supplementary table 1 summery of the case-control association analysis of representative snps around...
TRANSCRIPT
![Page 1: Supplementary Table 1 Summery of the case-control association analysis of representative SNPs around ITPR3 locus MAF, minor allele frequency. CI, confidence](https://reader036.vdocuments.mx/reader036/viewer/2022082510/5a4d1b787f8b9ab0599b80e3/html5/thumbnails/1.jpg)
Location
NT_007592. 14 Gene 11 12 22 Sum MAF 11 12 22 Sum MAF Odds rati o(95%CI ) p- val ue Odds rati o(95%CI ) p- val ue Odds rati o(95%CI ) p- val ue
24398459 BAKI 3' fl anki ng +121G/ A - 95 72 10 177 0. 26 209 133 17 359 0. 23 0. 86 (0. 64~1. 17) 0. 325 0. 83 (0. 57~1. 22) 0. 354 0. 83 (0. 35~2. 08) 0. 67724398942 BAKI Exon 6 993A/ T - 108 62 7 177 0. 21 223 122 13 358 0. 21 0. 95 (0. 69~1. 32) 0. 811 0. 95 (0. 64~1. 40) 0. 777 0. 92 (0. 33~2. 6) 0. 81424399969 BAKI I VS5 +564G/ A - 78 74 23 175 0. 34 160 161 35 356 0. 32 0. 92 (0. 70~1. 22) 0. 579 0. 99 (0. 67~1. 44) - 0. 72 (0. 40~1. 33) 0. 30024410957 FLJ 43752 3' fl anki ng +1176T/ G - 108 9 39 156 0. 28 176 42116 334 0. 41 1. 80 (1. 33~2. 44) 6. 75E-05 2. 02 (1. 33~3. 09) 0. 00058 1. 59 (1. 02~2. 52) 0. 03724415991 FLJ 43752 I VS1 +3033T/ C - 45 90 42 177 0. 49 127 159 62 348 0. 41 0. 71 (0. 54~0. 92) 0. 0102 0. 59 (0. 39~0. 90) 0. 011 0. 70 (0. 44~1. 12) 0. 13224416908 FLJ 43752 I VS1 +2116A/ G - 119 51 6 176 0. 18 243 105 10 358 0. 17 0. 97 (0. 69~1. 38) 0. 865 0. 99 (0. 66~1. 48) - 0. 81 (0. 26~2. 77) 0. 78824420212 FLJ 43752 5' fl anki ng -847C/ T - 97 66 14 177 0. 27 144 162 52 358 0. 37 1. 63 (1. 23~2. 19) 0. 00058 1. 80 (1. 23~2. 64) 0. 0017 1. 98 (1. 04~3. 98) 0. 03524420959 T/C - 97 68 13 178 0. 26 146 158 53 357 0. 37 1. 63 (1. 23~2. 19) 0. 00058 1. 73 (1. 18~2. 53) 0. 0032 2. 21 (1. 15~4. 55) 0. 01224422546 A/T - 130 42 6 178 0. 15 184 128 27 339 0. 27 2. 05 (1. 45~2. 93) 1. 68E-05 2. 28 (1. 51~3. 46) 3. 00E-05 2. 48 (0. 98~7. 48) 0. 05724423724 A/G - 39 88 50 177 0. 47 123 156 78 357 0. 44 0. 69 (0. 53~0. 89) 0. 0041 0. 54 (0. 34~0. 83) 0. 0037 0. 71 (0. 46~1. 10) 0. 10724430375 G/A - 78 71 29 178 0. 36 111 156 81 348 0. 46 1. 48 (1. 13~1. 94) 0. 0037 1. 66 (1. 13~2. 46) 0. 0094 1. 56 (0. 96~2. 59) 0. 07024433259 G/A - 40 88 50 178 0. 47 120 159 68 347 0. 43 0. 66 (0. 51~0. 86) 0. 0017 0. 55 (0. 