Supplementary Methods and MaterialsIsolation of adipocytes and co-culture with cancer cells

All experiments were performed with primary human adipocytes. Primary human omental adipocytes were isolated as described previously (1,2). Isolated adipocytes were grown in DMEM: F12 media supplemented with 0.1% fatty acid free BSA (Roche, NY), 100 U/ml penicillin, and 100 µg/ml streptomycin. Co-culture of adipocytes with cancer cells was carried out in 1:5 packed cell adipocyte volume (PCV) to serum-free media (SFM). To generate adipocyte-conditioned media (CM), adipocytes were grown in DMEM: F12 media for 72hr, after which media was removed and filtered through a 0.8µm syringe filter.

Reactive oxygen species detection assayIntracellular reactive oxygen species (ROS) were estimated using CellROX Deep Red

reagent (Thermo-Fisher). Cancer cells were treated with 7.5 µM dye for 30 min, cells trypsinized and flow cytometry carried out using LSR-fortessa 4-15 (BD Biosciences). Analysis of cytometry data was performed using FlowJo V.10.1 and mean fluorescence intensity plotted between experimental groups.

Immunohistochemistry Normal and metastatic high grade serous cancer omental tissue from human and

mouse sources was formalin fixed and embedded in paraffin. Sections (5 µm thickness) were mounted on glass slides, de-paraffinized using xylene and rehydrated in decreasing dilutions of ethanol. Antigen retrieval was carried out using 10 mmol/L sodium citrate buffer at pH 6, containing 0.05% Tween 20 with heating for 30 min at 100°C. Samples were incubated in 0.3% hydrogen peroxide for 20 minutes at room temperature (RT) and blocked with 2.5% normal horse serum (Vector Laboratories) for 1 hour. Slides were incubated with primary antibodies FABP4 (ab13979, Abcam, 1:200), CD36 (18836-1-AP, Peprotech, 1:200), ADH1B (AV41787, Sigma-Aldrich, 1:400); 4-HNE (ab46545, Abcam, 1:200); 5-hmc (39769, Active Motif, 1:1500 ) and subsequently visualized using Vectastain Elite ABC HRP kit (Vector Laboratories, Burlingame, CA). Quantification of 5-hmc staining (H-score) in omental tumors from control CRISPR and FABP4 CRISPR (5 samples each group), was determined as a product of percent cancer cells positive for the stain and the intensity of staining.

Immunoblotting Cells were lysed using RIPA buffer supplemented with protease and phosphatase

inhibitors, and protein estimation was carried out using a Pierce BCA Protein Assay Kit, (Thermo Scientific). Equal protein amounts were resolved using 4-20% SDS gel and transferred onto nitrocellulose membrane. Blotting was carried out using specific antibodies FABP4 (ab13979, Abcam), 1:1000; CD36 (SR-B3, R&D Systems), 1:1000; β-Actin (A5441, Sigma-Aldrich), 1:3000; 5-hmc (A-1018, Epigentek), 1:1000. Signals were detected using 1:2000 dilutions of either horseradish peroxide linked anti-mouse (7076, Cell Signaling Technology), anti-rabbit (7074, Cell Signaling Technology) or anti-goat (A15999, ThermoFisher Scientific) secondary antibodies and subsequently developed with ECL substrate (Bio-Rad, Hercules, Ca). Images were acquired using G: Box (Syngene).

Lentivirus generationLentivirus was generated using the packaging plasmids pCMV-dR8.2 dvpr and pCMV-

VSV-G (a gift from Robert Weinberg, Addgene plasmid #8455 and 8454 respectively). 293T

cells were grown in 10 cm dishes and transfected with 8µg of targeting plasmid along with 8µg of dR8.2 and 2 µg of VSV-G using lipofectamine 2000 (Thermo-Fisher Scientific). Viral supernatants were collected 48hr post infection, filtered through a 0.45µm filter to remove cell debris and subsequently added onto cells for transduction.

RNA interference, CRISPR and FABP4 overexpression Transient knockdown of FABP4 was carried out by transfecting 20nM siRNA

