1

The 14-3-3 homolog, ArtA, regulates development and secondary metabolism 1

in the opportunistic plant pathogen Aspergillus flavus 2

3

Beatriz A. Ibarra1, Jessica M. Lohmar1, Timothy Satterlee1, Taylor McDonald1, Jeffrey W. 4

Cary2, Ana M. Calvo1* 5

6

1. Department of Biological Sciences, Northern Illinois University, 155 Castle Dr., Dekalb, IL, 7

60115, USA 8

2. Food and Feed Safety Research Unit, USDA/ARS, Southern Regional Research Center, New 9

Orleans, LA, 70124, USA 10

11

*Corresponding author: Department of Biological Sciences, Northern Illinois University, 155 12

Castle Dr., Dekalb, IL, 60115, USA. amcalvo@niu.edu 13

14

15

Abstract 16

17

The opportunistic plant pathogenic fungus Aspergillus flavus produces carcinogenic mycotoxins 18

termed aflatoxins (AFs). Aflatoxin contamination of agriculturally important crops such as 19

maize, peanut, sorghum and tree nuts is responsible for serious adverse health and economic 20

impacts worldwide. In order to identify possible genetic targets to reduce AF contamination, we 21

have characterized the artA gene, encoding a putative 14-3-3 homolog in A. flavus. The artA 22

deletion mutant presents a slight decrease in vegetative growth and alterations in morphological 23

AEM Accepted Manuscript Posted Online 15 December 2017Appl. Environ. Microbiol. doi:10.1128/AEM.02241-17Copyright © 2017 American Society for Microbiology. All Rights Reserved.

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

2

development and secondary metabolism. Specifically, artA affects conidiation, and this effect is 24

influenced by the type of substrate and culture condition. In addition, normal levels of artA are 25

required for sclerotial development. Importantly, artA negatively regulates AF production as 26

well as the concomitant expression of genes in the AF gene cluster. An increase in AF is also 27

observed in seeds infected with the A. flavus strain lacking artA. Furthermore, the expression of 28

other secondary metabolite genes is also artA-dependent, including genes in the cyclopiazonic 29

acid (CPA) and ustiloxin gene clusters, in this agriculturally important fungus. 30

31

Importance 32

33

In the current study, an artA homolog was characterized in the agriculturally and medically 34

important fungus Aspergillus flavus; specifically, its possible role governing sporulation, 35

formation of resistant structures, and secondary metabolism. The highly conserved 14-3-3 artA is 36

necessary for normal fungal morphogenesis in an environment-dependent manner, affecting the 37

balance between production of conidiophores and the formation of resistant structures that are 38

necessary for the dissemination and survival of this opportunistic pathogen. This study reports a 39

14-3-3 protein affecting secondary metabolism in filamentous fungi. Importantly, artA regulates 40

the biosynthesis of the potent carcinogenic compound AFB1 as well as the production of other 41

secondary metabolites. 42

43

44

45

46

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

3

Introduction 47

48

The genus Aspergillus includes both beneficial and harmful species. Aspergillus flavus is among 49

the later, producing mycotoxins, including potent carcinogenic polyketides called aflatoxins 50

(AF), when colonizing crops of agricultural importance worldwide. Oil seeds crops are 51

particularly susceptible hosts including maize, spices, peanuts, tree nuts (such as almonds, 52

pistachios, hazelnuts, pecans, and Brazil nuts), cottonseed and sorghum (51, 5, 4, 49, 19). These 53

compounds are responsible for numerous health problems, including acute aflatoxicosis, 54

immunosuppression, and liver cancer in humans and other animal species (48). Acute 55

aflatoxicosis is linked to the consumption of large amounts of AF due to ingestion of 56

contaminated crops, resulting in extreme gastrointestinal symptoms and often death (49). Recent 57

studies have linked AF ingestion with growth impairment in children (25, 48). Exposure to AF 58

coupled with hepatitis B virus further increases risk of liver cancer (18). AF and other 59

mycotoxins are estimated to contaminate one quarter of the world’s crops (35). Economically, 60

AF contamination leads to substantial monetary losses yearly, due in large part to rejection or 61

reduced value of contaminated crops as well as costs associated with monitoring and detection in 62

developed countries. In developing countries the health risks are a major concern due to the lack 63

of strict regulation and monitoring of levels of AFs in commodities prior to consumption by the 64

indigenous population. 65

66

Aspergillus flavus efficiently disseminates causing extensive infestations by producing asexual 67

spores called conidia on specialized structures termed conidiophores (19). Once the fungus is 68

established, formation of highly resistant structures termed sclerotia contribute to its survival 69

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

4

under harsh environmental conditions (11, 32, 46). Current approaches are insufficient to control 70

preharvest colonization of crops by A. flavus and AF contamination of food commodities. New 71

approaches, such as those based on genetic strategies, could results in the development of new 72

methodologies to reduce dissemination and survival of this organism, as well as AF biosynthesis. 73

With this purpose, it is important to gain insight into the genetic regulatory pathways that control 74

A. flavus morphogenesis and toxin biosynthesis. The current study focuses on an A. flavus gene 75

encoding a putative 14-3-3 protein. These proteins are a group of highly conserved, acidic, small 76

proteins (42, 51) that are found in many different eukaryotic species, often presenting multiple 77

isoforms per species with a wide range of cellular roles. First discovered in humans, it was later 78

characterized across other eukaryotic species. Isoforms of 14-3-3 homologs have been identified 79

in animals such as Xenopus and Drosophila, as well as in plants and in yeast (42, 43, 30). In 80

mammals, there are seven isoforms with roles in signal transduction pathways affecting 81

apoptosis, adhesion, cellular proliferation, differentiation and survival. These proteins form 82

homodimers and heterodimers with different 14-3-3 isomers. The end result is a U-shaped 83

structure containing two protein binding sites (13, 51, 43, 30). There are two copies in 84

Saccharomyces cerevisiae (BMH1 and BMH2) and Schizosaccharomyces pombe (rad 24 and 85

rad25) (15, 42, 43). Characterization of these four genes and their encoded proteins provided 86

further evidence that the 14-3-3 proteins play a role in a vast variety of cellular processes (42). 87

Due to the large potential for protein interactions with 14-3-3 proteins, and their conservation in 88

eukaryotic organisms, it is possible that 14-3-3 homologs could also influence important 89

functions in filamentous fungi. A 14-3-3 gene, artA, was partially characterized in the model 90

fungus A. nidulans (27), where it was shown that over-expression of artA resulted in a conidial 91

polarization defect, presenting abnormal formation of germ tubes. 92

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

5

93

It is likely that, as in the case of other eukaryotes, 14-3-3 proteins bind to numerous proteins in 94