35~0. 84) 0. 0050 0. 62 (0. 40~0. 97) 0. 03624446161 I TPR3 5' fl anki ng -1245A/ G - 171 5 0 176 0. 01 355 5 0 360 0. 01 0. 49 (0. 11~2. 13) 0. 311 0. 48 (0. 11~2. 13) 0. 309 - - -24446204 I TPR3 5' fl anki ng -1202G/ A - 170 6 1 177 0. 02 339 20 1 360 0. 03 1. 36 (0. 58~3. 58) 0. 557 1. 50 (0. 60~4. 27) 0. 415 0. 49 (0. 01~38. 70) 0. 55124446397 I TPR3 5' fl anki ng -1009C/ T - 153 22 2 177 0. 07 229 118 14 361 0. 20 3. 19 (2. 04~5. 17) 1. 64E-08 3. 67 (2. 24~6. 21) 1. 11E-08 3. 52 (0. 80~32. 29) 0. 10424446860 I TPR3 5' fl anki ng -546A/ G - 70 76 30 176 0. 39 93 176 90 359 0. 50 1. 56 (1. 20~2. 04) 0. 00086 1. 89 (1. 26~2. 82) 0. 0014 1. 63 (1. 01~2. 67) 0. 03724448060 I TPR3 I VS1 +342G/ A - 171 6 1 178 0. 02 267 13 0 280 0. 02 1. 03 (0. 39~2. 91) - 1. 19 (0. 43~3. 59) 0. 817 - - 0. 38924451098 I TPR3 I VS1 +3380C/ G - 123 46 5 174 0. 16 267 88 5 360 0. 14 0. 82 (0. 57~1. 20) 0. 307 0. 84 (0. 55~1. 29) 0. 407 0. 48 (0. 11~2. 10) 0. 30724451827 I TPR3 I VS1 +4109C/ A - 126 49 3 178 0. 15 267 91 1 359 0. 13 0. 81 (0. 56~1. 19) 0. 261 0. 84 (0. 55~1. 28) 0. 408 - - 0. 10924451937 I TPR3 I VS1 +4219C/ G - 94 75 8 177 0. 26 146 158 56 360 0. 38 1. 73 (1. 30~2. 33) 0. 000117 1. 66 (1. 14~2. 43) 0. 0073 3. 88 (1. 79~9. 66) 0. 0001124456706 I TPR3 I VS1 +8988C/ G - 163 15 0 178 0. 04 256 24 0 280 0. 04 1. 02 (0. 50~2. 12) - 1. 02 (0. 50~2. 15) - - - -24464773 I TPR3 I VS1 +17055C/ T - 45 78 55 178 0. 47 136 139 75 350 0. 41 0. 63 (0. 48~0. 82) 0. 00041 0. 53 (0. 35~0. 81) 0. 0019 0. 61 (0. 40~0. 94) 0. 01924468306 I TPR3 I VS2 +1725C/ T - 135 39 4 178 0. 13 279 79 2 360 0. 12 0. 86 (0. 58~1. 29) 0. 428 0. 91 (0. 59~1. 43) 0. 665 0. 24 (0. 02~1. 72) 0. 09624469528 I TPR3 I VS2 +2947G/ T - 115 54 7 176 0. 19 171 162 27 360 0. 30 1. 79 (1. 30~2. 48) 0. 00017 2. 08 (1. 41~3. 06) 0. 00011 1. 96 (0. 81~5. 43) 0. 13324471594 I TPR3 I VS2 +5013G/ A - 116 53 8 177 0. 19 173 151 29 353 0. 30 1. 74 (1. 26~2. 40) 0. 00038 1. 98 (1. 34~2. 93) 0. 00031 1. 89 (0. 82~4. 89) 0. 14824471617 I TPR3 I VS2 +5036G/ T - 45 89 41 175 0. 49 148 144 61 353 0. 38 0. 63 (0. 48~0. 83) 0. 00056 0. 48 (0. 31~0. 73) 0. 00026 0. 68 (0. 43~1. 10) 0. 10224472377 I TPR3 I VS2 +5796C/ T - 45 89 44 178 0. 50 148 146 58 352 0. 37 0. 60 (0. 46~0. 78) 0. 000125 0. 47 (0. 31~0. 71) 0. 00018 0. 