(SI00026033, Qiagen) in Opti-MEM media, using lipofectamine 2000. Stable knockdown of CD36 in SKOV3ip1 was achieved as described previously (2). To generate FABP4 knockdown plasmid, oligonucleotides containing a targeting sequence against FABP4 (GAAACTTGTCTCCAGTGAAAA) was cloned into pLV-RNAi Vector (SORT-04, Biosettia, San Diego, CA). Cells were infected with FABP4 targeting lentivirus and transduced (GFP expressing) cells were sorted out using flow cytometry. CRISPR mediated knockout of FABP4 was carried out by generating lentivirus containing guide RNA (gRNA) targeting FABP4, cloned in pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro (TAGGAGTGGGCTTTGCCACC, ABMgood, Richmond, BC, Canada). OVCAR8 cells were infected and subsequently selected for 7 days using puromycin (1µg/ml, Sigma-Aldrich). Single cell colonies were grown out and analyzed for knockout status using Sanger sequencing of TA clones (TOPO TA cloning, Thermo Fisher), containing genomic DNA of interest. Using single guide RNA (gRNA) targeting FABP4 exon 3, we generated FABP4 knockout clones with heterozygous deletion of FABP4. CRISPR against FABP4 resulted in 21bp deletion in one allele of the FABP4 gene (Supplementary Fig. 3B), leading to a partial loss of FABP4 protein (Supplementary Fig. 3C).

The sequence corresponding to Myc-DDK-tagged FABP4 (RC202702, Origene) was cloned in pcDNA 3.1 plasmid for expression in cells. The cloned plasmid was transfected into SKOV3ip1 cells using lipofectamine 2000 and transfected cells selected by treating cells with hygromycin for 7 days. Following which the clone was validated for FABP4 expression using anti-Myc-DDK antibody.

Cell Cycle analysisOvarian cancer cell lines with 1) stable knockdown/knockout of FABP4, 2) SKOV3ip1

cells treated with indicated amounts of FABP4 inhibitor (BMS309403), or 3) dimethyl 2-oxoglutarate (dm-OG) for 48hr, 24hr, and 72hr respectively, were trypsinized and ethanol fixed (final concentration of 70%). 1 million cells were washed, re-suspended in Pi/RNase staining buffer (BD Bioscience, San Jose, CA), and stained for 30 min at room temperature. Flow cytometry analysis was then carried out using LSR-fortessa 4-15 (BD Biosciences). Data analysis was carried out using FlowJo V.10.1.

MTT and carboplatin IC50 analysis Cancer cells were plated in 96-well plates (2,000 cells/well) and allowed to adhere for

24hr. BMS309403 (20 µM) and carboplatin treatments were then carried out in 1% FBS containing DMEM media for 72 hr. Subsequently, thiazolyl blue tetrazolium bromide (MTT) solution (5mg/ml, Sigma-Aldrich) was added to each well and incubated at 37 C for 2hr. Media was removed and the formazan crystals were dissolved in DMSO. Absorbance was then read at 570 nm using the Spectra max i3. The absorbance values were converted into percent survival values after comparison with control values and IC50 determined via non-linear regression analysis (variable slope curve fitted to log (inhibitor) versus normalized response) using Graph Pad Prism 7.

Supplementary figure1. Changes in the ovarian cancer cell metabolome after co-culture with adipocytes. Heat map depicting log2 transformed scaled intensity values of significantly altered metabolites in cancer cells cultured with or without adipocytes for 4hr (A) and 18hr (B).

Supplementary figure 2. Expression of FABP4, CD36, and ADH1 in ovarian cancer samples. (A) Average number of proteins detected in OvCa samples using shotgun proteomics after co-culture with HPA. Error bars represent standard error. (B) Copy number amplifications and mRNA expression of FABP4, CD36, and ADH1 family members in ovarian cancer samples (TCGA ovarian cancer samples, generated using cBioPortal). (C) Pearson correlation of FABP4/CD36 (left), and FABP4/ADH1B (right) mRNA expression in TCGA ovarian cancer samples data. Source data from cBioPortal. (D) Immunohistochemical staining for FABP4, CD36 and ADH1b proteins in serial sections of omentum from non-cancer patients. (E) Expression of CD36, FABP4, and ADH1b were analyzed using the publicly available Tothill database to check for differential expression between primary and metastatic cancer samples. CD36, FABP4, and ADH1b were significantly higher in peritoneal metastasis. (F) Immunoblot showing adipocyte induced FABP4 expression in HGSOC cell lines.

Supplementary figure 3. Blocking FABP4 changes intra-cellular lipid species and affects global lipid metabolism. (A) SKOV3ip1 cells transiently transfected with FABP4 siRNA were cultured ± adipocytes for 24 hr. Total intracellular lipids in cancer cells were labeled using Bodipy 309/403 dye. Scale bar 20 µm (B) Relative levels of significantly altered triacylglycerol species from untargeted metabolomics in figure 3A following stable knock down of FABP4 in SKOV3ip1 cells ± adipocytes. (C-F) SKOV3ip1 FABP4 knock down cells were cultured ± adipocytes, followed by untargeted metabolomics as shown in figure 3A. The relative levels of significantly altered cholesterol esters (C), ceramide (D), glucosylceramide (E), sphingomyelin (F), phosphatidylcholine (PC) and phosphatidylethanolamine (PE) species are plotted (G). Bars are mean ± SEM (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p< 0.0001).

