structure and evolution of the humansprr3gene: implications for function and regulation

eeaatsptttrsa(tAir©

c(gt(catso

E

M

oR7

Genomics 55, 88–99 (1999)Article ID geno.1998.5622, available online at http://www.idealibrary.com on

0CA

Structure and Evolution of the Human SPRR3 Gene:Implications for Function and Regulation

David F. Fischer, Murielle W. J. Sark, Marika M. Lehtola, Susan Gibbs,1

Pieter van de Putte, and Claude Backendorf2

Laboratory of Molecular Genetics, Leiden Institute of Chemistry, Leiden University, P.O. Box 9502, 2300 RA Leiden, The Netherlands

Received July 22, 1998; accepted October 12, 1998

gitpancdSaleAprtnetu1ib1ppdo1i1rma

issvet(

SPRR3, a member of the SPRR family of cornifiednvelope precursor proteins, is expressed in oral andsophageal epithelia, where it is strictly linked to ker-tinocyte terminal differentiation. This gene is char-cterized by intragenic duplications that have createdhe characteristic proline-rich repeats in the codingequence, an alternative noncoding exon, and a 200-bpolypyrimidine tract in the promoter region. Muta-ional analysis of the promoter region and transientransfection in normal human keratinocytes showedhat in addition to the polypyrimidine tract, multipleegulatory elements are involved in differentiation-pecific expression. These elements include a high-ffinity Ets binding site bound by ESE-1, an AP-1 siteTRE) recognized by the Jun/Fos family of transcrip-ion factors, and an ATF/CRE bound by Jun/Fos andTF factors. The repositioning of the SPRR3 Ets bind-

ng site during evolution has a major effect on theelative contribution of this site to promoter activity.1999 Academic Press

INTRODUCTION

The small proline-rich proteins constitute a spe-ific class of cornified envelope (CE) precursorsSteinert and Marekov, 1995) encoded by a multi-ene family clustered within the epidermal differen-iation complex (EDC) at human chromosome 1q21Gibbs et al., 1993; Mischke et al., 1996). The locusontains two SPRR1 genes, seven SPRR2 genes, andsingle SPRR3 gene. The head and tail domains of

he SPRR proteins are homologous to the corre-ponding domains of loricrin and involucrin, twother cornified envelope precursors encoded by single

Sequence data from this article have been deposited with theMBL/GenBank Data Libraries under Accession No. AF077374.

1 Present address: Department of Dermatology, Leiden Universityedical Center, 2300 RC Leiden, The Netherlands.2 To whom correspondence should be addressed at the Laboratory

f Molecular Genetics, Gorlaeus Laboratories, P.O. Box 9502, 2300A Leiden, The Netherlands. Telephone: (31) 71 527 4409. Fax: (31)1 527 4537. E-mail: [email protected].

88888-7543/99 $30.00opyright © 1999 by Academic Pressll rights of reproduction in any form reserved.

enes in the EDC (Backendorf and Hohl, 1992). Thenternal domains of these proteins are, however, dis-inct from the short proline-rich repeats of the SPRRroteins. The cornified envelope precursor proteinsre substrates for transglutaminases, forming a 15-m-thick protein envelope with intra- and interchainross-links, often involving loricrin, the most abun-ant constituent (Steinert and Marekov, 1995).PRRs have been found to connect only via their N-nd C-termini, thus forming cross-bridges betweenoricrin and the other CE precursor molecules (Stein-rt et al., 1998; Steinert and Marekov, 1995, 1997).lthough the sum of the percentage of the total CErotein mass of loricrin and SPRRs is constant, theatio varies greatly between tissues and is proposedo determine the biomechanical properties of the cor-ified envelope and consequently of the tissue (Stein-rt et al., 1998). Incorporation of different SPRRs inhe cornified envelope would be another way of mod-lating these biomechanical properties (Jarnik et al.,996; Kartasova et al., 1996). Whereas loricrin andnvolucrin are single genes, 10 different SPRRs haveeen described in human thus far (Gibbs et al.,993). The different SPRRs show highly specific ex-ression patterns (Hohl et al., 1995), and their ex-ression can be differentially affected when terminalifferentiation is modulated by natural, accidental,r disease-related causes (reviewed in Fischer et al.,996), in contrast to involucrin and loricrin, presentn most squamous epithelial tissues (Hohl et al.,993). For example, SPRR expression is down-egulated by carcinogenic transformation in epider-al, oral, and esophageal carcinomas (Abraham et

l., 1996; Lohman et al., 1997).In the SCC (squamous cell carcinoma) cell lines stud-

ed so far, SPRR3 expression appears to be the mosteverely affected of all SPRR genes, indicating that theignaling pathways involved in SPRR3 expression areery susceptible to oncogenic transformation (Lohmant al., 1997). The expression of SPRR3 in mucosal epi-helia (Hohl et al., 1995) and mouse forestomachSteinert et al., 1998), where great flexibility and

stS

lcupSdpwogprtmbef

wGog3

fias

ge1lpp

sipmaaptiHp

opat

rifpe(cc1

kp(sm0(ts2ms1tmM

t

89REGULATION OF THE HUMAN SPRR3 GENE

trength are required from the tissue, is likely relatedo its longer and less rigid structure compared to thePRR1 and SPRR2 proteins.Apparently, SPRR genes have diverged during evo-

ution not only to create proteins with variable biome-hanical properties, but also to target these gene prod-cts to specific epithelial sites. We have previouslyroposed a model for the evolutionary origin of thePRR genes (Gibbs et al., 1993) and showed that afteruplication of an ancestral SPRR gene, intergenic du-lications have prevailed among the SPRR2 genes,hereas intragenic duplications in the internal domainf the protein have been predominant in the SPRR3ene. How evolution has shaped the specific expressionatterns of this gene family is not yet known. It iseasonable to assume that analysis and comparison ofhe promoter sequences of the various SPRR genesight reveal at least some of the processes that have

een operative during evolution to create the typicalxpression patterns that are characteristic of this geneamily.

MATERIALS AND METHODS

Cell culture. Primary cultures of human epidermal keratinocytesere initiated in complete medium as described by Rheinwald andreen (1975) with minor modifications (Ponec et al., 1981). Keratin-

cytes were isolated from foreskin derived from circumcision andrown in the presence of a layer of lethally 137Cs-irradiated mouseT3 fibroblasts.

Transient transfections and CAT assay. Transfections were per-ormed as described previously (Fischer et al., 1996). Chloramphen-col acetyltransferase activity was measured according to Purschkend Muller (1994) using [3H]sodium acetate (ICN) in a Fluor Diffu-ion Assay (Neumann et al., 1987).

