190 Biochimica et Biophysica Acta, 1172 (1993) 190-192 Elsevier Science Publishers B.V.

BBAEXP 90454 Short Sequence-Paper

Structure of the human apolipoprotein D gene promoter region

Jacques Lambert a, Pierre R. Provost a, Yves L. Marcel b and Eric Rassart ~

a D~partement des Sciences Biologiques, Unit,ersit~ du Quebec h Montreal, Montreal (Canada) and ~ Laboratory of Lipoprotein Metabolism, Institut de Recherches Cliniques de Montreal, Montreal (Canada)

(Received 18 September 1992)

Key words: Regulatory element; Steroid hormone; Z-DNA

A human genomic clone of 18.2 kbp encompassing the apolipoprotein D (apoD) exon-1 and 2 and 10 kbp of upstream sequence was isolated and characterized. DNA sequencing and primer extension analysis revealed a transcriptional initiation site located 27 bp downstream of a consensus TATA box sequence. The exon 1 was 66 bp long. Computer analysis of DNA sequence from positions - 557 to + 129 revealed some putative transcriptional regulatory elements including a stretch of (pyrimidine/purine)2~ , located from nucleotide -263 to nucleotide -212, which could potentially form Z-DNA. Steroid hormone regulatory elements were identified which may be related to the modulation of apoD genc expression by androgens and estrogens in vitro.

Apolipoprotein D (apoD) is a member of the lipocalin superfamilly [1] and was first discovered in the human plasma where it is mainly associated with high density lipoproteins (HDL) [2-5]. ApoD binds pregnenolone, progesterone and bilirubin in several in vitro analyses [6-8] and it is the progesterone-binding component of human breast-gross-cystic-disease fluid (also named GCDFP-24) [9,10].

ApoD gene expression appears to be regulated at different levels. The apoD m R N A varies from organ to organ [3,11], is cell type specific [12-14], and seems to be transcriptionaly inducible since its amount increases over 40-fold in regenerating rat sciatic nerve [15,16]. In addition, levels of apoD secreted by human cancer cell lines vary under the influence of steroids [10,17] and recently, we showed that apoD m R N A levels increased specifically in growth arrested fibroblasts and senes- cent cultures [20]. These data indicate a high level of complexity in the control of apoD expression. We report here the sequence organization of the apoD gene 5' flanking region.

Correspondence to: E. Rassart, D6partement des Sciences Bio- logiques, Universit~ du Quebec ~ Montreal, Case Postale 8888 Succ. A, Montreal, Quebec, Canada H3C-3P8. The sequence data reported in this paper have been submitted to the EMBL/Genbank Data Libraries under the accession number Z12121. Abbreviations: apoD, apolipoprotein D; HDL, high density lipopro- teins; GCDFP, gross-cystic-disease-fluid protein; ERE, estrogen re- sponsive element; GRE, glucocorticoid responsive element; PRE, progesterone responsive element; TGF/3, transforming growth factor /31; T/3IE, TGF/3 inhibitory element.

A 155 bp E c o R I - H p a I I restriction fragment in the 5' portion of the human apoD cDNA [3] was used to screen an EMBL-3 human genomic library of placental DNA. Two positive clones were obtained. One of them (named HapoD18) was scored positive when probed with a 32p-end-labelled 27-met synthetic oligonucleo- tide (corresponding to exon-1). A restriction map of the 18.2 kbp HapoD18 clone was established (data not shown) and a 1829 bp SacI-BglI fragment was sub- cloned in the bluescript vector (pexlSB). Southern blot analysis of human genomic D N A and HapoD18 DNA, which were digested with the same restriction enzymes, were performed and compared. Hybridization with the exlSB probe revealed no significant differences in length between restriction fragments generated from the two D N A sources indicating that HapoD18 con- tains the 5' region of the human apoD gene (data not shown). Both strands of pexlSB were sequenced (Fig. 1). The SacI-BglI insert contains 1176 bp of the 5' flanking region, the exon 1, and 650 bp of the intron 1 (only 61 bp of the intron 1 are shown in Fig. 1).

