostridium perfringens cells and alpha-toxin from field cases ofnecrotic enteritis in poultry. Vet Microbiol 2005;106:259e64.

[13] Cerquetti M, Serafino A, Sebastianelli A, Mastrantonio P. Binding of Clostridiumdifficile to Caco-2 epithelial cell line and to extracellular matrix proteins. FEMSImmunol Med Microbiol 2002;32:211e8.

[14] Hubble TS, Hatton JF, Nallapareddy SR, Murray BE, Gillespie MJ. Influence ofEnterococcus faecalis proteases and the collagen-binding protein. MicrobiolImmunol 2003;18:121e6.

[15] Knutton S, Lloyd DR, McNeish AS. Adhesion of enteropathogenic Escherichicacoli to human intestinal enterocytes and cultured human intestinal mucosa.Infect Immun 1987;55:69e77.

[16] Pultz NJ, Vesterlund S, Ouwehand AC, Donskey CJ. Adhesion of vancomycin-resistant enterococcus to human intestinal mucus. Curr Microbiol2006;52:221e4.

[17] Teixera EP. Adhesive properties of an outer structure of Clostriduim perfringenstype A isolated form piglets with catarrhal enteritis. Revista de Microbiologia1999;30:242e8.

[18] Smyth JS, Martin TG. Disease producing capability of netB positive isolates ofC. perfringens recovered from normal chickens and a cow, and netB positiveand negative isolates from chickens with necrotic enteritis. Vet Microbiol;2010;. doi:10.1016/j.vetmic.2010.04.022.

[19] Cooper KK, Songer JG. Virulence of Clostridium perfringens in an experimentalmodel of poultry necrotic enteritis. Vet Microbol; 2009; doi:10.1016/j.vetmic.2009.09.065.

[20] Timbermont L, Lanckriet A, Gholamiandehkordi AR, Pasmans F, Martel A,Haesebrouck F, et al. Origin of Clostridium perfringens isolates determine theability to induce necrotic enteritis in broilers. Comp Immunol Microbiol InfectDis; 2008; doi:10.1016/j.cimid.2008.07.001.

[21] Long JR, Pettit JR, BarnumDA.Necrotic enteritis in broiler chickens III. Pathologyand proposed pathogenesis. Can J Comp Med Vet Sci 1974;38:467e74.

[22] Jost HB, Billington SJ, Trinh HT, Songer JG. Association of genes encoding beta2toxin and a collagen binding protein in Clostridium perfringens isolates ofporcine origin. Vet Microbiol 2006;115:173e82.

[23] Katayama S, Nozu N, Yokoyama M, Hitsumoto Y. Detection of fibronectin-binding proteins in Clostridium perfringens. Acta Med Okayama2006;60:351e5.

[24] Katayama S, Nozu N, Okuda M, Hirota S, Yamasaki T, Hitsumoto Y. Charac-terization of two putative fibronectin-binding proteins of Clostridium per-fringens. Anaerobe 2009;15:155e9.

[25] Taha S, Johansson O, Johsson SR, Heimer D, Krovacek K. Toxin production byand adhesive properties of Clostridium difficile isolated from humans andhorses with antibiotic-associated diarrhea. Comp Immunol Microbiol InfectDis 2007;30:163e74.

[26] Borriello SP, Welch AR, Barclay F, Davis HA. Mucosal association by Clos-tridium difficile in the hamster gastrointestinal tract. J Med Microbiol1988;25:191e6.

[27] Martin TG, Smyth JA. Prevalence of netB among some clinical isolates ofClostridium perfringens from animals in the United States. Vet Microbiol2009;136:202e5.

T.G. Martin, J.A. Smyth / Anaerobe 16 (2010) 533e539 539

[28] Tuomla EM, Salminen SJ. Adhesion of some probiotic and dairy Lactobacillusstrains to Caco-2 cell cultures. Int J Food Microbiol 1998;41:45e51.

[29] Shimizu T, Ohtani K, Hirakawa H, Ohshima K, Yamashita A, Shiba T, et al.Complete genome sequence of Clostridium perfringens, an anaerobic flesh-eater. Prod Natl Acad Sci 2002;99:996e1001.

[30] Songer JG, Bueschel D. Multiplex PCR procedure for genotyping Clostridium per-fringens, http://www.microvet.arizona.edu/Faculty/songer/multiplexprocedure.pdf; 1999.

[31] Le Blay G, Fliss I, Lacroix C. Comparative detection of bacterial adhesion toCaco-2 cells with ELISA, radioactivity and plate count methods. J MicrobiolMethods 2004;59:211e21.

[32] Pinto M, Robine-Leon S, Appay MD, Kedinger M, Triadou N, Dussaulx E, et al.Enterocyte-like differentiation and polarization of the humon colon carci-noma cell line Caco-2 in culture. Biol Cell 1983;47:323e30.

[33] Waligora AJ, Barc MC, Bourlioux P, Collignon A, Karjalainen T. Clostridiumdifficile cell attachment is modified by environmental factors. Appl EnvironMicrobiol 1999;65:4234e8.

[34] Ali A, Reynolds D. Primary cell culture of Turkey intestinal epithelial cells.Avian Dis 1996;40:103e8.

[35] Bernet-Camard MF, Coconnier MH, Hudault S, Timbermount AL. Pathogenicityof the diffusely adhering strain Escherichia coli C1845: F1845 adhesin-decayaccelerating factor interaction, brush border microvillus injury, and actin

disassembly in cultured human intestinal epithelial cells. Infect Immun1996;64:1918e28.

[36] Dupre I, Zanetti S, Schito AM, Fadda G, Sechi LA. Incidence of virulencedeterminants in clinical Enterococcus faecium and Enterococcus faecalis isolatescollect in Sardinia (Italy). J Med Microbiol 2003;52:491e8.

[37] Salit IE, Gotschlich EC. Type I Escherichia coli pili: characterization of bindingto monkey kidney cells. J Exp Med 1977;146:1182e94.

[38] May M, Papazisi L, Gorton T, Geary S. Identification of Fribronectin bindingproteins in Mycoplasma gallisepticum strain R. Infect Immun2006;74:1777e85.

[39] Xu Y, Rivas JM, Brown EL, Liang X, Hook M. Virulence potential of thestaphylococcal adhesin CNA in experimental arthritis is determined by itsaffinity for collagen. J Infect Dis 2004;189:2323e33.

[40] Westerlund B, Korhonen TK. Bacterial proteins binding to the mammalianextracellular matrix. Mol Microbiolo 1993;9:1157e88.

[41] LeBleu VS, MacDonald B, Kalluri R. Structure and function of basementmembranes. Exp Biol Med 2007;232:1121e9.

[42] Creamer B. The turnover of the epithelium of the small intestine. Br Med Bull1967;23:226e30.

[43] Van Immerseel F, De Buck J, Pasmans F, Huyghebaert G, Hasesebrouck F,Ducatelle R. Clostridium perfringens in poultry: an emerging threat for animaland public health. Avian Pathol 2004;33:537e49.