Genomic library screening and sequence analysis. A l EMBL3enomic library of human chromosomal DNA, isolated from periph-ral blood from a male CML patient, with an initial complexity of 2 306 was a generous gift from Dr. G. Grosveld, Rotterdam. From thisibrary a total of 250,000 plaques were screened with a SPRR1 cDNArobe (No. 15B) (Kartasova and van de Putte, 1988). Of the twoositive clones one was identified as containing SPRR1A, while the

TAB

Sequences of Oligonucle

Name Gene

First exon SPRR3Third exon SPRR3AP-1 SPRR3ATF SPRR3AP-11ATF SPRR3Ets wildtype SPRR3Ets mut 275 SPRR3wt2/3 SPRR2Amut 148 SPRR2Amut 212 SPRR2Apea3 Polyomavirus255 region SPRR3255 mut 469 SPRR3

Note. Oligonucleotides used in electrophoretic mobility shift assayso create blunt-ended substrates.

econd clone contained the SPRR3 gene. Subclones of the latter lnsert were sequenced by dideoxy sequencing. The wildtype SPRR3romoter construct pSG-209 contains a 1787-bp HindIII–BglII pro-oter fragment including the first exon cloned in pBLCAT5 (Jonat et

l., 1990). Mutants in the SPRR3 promoter were made by exonucle-se III digestion, Kunkel mutagenesis (Kunkel, 1985), PCR with Pwoolymerase (Boehringer Mannheim), or standard recombinant DNAechniques (Sambrook et al., 1989) and were all verified by sequenc-ng. Constructs pSG-363 to pSG-366 were made by fusing a 360-bpindIII/NheI fragment to different 59 ExoIII deletions. ConstructSG-354 is a RsaI/AflII deletion of 100 bp.

Nucleotide substitution calculations. The two-parameter methodf Kimura (1980) was used to calculate nucleotide substitutions: theroportion of transitional differences between the two sequences is Pnd the proportion of transversions is Q. The number of substitu-ions per nucleotide

K 512 ln S 1

1 2 2P 2 QD 114 ln S 1

1 2 2QD .

RT-PCR analysis. Total RNA (0.4 mg) was transcribed with AMVeverse transcriptase (HT Biotechnologies Ltd., Cambridge, UK) us-ng random hexanucleotides (Pharmacia) as primers. PCR was per-ormed for 20 cycles with 20 pmol of the first exon primer (Table 1,osition 21 relative to the transcriptional start site) and the thirdxon primer (Table 1, position 11281) each, with Taq polymeraseHT Biotechnologies). PCR products from a PCR with 35 cycles wereloned in pIC19H (Marsh et al., 1984) with a 59 T overhang. Fivelones containing the 70-bp product and five clones containing the50-bp product were sequenced.

Nuclear extracts and EMSA. Nuclear extracts were isolated fromeratinocytes grown to confluence in complete medium as describedreviously (Fischer et al., 1996). Electrophoretic mobility shift assaysEMSA/bandshifts) with the AP-1/TRE oligonucleotide (Table 1, po-ition 2176 to 2157) were performed in a 20-ml volume containing 5g nuclear extract in 10 mM Hepes, pH 7.9, 60 mM KCl, 1 mM DTT,.5 mM EDTA, 4% Ficoll-400, with 2 mg poly(dI–dC) z poly(dI–dC)Pharmacia) and 20 fmol end-labeled double-stranded oligonucleo-ide. After 30 min incubation at room temperature, the mixture wasubjected to electrophoresis on a 4% polyacrylamide gel, containing5 mM Tris-base, 190 mM glycine, 1 mM EDTA, 2.5% glycerol for 90in at 10 V/cm. The dried gel was exposed to X-ray film, which was

canned at 300 dots per inch using the NIH Image software (version.59b). Bandshifts with the ATF/CRE oligonucleotide (Table 1, posi-ion 2162 to 2143) were performed in a 20-ml volume containing 5g nuclear extract in 10 mM Hepes, pH 7.9, 60 mM KCl, 5 mMgSO4, 1 mM DTT, 0.5 mM EDTA, 4% Ficoll-400, with 2 mg poly(dI–

1

ides Used in this Study

Sequence 59 to 39

CACCAGATCCCAGAGGCTGAACACGAACTCATGCTTCAAAGGATCGGGACAGTGAGTCAGGCCCAGGCCCAGGTGACATCACTGTCGGACAGTGAGTCAGGCCCAGGTGACATCACTGTCCATGGTACTTCCTCCTAATTTACATGGTACCCCCTCCTAATTTAGGGTAGTTTCACTTCCTGCTGGGGTAGGGGCACTTCCTGCTGGGGTAGTTTCACTTTCAGCTGTCGAGCAGGAAGTTCGACGTAAAAAATCCAATTTTCTTAAGGCAGGGCTCATTTTCTATAAAAAAATCCAATTTCCTTAAGGCAGGGCTCATTTT

re annealed to their respective complementary strands (not shown)

LE

ot

we

dsB2eEddaaeq11fS1FSipr

fmiS(f(esueoS2stota(isyitsYipSiattAp

saicdntmatkaioeta

araIosactdstam1pd(

Sonibst(an3tarmtN1

et

90 FISCHER ET AL.

C) z poly(dI–dC) (Pharmacia) and 20 fmol end-labeled double-tranded oligonucleotide. Electrophoresis was as described above.andshifts with the Ets oligonucleotide (Table 1, position 2251 to230) were performed in a 20-ml volume containing 5 mg nuclear

xtract in 20 mM Hepes, pH 7.9, 50 mM KCl, 2.5 mM DTT, 0.1 mMDTA, 3% Ficoll-400, 20% glycerol, with 1 mg poly(dI–dC) z poly(dI–C) (Pharmacia) (Giovane et al., 1994) and 20 fmol end-labeledouble-stranded oligonucleotide. Electrophoresis was as describedbove. Oligonucleotides were labeled with T4 polynucleotide kinasend [g-32P]ATP (ICN), purified by denaturing polyacrylamide gellectrophoresis and reverse-phase chromatography, and subse-uently annealed to a twofold excess of the complementary strand in0 mM Tris–Cl, pH 7.5, 100 mM KCl, 1 mM MgCl2 by heating to00°C and slowly cooling to room temperature. Oligonucleotidesrom the SPRR1A and SPRR2A promoters have been described inark et al., (1998) and Fischer et al., (1996) and are shown in Table. Antibodies against cJun (N), JunB (N-17), JunD (329), cFos (4),osB (102), Fra-1 (R-20), Fra-2 (Q-20), and ATF-2 (C-19) were fromanta Cruz Biotechnology (Santa Cruz, CA). Antibodies and compet-

tor DNA were added to the EMSA reaction prior to addition of therobe and incubated for 2 h on ice and 5 min at room temperature,espectively.

RESULTS AND DISCUSSION

Exon/intron structure of SPRR3. A 3888-bp DNAragment, derived from the previously described hu-an genomic clone (Gibbs et al., 1993) and encompass-

ng the complete SPRR3 gene, is shown in Fig. 1.equence analysis of several SPRR3 cDNA clones

data not shown) and RT-PCR analysis of RNA isolatedrom oral mucosa, where SPRR3 is highly expressedHohl et al., 1995), and from in vitro-cultured humanpidermal keratinocytes revealed that alternativeplicing can occur. The primers and possible PCR prod-cts are depicted in Fig. 2A. Cultured keratinocytesxpressed mRNA either lacking or containing the sec-nd exon (Fig. 2B, lane 3), whereas oral mucosalPRR3 mRNA did not contain this exon (Fig. 2B, lane). RT-PCR products containing the second exon wereubcloned, and five clones were sequenced, revealinghat one clone contained the 153-bp fragment and thether four the 157-bp fragment, indicating that at leastwo of the three consecutive GT dinucleotides (Fig. 2A)re used as the 59 splice donor site of the second intronnote the diffuse band in lane 3, Fig. 2B). At present its not clear what the physiological significance of theecond, alternative exon is. Alternative splicing has notet been observed for the other SPRR genes nor fornvolucrin and loricrin, which all contain a single in-ron at approximately the same distance from the AUGtart codon (Eckert and Green, 1986; Gibbs et al., 1993;oneda et al., 1992), indicating that differential splic-