Aspergillus spp., affecting diverse signaling pathways, including those involved in development 95

and secondary metabolism, such as those leading to mycotoxin production. In the current study, 96

an artA homolog was characterized in the agriculturally and medically important fungus A. 97

flavus; specifically, its possible role in the regulation of conidiation, sclerotial formation and the 98

production of AF and other secondary metabolites. 99

100

Materials and Methods 101

Sequence alignment and phylogenetic analysis 102

Gene sequence and the deduced amino acid sequence of A. flavus artA (AFL2G_08271) (Table 103

S1) were obtained from the Aspergillus Genome Database (aspGD) 104

( http://aspgd.broadinstitute.org/cgi-105

bin/asp2_v3/shared/show_protein.cgi?site=asp2_v9&protein_name=afl.polypeptide.1670205416106

.1. ). Sequencing verification using primers A.fl_artA-SEQ5'F & A.fl_artA-SEQ3'R (Table S2), 107

indicated errors, specifically two guanine deletions, in the published sequence at positions +941 108

and +949 bp from the start codon. The corrected sequence was used in this study. 109

Blastp search tool was used to identify homologs in other fungal species. The accession numbers 110

corresponding to all sequences used in this study are listed in Table S1. MUSCLE sequence 111

alignment (http://www.ebi.ac.uk/Tools/msa/muscle/) was used with all sequences. This was 112

followed by shading using the Color Align Conservation from Sequence Manipulation Suite 113

(http://www.bioinformatics.org/sms2/color_align_cons.html). 114

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

6

The software MEGA v6.0 was used for sequence alignment and analysis (37). After input of data 115

into MEGA, MUSCLE settings were used to generate a multiple sequence alignment. For 116

generation of phylogenetic trees, a Maximum-likelihood model was used with a bootstrap value 117

of 1000 (http://megasoftware.net/). 118

119

Strains and culture conditions 120

121

In order to characterize the artA gene, CA14 (pyrG-, niaD-, Δku70) (SRRC collection # 1709), 122

CA14 WT (pyrG+, niaD+, Δku70) control strain, artA deletion mutant TBAI3 (ΔartA::pyrG, 123

niaD+, Δku70), and a complementation strain (ΔartA::pyrG, artA::niaD, Δku70), TBAI6, were 124

used. All strains were grown on YGT medium [5 g of yeast extract, 20 g of glucose, and 1 mL of 125

trace elements (20)] at 30 °C in the dark, unless otherwise specified. Agar (10 g/L) was added in 126

the case of solid medium. Strains were maintained as 30% glycerol stocks at -80°C. 127

128

Generation of the ΔartA strain 129

130

The artA deletion cassette was constructed using fusion PCR as previously described (36). The 131

5ʹ and 3ʹ UTR fragments were first PCR amplified from A. flavus genomic DNA using primers 132

1346 and 1347 obtaining a 1.399 kb product, and primers 1348 and 1349, obtaining a 1.587 kb 133

product, respectively. A third fragment containing the auxotrophic marker A. fumigatus pyrG 134

was PCR-amplified from plasmid p1439 using primers 1358 and 1359. Primers 1362 and 1363 135

were used to fuse these three fragments resulting in the generation of the deletion cassette, that 136

was then transformed into A. flavus CA14 (pyrG -, niaD -, Δku70). 137

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

7

138

All the primers used in this study are listed in Table S2. Fungal transformation was performed as 139

previous described (7). Transformants were selected on Czapek Dox (CZ, Difco, Franklin Lakes, 140

New Jersey, USA) plus sucrose as osmotic stabilizer without supplementation of uridine and 141

uracil. Transformants were confirmed by Southern blot analysis. A selected artA deletion strain, 142

TBAI2, was then transformed with the wild-type niaD allele from A. flavus, previously PCR-143

amplified from genomic DNA with primers 1576 and 1577, to obtain a prototroph, TBAI3. 144

145

Generation of the complementation strain 146

147

A complementation strain was obtained by transforming the A. flavus ΔartA mutant with the artA 148

wild-type allele. The complementation vector was generated as follows: A DNA fragment 149

containing the artA wild-type allele was PCR amplified from A. flavus wild-type genomic DNA 150

using primers 1507 and 1513. The resulting PCR product was digested with PstI and 151

subsequently ligated to pSD52.2, containing A. fumigatus niaD, which was previously digested 152

with the same enzyme, resulting in plasmid pBAI2. This plasmid was transformed into TBAI2. 153

Presence of the complementation plasmid in the transformants was verified by diagnostic PCR. 154

The resulting complementation strain was denominated TBAI6. 155

156

157

Morphological studies 158

159

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

8

The possible role of artA in the regulation of fungal growth, conidiation, and sclerotial 160

development was investigated. A. flavus wild type, ∆artA, and complementation strains were 161

point-inoculated on YGT solid medium, and incubated at 30 °C for 5 days. Fungal growth was 162

measured as colony diameter. The experiment was carried out with three replicates. To quantify 163

production of conidia, spores (106 conidia/mL) from each strain were top-agar inoculated on 164

YGT. After 48 h and 72 h of incubation, 7 mm cores were harvested and homogenized in water. 165

Conidia were quantified using a hemocytometer (Hausser Scientific, Horsham, PA, USA) under 166

a bright-field Nikon Eclipse E400 microscope (Nikon Inc., Melville, NY, USA). In addition, 16 167

mm cores were harvested and washed with 70 % EtOH to visualize and quantify sclerotial 168

production. Micrographs were taken with a Leica MZ7.5 microscope coupled with a Leica 169

MC170 camera (Leica Microsystems Inc., Buffalo Grove, IL, USA). The experiment was 170

performed with three replicates. An additional experiment was carried out with YGT point-171

inoculated cultures incubated for 7 days. Plates were photographed before and after a 70% EtOH. 172

The experiment included three replicates. 173

174

Aflatoxin analysis 175

176

To analyze the effect of artA on the production of AF, specifically AFB1, spores (5 x 106 177

conidia) from wild type, ΔartA, and complementation strains were top-agar inoculated on YGT 178

and incubated for 72 h. Three 16 mm cores were collected, and toxin was extracted with 5 mL 179

chloroform. AF extracts were then allowed to dry overnight and resuspended in 250 μL 180

chloroform. Thin-layer chromatography (TLC) was used to separate the extracts using a 181

chloroform:acetone (85:15, v/v) solvent system. A standard of AFB1 (Sigma-Aldrich, St. Louis, 182

