similarity index 13% - virginia tech..."new norovirus study findings have been reported by...

12/19/2018 Summary Report

https://app.ithenticate.com/en_us/report/42517373/summary 1/156

198 words / < 1% match - Internet from 12-Nov-2013 12:00AMwww.elbiruniblogspotcom.blogspot.hk

190 words / < 1% match - Internet from 03-Aug-2012 12:00AMfhbgrants.netsoft.net

182 words / < 1% match - Internet from 15-Oct-2011 12:00AMdnareplication.cshl.edu

180 words / < 1% match - Internet from 27-May-2012 12:00AMwww.avpa.asn.au

179 words / < 1% match - Internet from 04-Oct-2012 12:00AMen.engormix.com

159 words / < 1% match - ProQuestMarkis, Milos. "In vivo and in vitro characterization of virus isolates involved in viralenteritis/enteropathy, also known as runting stunting syndrome (rss), in broiler chickens.", Proquest,2014.

149 words / < 1% match - Internet from 02-Dec-2013 12:00AMwww.oie.int

148 words / < 1% match - Internet from 22-Jan-2014 12:00AMwww1.gifu-u.ac.jp

142 words / < 1% match - Internet from 01-Dec-2013 12:00AMwww.picornaviridae.com

137 words / < 1% match - Internet from 02-Oct-2013 12:00AMwww.macvetrev.mk

126 words / < 1% match - Publications

sources:

Pathogenesis and Cross-species Infection of Hep...By: DANIELLE YUGO

As of: Dec 19, 2018 5:21:16 PM 69,868 words - 481 matches - 244 sources

Similarity Index

13%

Mode:



Clemente-Casares, Pilar Pina, Sonia Buti. "Hepatitis E virus epidemiology in industrialized countries.(Research).", Emerging Infectious Diseases, April 2003 Issue

119 words / < 1% match - Internet from 26-Aug-2013 12:00AMwww.labome.org

118 words / < 1% match - Internet from 29-Sep-2012 12:00AMclinet.cn

116 words / < 1% match - Crossref Posted ContentIjeoma M. Ifeorah, Temitope O. C. Faleye, Adeleye S. Bakarey, Moses Olubusuyi Adewumi et al. "AcuteHepatitis E Virus infection in two geographical regions of Nigeria", Cold Spring Harbor Laboratory,2017

115 words / < 1% match - Internet from 08-Apr-2012 12:00AMwww.izw-berlin.de

112 words / < 1% match - Internet from 05-Aug-2012 12:00AMwww.�u.starszenaseks.malopolska.pl

107 words / < 1% match - Internet from 16-Aug-2012 12:00AMwww.researchgate.net

105 words / < 1% match - Internet from 21-Jan-2014 12:00AMwww.vetmed.vt.edu

103 words / < 1% match - Internet from 19-Nov-2012 12:00AMwww.biomedcentral.com

94 words / < 1% match - Internet from 08-Aug-2012 12:00AMwwwnc.cdc.gov

91 words / < 1% match - Crossref"Hepatitis E Virus", Springer Nature, 2016

90 words / < 1% match - Internet from 21-Sep-2017 12:00AMlib.dr.iastate.edu

87 words / < 1% match - Internet from 17-Jun-2013 12:00AMwww.biomedcentral.com

83 words / < 1% match - Internet from 12-Oct-2017 12:00AMelib.tiho-hannover.de



81 words / < 1% match - Internet from 25-Jul-2012 12:00AMwww.rsghb.cn

81 words / < 1% match - Internet from 04-Apr-2017 12:00AMrepub.eur.nl

80 words / < 1% match - Internet from 18-Jul-2013 12:00AMwww.virologyj.com

80 words / < 1% match - Internet from 28-Mar-2014 12:00AMwww.comprehensivephysiology.com