ng is a feature specific for the SPRR3 gene. The threeossible splice products containing the alternativePRR3 exon introduce an upstream AUG codon, which

s, however, in a poor initiation context (Kozak, 1987)nd which cannot encode a longer SPRR3 protein sincewo of the possible splice products are out of frame andhe third has a stop codon upstream of the regularUG at position 1274 (Fig. 1). The open reading framesresent in the alternative exon are short and do not

how homology to known proteins (data not shown). Inccordance with the scanning model for translationnitiation (Kozak, 1978), upstream initiation codonsan have a negative effect on translation from theownstream AUG (Kozak, 1984). Significantly, alter-ative splicing of late papillomavirus mRNAs in kera-inocytes has been shown to limit the expression of theajor capsid protein to the most terminally differenti-

ted cells (Barksdale and Baker, 1995). It is knownhat in in vitro cultures, terminal differentiation oferatinocytes does not proceed as far as in vivo (Leighnd Watt, 1994). Consequently, it is possible that thenclusion of the second exon in SPRR3 mRNA, whichccurs in the in vitro cultures and not in mucosalpithelium, restrains the expression of the SPRR3 pro-ein to the most differentiated cells. More experimentsre, however, required to confirm this hypothesis.Sequence comparison indicated that the complete

lternative second exon of SPRR3 with the flankingegions (Fig. 1, IR2, position 758 to 966) is conserved inn inverted orientation in the 39 UTR of SPRR3 (Fig. 1,R1, position 1931 to 2141). The overall identity is 87%ver 207 nucleotides. The same sequence is also con-erved in the 39 UTR of mouse (Steinert et al., 1998)nd rabbit SPRR3 (Austin et al., 1996) (Fig. 3), indi-ating that IR2 is the result of an intragenic duplica-ion event of IR1 in the 39 UTR. The fact that thisuplication is not found in the mouse SPRR3 geneuggests that the duplication occured after the split ofhe rodent and primate lineages. These duplicationsre rare in the human genome and have been identifiedainly in amplified genes (Nalbantoglu and Meuth,

986, and references therein). A model has been pro-osed for their generation, involving strand switchinguring DNA replication with looping out of one strandNalbantoglu and Meuth, 1986).

The approximate age of the duplication event inPRR3 can be determined by comparing the sequencesf human, mouse, and rabbit and determining theumber of nucleotide substitutions that have occured

n the two human DNA fragments of 207 bp. The num-er of transitions in IR1 is 9, the number of transver-ions is 7; for IR2 these values are 12 and 7, respec-ively. With the two-parameter method of Kimura1980), the numbers of substitutions per nucleotide Kre 0.082 for IR1 and 0.100 for IR2. If we assume aucleotide substitution rate for noncoding sequences of3 1029 per nucleotide per year (Maeda et al., 1983),

hen the duplication event could be at most between 27nd 33 Myr (million years) old, which is well after theodent–primate radiation, which occurred approxi-ately 80 Myr ago and probably after the separation of

he human and Old World monkey lineage from theew World monkey lineage at 35 Myr ago (Shen et al.,981).Structural features in the SPRR3 gene. Cornified

nvelope precursors in the EDC are characterized byheir internal repetitive domains, specific for each pro-

ttawpmai

lw

gheTattbttp

(it


ein. In the SPRR3 coding sequence the central oc-apeptide (TKVPEPGC) is repeated 14 times (Gibbs etl., 1993). The recent isolation of a human cDNA cloneith 13 repeats (I. Marenholz and D. Mischke, Berlin,ers. comm., 1998) suggests that some degree of poly-orphism exists in the human population. Such vari-

tions in the number of repeats have also been detectedn the involucrin gene (Simon et al., 1991).

The amount of proline in the repeats of SPRR3 isower than in the SPRR1 and the SPRR2 proteins,hich also have fewer repeats (Gibbs et al., 1993). A

FIG. 1. Sequence of the human SPRR3 gene (GenBank Accession11, indicated with z). Intron sequences are indicated in lowercasenverted repeats (IR1) and (IR2) are underlined; in the coding sequehe TATA box are double underlined.

lycine residue is conserved in the SPRR3 repeats fromuman, mouse, and rabbit (Austin et al., 1996; Steinertt al., 1998), but not in the SPRR1 and SPRR2 repeats.he presence of glycine, the lower amount of proline,nd the higher repeat number in SPRR3 suggest thathis protein has a more flexible, less rigid structurehan SPRR1 and SPRR2. Additionally, mouse and rab-it SPRR3s have more repeats (23 and 22, respectively)han the human protein, suggesting that SPRR3 inhese species is even more flexible. By using the Motifsrogram (Genetics Computer Group, version 9.1)

o. AF077374). Numbering is relative to the transcriptional start sitethe promoter region, the polypyrimidine tract is underlined; the

the octapeptide repeat is underlined. The regulatory elements and

N. Innce

SttIct

pEhtpk

asr(irt2er21ihSsi(

smqpcpge

tiavRfgm

rssv

92 FISCHER ET AL.

PRR3 was shown to contain a number of serine andhreonine residues that are putative substrates for pro-ein kinases (e.g., at position 36, TTKE (casein kinaseI) and at position 114, SIK (protein kinase-C)) whichould be phosphorylated at some stage of keratinocyteerminal differentiation, a mechanism also used for the

FIG. 2. Differential splicing of SPRR3 transcripts. (A) Scheme ofhe RT-PCR analysis. Exons are represented as thick lines and thentrons as hair lines; PCR primers are indicated by arrows. The 59nd 39 splice sites of the introns are shown. (B) RT-PCR analysis ofarious RNAs with primers in exon 1 and exon 3. Lane 1, no templateNA; lane 2, RNA isolated from oral mucosa; lane 3, RNA isolated

rom cultured keratinocytes grown in complete medium lackingrowth factors (1.8 mM calcium) (Fischer et al., 1996); M, DNA sizearkers (basepairs).

FIG. 3. Sequence comparison of the 39 untranslated region ofespectively) and the inverted repeat (IR2) of human SPRR3, whicequences is according to Fig. 1; numbering of the mouse sequence isequence is according to GenBank Accession No. U40631. Analysisersion 9.1) and edited manually with the SeqVu program (The Gar

osttranslational regulation of profilaggrin (Lonsdale-ccles et al., 1980) and cystatin-a/keratolinin (Taka-ashi et al., 1992, 1997). We have recently observedhat antibodies recognizing SPRR3 precipitate a phos-horylated protein with the size of SPRR3 in culturederatinocytes (data not shown).Comparison of SPRR promoter regions. The GAP

lignment program (Genetics Computer Group, ver-ion 9.1) was used to compare the proximal promoteregions of SPRR1A and B, SPRR2A and C, and SPRR3Table 2). The proximal promoters were subdividednto the 21 to 2150 region and the 2151 to 2300egion and compared separately (Table 2). In generalhe 21 to 2150 regions gave higher scores than the151 to 2300 regions, which is in agreement with

arlier results indicating that the minimal promoteregion required for expression is contained within the1 to 2150 regions of both SPRR2A (Fischer et al.,996) and SPRR1A (Sark et al., 1998). The comparisonndicates that although the various regulatory regionsave diverged considerably during the evolution of thePRR genes, the residual sequence conservation isignificant enough, in at least several combinations, todentify the evolutionary changes that have occurredsee below).