60 (0. 38~0. 96) 0. 02724475714 I TPR3 I VS2 +9133T/ C - 109 59 9 177 0. 22 160 153 38 351 0. 33 1. 74 (1. 28~2. 38) 0. 00024 1. 91 (1. 30~2. 82) 0. 00063 2. 26 (1. 04~5. 45) 0. 03424476174 I TPR3 I VS2 +9593C/ T - 114 55 8 177 0. 20 176 158 26 360 0. 29 1. 64 (1. 20~2. 26) 0. 0015 1. 89 (1. 29~2. 79) 0. 00089 1. 64 (0. 70~4. 29) 0. 26224476412 I TPR3 I VS2 +9831T/ A - 21 89 67 177 0. 37 99 152 94 345 0. 49 0. 57 (0. 43~0. 75) 2. 65E-05 0. 34 (0. 19~0. 57) 9. 48E-06 0. 62 (0. 41~0. 92) 0. 01624477434 I TPR3 I VS2 +10853G/ C - 116 53 8 177 0. 19 173 154 28 355 0. 30 1. 73 (1. 26~2. 40) 0. 00038 2. 00 (1. 36~2. 96) 0. 00030 1. 81 (0. 78~4. 69) 0. 19924478170 I TPR3 I VS2 +11589C/ T - 95 63 20 178 0. 29 172 162 26 360 0. 30 1. 04 (0. 78~1. 39) 0. 831 1. 25 (0. 86~1. 82) 0. 234 0. 62 (0. 32~1. 20) 0. 14024478258 I TPR3 I VS2 +11677C/ G - 27 51 16 94 0. 44 146 155 59 360 0. 38 0. 77 (0. 55~1. 09) 0. 131 0. 59 (0. 35~0. 99) 0. 042 0. 96 (0. 51~1. 88) 0. 87724480686 I TPR3 I VS2 +14105C/ G - 153 23 2 178 0. 08 241 111 8 360 0. 18 2. 61 (1. 67~4. 20) 4. 89E-06 3. 02 (1. 85~5. 08) 1. 62E-06 2. 00 (0. 39~19. 51) 0. 50924481955 I TPR3 I VS3 +41C/ T - 170 3 1 174 0. 01 354 5 0 359 0. 01 0. 48 (0. 11~2. 11) 0. 309 0. 60 (0. 13~3. 07) 0. 483 - - 0. 32624483152 I TPR3 I VS3 +1238C/ G - 118 52 7 177 0. 19 178 156 25 359 0. 29 1. 75 (1. 27~2. 44) 0. 00034 2. 03 (1. 38~3. 02) 0. 00021 1. 82 (0. 74~5. 08) 0. 18124483635 I TPR3 I VS3 +1721C/ T - 164 13 0 177 0. 04 333 28 1 362 0. 04 1. 13 (0. 57~2. 40) 0. 869 1. 10 (0. 54~2. 37) 0. 865 - - -24484967 I TPR3 I VS5 +112A/ G - 49 88 40 177 0. 47 130 170 60 360 0. 40 0. 75 (0. 57~0. 97) 0. 026 0. 68 (0. 45~1. 02) 0. 052 0. 69 (0. 43~1. 10) 0. 10024485327 I TPR3 I VS6 +181T/ C - 47 89 39 175 0. 48 137 162 61 360 0. 39 0. 71 (0. 55~0. 93) 0. 012 0. 60 (0. 39~0. 90) 0. 012 0. 71 (0. 44~1. 15) 0. 15624485823 I TPR3 I VS7 +247A/ G - 136 31 7 174 0. 13 243 104 15 362 0. 19 1. 53 (1. 05~2. 26) 0. 023 1. 75 (1. 13~2. 75) 0. 0085 1. 03 (0. 39~3. 05) -24488722 I TPR3 I VS8 +21C/ T - 171 5 1 177 0. 02 340 19 1 360 0. 03 1. 49 (0. 60~4. 19) 0. 421 1. 67 (0. 63~5. 19) 0. 392 0. 49 (0. 01~38. 70) 0. 55124488874 I TPR3 I VS8 +173G/ A - 109 60 8 177 0. 21 159 162 38 359 0. 33 1. 81 (1. 34~2. 48) 8. 31E-05 2. 01 (1. 37~2. 96) 0. 00023 2. 