The T A T A box is generally located about 30 bp upstream of the transcription start site in eukaryotic promoters. Drayna and his colleges [1,3] have reported an exon I of at least 27 bp. We found a perfect homology for the last 23 bp of this sequence 71 bp downstream of a typical T A T A box in our genomic clone HapoD18. The first four nucleotides have possi- bly been added during cDNA cloning. To determine the apoD transcription start site, we performed a primer extension assay. An antisense synthetic 19-mer oligonucleotide corresponding to the 3' end of exon-1 was 5' end-labelled with [7-32P]ATP and T4 polynu-

-1176 GAGCTCTTAGGGGAGGGCAGCACAGGAGGTCAGCGAGAGGCAGGCCCTGG ERE

-1126 GTGGTAGTAGGAATTTCTTATGTTTCTGAAAAGGCAAAGAACATCTTAAA -1076 ~AGCGCTCACAACGTTTGGGATGTTACGGATCTGTGTTGTTGTTTTCA -1026 TGTTTATAGACTCAGTGCTGTAAATGTATCTCTGTTGCTTACATATTTTA -976 GAATGAATTTCATTTAGGAGTCTAAGTCTACTACGAAGGCACTGCCTTAT -926 CTAAATGTCTCTAAACATACCTCCTGCCTATCACAAAGACATAGAATCTC -876 ACTCACAAGAGTCAAAGTTGTTCATTCCACCAGGAGAGATAAGGCTGGAC

SDR -826 CAAAAGCACCCCTGGGTTTAAGTCCACACTCCCCACCACCCCGGCCCCCA -776 CCCCCAAGCAGTGACAGACTGTCTTGAACTCTCTCGCTGCAAGGGTCATA

ERE -726 AAAGGGACAGAGAACAGAGCGACAGAAGATGTCTTCTGCATTCTCAACTT

APRE-3 FSE -676 TTAGCCCCAGTTGTTAGAGAACTGGTATCTCCCCTACACGTCTQGCTCTG -626 GTGGAGAAAGAATGACAGCCCCTACTTACAACGAGGAGACTGTGGCTCAG

AP-I -576 AGAAGTTAGGGGGCTGCCCAGGATCCTGGAGAAAGCCAGCTTTGACTCAT

GRE -526 AACCCTCGCGCCATTACCTGACTCCCATTAGTGGAGTCAGGAACTCCATG -476 TTCCACTTCAGGAAATGAGCTTGTTGATTTTTCATTTACACAAAAATGAA

APRE-2 -426 AAATA2~TACCACATGTTTGAAAACATGTTGCAACACGTCCTGCTGGAAC

ERE APKE-2 -376 TTAAAAGTGCATTCTGACCAAAAAAATTAAATTAGAAAATCCACATAGCA -326 AAAAAAAAAATGTTTTGGATGAAAATATACTTTATCTTTCTCTCACACAT

APP -276 ACTCTCTCTCTCTCTCGCACACATACCCACACACACACACACACACACAC

PKE -226 ACACACACACACGCGCGAAAACAATATCTQATTTCTTCTT¢AGGGAGCAG

PRE -176 CTGTGAAGGAAATCGGGGGAGGAGGATGGACACAACATCCCATCTTTGTG -126 TTTCGATACAGACTAAGCTTTTAGGCCAACCCTCCTGACTGGATGGGGGC

GC BOX -76 GGCGGGCGTGGCATGCATGAAAAGTAAACATCAGAGACCTGAAGAAGCT~

TATA BOX +i T~IE -26 ATAAAATAGCTTGGGAGAGGCCAGTC A(~.~.C.~.AGGC~TCTC&&~TCG +24 C~ATTCTGCATCTGGAR.%ETGCCTTCATCTTGAR~%C, AAAAG GTATGT +74 ACTGTAGTTTTAAGCTTTTCATTTATGATAATAATGTCTAAAATAGAAAC

+124 AGTCT

Fig. 1. Nucleotide sequence of the promoter region of the human apoD gene. Nucleotides corresponding to exon-1 are in bold-face type beginning at the transcriptional initiation site which is defined as + 1; upstream nucleotides have negative numbers. The putative regulatory elements and the alternating purine/pyrimidine ([A/G][T/C])n stretch (APP) are underlined. Their names are indi-

cated above the sequence.