78 words / < 1% match - Internet from 20-Oct-2012 12:00AMdyxy.nwsuaf.edu.cn

78 words / < 1% match - Internet from 26-Oct-2013 12:00AMwww.picornaviridae.com

78 words / < 1% match - Internet from 14-Nov-2014 12:00AMaran.library.nuigalway.ie

75 words / < 1% match - Internetaac.asm.org

74 words / < 1% match - Internet from 09-Jun-2012 12:00AMwww.uniklinik-freiburg.de

72 words / < 1% match - Internet from 01-Sep-2013 12:00AMwww.cresa.cat

70 words / < 1% match - Internet from 21-Nov-2017 12:00AMlib.dr.iastate.edu

67 words / < 1% match - Internet from 22-Sep-2011 12:00AMmedicina.udea.edu.co

67 words / < 1% match - Internet from 04-Feb-2013 12:00AMonlinelibrary.wiley.com

64 words / < 1% match - Internet from 11-Jul-2018 12:00AMd-nb.info



63 words / < 1% match - Internetintl-vir.sgmjournals.org

63 words / < 1% match - Internet from 23-Oct-2018 12:00AMwww.newmicrobiologica.org

62 words / < 1% match - Internet from 13-Oct-2013 12:00AMeatris.it

60 words / < 1% match - PublicationsSaniewski, Mona(Institut für Medizinische Virologie). "Struktur und Funktion der Ober�ächenproteinevon ungewöhnlichen Hepatitis B Virus-Varianten", Justus-Liebig-Universität Gießen, 2009.

59 words / < 1% match - Internet from 02-Aug-2013 12:00AMbiosciencetrends.com

59 words / < 1% match - Crossref Posted ContentMaliki Ankavay, Claire Montpellier, Ibrahim M Sayed, Jean-Michel Saliou et al. "New insights into theORF2 capsid protein, a key player of the hepatitis E virus lifecycle", Cold Spring Harbor Laboratory,2018

58 words / < 1% match - Internet from 25-Sep-2012 12:00AMwww.biosecurity.govt.nz

56 words / < 1% match - Internet from 01-Jul-2014 12:00AMmmbr.asm.org

55 words / < 1% match - Internet from 09-Sep-2017 12:00AMhal.archives-ouvertes.fr

54 words / < 1% match - Internet from 14-Oct-2017 12:00AMonlinelibrary.wiley.com

54 words / < 1% match - Crossref Posted ContentMatthias Fritsche, Floris P de Lange. "Reference Repulsion Is Not a Perceptual Illusion", Cold SpringHarbor Laboratory, 2018

52 words / < 1% match - Internet from 28-Jul-2013 12:00AMxkb.bjmu.edu.cn

50 words / < 1% match - Internet from 02-Sep-2013 12:00AMwww.gallusimmunotech.com



50 words / < 1% match - Internet from 10-Sep-2018 12:00AMcmr.asm.org

50 words / < 1% match - Internet from 12-Nov-2018 12:00AMkrishikosh.egranth.ac.in

50 words / < 1% match - Internet from 27-Jul-2014 12:00AMwww.biomedcentral.com

47 words / < 1% match - Internet from 03-Oct-2003 12:00AMpneumocystis.uc.edu

46 words / < 1% match - Internet from 05-Oct-2012 12:00AMen.nwsuaf.edu.cn

46 words / < 1% match - Internet from 10-Sep-2013 12:00AMwww.recentmedical�ndings.com

46 words / < 1% match - Internet from 14-Oct-2013 12:00AMwww0.nih.go.jp

46 words / < 1% match - PublicationsSchildgen, Oliver. "Identi�zierung einer O-Glykosylierungsstelle der Woodchuck Hepatitis Virus (WHV)preS2-Domäne und deren Ein�uß auf den intrazellulären Transport des middle surface antigen(WHmsAg)", DuEPublico: University of Duisburg-Essen Publications Online, 2002.