50 (1. 11~6. 34) 0. 02124489066 I TPR3 I VS9 +33C/ T - 63 87 27 177 0. 40 99 184 77 360 0. 47 1. 34 (1. 02~1. 75) 0. 031 1. 46 (0. 97~2. 18) 0. 058 1. 51 (0. 92~2. 55) 0. 10424489946 I TPR3 I VS11 +39C/ T - 46 89 37 172 0. 47 138 162 60 360 0. 39 0. 72 (0. 55~0. 93) 0. 012 0. 59 (0. 38~0. 89) 0. 0086 0. 73 (0. 45~1. 19) 0. 18824491000 I TPR3 I VS12 +4G/ A - 160 14 2 176 0. 05 340 18 1 359 0. 03 0. 53 (0. 26~1. 08) 0. 077 0. 56 (0. 26~1. 20) 0. 135 - - 0. 25324494910 I TPR3 I VS17 +249C/ G - 36 92 47 175 0. 47 129 159 72 360 0. 42 0. 64 (0. 49~0. 84) 0. 00068 0. 46 (0. 29~0. 72) 0. 00032 0. 68 (0. 44~1. 07) 0. 07724496430 I TPR3 Exon 19 2268C/ T Gl y756Gl y 40 92 43 175 0. 49 138 157 67 362 0. 40 0. 65 (0. 50~0. 85) 0. 0010 0. 48 (0. 31~0. 74) 0. 00042 0. 70 (0. 44~1. 11) 0. 11124496907 I TPR3 I VS20 +65C/ T - 32 93 52 177 0. 44 101 174 83 358 0. 47 0. 72 (0. 55~0. 94) 0. 014 0. 56 (0. 35~0. 89) 0. 011 0. 73 (0. 47~1. 12) 0. 13924498010 I TPR3 I VS21 +677C/ G - 133 40 4 177 0. 14 266 83 11 360 0. 15 1. 09 (0. 74~1. 61) 0. 711 1. 07 (0. 69~1. 66) 0. 834 1. 36 (0. 40~5. 95) 0. 78324499487 I TPR3 I VS22 +1232T/ C - 155 22 0 177 0. 06 319 39 2 360 0. 06 0. 96 (0. 55~1. 71) 0. 892 0. 91 (0. 51~1. 66) 0. 776 - - -24499629 I TPR3 Exon 23 2940C/ T Asn980Asn 66 93 18 177 0. 36 105 172 85 362 0. 47 1. 56 (1. 19~2. 05) 0. 000849 1. 45 (0. 98~2. 16) 0. 061 2. 71 (1. 55~4. 96) 0. 0001724500262 I TPR3 Exon 24 3087C/ A Val 1029Gl y 170 7 0 177 0. 02 346 14 0 360 0. 02 0. 98 (0. 37~2. 91) - 0. 98 (0. 36~2. 93) - - - -24501808 I TPR3 Exon 25 3207G/ A Pro1069Pro 133 40 3 176 0. 13 263 89 7 359 0. 14 1. 11 (0. 76~1. 66) 0. 639 1. 13 (0. 73~1. 76) 0. 601 1. 15 (0. 26~6. 95) -24503365 I TPR3 I VS27 +249C/ A - 116 53 8 177 0. 19 177 157 26 360 0. 29 1. 69 (1. 23~2. 34) 0. 00083 1. 96 (1. 33~2. 91) 0. 00044 1. 64 (0. 70~4. 29) 0. 26224504398 I TPR3 I VS28 +742C/ T - 132 42 2 176 0. 13 285 62 4 351 0. 10 0. 74 (0. 49~1. 12) 0. 144 0. 70 (0. 44~1. 10) 0. 112 1. 00 (0. 14~11. 19) -24504578 I TPR3 I VS29 +8A/ G - 150 24 1 175 0. 07 295 62 2 359 0. 09 1. 26 (0. 77~2. 11) 0. 355 1. 30 (0. 77~2. 25) 0. 325 0. 97 (0. 05~57. 82) -24508680 I TPR3 I VS34 +9C/ G - 135 35 5 175 0. 13 284 71 7 362 0. 12 0. 90 (0. 60~1. 36) 0. 618 0. 93 (0. 59~1. 47) 0. 740 0. 67 (0. 18~2. 72) 0. 