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

9

MO, USA) was used as reference. The TLC plate (Macherey-Nagel, Bethlehem, PA, USA) was 183

air dried, sprayed with a 12.5% AlCl3 solution in 95% ethanol and baked at 80 °C for 10 184

minutes. The samples were visualized using UV detection at 375nm. Densitometry of AF bands 185

in the TLC plates were carried out using Gelquant.NET software. This experiment included three 186

replicates. 187

188

Gene expression analysis 189

190

Wild type, ∆artA, and complementation strains were top-agar inoculated (5 x 106 conidia) on 191

YGT medium and incubated for 48 h and 72 h. Mycelium from each strain was collected and 192

lyophilized overnight. Total RNA was extracted using TRIsure (Bioline, Taunton, MA, USA) 193

and RNeasy mini kit (Qiagen, Valencia, CA, USA) as described by the manufacturers. Five 194

micrograms of total RNA was treated using RQ1 DNAse (Promega, Madison, WI, USA) to 195

remove possible DNA contamination. Approximately, 1 μg of DNAsed RNA was used for 196

cDNA synthesis using Moloney murine leukemia virus (MMLV) reverse transcriptase 197

(Promega). qRT-PCR was performed utilizing an Mx3000p thermocycler (Agilent 198

Technologies, Santa Clara, CA, USA) with SYBR green Jumpstart Taq Ready Mix (Sigma) to 199

evaluate the expression of artA as well as the expression of regulatory genes involved in 200

development (brlA, wetA, and nsdC ) and secondary metabolite production (aflR, aflJ, ver1, the 201

PKS/NRPS gene AFLA_139490, and ustD, (AFLA_095040). cDNA was normalized 202

to A. flavus 18S ribosomal gene expression, and the relative expression levels were calculated 203

using the 2-ΔΔCT method (31). Primers used for gene expression analysis are listed in Table S2. 204

205

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

10

Pathogenicity assay 206

207

The NC94022 Virginia Peanut line used in this study was kindly provided by Dr. Baozhu Guo 208

(USDA, Tifton, Georgia). The methods utilized in this study are similar to those described in 209

Zhuang et al. (55), with minor modifications. Briefly, the shelled viable peanut cotyledons (0.3 g 210

-0.4 g), with the embryos removed, were surface sterilized utilizing a 10 % beach solution; 211

cotyledons were submerged for approximately 1 minute. The peanut cotyledons were then 212

washed twice in sterile water and dried. Approximately, 10 cotyledons were infected on the 213

adaxial surface of the cotyledon per fungal strain (approximately 105 conidia/ cotyledon) and 214

incubated at 30 °C for 7 days in the dark. 215

216

Conidial quantification in infected seeds 217

Two infected peanut cotyledons were collected in individual 1.7 mL Eppendorf tubes. One 218

milliliter of water was added into each tube and vortexed for 1 minute. Conidia were quantified 219

using a hemacytometer (Hausser Scientific) under a bright-field Nikon Eclipse E400 microscope 220

(Nikon Inc.). This experiment was carried out in duplicate. 221

222

AFB1 analysis of infected seeds 223

Infected cotyledons (four per strain) were ground in liquid nitrogen and added to a 50 mL Falcon 224

tube containing 12 mL of water. Samples were extracted with 6 mL of acetone at room 225

temperature for 3 h on a rotary platform. Extracts were then filtered through a piece of Whatman 226

paper and collected into a separate 50 mL Falcon tube. Seventeen milliliters of methylene 227

chloride was added to the tubes and vortexed for 1 minute. The samples were then centrifuged 228

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

11

for 5 minutes at 4,000 rpm before 15 mL of the bottom organic phase was collected and filtered 229

through sodium sulfate to remove any excess water. Extracts were collected into a 50 mL glass 230

beaker and allowed to evaporate. Samples were then resuspended in 2 mL of methylene chloride 231

and transferred to another 50 mL baker where they were allowed to evaporate again. Finally the 232

extracts were solubilized in 150 uL acetone. Ten microliters of each sample were analyzed by 233

TLC as described above. 234

235

Statistical analysis 236

237

Statistical Analysis was carried out for all quantitative data in this study. ANOVA (Analysis of 238

Variance) in conjunction with Tukey’s post hoc test was carried out using the statistical software 239

program R version x64 3.3.0. 240

241

242

Results 243

244

artA is highly conserved in fungi and other eukaryotic species 245

246

Aspergillus flavus ArtA (corresponding to artA AFL2G_08271.2) presents 92.0% identity and 95.1% 247

similarity with its homolog in the model fungus A. nidulans (AAK25817.1). The deduced amino acid 248

sequence of the putative A. flavus artA gene was also compared to other putative homologs from 249

other Aspergillus spp. (Figure S1). This analysis indicated that ArtA is highly conserved among 250

species of this genus. The comparison between A. flavus artA and other Ascomycetes as well as 251

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

12

Basidiomycetes showed a similar pattern, with homologs found in numerous species (Figure 1). 252

Multiple sequence alignment of these homologs with that of A. flavus demonstrated strong sequence 253

homology, even between distant fungal species (Figure S2 and S3). 254

255

artA regulates growth and development in A. flavus 256

257

In order to characterize the role of artA in growth and development in A. flavus, a deletion artA 258

(ΔartA), and a complementation (Com) strain were constructed. The deletion strain was 259

confirmed by Southern blot analysis (Figure S4A). Complementation of ΔartA with the artA 260

wild-type allele was verified by diagnostic PCR (Figure S4B). Expression levels of artA in wild-261

type, ΔartA, and complementation artA strains were analyzed using qRT-PCR (Figure S4C). 262

artA transcripts were not detected in the deletion strain, whereas artA was expressed in the wild-263

type and complementation strains. Colony growth was slightly decreased in the ΔartA strain in 264

comparison to the wild type (Figure 2). Complementation of ΔartA with the artA wild-type 265

allele rescued wild-type phenotype. 266

267

In addition, absence of artA affected conidiation. However this effect varied depending on 268

culture conditions. In top-agar inoculated cultures, the ΔartA strain presented a decrease in 269

conidial production with respect to the control strains (Figure 3). This reduction was also 270

accompanied by a decrease in the expression of transcription factor genes brlA and wetA, 271

components of the central regulatory pathway essential for conidiophore formation (1,2,3, 272

reviewed by 28). Interestingly, in point-inoculated cultures, conidiation increased in the artA 273

deletion mutant with respect to the control strain growing under the same conditions (Figure 274