cleotide kinase (Pharmacia) and annealed to 1 /zg of human cerebellum poly(A) + RNA for 5 min at 95°C and then 6 h at 25°C in 5 p~l of 60% formamide/0.4 M NaC1/1 mM EDTA/40 mM Pipes (pH 6.4). The hy- bridization mixture was diluted in 45 ~zl of extention buffer (50 mM Tris-C1 (pH 7.6)/60 mM KC1 10 mM MgC12/1 mM of each dNTP/1 mM DTT) and incu- bated for 2 h at 37°C [22] with 50 U of MMLV reverse transcriptase (Pharmacia) and 25 U of RNase inhibitor (Pharmacia). The extension products were separated on a 10% polyacrylamide-urea gel. As shown in Fig. 2, three primer extension products were obtained, the co-electrophoresed sequence allowed us to identify the largest product (65-67 bases long) as C-A-C. This corresponds to the Py-A-Py stretch found in most eukaryotic transcription initiation sites, the A being the capping site. We have thus chosen the A of the C-A-C stretch as the transcription start site. This higher molecular weight product ended 27 bp downstream of the TATA box (Fig. 1). The other extension products are probably incomplete extention products. The tran- scription start site was confirmed by RNase protection assay (data not shown).

In addition to the T A T A box, the human apoD gene 5' flanking region contains two GC boxes at nt - 8 3 and - 7 6 (consensus: 5'-KRGGCGKRRY-3') which are candicate for binding the SP-1 transcription factor

191

[19]; the transforming growth factor /31 (TGF/3) can stimulate transcription through the AP-1 site located at nt -537 (5'-CTGACTCA-Y) [20]; TGF/3 can also in- hibit transcription through the TGF/3 inhibitory ele- ment (T/3IE; 5'-GNNTTGGTGA-Y) [21] which was found to overlap the 5' end of the apoD exon-1 from nucleotides - 2 to + 8. Since the apoD expression is possibly controled by steroid hormones [10,17] it is interesting to find responsive elements for estrogen

1 I~

A A C G T ~

•

I ~ b . - -

Fig. 2. Primer extension analysis of the human apoD transcriptional initiation site. Panel 1: primer extended products from human cere- bellum poly(A) ÷ RNA primed with 5'-32p end-labelled 19-mer synthetic antisense oligonucleotide corresponding to the 3' end of exon-1 (5'-CTTTTCTIq'CAAGATGAAG-Y). Lane A: nucleotide sequence of the pexlSB subclone with ddA using the same primer and electrophoresed with the primer extension product (14 days exposure). Panel 2: Nucleotide sequence of the exlBX using the

same primer (lanes A, C, G and T).

192

(ERE; 5'-KGTCANNNTGTYCT-3') [22], proges- terone (PRE; 5'-ATCYYATI'WTCTGKTTGTA-3') [23], and glucocorticoids (GRE; 5'-GGTACANN- NTGTTCT-3') [24]. Putative acute phase responsive elements (APRE-2; 5'-WTMTGGGAW-3' and APRE- 3; 5'-AACAGGGGCTAA-3') [25] were also found in the 5' flanking region of apoD gene (Fig. I). These elements might be involved in the increase of apoD mRNA and consequently of protein levels in regenerat- ing rat sciatic nerve [13]. In addition, a sterol depen- dent repressor (SDR; 5'-GTGMGGTG-3') [26] is lo- cated at position -795. The putative fat-specific ele- ment (FSE; 5'-GGCWCTGGTCAKG-3') found at po- sitions - 6 3 5 is common to the 5' flanking regions of several genes whose transcription increases during adipocyte differentiation [27]. Moreover, the apoD gene 5' flanking region contains an alternating purine- pyrimidine strech (APP) extending from positions - 263 to -212. Such a sequence has been shown to adopt a Z-DNA conformation in vitro [28]. Z-DNA structure has been associated with the activation [29] and repres- sion [30] of gene expression in mammalian cell tran- sient expression assays. The functional significance of these potential transcription factor binding sites is cur- rently under investigation.

We thank Dr. Dennis Drayna (Genentech) for giv- ing the cAPOD.6 plasmid and a 27-mer synthetic oligo- nucleotide derived from the sequence of exon-1 and Dr. Jacques Simard (CHUL Research Centre) for giv- ing access to unpublished data. We thank Dr. Ross Milne (IRCM) and Philip Weech (Merck Frosst Canada) for helpful discussions. We also thank Nicole Couture and Marc Desforges for their technical assis- tance. This study was supported by grant from the Medical Research Council of Canada (grant MT-9880). J.L. and P.R.P. were supported by studentships from the Fonds pour la Formation de Chercheurs et l'Aide ~ la Recherche du Qu6bec and from the Canadian Heart Foundation, respectively.