Supplementary figure 4. Effect of α-ketoglutarate on cell cycle and DNA 5-hmc. (A) Immunoblot showing expression levels of DDK tagged FABP4 protein after stable transfection in SKOV3ip1 cells. (B) SKOV3ip1 cells were treated with an increased dose of dimethyl 2-oxoglutarate (dm-OG) for 72hr, followed by propidium iodide staining and cell cycle analysis. Percent of cells in respective phases of cell cycle with treatment are plotted. The bar are the mean ± SEM. DNA dot blot analysis of 5-hydroxymethylcytosine levels in (C) SKOV3ip1 cells treated with indicated doses of dm-OG for 72hr and (D) CAOV3 cells co-cultured with adipocytes +/- BMS309403 (BMS, 20 µM). Dot blots (left) and mean density of dot blot (right) shown. Bars are mean ± SEM (* p < 0.05, ** p < 0.005, *** p < 0.001).

Supplementary figure 5. Metastatic role of FABP4. (A) Top canonical pathways affected by FABP4 knockdown (IPA). (B) Genomic DNA sequence analysis of control CRISPR (CCr) and FABP4 CRISPR (FCr) clones using the MultiAlin tool (3) to identify and confirm deleted sequence. (C) Western blot validating loss of FABP4 expression in the FABP4 CRISPR clone used for in vivo experiments in figure 5C. (D) Omental tumor weight. OVCAR-8 control CRISPR or FABP4 CRISPR cells were injected in nude mice and omental tumor weights estimated (mean +/- SEM, **p < 0.01). (E) H&E stained omental tumors from in vivo experiments in figure 5C. Dark purple regions are immune cells. Scale bar 100 µm. (F) DNA dot blot analysis of 5-hydroxymethylcytosine levels in, control and FABP4 CRISPR OVCAR8 cells treated with adipocyte conditioned media (Adi CM). Bar graphs show densitometric analysis of the dot blots. Plots depict mean +/- SEM. (* p < 0.05, ** p < 0.005)

Supplementary figure 6. Effect of BMS309403 on mouse orthotopic ovarian tumors. ID8 mouse ovarian cancer cells were injected intra-bursally and treated with BMS309403 (15 mice) or vehicle control (16 mice). Primary tumor weights were measured and plotted as mean ± SEM.

TablesSupplementary Table 1: Significantly altered proteins in cancer cells after adipocyte co-culture.

Protein IDs Protein names Gene symbols(- ) Log t-test p value

Log t-test difference (fold change)

Upregulated proteins

Q16853 Membrane primary amine

oxidase

AOC3 10.29 6.68

P02787 Serotransferrin TF 6.53 6.11

P00325;P07327;P00326

Alcohol dehydrogenase

1B;Alcohol dehydrogenase

1A;Alcohol dehydrogenase

1C

ADH1B;

ADH1A; ADH1C4.58 5.29

P16671;E7EU05;E9PLT1Hemoglobin subunit

beta;LVV-hemorphin-7HBB 4.79 4.05

P68871;F8W6P5 Platelet glycoprotein 4 CD36 7.01 3.98

P15090;E5RIR0Fatty acid-binding protein,

adipocyteFABP4 5.09 3.57

Q15661;P20231Tryptase alpha/beta-

1;Tryptase beta-2TPSAB1;TPSB2 4.05 2.94

P59666;P59665

Neutrophil defensin 3;HP 3-

56;Neutrophil defensin 1;HP

1-56;

DEFA3;DEFA1 5.81 2.18

P05091Aldehyde dehydrogenase,

mitochondrialALDH2 4.70 1.60

Q5QPR3;Q9UQ88;Q5QPR4 Cyclin-dependent kinase 11A CDK11A 3.78 0.58

Downregulated proteins

P05067;E9PG40;H7C0V9Amyloid beta A4 protein;N-

APPAPP 4.42 -0.63

B1AHL2 Fibulin-1 FBLN1 4.02 -1.81

P98160

Basement membrane-specific

heparan sulfate proteoglycan

core protein; Endorepellin;

LG3 peptide

HSPG2 5.70 -1.92

P13611;E9PF17 Versican core protein VCAN 9.32 -2.65

P35052;H7C410;H7C024Glypican-1;Secreted

glypican-1GPC1 5.67 -3.32

Q8TCZ2 CD99 antigen-like protein 2 CD99L2 5.87 -3.50

Supplementary Table 2: Top 20 genes that are up or down regulated with FABP4 inhibition

Number Probe ID Gene nameFold

Changep-value

False

discovery

rate (q-value)