S5). 275

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

13

276

In addition to production of conidia, A. flavus forms resistant structures termed sclerotia. Our 277

results revealed that in the absence of artA the production of these structures was precocious and 278

increased with respect to the wild type (Figure 4). Furthermore, gene expression analysis of the 279

nsdC gene, encoding a transcription factor necessary for normal sclerotial production in A. flavus 280

(8), showed an increase in expression of this gene coincided with the observed increased of 281

sclerotia in ΔartA. In contrast, in point-inoculated cultures, sclerotial production was delayed, 282

mainly restricted to the center of the colony (Figure S5). 283

284

artA negatively affects AFB1 production 285

286

To determine if artA plays a role in the production of AFB1, content of this toxin was analyzed 287

in ΔartA cultures as well as in cultures of the wild type and complementation strain (Figure 5A 288

and 5B). Deletion of artA resulted in an increase in AF levels when compared to those in the 289

controls. In addition, expression of AF cluster regulatory genes aflR and aflJ (47,9) was 290

analyzed. (Figure 5C and 5D). Our results indicated that both regulators was greater in the 291

absence of artA compared to the controls. Furthermore, expression of ver1, often used as an 292

indicator of AF gene cluster activation also increased in the artA deletion mutant (Figure 5E). 293

294

artA influences the expression of other secondary metabolite genes in A. flavus 295

296

Aspergillus flavus contains 56 secondary metabolite gene clusters and is known to produce a 297

wide variety of other metabolites in addition to AFs (10,24, 38, 39, 54). In the current study our 298

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

14

results showed that artA also affects the expression of genes involved in the synthesis of other 299

secondary metabolites, for example, PKS/NRPS (AFLA_139490), an essential gene in the 300

synthesis of the indole-tetramic acid mycotoxin cyclopiazonic acid (CPA) (10) and ustD, 301

involved in the production of ustiloxin, an inhibitor of microtubule assembly (40). Specifically, 302

artA positively regulates the expression of these genes in A. flavus (Figure 6). 303

304

Effect of artA on peanut seed infection 305

306

Due to the fact that the aflatoxin-producer A. flavus is an opportunistic plant pathogen of 307

economically relevant oil seed crops, the possible effect of artA on peanut seed infection was 308

examined. Our analysis revealed that in the absence of artA conidial production was increased 309

with respect to the controls when the fungus was grown on peanut seed substrate (Figure 7). In 310

addition, analysis of AF content in the infected tissue indicated that artA also negatively 311

regulates AFB1 production under these conditions (Figure 7). 312

313

Discussion 314

In this work we investigated the role of artA, encoding a putative 14-3-3 protein, in 315

morphological development and secondary metabolism of the agriculturally and medically 316

important fungus A. flavus. Our in-silico analysis indicated that the predicted ArtA protein 317

sequence is highly conserved within its corresponding homologs in Ascomycetes and 318

Basidiomycetes, as well as in other eukaryotes, where they have been found to be involved in the 319

regulation of numerous cellular processes. Approximately 200 different proteins from a wide 320

range of eukaryotic organisms have been reported as binding partners for the 14-3-3 proteins (i.e. 321

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

15

13,44 ,41,29). Although there are numerous studies in yeast, where these proteins are essential in 322

most genetic backgrounds (i.e. reviewed by 42), 14-3-3 proteins are mostly unknown in 323

filamentous fungi, with few exceptions; in Trichoderma reesei the 14-3-3 proteins were shown to 324

affect the secretory system (45), also, overexpression of the artA homolog in A. nidulans resulted 325

in changes of polarization of conidia, with defects in the formation of germ tubes (27). In A. 326

flavus the majority of the ArtA protein sequence is conserved throughout numerous species, with 327

the exception of the C-terminal region, in agreement with previous observations (15, 42). It is 328

possible that the divergent C-termini of 14-3-3 proteins could have an effect on the diversity of 329

roles of these proteins in the cell. 330

331

Interestingly, our results revealed that artA plays a role in the morphological differentiation and 332

secondary metabolism of this fungus. Specifically, artA is a positive regulator of A. flavus 333

growth as a slight reduction in the diameter of the ΔartA colonies was observed compared to 334

those of wild-type. In addition to the effect of artA on vegetative growth, artA influences 335

asexual development. When the fungus was grown on top-agar inoculated cultures, deletion of 336

artA resulted in a decrease in conidiation, accompanied by a reduction in brlA and wetA 337

expression, essential genes in the central regulatory pathway that controls asexual development 338

(1,3). However, when A. flavus was grown as point-inoculated cultures on the same medium the 339

output changed and conidiation was enhanced in the ΔartA strain with respect to the controls. 340

Similarly, conidiation also increased in the absence of artA when growing on a different 341

substrate such as peanut seeds. This suggests that the role of artA on asexual development 342

depends on environmental clues, such as cell density or crowdedness (22), as well as the type of 343

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

16

substrate where this organism is growing on, acting as a modulator of A. flavus development 344

contributing to the optimization of spore dissemination depending on external stimuli. 345

346

Aspergillus flavus also produces sclerotia, structures that allow this fungus to survive extreme 347

environmental conditions (11, 32, 46, 12, 8). These hard-pigmented structures consist of 348

compact mycelia (4, 48) that are vestigial forms of the sexual fruiting bodies (14, 34). Additional 349

research by Horn et al. (21) on the sexual stage in A. flavus demonstrated the presence of 350

ascospores in A. flavus sclerotia (termed stromata) under laboratory conditions. The current 351

study revealed that artA also regulates sclerotial production in this fungus. In this case, absence 352

of artA resulted in the opposite effect than that observed for conidiation, influencing the 353

developmental balance between these two morphological stages. On top-agar inoculated plates 354

absence of artA greatly promoted sclerotial production, while in point-inoculated cultures ΔartA 355

sclerotia were only formed at the center or near the center of the colony, where cell density and 356

rapid depletion of nutrients occurs, while formation of conidiophores abundantly occurred in 357

these colonies. The differential effects of artA on sclerotial formation under different culture 358

conditions suggests, as in the case of conidiation, that artA is a mediator between the 359

environment cues and the developmental changes observed in this mycotoxigenic fungus. 360

361

In addition to its effect of fungal development, artA also affects secondary metabolism in A. 362

flavus. AFB1 levels were significantly increased in the deletion mutant in both laboratory 363

medium and on seeds, indicating that artA negatively regulates the production of this toxin. 364

Genes involved in secondary metabolism are normally found in clusters (23, 52, 53, 16, 17). This 365

is also the case for the AF gene cluster. Two well-known endogenous regulatory genes are found 366