53924508871 I TPR3 I VS34 +200C/ T - 76 84 16 176 0. 33 108 194 58 360 0. 43 1. 54 (1. 17~2. 03) 0. 0018 1. 77 (1. 20~2. 62) 0. 0036 1. 92 (1. 05~3. 70) 0. 03224508993 I TPR3 I VS34 +322T/ C - 132 36 4 172 0. 13 210 135 14 359 0. 23 2. 00 (1. 38~2. 94) 0. 00013 2. 34 (1. 53~3. 63) 4. 36E-05 1. 70 (0. 52~7. 21) 0. 44724509379 I TPR3 Exon 35 4743C/ T Pro1581Pro 152 17 2 171 0. 06 255 99 6 360 0. 15 2. 78 (1. 70~4. 77) 9. 7E-06 3. 29 (1. 91~5. 91) 1. 98E-06 1. 43 (0. 25~14. 65) -24509527 I TPR3 I VS35 +103G/ A - 132 35 5 172 0. 13 283 70 7 360 0. 12 0. 88 (0. 59~1. 32) 0. 547 0. 90 (0. 57~1. 43) 0. 655 0. 66 (0. 18~2. 69) 0. 53724511130 I TPR3 I VS39 +160A/ G - 115 48 9 172 0. 19 234 112 14 360 0. 19 1. 02 (0. 73~1. 43) - 1. 09 (0. 73~1. 63) 0. 697 0. 73 (0. 29~1. 96) 0. 49824513423 I TPR3 I VS45 +69T/ C - 106 57 9 172 0. 22 166 157 33 356 0. 31 1. 63 (1. 20~2. 24) 0. 0013 1. 84 (1. 25~2. 71) 0. 0015 1. 85 (0. 84~4. 50) 0. 12424513978 I TPR3 I VS46 +387G/ C - 140 28 3 171 0. 10 291 61 3 355 0. 09 0. 94 (0. 60~1. 51) 0. 823 0. 99 (0. 61~1. 65) - 0. 48 (0. 06~3. 61) 0. 39624514500 I TPR3 I VS48 +42C/ T - 129 35 7 171 0. 14 253 96 9 358 0. 16 1. 13 (0. 78~1. 66) 0. 525 1. 27 (0. 83~1. 99) 0. 299 0. 60 (0. 20~1. 95) 0. 41524515100 I TPR3 I VS49 +292T/ C - 124 40 8 172 0. 16 247 102 10 359 0. 17 1. 05 (0. 74~1. 52) 0. 793 1. 17 (0. 77~1. 79) 0. 480 0. 59 (0. 20~1. 75) 0. 30724515219 I TPR3 I VS49 +411A/ G - 117 44 10 171 0. 19 229 114 16 359 0. 20 1. 11 (0. 79~1. 56) 0. 565 1. 23 (0. 82~1. 85) 0. 329 0. 75 (0. 31~1. 90) 0. 52124517722 I TPR3 Exon 53 7038G/ C Val2436Leu 129 35 7 171 0. 14 253 97 9 359 0. 16 1. 14 (0. 78~1. 68) 0. 525 1. 29 (0. 84~2. 00) 0. 255 0. 60 (0. 20~1. 94) 0. 41524520545 I TPR3 I VS54 +250C/ G - 122 37 9 168 0. 16 236 107 15 358 0. 19 1. 21 (0. 85~1. 74) 0. 305 1. 37 (0. 90~2. 10) 0. 133 0. 77 (0. 31~2. 05) 0. 65424537846 C6orf125 5' fl anki ng -92C/ A - 121 41 9 171 0. 17 231 110 16 357 0. 20 1. 19 (0. 84~1. 70) 0. 316 1. 32 (0. 88~2. 00) 0. 200 0. 84 (0. 34~2. 22) 0. 66824538057 C6orf125 5' fl anki ng -303A/ G - 167 4 1 172 0. 02 343 16 1 360 0. 03 1. 44 (0. 54~4. 49) 0. 514 1. 65 (0. 57~5. 83) 0. 485 0. 48 (0. 01~37. 61) 0. 54324553380 I HPK3 I VS3 +734G/ A - 102 54 14 170 0. 24 153 163 42 358 0. 34 1. 66 (1. 23~2. 25) 0. 00064 2. 01 (1. 36~2. 97) 0. 00027 1. 48 (0. 76~3. 03) 0. 28924602897 LEMD2 I VS8 +4092C/ T - 160 11 0 171 0. 03 332 26 0 358 0. 04 1. 13 (0. 53~2. 57) 0. 859 1. 14 (0. 53~2. 62) 0. 856 - - -