1 ILMN_2148527 H19 4.45 4.02E-05 0.017

2 ILMN_1770940 CDH1 3.73 2.34E-05 0.017

3 ILMN_2298301 BNC1 2.96 1.51E-04 0.021

4 ILMN_1680689 SPANXB2 2.91 2.62E-04 0.024

5 ILMN_1785071 SEPP1 2.79 6.86E-05 0.019

6 ILMN_1892403 SNORD13 2.71 1.19E-03 0.042

7 ILMN_2109197 EPB41L3 2.70 1.01E-03 0.039

8 ILMN_2080080 MAP7D2 2.67 3.14E-04 0.026

9 ILMN_1796737 APM-1 2.58 1.40E-03 0.046

10 ILMN_1696731 LOC652683 2.45 8.68E-04 0.037

11 ILMN_3244876 LOC100133171 2.39 8.62E-04 0.037

12 ILMN_2093343 PLAC8 2.37 9.21E-05 0.021

13 ILMN_1801307 TNFSF10 2.36 6.06E-04 0.032

14 ILMN_2211030 SPANXB1 2.30 1.47E-03 0.047

15 ILMN_2308338 BMF 2.28 2.99E-05 0.017

16 ILMN_2198300 SPANXC 2.25 6.70E-04 0.033

17 ILMN_2399016 MMP28 2.24 3.21E-04 0.026

18 ILMN_1664303 HTATIP2 2.21 6.27E-05 0.019

19 ILMN_2094266 HES2 2.21 4.29E-04 0.028

20 ILMN_2379226 CCNL2 2.15 2.19E-04 0.024

Supplementary Table 2: Top 20 downregulated genes with FABP4 inhibition

Number Probe ID Gene nameFold

Changep-value

False

discovery

rate (q-value)

1 ILMN_1701854 GNG5 -4.03 3.65E-05 0.017

2 ILMN_1811238 ALPK2 -4.03 0.000217 0.024

3 ILMN_1805466 SOX9 -3.43 0.000456 0.028

4 ILMN_1699829 CTGF -3.42 5.58E-07 0.003

5 ILMN_3244117 STMN3 -3.01 0.000137 0.021

6 ILMN_2198413 MYEOV -2.83 0.000723 0.034

7 ILMN_2329914 SPRY1 -2.83 1.12E-05 0.017

8 ILMN_2184373 IL8 -2.68 0.000809 0.036

9 ILMN_1732410 SLC16A9 -2.62 7.54E-05 0.019

10 ILMN_2228809 YWHAG -2.55 0.000164 0.021

11 ILMN_1805665 FLRT3 -2.54 3.52E-05 0.017

12 ILMN_2086105 SPRY4 -2.28 0.000181 0.022

13 ILMN_1739222 ETV5 -2.28 8.80E-05 0.021

14 ILMN_1687978 PHLDA1 -2.27 0.000203 0.023

15 ILMN_1669410 CHGA -2.24 0.000168 0.021

16 ILMN_1771841 FOSL1 -2.21 0.000109 0.021

17 ILMN_1812297 CYP26B1 -2.16 9.04E-05 0.021

18 ILMN_1708508 PPM1E -2.15 2.33E-05 0.017

19 ILMN_1653856 STS-1 -2.10 0.000541 0.031

20 ILMN_1758731 CYP2J2 -2.10 0.001369 0.046

Supplementary Table 3: Ingenuity pathway analysis showing top canonical pathways and

molecular /cellular functions affected in cancer cells after FABP4 knockdown.

Name p-value range Number of Molecules

Cellular Growth and Proliferation 2.12E-03 - 4.82E-15 78

Cellular Development 2.30E-03 - 6.90E-15 69

Cellular Movement 2.28E-03 - 3.56E-13 49

Cell Death and Survival 2.33E-03 - 8.62E-11 61

Cell Morphology 1.98E-03 - 4.92E-08 33

Top Canonical Pathways

Name p-value

Bladder Cancer Signaling 9.07E-06

Colorectal Cancer Metastasis Signaling 3.12E-05

Pancreatic Adenocarcinoma Signaling 3.56E-05

Estrogen-mediated S-phase Entry 4.83E-05

Molecular Mechanisms of Cancer 6.40E-05

References:

1. Nieman KM, Kenny HA, Penicka CV, Ladanyi A, Buell-Gutbrod R, Zillhardt MR, et al. Adipocytes promote ovarian cancer metastasis and provide energy for rapid tumor growth. Nat Med 2011;17:1498-503

2. Ladanyi A, Mukherjee A, Kenny HA, Johnson A, Mitra AK, Sundaresan S , et al. Adipocyte-induced CD36 expression drives ovarian cancer progression and metastasis. Oncogene 2018;37:2285-301

3. Corpet F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res 1988;16:10881-90