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

17

within the AF cluster, aflR and aflJ. The expression of both aflR and aflJ (also called aflS) was 367

increased in the absence of artA. Furthermore, expression of ver1 (also called aflM), which is a 368

structural gene in the AF pathway that is commonly used as an indicator of AF cluster activation, 369

was also enhanced, coinciding with the observed increase in AF biosynthesis. These results 370

indicate that artA is a key negative regulator of AF gene expression and concomitant AF 371

production. Importantly, our chemical analysis indicated that artA also affects the synthesis of 372

other metabolites. Differently from the case of the AF genes, expression of a PKS/NRPS 373

(AFLA_139490) and ustD (AFLA_095040) genes, corresponding to the CPA and ustiloxin gene 374

clusters, respectively, were negatively regulated by artA. These results indicate a broad 375

regulatory role of this gene on A. flavus secondary metabolism differentially affecting diverse 376

gene clusters. 377

378

ArtA homologs have been previously described as scaffolds/adaptors interacting with numerous 379

proteins, and influencing multiple cell functions (13, 50, 42, 51, 43, 26, 6, 33). ArtA could 380

interact and modulate the function of proteins present in the cell, and also affect the 381

transcriptional machinery affecting the expression of numerous genes, including those observed 382

in this study, such as the developmental genes brlA, wetA, nsdC, as well as the described artA-383

dependent secondary metabolite genes. 384

385

In conclusion, A. flavus artA encodes a highly conserved 14-3-3 homolog that is required for 386

normal fungal morphogenesis in an environment-dependent manner, affecting the balance 387

between production of conidiophores and the formation of resistant structures that are necessary 388

for the dissemination and survival of this opportunistic pathogen. In addition, to our knowledge 389

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

18

this is the first report of a 14-3-3 protein affecting secondary metabolism in filamentous fungi; 390

importantly, artA negatively regulates the biosynthesis of the potent carcinogenic compound 391

AFB1 as well as the production of other secondary metabolites in this agriculturally and 392

medically relevant fungus. 393

394

Aknowledgements 395

396

This work was supported by USDA grant 58-6435-4-015 and the Department of Biological 397

Sciences at Northern Illinois University. We thank Dr. Bahzhu Guo (USDA, Tifton, Georgia) 398

for kindly providing the NC94022 Virginia peanut line used in this study. 399

400

401

402

403

404

405

406

407

408

409

410

411

412

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

19

Table S1. Amino acid sequences of ArtA used for sequence alignment and phylogenetic analysis 413

SPECIES ACCESSION NUMBER

Aspergillus flavus AFL2G_08271

Aspergillus oryzae XP_001823993.1

Aspergillus niger XP_001218186.1

Aspergillus kawachii GAA85416.1

Aspergillus clavatus XP_001272853.1

Aspergillus ruber EYE98024.1

Aspergillus fischeri XP_001265893.1

Aspergillus fumigatus XP_749464.1

Aspergillus nidulans AAK25817.1

Penicillium digitatum XP_014531373.1

Penicillium rubens XP_002562230.1

Penicillium subrubescens OKO90863.1

Talaromyces marneffei XP_002150416.1

Trichoderma virens XP_013949592.1

Trichoderma reesei CAC20377.1

Fusarium verticillioides XP_018750037.1

Fusarium fujikuroi KLO89980.1

Fusarium graminearum XP_011326500.1

Nuerospora crassa XP_964462.1

Candida albicans XP_721512.1

Schizosaccharomyces pombe NP_594167.1

Saccharomyces cerevisiae ONH73069.1

Trichosporon asahii XP_014184402.1

Puccinia graminis KDQ15383.1

Botryobasidium botryosum KDQ15383.1

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

20

Coprinopsis cinerea XP_001837506.1

Ustilago maydis XP_011387257.1

Agaricus bisporus XP_006456745.1

Neolentinus lepideus KZT24546.1

Table S2. Primers used in this study 414

NAME SEQUENCE (5' → 3')