Multiple regulatory elements cooperate in the expres-ion of SPRR3. Examination of the SPRR3 distal pro-oter region revealed at position 2980 a simple se-

uence repeat (C/T) of nearly 200 bp (Fig. 1) notresent in the other SPRR genes. This repeat does notonsist of reiterated blocks and can be described as aolypyrimidine tract. Such tracts occur in a number ofenes (Manor et al., 1988) and have been described asvolutionarily stable elements (Maeda et al., 1983).

an, mouse, and rabbit SPRR3 (indicated by IR1, Mur, and Rab,represented in reverse orientation. The numbering of the human

cording to GenBank Accession No. Y09227; numbering of the rabbitperformed with the PILEUP program (Genetics Computer Group,Institute of Medical Research, version 1.1).

humh is

acwasvan

Pow(i(oFbt

mcc

tscawatltrppem

SSSSS

pSSLfb

terb


hylogenetic comparison has indicated that the originf these tracts was a perfect polypyrimidine tract,hich was subsequently interrupted by purines

Maeda et al., 1988). In SPRR3, the number of purinesn the 200-bp polypyrimidine tract is relatively low3.1%), indicating either that the element is of recentrigin or that the element is functionally important.or instance, a number of transcription factors haveeen identified to bind specifically to polypyrimidineracts (Brunel et al., 1991; Yee et al., 1991).

To analyze a possible involvement of this polypyri-idine tract in gene regulation, a 1787-bp fragment

ontaining the SPRR3 promoter and the first exon wasloned in front of the CAT reporter gene and studied in

TAB

Sequence Homologies between

Gene SPRR1A SPRR1B SPRR2A

PRR1A 100/1500 67/792 38/504PRR1B 50/651 100/1500 39/497PRR2A 38/497 34/510 100/1500PRR2C 41/557 45/505 81/1107PRR3 36/500 39/570 39/500

2300 to 2151 region

Note. 150-bp regions (21 to 2150, above the diagonal, or 2151 trogram (Genetics Computer Group, version 9.1) with a gap penaltPRR1A promoter (Sark et al., 1998), GenBank Accession No. L0518PRR2A promoter (Gibbs et al., 1990), GenBank Accession No. X505189; and SPRR3 promoter (GenBank Accession No. AF077374). T

or each pair of sequences before and after the solidus, respectivelyased upon 10 randomizations of the sequence and was on average

FIG. 4. Deletion mapping of regulatory elements in the SPRranscriptional start site. Each construct was tested for CAT activityt al., 1996) in 3 to 10 independent experiments. pBLCAT5 is the prelative to the wildtype (21679) construct pSG-209; error bars indicox depicts the polypyrimidine tract.

ransient transfection. Promoter activity of this con-truct was increased approximately 14-fold during cal-ium-induced terminal differentiation of cultured ker-tinocytes (Fig. 4, pSG-209). Successive 59 deletionsere tested for activity in calcium-containing mediumnd indicated at the first instance that the region con-aining the polypyrimidine tract might have only aimited importance in gene regulation (compare mu-ants 314 and 315), but instead revealed an upstreamegulatory element in the 21415 to 21321 region (com-are mutants 313 and 342). However, deletion of theolypyrimidine tract, while preserving the upstreamlement (mutant 363), resulted in a loss of approxi-ately 50% of promoter activity. This is unlikely to be

2

rious SPRR Promoter Regions

SPRR2C SPRR3

38/504 54/625 2150 to 21 region36/477 51/66269/935 40/590

100/1500 41/53533/490 100/1500

300, below the diagonal) were compared with the GAP alignmentf 50 and a gap extension penalty of 3. The sequences are from thePRR1B promoter (An et al., 1993), GenBank Accession No. M84757;4; SPRR2C promoter (Gibbs et al., 1993), GenBank Accession No.percentage of sequence identity and alignment quality are indicatedndom alignment quality was calculated for each pair of sequences6 11. Scores greater than 50% identity are indicated in bold.

promoter. Promoter length of each construct is relative to thecomplete medium lacking growth factors (1.8 mM calcium) (Fischeroterless CAT construct. Promoter activity is depicted as percentagethe standard error between independent experiments. The hatched

LE

Va

o 2y o7; S306he. Ra483

R3in

omate

datateu3tmram

srdiwoiistib(

tc(Cy

trbwACesSnpFmsrAap(ua(pJstttfiasF

1eaceapl

i5lipsr

94 FISCHER ET AL.

ue to defective spacing between the upstream elementnd, for example, the TATA box, since progressive in-ernal deletions had no additional effect on promoterctivity (compare mutants 363 to 366). The finding thathe deletion of the polypyrimidine tract had a similarffect on promoter activity as both the deletion of thepstream element and the combined deletion (mutants15 and 316) might indicate that the polypyrimidineract functions in conjunction with the upstream ele-ent. Fine mapping of the 21415 to 21321 region is

equired to identify the upstream promoter elementnd to study its possible interaction with the polypyri-idine tract.Deletions of the region between 2979 and 2266

howed that this sequence is not important in geneegulation (compare mutants 363 to 366). However,eletion of the region between 2245 and 2138 resultedn a severe reduction of promoter activity (mutant 354),hich does not significantly differ from the expressionf the uninduced wildtype construct (pSG-209; 2Ca21),ndicating that crucial regulatory elements are presentn the proximal 266 bp of the promoter. Sequence in-pection of the 2266 to 2138 region allowed the iden-ification of several putative transcription factor bind-ng sites: an Ets binding site at position 2239, an AP-1inding site (TRE) at position 2164, and an ATF/CREATF binding site/cAMP-responsive element) at posi-

FIG. 5. Electrophoretic mobility shift assay with the AP-1 (lanes–15) and ATF (lanes 16–22) binding sites. Keratinocyte nuclearxtract was incubated in the absence (lanes 9 and 16) or presence ofntibodies or competitor DNA before addition of the labeled oligonu-leotide; the various antibodies and competitors are indicated forach lane. Lane 1 contains nonspecific antibody. Competitors weredded in either 10- or 500-fold molar excess. S indicates the com-lexes supershifted with antibody; U and L indicate the upper andower ATF complexes, respectively.