Ami no aci dchange
Nucl eoti dechange
GenotypeGenotype 11+12 versus 22Case Control Al l el e 1 versus Al l el e 2 Genotype 11 versus 12+22
Supplementary Table 1 Summery of the case-control association analysis of representative SNPs around ITPR3 locus
MAF, minor allele frequency. CI, confidence interval
![Page 2: Supplementary Table 1 Summery of the case-control association analysis of representative SNPs around ITPR3 locus MAF, minor allele frequency. CI, confidence](https://reader036.vdocuments.mx/reader036/viewer/2022082510/5a4d1b787f8b9ab0599b80e3/html5/thumbnails/2.jpg)
DRB1*0101 16 0.046 46 0.063 0.71 (0.37-1.31) 2.7E-01DRB1*0301 0 0.000 2 0.003 0.00 (0-11.11) 1.0E+00DRB1*0401 6 0.017 12 0.016 1.04 (0.32-3.03) 1.0E+00DRB1*0403 8 0.023 26 0.036 0.63 (0.25-1.46) 3.5E-01DRB1*0404 0 0.000 2 0.003 0.00 (0-11.11) 1.0E+00DRB1*0405 40 0.114 88 0.121 0.94 (0.62-1.42) 8.4E-01DRB1*0406 9 0.026 25 0.034 0.74 (0.3-1.67) 5.8E-01DRB1*0407 2 0.006 4 0.005 1.04 (0.09-7.32) 1.0E+00DRB1*0410 12 0.034 8 0.011 3.20 (1.19-9.11) 1.4E-02DRB1*0701 0 0.000 1 0.001 0.00 (0-81.24) 1.0E+00DRB1*0802 25 0.071 24 0.033 2.26 (1.22-4.2) 7.2E-03DRB1*0803 35 0.100 62 0.085 1.20 (0.75-1.88) 4.3E-01DRB1*0901 63 0.180 98 0.134 1.42 (0.98-2.03) 5.5E-02DRB1*1001 0 0.000 8 0.011 0.00 (0-1.22) 6.0E-02DRB1*1101 6 0.017 20 0.027 0.62 (0.2-1.62) 4.0E-01DRB1*1108 0 0.000 1 0.001 0.00 (0-81.24) 1.0E+00DRB1*1201 13 0.037 31 0.042 0.87 (0.41-1.74) 7.4E-01DRB1*1202 4 0.011 12 0.016 0.69 (0.16-2.3) 6.0E-01DRB1*1301 1 0.003 4 0.005 0.52 (0.01-5.28) 1.0E+00DRB1*1302 12 0.034 29 0.040 0.86 (0.39-1.76) 7.4E-01DRB1*1401 15 0.043 17 0.023 1.88 (0.86-4.05) 8.5E-02DRB1*1403 2 0.006 14 0.019 0.29 (0.03-1.29) 1.1E-01DRB1*1405 5 0.014 8 0.011 1.31 (0.33-4.57) 7.7E-01DRB1*1406 2 0.006 10 0.014 0.41 (0.04-1.96) 3.6E-01DRB1*1501 54 0.154 51 0.070 2.43 (1.58-3.72) 2.4E-05DRB1*1502 15 0.043 97 0.133 0.29 (0.16-0.52) 1.9E-06DRB1*1602 3 0.009 6 0.008 1.04 (0.17-4.92) 1.0E+00
HLA-DRB1
Supplementary Table 2 Case-control association study between HLA-DRB1 allele and SLE
c.i., confidence interval. n (%), number of alleles and its frequency.