1346 - AflartA08271_5'F CGCGGGTGAGTCAGCGGGTC

1347 - AflartA08271_5'R GAGGGCCAAAAGCAACGGAAAAAGCAAGTATGAAATGG

1348 - AflartA08271_3`F GAACGCCTCCACCGAGAAGAAGGAGGA

1349 - AflartA08271_3`R

GGCGAGGCGGGGAGAGTAAGCATTTTCAC

1352 - AflartA08271_Asc1 AAAAAGGCGCGCCATGGGTCACGAAGATGCTGTTTATCTGGCCAA

GC

1353 - AflartA08271_Not1 AAAAAAAAAAAGCGGCCGCTCAGCAGCGGCTCGGCTCAG

1358 - 08271artApyrGF CCATTTCATACTTGCTTTTTCCGTTGCTTTTGGCCCTCACCGGTCGC

CTCAAACAATGCTCT

1359 - 08271artApyrGR TCCTCCTTCTTCTCGGTGGAGGCGTTCGTCTGAGAGGAGGCACTG

ATGCG

1362 - Afl_artA_NF GGGACTCTGGTGCTTGGATACGGGC

1363 - Afl_artA_NR CTAGCCCCATCTCAGCCACACCC

1507 - Afl_artA_Comp. F AAAAAAACTGCAGCGCGGGTGAGTCAGCGGGTC

1513 - Afl_artA_Comp. R AAAAAAACTGCAGGGAGCGACGATGCGCGTGGAG

1576 - 13837-flavus-niaD F CGTGGCGAGATGTTTGACTATCGAATCAC

1577 - 13837-flavus-niaD R AGGGAGCCGTGACACTTGGCCTC

Afla_18S F

TGATGACCCGCTCGGCACCTTACGAGAAATCAAAGT

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

21

Afla_18S R

GGCCATGCACCACCATCCAAAAGATCAAGAAAGAGC

qPCR-Afla_artA_F

GGCGAGTCTAAGGTCTTCTACCACAAGAT

qPCR-Afla_artA_R

GGTTGTCTCTGAGAAGCTGCATCATCAG

qPCR-Afla_brlA_F

TATCCAGACATTCAAGACGCACAG

qPCR-Afla_brlA_R

GATAATAGAGGGCAAGTTCTCCAAAG

qPCR_Afla_wetA_F

GGGCTGTTCACGCCTGATCT

qPCR_Afla_wetA_R

GACCCCCTTGCAGGATGTCA

qPCR_Afla_nsdC_F

GGAAGTTACGCTCCTGAAGATG

qPCR_Afla_nsdC_R

CGTTCGTCCTCTTCATCCATAC

qPCR-Afla_ver1 F

CCGACAACCACCGTTTAGATGGC

qPCR-Afla_ver1 R

ACGTCTTTCAGGTGACCGAACGATA

qPCR-Afla_aflR_F

GCAACCTGATGACGACTGATATGG

qPCR-Afla_aflR_R

TGCCAGCACCTTGAGAACGATAAG

qPCR-Afla_aflJ_F

TGGAATATGGCTGTAGGAAGTG

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

22

qPCR-Afla_aflJ_R

CATCCGAGTGAGCGTATCC

qPCR-Afla PKS/NRPS CPA F

TCGGGAGACTGCGGTCAACTC

qPCR-Afla PKS/NRPS CPA R

CCCACATAGAGTTTGTCGTCCGG

qCPR-Afla Ustiloxin ustD

NRPS F

TGCACAGGCAGAAACACCTCTTG

qPCR-Afla Ustiloxin ustD

NRPS R

A.fl_artA-SEQ5'F

A.fl_artA-SEQ3'R

CCGGGGGGAAAGGGAAGGAA

GGACACCTTATTAACATTTGTCGCAGAGC

GTTTGAGGGGGCACGAGTCTG

415

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

23

23

Figure 1: Ascomycota Phylogenetic tree. Phylogenetic tree of ArtA fungal homologs 416

constructed using MEGA v6.0. Trees were generated with Maximum-Likelihood model with a 417

bootstrap value of 1000. 418

419

Figure 2. Effects of artA on vegetative colony growth. Quantification of colony growth as 420

colony diameter (mm). A. flavus strains were point-inoculated on YGT medium and incubated at 421

30° C in the dark. Measurements were taken 5 days after inoculation. Values shown are the 422

means of three samples. Error bars represent standard error. Different letters on the columns 423

indicate statistically different values (p<0.05). 424

425

Figure 3. Effects of artA on asexual development (A) Quantification of conidia after 72 h of 426

incubation of top-agar inoculated cultures. Seven millimeter cores were taken from each culture. 427

Conidia were counted using a hemocytometer. (B & C) qRT-PCR expression analyses of brlA 428

and wetA. Error bars represent standard error. Different letters on the columns indicate 429

statistically different values (p<0.05). 430

431

Figure 4. artA regulates sclerotial production in A. flavus. (A) Strains grown on YGT top-432

agar for 48 h and 72 h. In the second and third rows, plates were sprayed with ethanol before 433

photographs and micrographs were taken. (B) Quantification of sclerotial production. Sixteen 434

millimeter cores were collected. Number of sclerotia in each core were counted under a Leica 435

MZ75 dissecting microscope. (C) qRT-PCR expression analysis of nsdC. Error bars represent 436

standard error. Different letters on the columns indicate statistically different values (p<0.05). 437

438

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

24

24

Figure 5. artA is a negative regulator of AFB1 biosynthesis and other unknown secondary 439

metabolites. (A) TLC analysis of aflatoxin B1 production in wild type, artA, and 440

complementation cultures after 48 h and 72 h of incubation. (B) Densitometry of TLC present in 441

Panel A. (C, D, and E) qRT-PCR expression analyses of aflR, aflJ, and ver1, respectively, after 442

48 h of incubation. Error bars represent standard error. Different letters on the columns indicate 443

statistically different values (p<0.05). 444

445

Figure 6. Effects of artA on the expression of key genes in the ustiloxin and CPA secondary 446

metabolite gene clusters. The A. flavus strains were top-agar inoculated on YGT medium and 447

incubated at 30 °C. Mycelium was collected after 72 h of incubation. (A and B) qRT-PCR results 448

showing the relative expression of the AFLA_139490 gene in the CPA gene cluster, and ustD 449

gene in the ustiloxin gene cluster. Error bars represent standard error. Different letters on the 450

columns indicate statistically different values (p<0.05). 451

452

Figure 7. Effects of artA on A. flavus peanut seed infection. The NC94022 viable peanut line 453

was infected with the A. flavus stains and incubated at 30 °C in the dark for 7 days. (A) 454

Photographs of the infected peanuts after incubation. (B) Quantification of conidia produced on 455

infected peanut cotyledons. (C) TLC analysis of AFB1 present in infected peanuts. (D) 456

Densitometry of TLC present in Panel C. The experiment was carried out in triplicate. Error bars 457

represent standard error. Different letters on the columns indicate statistically different values 458

(p<0.05). 459

460

461

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

25

25

References 462

463

1. Adams TH, Boylan MT, Timberlake WE. 1988. brlA is necessary and sufficient to direct 464

conidiophore development in Aspergillus nidulans. Cell. 54(3): 353-62. DOI: 465

http://dx.doi.org/10.1016/0092-8674(88)90198-5 466

467

2. Adams T H, andTimberlake WE. 1990 Developmental repression of growth and gene 468

expression in Aspergillus. Proc. Natl. Acad. Sci.USA. 87: 5405-09. PMCID: PMC54333 469

470

3. AdamsTHWieser JK, Yu J. 1998 Asexual Sporulation in Aspergillus nidulans. Microbiol. 471

Mol. Biol. Rev. 62(1): 35-54. PMCID: PMC98905 472

473

4. Amaike S, Keller NP. 2011 Aspergillus flavus. Ann. Rev. Phytopathol. 49: 107–33. 474

DOI:10.1146/annurev-phyto-072910-095221 475

476

5. Bennett JW. 2010. “An overview of the genus Aspergillus.” Aspergillus. Caister Academic 477

478

6. Bustos DM. 2012 The role of protein disorder in the 14-3-3 interaction network. Mol. 479

Biosyst. 8: 178-84. DOI: 10.1039/C1MB05216K 480

481

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

26

26

7. Cary JW, Ehrlich KC, Bland JM, Montalbano BG. 2006. The aflatoxin biosynthesis cluster 482

gene, aflX, encodes an oxidoreductase involved in the conversion of Versicolorin A to 483

Demethylsterigmatocystin. Appl Environ Microbiol. 72: 1096–1101. pmid:16461654 484

485

8. Cary JW, Harris-Coward PY, Ehrlich KC, Mack BM, Kale SP et al.. 2012. NsdC and 486

NsdD affect Aspergillus flavus morphogenesis and aflatoxin production. Eukaryotic Cell 487

11(9): 1104–11. DOI:10.1128/EC.00069-12 488

489

9. Chang PK. 2003. The Aspergillus parasiticus protein AFLJ interacts with the aflatoxin 490

pathway-specific regulator AFLR. Mol Gen Genomics 268:711–719. doi:10.1007/s00438-491