References

1 Drayna, D.T., McLean, J.W., Wion, K.L., Trent, J.M., Drabkin, H.A. and Lawn, R.M. (1987) DNA 6, 199-204.

2 McConathy, W.J. and Alopovic, P. (1973) FEBS Lett. 37, 178-182.

3 Drayna, D., Fielding, C., Mclean, J., Baer, B., Castro, G., Chen, E., Comstock, L., Henzel, W., Rhee, L., Wion, K. and Lawn, R. (1986) J. Biol. Chem. 261, 16535-16539.

4 Weech, P.K., Camato, R., Milne, R.W. and Marcel, Y.L. (1986) J. Biol. Chem. 261, 7941-7951.

5 Albers, J.J., Cheung, M.C., Ewens, S.L. and Tollefson, J.tt. (1981) Atherosclerosis 39, 1-65.

6 Lea, O.A. (1988) Steroids 52, 337-338. 7 Peitsch, M.C. and Boguski, M.S. (1990) New Biol. 2, 197-206. 8 Dilley, W.G., Haagensen, D.E., Cox, C.E. and Wells, S.A. (1990)

Breast Cancer Res. Treat. 16, 253-260. 9 Balbin, M., Freije, J.M.P., Fueyo, A., Sanchez, L.M. and Lope-

zotin, C. (1990) Biochem. J. 271,803-807. 10 Simard, J., Dauvois, S., Haagensen, D.E., L6vesque, C., M6rand,

Y. and Labrie, F. (1990) Endocrinology 126, 3223-32331. 11 Provost, P.R., Weech, P.K., Tremblay, N,M., Marcel, Y.L. and

Rassart, E. (1990) J. Lipid Res. 31, 2057-2065. 12 Smith, K.M., Lawn, R.M. and Wilcox, J. (1990) J. Lipid Res. 31,

995-1004. 13 Boyles, J.K., Notterpek, L.M., Wardell, M.R. and Stanley, C.R.

Jr. (1990) J. Lipid Res. 31, 2243-2256. 14 Provost, P.R., Villeneuve, L., Weech, P.K., Milne, R.W., Marcel,

Y.L. and Rassart, E. (1991) J. Lipid Res. 32, 1959-1970. 15 Spreyer, S., Schaal, H., Kuhn, G., Rothe, T., Unterbeck, A.,

Olek, K. and Muller, H,W. (1990) EMBO J. 9, 2479-2484. 16 Boyles, J.K., Notterpek, L.M. and Anderson, L.J. (1990) J. Biol.

Chem. 265, 17805-17815. 17 Simard, J., Veilleux, R., De!aunoit, Y., Haagensen, D.E. and

Labrie, F. (1991) Cancer Res. 51, 4336-4341. 18 Provost, P.R., Marcel, Y.L., Milne, R.W., Weech, P.K. and Ras-

sart, E. (1991) FEBS Lett. 290, 139-141. 19 Briggs, M.R., Kadonaga, J.T., Bell, S.P. and Tjian, R. (1986)

Science 234, 47-52. 20 Kim, S.J., Angel, P., Lafyatis, R., Hattori, K., Sporn, M.B., Karin,

M. and Roberts, A.B. (1990) Mol. Cell. Biol. 10, 1492-1497. 21 Locker, J. and Buzard, G. (1990) J. DNA Sequencing Mapping 1,

3-11. 22 Maurer, R.A. and Notides, A.C. (1987) Mol. Cell. Biol. 7, 4247-

4254. 23 Mulvilhill, E.R., LePennec, J.-P. and Chambon, P. (1982) Cell 24,

621-632. 24 Evans, R.E. (1988) Science 240, 889-895. 25 Boxer, L.M, Prywes, R., Roeder, R. and Kedes, L. (1989) Mol.

Cell. Biol. 9, 515-522. 26 Osborne, T.F., Gil, G., Goldstein, J.L. and Brown, M.S. (1988) J.

Biol. Chem. 263, 3380-3387. 27 Hunt, C.R., Ro, J.H.-S., Dobson, D.E., Min, H.Y. and Speigel-

man, B.M. (1986) Proc. Natl. Acad. Sci. USA 83, 3786-3790. 28 Rich, A., Nordheim, A. and Wang, A.H.-J. (1984) Annu. Rev.

Biochem. 53, 791-846. 29 Hamada, H., Seidman, M., Howard, B. and Goodman, C.M.

(1984) Mol. Cell. Biol. 4, 2622-2630. 30 Gilmour, R.S., Spandidos, D.A., Vass, J.K., Gow, J.W. and Paul,

J. (1984) EMBO J. 3, 1263-1272.