ion 2148 (Fig. 1). As each one of these binding sitesan be recognized by large transcription factor familiesAngel and Karin, 1991; Lin and Green, 1988; Sassone-orsi, 1995; Wasylyk et al. 1993), a more detailed anal-sis of the various binding activities was necessary.AP-1 and ATF binding sites involved in the regula-

ion of SPRR3. To determine whether these putativeegulatory elements are actual transcription factorinding sites, electrophoretic mobility shift assaysere performed. Considering the fact that AP-1 andTF transcription factors can cross-dimerize (Hai andurran, 1991), we investigated the proteins bound toach element in detail. In an electrophoretic mobilityhift assay, one major complex could be observed on thePRR3 AP-1 site (Fig. 5, lane 1). Preincubation of theuclear extract with antibodies showed that this com-lex contains JUN B, JUN D, c-FOS, FRA-1, andRA-2 (Fig. 5, lanes 2 to 8). Cross-competition experi-ents established that the factors bound to the AP-1

ite could also bind to the ATF site, although witheduced affinity (Fig. 5, lanes 10 to 13). The SPRR3TF site showed two specific complexes in a bandshiftssay (Fig. 5, lane 16), which were only partially com-eted for by the AP-1 site (Fig. 5, lane 18). Only ATF-2Hai et al., 1989) and c-JUN antibodies affected thepper complex (Fig. 6, lanes 7 and 8); the use of bothntibodies eliminated the upper complex completelyFig. 6, lane 4), indicating that this complex is com-osed solely of ATF-2 and c-JUN. Antibodies againstUN D and FRA-2 (Fig. 6, lanes 10 and 14) produced aupershift when added to the ATF complex, suggestinghat the corresponding transcription factors are part ofhe lower complex. The fact that these antibodies in-eract with only a fraction of the ATF complex, and thending that the AP-1 element can only compete forpproximately 50% of this complex, suggests that ATF-pecific proteins other than ATF-2, c-JUN, JUN D, andRA-2 also bind to this site.

FIG. 6. Electrophoretic mobility shift assay with the ATF bind-ng site. Nuclear extract was incubated in the absence (lanes 1 and) or presence of antibodies or competitor DNA before addition of theabeled oligonucleotide. The various antibodies and competitors arendicated in each lane; lane 6 contains nonspecific antiserum. Com-etitors were added in 500-fold molar excess. S indicates the super-hifted complexes; U and L indicate upper and lower ATF complexes,espectively.

mstaimc(ai(SbpnRirdfcTtatpttll

S2ti2S

cTEmsn1mfci1(wtt(Diatheos(1

taoclEEsSSbopa

t2mets


Point mutants in either one of these regulatory ele-ents were generated in the 1787-bp promoter con-

truct and tested for promoter activity (Fig. 7). Muta-ion of either the AP-1 or the ATF site reduced thectivity to 12% (mutants 276 and 277, respectively),ndicating that both sites are crucial regulatory ele-

ents. The AP-1 core sequence (TGAGTCA) is alsoonserved in SPRR2A (Gibbs et al., 1990), SPRR1BReddy et al., 1995), and SPRR1A (Sark et al., 1998),lthough at different positions. This sequence is anmportant regulatory element in the SPRR1 genesReddy et al., 1995; Sark et al., 1998), but not inPRR2A (Fischer et al., 1996). The ATF site seems toe specific for SPRR3, although the core sequence isresent, but not essential, in the SPRR1A gene (dataot shown) and the SPRR1B gene (An et al., 1993;eddy et al., 1995). The finding that both the mutation

n the AP-1 site and the mutation in the ATF siteeduced promoter activity with approximately 90% in-icates that the corresponding transcription factorsunction cooperatively (for a review on transcriptionalooperativity refer to Herschlag and Johnson, 1993).his cooperation might be favored by the proximity ofhe two elements in the SPRR3 promoter, which couldllow a direct interaction between the proteins boundo these two sites. The competition data in Fig. 5 sup-ort such a view, as they indicate that an oligonucleo-ide containing both sites was a better competitor thanhe two sites separately (in the case of AP-1, compareanes 10 and 12 to lane 14; in the case of ATF, compareanes 17 and 19 to lane 21).

Involvement of a high-affinity ESE-1 binding site.ite-directed mutagenesis indicated that although the239 Ets site in SPRR3 is a functional element, mu-

ation of this site resulted in only partial promoternactivation (32% residual activity; Fig. 7, mutant75). This is in contrast to earlier studies with thePRR2A Ets binding site in which mutations result in

FIG. 7. Mutational analysis of the Ets, AP-1, and ATF sites inhe SPRR3 promoter. Each point mutant was generated in the1679 promoter context and was tested for CAT activity in completeedium lacking growth factors (1.8 mM calcium) (9 independent

xperiments). Promoter activity is depicted as percentage relative tohe wildtype (21679) construct pSG-209, error bars indicate thetandard error between independent experiments.

omplete promoter inactivation (Fischer et al., 1996).his difference prompted us to investigate the SPRR3ts binding site at position 2239 in an electrophoreticobility shift assay. The wildtype SPRR3 Ets site

howed two specific complexes (a and b), which couldo longer bind to the mutated sequence (Fig. 8, lanes–5), indicating that the partial promoter activity inutant 275 is not due to residual binding of the Ets

actor to the mutant site. The SPRR3 Ets complexesould also be competed for by oligonucleotides contain-ng wildtype Ets binding sites from PEA3 (lanes 12 and3) (Martin et al., 1988) and SPRR2A (lanes 10 and 11)Fischer et al., 1996). Competition for these complexesas also observed by the SPRR2A mutant site dis-

urbed in IRF binding (m148, lanes 6 and 7), but not byhe SPRR2A mutant site disturbed in Ets bindingm212, lanes 8 and 9). The differences in amount ofNA required for complete competition furthermore

ndicated that the SPRR3 Ets binding site has a higherffinity than the PEA3 and SPRR2A binding sites forhe bound Ets factor (compare lanes 3, 11, and 13). Weave recently cloned several Ets transcription factorsxpressed in keratinocytes (unpublished data), and onef these, clone A12, was identical to the recently de-cribed ESE-1b/ESX/jen/ERT transcription factorOettgen et al., 1997; Chang et al., 1997; Andreoli et al.,997; Choi et al., 1998). When the corresponding pro-

FIG. 8. Characterization of the SPRR3 Ets binding site at posi-ion 2239. Nuclear extract was incubated in the absence (lanes 1, 16,nd 17) or presence (lanes 2–15) of competitor DNA before additionf the labeled wildtype SPRR3 Ets binding site. The molar excess ofompetitor DNA (5- or 100-fold) is indicated in each lane. The fol-owing competitors were used: lanes 2 and 3, wildtype 2239 SPRR3ts binding site; lanes 4 and 5, mutated (TT to CC, pSG-275) SPRR3ts binding site; lanes 6 and 7, mutant 148 SPRR2A wt2/3 bindingite (ISRE mutant) (Fischer et al., 1996); lanes 8 and 9, mutant 212PRR2A wt2/3 binding site (Ets mutant); lanes 10 and 11, wildtypePRR2A wt2/3 binding site; lanes 12 and 13, wildtype PEA3 Etsinding site (Martin et al., 1988); and lanes 14 and 15, an unrelatedligonucleotide. Lane 18 contains in vitro-translated ESE-1 fromlasmid A12 (Promega TnT reticulocyte lysate). Specific complexesre indicated by a and b.