003-0809-3 492

493

10. Chang PK, Horn BW, Dorner JW. 2009. Clustered genes involved in cyclopiazonic acid 494

production are next to the aflatoxin biosynthesis gene cluster in Aspergillus flavus. Fungal 495

Genet Biol. 46(2): 176-182. http://dx.doi.org/10.1016/j.fgb.2008.11.002 496

497

11. Coley-Smith JR, Cooke RC. 1971. Survival and germination of fungal sclerotia. Annual 498

Review of Phytopathology. 9: 65-92. DOI:10.1146/annurev.py.09.090171.000433 499

500

12. DuranRM, Cary JW, Calvo AM. 2007. Production of cyclopiazonic acid, aflatrem, and 501

aflatoxin by Aspergillus flavus is regulated by veA, a gene necessary for sclerotial 502

formation. Appl. Microbiol. Biotechnol. 73: 1158-68. DOI:10.1007/s00253-006-0581-5 503

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

27

27

504

13. Fu H, RR Subramanian RR, Masters SC. 2000. 14-3-3 proteins: Structure, function and 505

regulation. Annu. Rev. Pharmacol. Toxicol. 40: 617-47. 506

DOI:10.1146/annurev.pharmtox.40.1.617 507

508

14. Geiser DM, Pitt JI, Taylor JW. 1998. Cryptic speciation and recombination in the aflatoxin-509

producing fungus Aspergillus flavus. Proc. Natl. Acad. Sci. USA. 95: 388-93. PMCID: 510

PMC18233 511

512

15. Gelperin D, Weigle J, Nelson K,Roseboom P, Irie K et al., 1995. 14-3-3 proteins: Potential 513

roles in vesicular transport and Ras signaling in Saccharomyces cerevisiae. Proc. Natl. 514

Acad. Sci. USA. 92: 11539-43. PMCID: PMC40437 515

516

16. Georgianna DR, Fedorova ND, Burroughs JL, Dolezal AL, Bok JWet al., 2010. Beyond 517

aflatoxin: four distinct expression patterns and functional roles associated with Aspergillus 518

flavus secondary metabolism gene clusters. Mol. Plant Pathol. 11(2): 213-226. DOI: 519

10.1111/j.1364-3703.2009.00594.x 520

521

17. Gibbons JG, Rokas A. 2013. The function and evolution of the Aspergillus genome. 522

Trends Microbiol. 21(1): 14-22. DOI: 10.1016/j.tim.2012.09.005 523

524

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

28

28

18. Groopman JD, Kensler TW, Wild CP. 2008. Protective interventions to prevent aflatoxin-525

induced carcinogenesis in developing countries. Annu Rev Public Health. 29: 187-203. 526

DOI:10.1146/annurev.publhealth.29.020907.090859 527

528

19. Hedayati M.T, Pasqualotto AC, Warn PA, Bowyer P, Denning DW. 2007. Aspergillus 529

flavus: human pathogen, allergen and mycotoxin producer. Microbiology. 153: 1677-92. 530

DOI: 10.1099/mic.0.2007/007641-0 531

532

20. Hill T, Kafer E (2001) Improved protocols for Aspergillus minimal medium: trace elements 533

and minimal medium stock solution. Fungal Genet Newslett 48: 20–21. 534

535

21. Horn BW, Sorensen RB, Lamb MC, Sobolev VS, Olarte RA, et al., 2014. Sexual 536

reproduction in Aspergillus flavus sclerotia naturally produced in corn. Phytopathology 537

104: 75-85. DOI:10.1094/PHYTO-05-13-0129-R 538

22. Horowitz Brown S, Zarnowski R, Sharpee WC, Keller NP. 2008. Morphological 539

transitions governed by density dependence and lipoxygenase activity in Aspergillus flavus. 540

Appl Environ Microbiol. 74(18):5674-85. doi: 10.1128/AEM.00565-08. 541

542

23. Keller NP, Hohn TM. 1997. Metabolic pathway gene clusters in filamentous fungi. Fungal 543

Genet Biol. 21(1): 17-29. DOI:10.1006/fgbi.1997.0970 544

545

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

29

29

24. Khaldi N, Seifuddin FT, Turner G, Haft D, Nierman WC, Wolfe KH, Fedorova ND 2010. 546

SMURF: genomic mapping of fungal secondary metabolite clusters. Fungal Genet Biol 547

47:736–741. http://dx.doi.org/10 .1016/j.fgb.2010.06.003. 548

549

25. Khlangwiset P, Shephard GS, Wu F. 2011. Aflatoxins and growth impairment: A review. 550

Crit Rev Toxicol. 41(9): 740-55. DOI: 10.3109/10408444.2011.575766 551

552

26. Kleppe R, Martinez A., Døskeland SO ,Haavik J. 2011. The 14-3-3 proteins in regulation 553

of cellular metabolism. Seminars in Cell & Developmental Biology 22: 713-19. DOI: 554

10.1016/j.semcdb.2011.08.008 555

556

27. Kraus PR, Hoffman AF,. Harris SD. 2002. Characterization of the Aspergillus nidulans 557

14-3-3 homologue, ArtA. FEMS Microbiology Letters. 210(1): 61-66. 558

DOI:10.1111/j.1574-6968.2002.tb11160. 559

560

28. Krijgsheld P, Bleichrodt RJ, Veluw GJ van, Wang F, Müller WG, et al. 2013 Development 561

of Aspergillus. Studies in Mycology 74: 1–2. DOI: http://doi.org/10.3114/sim0006 562

563

29. Kumar R. 2017. An Account of Fungal 14-3-3 Proteins. Eur J Cell Biol. 96(2):206-217. 564

doi: 10.1016/j.ejcb.2017.02.006. 565

566

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

30

30

30. Lalle M, Leptourgidou F, Camerini S, Pozio E, Skoulakis EMC. 2013. Interkingdom 567

complementation reveals structural conservation and functional divergence of 14-3-3 568

proteins. PLOS ONE 8(10): e78090. DOI: 10.1371/journal.pone.0078090 569

570

31. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time 571

quantitative PCR and the 2(-Delta Delta C(T) method. Methods. 25: 402–408. 572

pmid:11846609 573

574

32. Malloch D, Cain RF. 1972. The Trichocomataceae: ascomycetes with Aspergillus, 575

Paecilomyces and Penicillium imperfect states. Can J Bot 50: 2613-28. DOI: 10.1139/b72-576