Odds ratio(95% c.i.) p -valuen (%) n (%)
Case Control
![Page 3: Supplementary Table 1 Summery of the case-control association analysis of representative SNPs around ITPR3 locus MAF, minor allele frequency. CI, confidence](https://reader036.vdocuments.mx/reader036/viewer/2022082510/5a4d1b787f8b9ab0599b80e3/html5/thumbnails/3.jpg)
B*0702 29 0.083 45 0.062 1.37 (0.82-2.29) 2.0E-01B*0705 1 0.003 0 0.000 Inf (0.05-inf) 3.2E-01B*1301 3 0.009 7 0.010 0.89 (0.15-3.94) 1.0E+00B*1501 29 0.083 40 0.055 1.56 (0.91-2.63) 8.4E-02B*1507 1 0.003 7 0.010 0.30 (0.01-2.32) 4.5E-01B*1511 5 0.014 6 0.008 1.75 (0.42-6.93) 3.5E-01B*1518 9 0.026 15 0.021 1.26 (0.48-3.1) 6.6E-01B*1527 0 0.000 1 0.001 0.00 (0-81.24) 1.0E+00B*1593 1 0.003 0 0.000 Inf (0.05-inf) 3.2E-01B*2704 0 0.000 2 0.003 0.00 (0-11.11) 1.0E+00B*3501 41 0.117 47 0.064 1.93 (1.21-3.06) 4.2E-03B*3701 0 0.000 7 0.010 0.00 (0-1.44) 1.0E-01B*3801 0 0.000 1 0.001 0.00 (0-81.24) 1.0E+00B*3802 2 0.006 2 0.003 2.09 (0.15-28.95) 6.0E-01B*3901 16 0.046 21 0.029 1.62 (0.78-3.3) 1.6E-01B*3902 3 0.009 0 0.000 Inf (0.86-inf) 3.4E-02B*3904 1 0.003 1 0.001 2.09 (0.03-163.98) 5.4E-01B*4001 17 0.049 44 0.060 0.80 (0.42-1.45) 4.8E-01B*4002 27 0.077 48 0.066 1.19 (0.7-1.98) 5.2E-01B*4003 4 0.011 3 0.004 2.80 (0.47-19.21) 2.2E-01B*4006 25 0.071 45 0.062 1.17 (0.68-1.99) 6.0E-01B*4402 1 0.003 2 0.003 1.04 (0.02-20.1) 1.0E+00B*4403 10 0.029 40 0.055 0.51 (0.22-1.05) 6.3E-02B*4601 17 0.049 28 0.038 1.28 (0.65-2.46) 4.2E-01B*4701 0 0.000 1 0.001 0.00 (0-81.24) 1.0E+00B*4801 11 0.031 19 0.026 1.21 (0.52-2.72) 6.9E-01B*5101 30 0.086 55 0.075 1.15 (0.7-1.87) 5.5E-01B*5102 0 0.000 2 0.003 0.00 (0-11.11) 1.0E+00B*5201 26 0.074 98 0.134 0.52 (0.32-0.82) 4.1E-03B*5401 22 0.063 68 0.093 0.65 (0.38-1.09) 1.0E-01B*5502 14 0.040 22 0.030 1.34 (0.63-2.78) 4.7E-01B*5504 0 0.000 2 0.003 0.00 (0-11.11) 1.0E+00B*5601 4 0.011 10 0.014 0.83 (0.19-2.91) 1.0E+00B*5603 2 0.006 3 0.004 1.39 (0.12-12.21) 6.6E-01B*5801 1 0.003 4 0.005 0.52 (0.01-5.28) 1.0E+00B*5901 5 0.014 19 0.026 0.54 (0.16-1.52) 2.7E-01B*6701 6 0.017 10 0.014 1.26 (0.37-3.85) 7.9E-01
Case Control Odds ratio(95% c.i.)n (%) n (%)HLA-B
Supplementary Table 3 Case-control association study between HLA-B allele and SLE
p -value
c.i., confidence interval. n (%), number of alleles and its frequency.