ttEtetnr(mE1tsog

sapegittsams

rStlTh2

acTrefSdfcpw(SapSbt

b

El4a((aebp

96 FISCHER ET AL.

ein was produced in an in vitro transcription/ranslation reaction, and incubated with the SPRR3ts oligonucleotide, a complex with mobility identical

o that of the upper specific complex (b) in nuclearxtracts was observed (Fig. 8, lane 18). This indicatedhat the Ets sites in SPRR2A and SPRR3 are recog-ized by ESE-1. We have recently shown that ESE-1ecognizes also the 255 Ets binding site in SPRR1ASark et al., 1998). The specific complex with higher

obility (a) could be the alternative splice variantSE-1a, which has been described (Oettgen et al.,997). Our data indicate that the Ets binding sites inhe three classes of SPRR genes are recognized by theame factor, ESE-1, but that the relative contributionf this factor to promoter activity differs between theseenes.Repositioning of the Ets site in SPRR3 results in

uperactivation. The SPRR1A, SPRR1B, SPRR2A,nd SPRR2C genes all have an Ets binding site atosition 255 (An et al., 1993; Fischer et al., 1996; Sarkt al., 1998) (data not shown), which in the 1A and 2Aenes has been shown to be crucial for promoter activ-ty (Fischer et al., 1996; Sark et al., 1998). This evolu-ionary conservation strongly implies that the ances-ral SPRR gene (Gibbs et al., 1993) had this bindingite already. The Ets binding site in SPRR3 is presentt position 2239, while inspection and electrophoreticobility shift analysis of the sequence around 255

howed that a single basepair transition (C to T) is

FIG. 9. Restitution of an Ets binding site at position 255 in the Sts site. Nuclear extract was incubated in the absence (lane 1) or pre

ane 2, 500-fold molar excess of wildtype 2239 SPRR3 Ets binding s, 500-fold molar excess of mutated (pSG-469) SPRR3 255 region.ctivity. All promoter constructs were made in the pBLCAT5 vector1.8 mM calcium). The SPRR1A promoter (pSG-227) has been descrpSG-2) described in Fischer et al., (1996). Mutant pSG-469 has bothnd a single T to C mutation at position 253. Promoter activity is deprror bars indicate the standard error between independent experiminding site (ZnF) in SPRR2A is indicated, and the Ets binding sitesosition 2239 (wildtype SPRR3) are indicated. Functional binding s

esponsible for the lack of binding of ESE-1 to thePRR3 sequence at 255 (Fig. 9A). This suggests thathe SPRR3 gene has lost this binding site during evo-ution after diverging from SPRR1 (Gibbs et al., 1993).his has been compensated, at least partially, by aigh-affinity Ets binding site in SPRR3 at position239, which is not found in SPRR1A or SPRR2A.The transcript levels of the endogenous SPRR3 gene

re relatively low in primary cultured keratinocytesompared to SPRR1A and SPRR2A (data not shown).his is also reflected by the relative activity of theespective promoter–CAT constructs in transfectionxperiments: the activity of SPRR3 was approximatelyour times lower than the activity of the SPRR1A andPRR2A promoters (Fig. 9B). To analyze whether theifferent position of the Ets binding site is responsibleor this difference, a mutant SPRR3 promoter wasonstructed in which the distal high-affinity Ets site atosition 2239 was mutated and the proximal Ets siteas restored at position 255 by a single base mutation

T to C), thereby creating a configuration similar toPRR1A and SPRR2A. This mutant (pSG-469) showedn activity comparable to the SPRR1A and SPRR2Aromoters and three times higher than the wildtypePRR3 construct (Fig. 9B). The position of the Etsinding site thus seems to be a crucial determinant forhe activation potential of ESE-1.

Our data suggest that the three transcription factorinding sites (AP-1, ATF, and Ets) function coopera-

R3 promoter. (A) Electrophoretic mobility shift assay with the 2239ce of competitor DNA before addition of the labeled oligonucleotide;; lane 3, 500-fold molar excess of wildtype SPRR3 255 region; laneEffect of repositioning of the SPRR3 Ets binding site on promotertested for CAT activity in complete medium lacking growth factorsin Sark et al., (1998). SPRR2A (pSG-216) is the 1500-bp promoter

e TT to CC mutation (Fig. 7, pSG-275) in the 2239 Ets binding siteed as percentage relative to the wildtype SPRR3 construct pSG-209;s. The TATA box in SPRR1A, 2A, and 3 is indicated, the zinc fingereither position 255 (SPRR1A, SPRR2A, and SPRR3 mutant 469) ors are underlined.

PRsenite

(B)andibed

thictentatite

tfmrodfoat1peTnlvaglmyrleampmtwotmfl

FsDTmUJ

A

A

A

A

A

B

B

B

C

C

E

F

G

G

G

G

H

H

H

H

H

J


ively, but are not interdependent, as was previouslyound for the regulatory elements in the SPRR2A pro-oter (TDE-1 to TDE-4), where a mutation in a single

egulatory element results in a complete inactivationf promoter activity (Fischer et al., 1996). Interdepen-ence between trancriptional activators is an extremeorm of cooperativity, which appears to be achievednly with a specific promoter architecture, allowing thessembly of highly organized stereospecific nucleopro-ein complexes (enhanceosomes) (Tjian and Maniatis,994). Such interdependent transcription factor com-lexes have been demonstrated in the promoters ornhancers of the genes for c-fos (Robertson et al., 1995),CR-a (Giese et al., 1995), interferon-b (Kim and Ma-iatis, 1997; Thanos and Maniatis, 1995), and inter-

eukin-2 (Rothenberg and Ward, 1997), all of which areery tightly regulated genes. Whereas the mutationalnalysis of the SPRR2A promoter indicated that thisene is under the control of four interdependent regu-atory elements which are clustered on a 150-bp pro-

oter fragment (Fischer et al., 1996), the present anal-sis shows that in the case of the related SPRR3 gene,egulatory elements are scattered throughout a mucharger promoter area. Furthermore, mutations in theselements result in only partial inactivation of promoterctivity (10–50% of wildtype activity). Significantly, autation in an artificially restituted Ets binding site at

osition 255 has a relatively higher impact on pro-oter activity (10-fold reduction) than a similar muta-

ion in the Ets binding site at position 2239 in theildtype configuration (3-fold reduction) (Fig. 9B). Thisbservation suggests that loss of an Ets binding site inhe proximal SPRR3 promoter might have been instru-ental during evolution in changing this promoter

rom a possibly interdependent (highly synergistic) to aess stringent cooperative mode.

ACKNOWLEDGMENTS

The authors thank Anne-Marijke Borgstein, Emile de Meijer,ranck Detoc, Thomas Roes, and Miguel Molinete for their help ineveral experiments. The contribution of sequence information byrs. D. Mischke and I. Marenholz (Berlin) is greatly appreciated. Dr.. Kartasova (Bethesda) is acknowledged for critically reading theanuscript. M.M.L. was an Erasmus exchange student from theniversity of Kuopio (Finland). This research was supported by the. A. Cohen Institute and by grants from NWO-SON and the EC.