335 577

578

33. Milroy L, Brunsveld L, Ottmann C. 2012. Stabilization and inhibition of protein−protein 579

interactions: The 14-3-3 case study. ACS Chem. Biol. 8: 27−35. DOI: 10.1021/cb300599t 580

581

34. Ramirez-Prado JH, Moore GG, Horn BW, Carbone I. 2008. Characterization and 582

population analysis of the mating-type genes in Aspergillus flavus and Aspergillus 583

parasiticus. Fungal Genet Biol 45: 1292-1299. DOI:10.1016/j.fgb.2008.06.007 584

585

35. Robens J, Cardwell K. 2003. The costs of mycotoxin management to the USA: 586

management of aflatoxins in the United States. J Toxicol Toxin Rev. 2003; 22: 139–152. 587

DOI: 10.1081/TXR-120024089 588

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

31

31

589

36. Szewczyk E, Nayak T, Oakley CE, Edgerton H, Xiong Y et al.. 2006. Fusion PCR and 590

gene targeting in Aspergillus nidulans. Nature Protocols. 1(6): 3111-20. 591

DOI:10.1038/nprot.2006.405 592

593

37. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. (2013) MEGA6: Molecular 594

Evolutionary genetics analysis version 6.0. Mol Biol Evol. 30: 2725–2729. doi: 595

10.1093/molbev/mst197 596

597

38. Terabayshi Y, Sano M, Yamane N, Marui J, Tamani K, Sagara J, Dohmoto M, Oda K, 598

Ohshima E, Tachibana K, HigaY, Ohashi S, Koike HH, Machida M. 2010. Identification 599

and characterization of genes responsible for biosynthesis of kojic acid, an industrially 600

important compound from Aspergillus oryzae. Fungal Genet Biol 47:953–961. 601

http://dx.doi.org /10.1016/j.fgb.2010.08.014 602

603

39. Tokuoka M, Seshime Y, Fujii I, Kitamoto K, Takahashi T, Koyama 604

Y.2008.Identificationof a novel polyketide synthase-nonribosomal peptide synthetase 605

(PKS-NRPS) gene required for the biosynthesis of cyclopiazonic acid in Aspergillus 606

oryzae. Fungal Genet Biol 45:1608–1615. http: //dx.doi.org/10.1016/j.fgb.2008.09.006. 607

608

40. Umemura M, Nagano N, Koike H, Kawano J, Ishii T, Miyamura Y, Kikuchi M, Tamano K, 609

Yu J, Shin-ya’ K, Machida M. 2014. Characterization of the biosynthetic gene cluster for 610

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

32

32

the ribosomally synthesized cyclic peptide ustiloxin B in Aspergillus flavus. FungalGenet 611

Biol. 68: 23-30. http://dx.doi.org/10.1016/j.fgb.2014.04.011 612

613

41. van Heusden GPH. 2005. 14-3-3 proteins: regulators of numerous eukaryotic 614

proteins. IUBMB Life 57: 623–629. DOI: 10.1080/15216540500252666 615

616

42. van Heusden G P.H, Steensma HY. 2006. Yeast 14-3-3 proteins. Yeast. 23: 159-71. DOI: 617

10.1002/yea.1338 618

619

43. van Heusden G PH. 2009. 14-3-3 proteins: Insights from genome-wide studies in yeast. 620

Genomics 94: 287-93. DOI: 10.1016/j.ygeno.2009.07.004 621

622

44. van Hemert MJ, van Heusden GPH, Steensma HY. 2001. Yeast 14-3-3 proteins. Yeast 18: 623

889–895. DOI:10.1002/yea.739 624

625

45. Vasara T, Keränen S, Penttilä M, Saloheimo M.2002. Characterization of two 14-3-3 genes 626

from Trichoderma reesei: interactions with yeast secretory pathway components. Biochim 627

Biophys Acta. 2002 Jun 12;1590(1-3):27-40. DOI: 10.1016/S0167-4889(02)00197-0 · 628

629

46. Wicklow DT. 1987 Survival of Aspergillus flavus sclerotia in soil. Trans. Br. mycol. Soc. 630

89(1): 131-4. DOI:10.1094/Phyto-83-1141 631

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

33

33

632

47. Woloshuk CP, Yousibova GL, Rollins JA, Bhatnagar D, Payne GA. 1995. Molecular 633

characterization of the afl-1 locus in Aspergillus flavus. Appl Enviorn Microbiol 61:3019–634

3023. PMCID: PMC167577 635

636

48. Wu F, Groopman JD, Pestka1 JJ. 2014. Public health impacts of foodbourne mycotoxins. 637

Annu. Rev. Food Sci. Technol. 5: 351-72. DOI:10.1146/annurev-food-030713-092431. 638

639

49. Wu F, Guclu H. 2012. Aflatoxin Regulations in a Network of Global Maize Trade. PLOS 640

One 7(9): e435151. DOI:10.1371/journal.pone.0045151 641

642

50. Yaffe MB. 2002. How do 14-3-3 proteins work? – Gatekeeper phosphorylation and the 643

molecular anvil hypothesis. FEBS Letters 513: 53-7. DOI: 10.1016/S0014-644

5793(01)03288-4 645

646

51. Yang X, Lee WH, Sobott F, Papagrigoriou E, Robinson CV et al., 2006. Structural basis 647

for protein-protein interactions in the 14-3-3 protein family. PNAS 103(46): 17237- 42. 648

DOI: 10.1073/pnas.0605779103 649

650

52. Yu J, Cleveland TE, Bierman WC, Bennett JW. 2005. Aspergillus flavus genomics: 651

gateway to human and animal health, food, safety, and crop resistance to diseases. Rev 652

Iberoam Micol 22: 194-202. DOI: 10.1016/S1130-1406(05)70043-7 653

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

34

34

654

53. Yu J, Keller N. 2005. Regulation of secondary metabolism in filamentous fungi. Annual 655

Review of Phytopathology. 22: 194-202. DOI: 10.1146/annurev.phyto.43.040204.14021 656

657

54. Zhang S, Monahan BJ, Tkacz JS, Scott B. 2004. Indole-diterpene gene cluster 658

fromAspergillus flavus. Appl Environ Microbiol 70:687 6883. 659

http://dx.doi.org/10.1128/AEM.70.11.6875-6883.2004. 660

661

55. Zhuang Z, Lohmar JM, Satterlee T, Cary JW., Calvo AM. 2016. The Master Transcription 662

Factor mtfA Governs Aflatoxin Production, Morphological Development and Pathogenicity 663

in the Fungus Aspergillus flavus. Toxins (Basel). Jan 20;8(1). pii: E29. doi: 664

10.3390/toxins8010029 665

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from