![Page 4: Supplementary Table 1 Summery of the case-control association analysis of representative SNPs around ITPR3 locus MAF, minor allele frequency. CI, confidence](https://reader036.vdocuments.mx/reader036/viewer/2022082510/5a4d1b787f8b9ab0599b80e3/html5/thumbnails/4.jpg)
SLE, Systemic lupus erythematosus RA, Rhematoid arthritis. CI, confidence interval. n, number of individuals. aOdds ratio and p-value were calculated on dominant model (TT + CT versus CC).
Supplementary Table 4 Association of the SNP(1192C>T) of NKX2.5 with SLE and RA
Genotype
Disease n TT CT CC Allele T frequency Odds ratio a(95% c.i.) p -value
SLE 174 3 38 133 0.13 1.74 (1.19-2.55) 0.0037RA 1115 12 189 914 0.10 1.24 (1.01-1.54) 0.042Control 1415 10 204 1211 0.08
![Page 5: Supplementary Table 1 Summery of the case-control association analysis of representative SNPs around ITPR3 locus MAF, minor allele frequency. CI, confidence](https://reader036.vdocuments.mx/reader036/viewer/2022082510/5a4d1b787f8b9ab0599b80e3/html5/thumbnails/5.jpg)
ITPR3 NKX2.5rs3748079(-1009C>T)
rs3095870(-1192C>T) SLE RA Control Odds ratioa 95% C.I. Odds ratioa 95% C.I.
CT+TT CC 21 271 408CT+TT CT+TT 3 52 85 0.69 (0.20-2.35) 0.92 (0.63-1.34)CC CC 112 641 796 2.73 (1.69-4.42) 1.21 (1.01-1.46)CC CT+TT 38 149 128 5.77 (3.17-10.19) 1.75 (1.32-2.32)
sum 174 1113 1417
SLE RA
Supplementary Table 5. Combinatorial effect of SNP (-1009C>T) of ITPR3 and SNP (-1192C>T) of NKX2.5 onSLE and RA susceptibility.
SLE, Systemic lupus erythematosus RA, Rhematoid arthritis. CI, confidence interval. a Odds ratio wascalculated in each group compared with that in control group (those with no disease susceptible genotype).
![Page 6: Supplementary Table 1 Summery of the case-control association analysis of representative SNPs around ITPR3 locus MAF, minor allele frequency. CI, confidence](https://reader036.vdocuments.mx/reader036/viewer/2022082510/5a4d1b787f8b9ab0599b80e3/html5/thumbnails/6.jpg)
Amplified region a Forward primer Reverse primer-1015 to -999 Allele C Tandem TGGGCACCCTATCTTAGGTGGGCACCCTATCTTAGGT ACCTAAGATAGGGTGCCCACCTAAGATAGGGTGCCCA-1015 to -999 Allele T Tandem TGGGCACTCTATCTTAGGTGGGCACTCTATCTTAGGT ACCTAAGATAGAGTGCCCACCTAAGATAGAGTGCCCA
Probe Sense Antisense-1015/-999 Allele C GGGCACCCTATCTTAGG CCTAAGATAGGGTGCCC-1015/-999 Allele T GGGCACTCTATCTTAGG CCTAAGATAGAGTGCCCNKX2.5 consensus CTGACCTCAAGTGATCTACC GGTAGATCACTTGAGGTCAG
Amplified region a Forward primer Reverse primer-1153 to -930 CCCCTAGCCTCTCTTCTTCC GGGCTCGCTTACTTTCTGTTCIVS6 +229 to +346 AAGACACCCTGTCCTTGTGC TGCGGAAGGGTGACAAGAC
Target gene Forward primer Reverse primerITPR3 CCACCATGAAGCTGGTGTC TGATGAGCATCCCCTGTTGß2MG TCTCTCTTTCTGGCCTGGAG AATGTCGGATGGATGAAACCHPRT CACTGGCAAAACAATGCAGACT GTCTGGCTTATATCCAACACTTCGT
a: Based on the reference sequence NCBI NT_007592.14
Primers used for quantification of target genes
Primers used for CHIP assay
Oligonucleotides used for EMSA
Primers used for constructing reporter plasmids
Supplementary Table 6 Sequences of oligonucleotides