REFERENCES

braham, J. M., Wang, S., Suzuki, H., Jiang, H.-Y., Rosenblum-Vos,L. S., Yin, J., and Meltzer, S. J. (1996). Esophagin cDNA cloningand characterization: A tissue-specific member of the small pro-line-rich protein family that is not expressed in esophageal tu-mors. Cell Growth Differ. 7: 855–860.

n, G., Tesfaigzi, J., Chuu, Y.-J., and Wu, R. (1993). Isolation andcharacterization of the human spr1 gene and its regulation ofexpression by phorbol ester and cyclic AMP. J. Biol. Chem. 268:10977–10982.ndreoli, J. M., Jang, S.-I., Chung, E., Coticchia, C. M., Steinert,P. M., and Markova, N. G. (1997). The expression of a novel,epithelium-specific ets transcription factor is restricted to the most

differentiated layers in the epidermis. Nucleic Acids Res. 25: 4287–4295.ngel, P., and Karin, M. (1991). The role of Jun, Fos and the AP-1complex in cell-proliferation and transformation. Biochim. Bio-phys. Acta 1072: 129–157.ustin, S. J., Fujimoto, W., Marvin, K. W., Vollberg, T. M., Lorand,L., and Jetten, A. M. (1996). Cloning and regulation of cornifin b,a new member of the cornifin/spr family. J. Biol. Chem. 271:3737–3742.ackendorf, C., and Hohl, D. (1992). A common origin for cornifiedenvelope proteins? Nat. Genet. 2: 91.arksdale, S., and Baker, C. C. (1995). Differentiation-specific alter-native splicing of bovine papillomavirus late mRNAs. J. Virol. 69:6553–6556.runel, F., Alzari, P. M., Ferrara, P., and Zakin, M. M. (1991).Cloning and sequencing of PYBP, a pyrimidine-rich specific singlestrand DNA-binding protein. Nucleic Acids Res. 19: 5237–5245.hang, C.-H., Scott, G. K., Kuo, W.-L., Xiong, X., Suzdaltseva, Y.,Park, J. W., Sayre, P., Erny, K., Collins, C., Gray, J. W., and Benz,C. C. (1997). ESX: A structurally unique Ets overexpressed earlyduring human breast tumorigenesis. Oncogene 14: 1617–1622.

hoi, S.-G., Yi, Y., Kim, Y.-S., Kato, M., Chang, J., Chung, H.-W.,Hahm, K.-B., Yang, H.-K., Rhee, H. H., Bang, Y. J., and Kim, S.-J.(1998). A novel ets-related transcription factor, ERT/ESX/ESE-1,regulates expression of the transforming growth factor-b type IIreceptor. J. Biol. Chem 173: 110–117.ckert, R. L., and Green, H. (1986). Structure and evolution of thehuman involucrin gene. Cell 46: 583–589.

ischer, D. F., Gibbs, S., van de Putte, P., and Backendorf, C. (1996).Interdependent transcription control elements regulate the ex-pression of the SPRR2A gene during keratinocyte terminal differ-entiation. Mol. Cell. Biol. 16: 5365–5374.ibbs, S., Fijneman, R., Wiegant, J., Geurts van Kessel, A., van dePutte, P., and Backendorf, C. (1993). Molecular characterizationand evolution of the SPRR family of keratinocyte differentiationmarkers encoding small proline-rich proteins. Genomics 16: 630–637.ibbs, S., Lohman, F. P., Teubel, W., Putte, P. v. d., and Backendorf,C. M. P. (1990). Characterization of the human spr2 promoter:Induction after UV irradiation or TPA treatment and regulationduring differentiation of cultured primary keratinocytes. NucleicAcids Res. 18: 4401–4407.iese, K., Kingsley, C., Kirshner, J. R., and Grosschedl, R. (1995).Assembly and function of a TCRa enhancer complex is dependenton LEF-1-induced DNA bending and multiple protein–protein in-teractions. Genes Dev. 9: 995–1008.iovane, A., Pintaz, A., Maira, S.-M., Sobieszczuk, P., and Wasylyk,B. (1994). Net, a new ets transcription factor that is activated byRas. Genes Dev. 8: 1502–1513.ai, T., and Curran, T. (1991). Cross-family dimerization of tran-scription factors Fos/Jun and ATF/CREB alters DNA binding spec-ificity. Proc. Natl. Acad. Sci. USA 88: 3720–3724.ai, T., Liu, F., Coukos, W. J., and Green, M. R. (1989). Transcrip-tion factor ATF cDNA clones: An extensive family of leucine zipperproteins able to selectively form DNA-binding heterodimers. GenesDev. 3: 2083–2090.erschlag, D., and Johnson, F. B. (1993). Synergism in transcrip-tional activation: A kinetic view. Genes Dev. 7: 173–179.ohl, D., de Viragh, P. A., Amiguet-Barras, F., Gibbs, S., Backendorf,C., and Huber, M. (1995). The small proline-rich proteins consti-tute a multigene family of differentially regulated cornified cellenvelope precursor proteins. J. Invest. Dermatol. 104: 902–909.ohl, D., Olano, B. R., de Viragh, P. A., Huber, M., Detrisac, C. J.,Schnyder, U. W., and Roop, D. R. (1993). Expression patterns ofloricrin in various species and tissues. Differentiation 54: 25–34.

arnik, M., Kartasova, T., Steinert, P. M., Lichti, U., and Steven,A. C. (1996). Differential expression and cell envelope incorpora-

J

K

K

K

K

K

K

K

K

L

L

L

L

M

M

M

M

M

M

N

N

O

P

P

R

R

R

R

S

S

S

S

S

S

S

S

T

98 FISCHER ET AL.

tion of small proline-rich protein 1 in different cornified epithelia.J. Cell Sci. 109: 1381–1391.

onat, C., Rahmsdorf, H. J., Park, K. K., Cato, A. C., Gebel, S., Ponta,H., and Herrlich, P. (1990). Antitumor promotion and antiinflama-tion: Down-modulation of AP-1 (Fos/Jun) activity by glucocorticoidhormone. Cell 62: 1189–1204.artasova, T., Darwiche, N., Kohno, Y., Koizumi, H., Osada, S.-I.,Huh, N.-H., Lichti, U., Steinert, P. M., and Kuroki, T. (1996).Sequence and expression patterns of mouse SPR1: Correlation ofexpression with epithelial function. J. Invest. Dermatol. 106: 294–304.artasova, T., and van de Putte, P. (1988). Isolation, characteriza-tion, and UV-stimulated expression of genes encoding polypeptidesof related structure in human epidermal keratinocytes. Mol. Cell.Biol. 8: 2195–2203.im, T. K., and Maniatis, T. (1997). The mechanism of transcrip-tional synergy of an in vitro assembled interferon-b enhanceo-some. Mol. Cell 1: 119–129.imura, M. (1980). A simple method for estimating evolutionaryrates of base substitutions through comparative studies of nucle-otide sequences. J. Mol. Evol. 16: 111–120.ozak, M. (1978). How do eucaryotic ribosomes select initiationregions in messenger RNA? Cell 15: 1109–1123.ozak, M. (1984). Selection of initiation sites by eucaryotic ribo-somes: Effect of inserting AUG triplets upstream from the codingsequence for preproinsulin. Nucleic Acids Res. 12: 3873–3893.ozak, M. (1987). An analysis of 59-noncoding sequences from 699vertebrate messenger RNAs. Nucleic Acids Res. 15: 8125–8148.unkel, T. A. (1985). Rapid and efficient site-specific mutagenesiswithout phenotypic selection. Proc. Natl. Acad. Sci. USA 82: 488–492.

eigh, I. M., and Watt, F. M. (1994). The culture of human epidermalkeratinocytes. In “The Keratinocyte Handbook” (I. M. Leigh, E. B.Lane, and F. M. Watt, Eds.), pp.43–52, Cambridge Univ. Press,Cambridge.

in, Y. S., and Green, M. R. (1988). Interaction of a common cellulartranscription factor, ATF, with regulatory elements in both E1A-and cyclic AMP-inducible promoters. Proc. Natl. Acad. Sci. USA85: 3396–3400.