46 words / < 1% match - PublicationsÖZPINAR, Haydar, TEZMEN, Gündüz, GÖKÇE, İnci and TEKİNER, İsmail Hakkı. "Detection of animalspecies in some meat and meat products by comparatively using DNA Microarray and Real time PCRmethods", Kafkas Üniversitesi, 2013.

46 words / < 1% match - PublicationsAppel, Bernd, Filter, Matthias, Johne, Reimar and Schielke, Anika. "Thermal stability of hepatitis E virusassessed by a molecular biological approach", Infektionsepidemiologie, 2011.

45 words / < 1% match - Internet from 16-Aug-2010 12:00AMfaculty.vetmed.ucdavis.edu

44 words / < 1% match - Internet from 29-Jan-2012 12:00AMdaff.gov.au

44 words / < 1% match - Internet from 05-May-2012 12:00AMwww.cs.afrims.org



42 words / < 1% match - Internet from 13-Sep-2018 12:00AMwww.vhpb.org

42 words / < 1% match - Internetntp.niehs.nih.gov

42 words / < 1% match - Internet from 27-Jul-2013 12:00AMwww.veteffect.nl

41 words / < 1% match - Internet from 01-Nov-2013 12:00AMwww.vetmed.vt.edu

41 words / < 1% match - Internet from 11-Oct-2017 12:00AMhal.archives-ouvertes.fr

41 words / < 1% match - Internet from 22-Aug-2014 12:00AMwww.cienciaanimal.ufpa.br

40 words / < 1% match - Internet from 15-Mar-2012 12:00AMwww.europic.org.uk

39 words / < 1% match - Internet from 13-Aug-2012 12:00AMwww.imi.si

39 words / < 1% match - Internet from 24-Jan-2014 12:00AMwww.jci.org

39 words / < 1% match - Internet from 11-Dec-2011 12:00AMwww.avian.uga.edu

38 words / < 1% match - Internet from 05-Jun-2015 12:00AMwww.acpv.info

37 words / < 1% match - Publications"New Norovirus Study Findings Have Been Reported by Researchers at Children's Hospital (Increasedand", Science Letter, June 3 2016 Issue

36 words / < 1% match - Internet from 05-Jun-2012 12:00AMwww.biosecurity.govt.nz

36 words / < 1% match - Internet from 12-Mar-2016 12:00AMwww.mdpi.com



36 words / < 1% match - Internet from 28-Mar-2011 12:00AMjsv.umin.jp

36 words / < 1% match - PublicationsScholtes, Caroline. "Chronic Genotype 3 Hepatitis E in Pregnant Woman Receiving In�iximab andAzathioprine.(RESEARCH LETTERS)", Emerging Infectious Diseases

35 words / < 1% match - Internet from 07-Feb-2012 12:00AMwww.wildlifedisease.org

34 words / < 1% match - Internet from 12-Dec-2018 12:00AMwww.pnas.org

34 words / < 1% match - Internet from 14-Jan-2014 12:00AMsegsydney.com.au

34 words / < 1% match - PublicationsHANSEN, Peter James, DENICOL, Anna Carolina and DOBBS, Kyle Bradley. "Maternal embryokines thatregulate development of the bovine preimplantation embryo", TÜBİTAK, 2014.

34 words / < 1% match - PublicationsAhlemeyer, Gabriele, Beyrer, Konrad, Dreesman, Johannes, Feil, Fabian, Hornig, Angelika, Kirchner,Markus, Krause, Gérard, Mankertz, Annette, Marcic, Anne, Matysiak-Klose, Dorothea, Reiter, Sabine,Santibanez, Sabine, Scharkus, Sibylle, Siedler, Anette and Wichmann, Ole. "Closer to the Goal: Effortsin Measles Elimination in Germany 2010", Infektionsepidemiologie, 2011.