ohman, F. P., Medema, J. K., Gibbs, S., Ponec, M., van de Putte, P.,and Backendorf, C. (1997). Expression of the SPRR cornificationgenes is differentially affected by carcinogenic transformation.Exp. Cell Res. 231: 141–148.

onsdale-Eccles, J. D., Haugen, J. A., and Dale, B. A. (1980). Aphosphorylated keratohyalin-derived precursor of epidermal stra-tum corneum basic protein. J. Biol. Chem. 255: 2235–2238.aeda, N., Bliska, J. B., and Smithies, O. (1983). Recombination andbalanced chromosome polymorphism suggested by DNA sequences59 to the human d-globin gene. Proc. Natl. Acad. Sci. USA 80:5012–5016.aeda, N., Wu, C.-I., Bliska, J., and Reneke, J. (1988). Molecularevolution of intergenic DNA in higher primates: Pattern of DNAchanges, molecular clock, and evolution of repetitive sequences.Mol. Biol. Evol. 5: 1–20.anor, H., Rao, B. S., and Martin, R. G. (1988). Abundance anddegree of dispersion of genomic d(GA)n.d(TC)n sequences. J. Mol.Evol. 27: 96–101.arsh, J. L., Erfle, M., and Wykes, E. J. (1984). The pIC plasmid andphage vectors with versatile cloning sites for recombinant selec-tion by insertional inactivation. Gene 32: 481–485.artin, M. E., Piette, J., Yaniv, M., Tang, W., and Folk, W. R. (1988).Activation of the polyomavirus enhancer by a murine activatorprotein1 (AP1) homolog and two contiguous proteins. Proc. Natl.Acad. Sci. USA 85: 5839–5843.ischke, D., Korge, B. P., Marenholz, I., Volz, A., and Ziegler, A.(1996). Genes encoding structural proteins of epidermal cornifica-tion and S100 calcium-binding proteins form a gene complex (“Epi-

dermal Differentiation Complex”) on human chromosome 1q21.J. Invest. Dermatol. 106: 989–992.albantoglu, J., and Meuth, M. (1986). DNA amplification-deletionin a spontaneous mutation of the hamster aprt locus: Structureand sequence of the novel joint. Nucleic Acids Res. 14: 8361–8371.eumann, J. R., Morency, C. A., and Russian, K. O. (1987). A novelrapid assay for chloramphenicol acetyltransferase gene expres-sion. BioTechniques 5: 444–447.ettgen, P., Alani, R. M., Barcinski, M. A., Brown, L., Akbarali, Y.,Boltax, J., Kunsch, C., Munger, K., and Libermann, T. A. (1997).Isolation and characterization of a novel epithelium-specific tran-scription factor, ESE-1, a member of the ets family. Mol. Cell. Biol.17: 4419–4433.

onec, M., Kempenaar, J. A., and de Kloet, E. R. (1981). Corticoidsand cultured human epidermal keratinocytes: Specific intra-cellu-lar binding and clinical efficacy. J. Invest. Dermatol. 76: 211–214.

urschke, W. G., and Muller, P. K. (1994). An improved fluor diffu-sion assay for chloramphenicol acetyltransferase gene expression.Biotechniques 16: 264–269.

eddy, S. P. M., Chuu, Y.-J., Lao, P. N., Donn, J., Ann, D. K., andWu, R. (1995). Expression of human squamous cell differentiationmarker, SPR1, in tracheobronchial epithelium depends on JUNand TRE motifs. J. Biol. Chem. 270: 26451–26459.

heinwald, J. G., and Green, H. (1975). Serial cultivation of strainsof human epidermal keratinocytes: The formation of keratinizingcolonies from single cells. Cell 6: 331–343.obertson, L. M., Kerppola, T. K., Vendrell, M., Luk, D., Smeyne,R. J., Bocchiaro, C., Morgan, J. I., and Curran, T. (1995). Regula-tion of c-fos expression in transgenic mice requires multiple inter-dependent transcription control elements. Neuron 14: 241–252.

othenberg, E. V., and Ward, S. B. (1997). A dynamic assembly ofdiverse transcription factors integrates activation and cell-typeinformation for interleukin 2 gene regulation. Proc. Natl. Acad.Sci. USA 93: 9358–9365.

ambrook, J., Fritsch, E. F., and Maniatis, T. (1989). “MolecularCloning: A Laboratory manual,” Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, NY.

ark, M. W. J., Fischer, D. F., de Meijer, E., van de Putte, P., andBackendorf, C. (1998). AP-1 and Ets transcription factors regulatethe expression of the SPRR1A keratinocyte terminal differentia-tion marker. J. Biol.Chem. 273: 24683–24692.

assone-Corsi, P. (1995). Transcription factors responsive to cAMP.Annu. Rev. Cell Dev. Biol. 11: 355–377.

hen, S.-H., Slightom, J. L., and Smithies, O. (1981). A history of thehuman fetal globin gene duplication. Cell 26: 191–203.

imon, M., Phillips, M., and Green, H. (1991). Polymorphism due tovariable number of repeats in the human involucrin gene. Genom-ics 9: 576–580.

teinert, P. M., Kartasova, T., and Marekov, L. N. (1998). Biochem-ical evidence that small proline-rich proteins and trichohyalinfunction in epithelia by modulation of the biomechanical proper-ties of their cornified cell envelopes. J. Biol. Chem. 273: 11758–11769.

teinert, P. M., and Marekov, L. N. (1995). The proteins elafin,filaggrin, keratin intermediate filaments, loricrin and small pro-line-rich proteins 1 and 2 are isodipeptide cross-linked componentsof the human epidermal cornified cell envelope. J. Biol. Chem. 270:17702–17711.

teinert, P. M., and Marekov, L. N. (1997). Direct evidence thatinvolucrin is a major early isopeptide cross-linked component ofthe keratinocyte cornified cell envelope. J. Biol. Chem. 272: 2021–2030.

akahashi, H., Kinouchi, M., Wuepper, K. D., and Iizuka, H. (1997).Cloning of human keratolinin cDNA: Keratolinin is identical tocysteine proteinase inhibitor, cystatin A, and is regulated by Ca21,TPA and cAMP. J. Invest. Dermatol. 108: 843–847.

T

T

T

W

Y

Y


akahashi, M., Tezuka, T., and Katunuma, N. (1992). Phosphory-lated cystatin a is a natural substrate of epidermal transglutami-nase for formation of skin cornified envelope. FEBS Lett. 308:79–82.

hanos, D., and Maniatis, T. (1995). Virus induction of human IFNbgene expression requires the assembly of an enhanceosome. Cell83: 1091–1100.

jian, R., and Maniatis, T. (1994). Transcriptional activation: Acomplex puzzle with few easy pieces. Cell 77: 5–8.

asylyk, B., Hahn, S., and Giovane, A. (1993). The Ets family oftranscription factors. Eur. J. Biochem. 211: 7–18.

ee, H. A., Wong, A. K. C., Sande, J. H. v. d., and Rattner, J. B.(1991). Identification of novel single-stranded d(TC)n binding pro-teins in several mammalian species. Nucleic Acids Res. 19: 949–953.

oneda, K., Hohl, D., McBride, O. W., Wank, M., Cehrs, K. U., Idler,W. W., and Steinert, P. M. (1992). The human loricrin gene. J. Biol.Chem. 267: 18060–18066.

structure and evolution of the humansprr3gene: implications for function and regulation

Documents