33 words / < 1% match - Internet from 15-Dec-2014 12:00AMrepository.ias.ac.in

33 words / < 1% match - Internet from 21-Jan-2014 12:00AMps.fass.org

33 words / < 1% match - Internet from 16-Oct-2012 12:00AMwww.afrims.org

33 words / < 1% match - Internet from 29-Jul-2013 12:00AMwww.mdpi.com

33 words / < 1% match - Internet from 27-Jan-2015 12:00AMwww.listeriosis-listeriose.investigation-enquete.gc.ca

32 words / < 1% match - Internet from 27-Mar-2009 12:00AMwww.oie.int



31 words / < 1% match - Internet from 02-Oct-2013 12:00AMwww.virosin.org

31 words / < 1% match - Internet from 19-Sep-2011 12:00AMaac.asm.org


31 words / < 1% match - Internet from 22-Sep-2013 12:00AMwww.els.net

31 words / < 1% match - Internet from 10-Feb-2014 12:00AMwww.medcamer.org

31 words / < 1% match - PublicationsMiao, Zengmin. "Detection and Characterization of Hepatitis E Virus in Goats at Slaughterhouse inTai'an Region, China.(Research Article)(Report)", BioMed Research International

30 words / < 1% match - Internet from 22-May-2012 12:00AMetd.uovs.ac.za

30 words / < 1% match - Internet from 06-Nov-2010 12:00AMwww.avian.uga.edu

30 words / < 1% match - PublicationsAbraham, Priya. "Expanded diagnostic approach to hepatitis E virus detection in patients with acute-on-chronic liver failure: A pilot study.(Original Article)(Clinical report)", Indian Journal of MedicalMicrobiology

29 words / < 1% match - Internet from 30-Jan-2016 12:00AMwww.wjgnet.com

29 words / < 1% match - Internet from 27-Nov-2015 12:00AMwww.researchgate.net

29 words / < 1% match - Internet from 11-Sep-2016 12:00AMftp.palgrave-journals.com

29 words / < 1% match - Internet from 14-Dec-2005 12:00AMvir.sgmjournals.org



29 words / < 1% match - Internet from 10-Oct-2013 12:00AMwww.klimik.org.tr

29 words / < 1% match - PublicationsDOAN, Huong Thi Thanh, LE, Xuyen Thi Kim, DO, Roan Thi, NGUYEN, Khue Thi and LE, Thanh Hoa."Sequencing and Phylogenetic Analysis Reveal the Prevalence of Duck Hepatitis A Virus Genotype-3 inVietnam", Kafkas Üniversitesi, 2017.

28 words / < 1% match - Internet from 20-Jan-2014 12:00AMwww.ciwf.org.uk

28 words / < 1% match - Internet from 25-Oct-2018 12:00AMvdocuments.site

28 words / < 1% match - Internet from 11-Aug-2013 12:00AMwww.rdb.or.kr

28 words / < 1% match - Internet from 23-Sep-2013 12:00AMwww.sciencedirect.com

28 words / < 1% match - PublicationsJournal of Manufacturing Technology Management, Volume 26, Issue 2 (2015)

27 words / < 1% match - Internet from 18-Jun-2011 12:00AMbuy-cheap.lp-idaho.org

27 words / < 1% match - Internet from 02-Jul-2013 12:00AMwww.elbiruniblogspotcom.blogspot.hk

27 words / < 1% match - Internet from 01-Mar-2012 12:00AMdaff.gov.au

27 words / < 1% match - Internet from 24-Aug-2014 12:00AMgeb.uni-giessen.de

27 words / < 1% match - Internet from 20-May-2012 12:00AMwww.spvet.it

27 words / < 1% match - Internet from 25-Jul-2013 12:00AMwww.burnet.edu.au

27 words / < 1% match - Internet from 08-Feb-2006 12:00AM



diaglab.vet.cornell.edu

27 words / < 1% match - Internet from 01-Jun-2013 12:00AMwww.bic.canterbury.ac.nz

26 words / < 1% match - Internet from 09-Dec-2016 12:00AMjgv.microbiologyresearch.org

26 words / < 1% match - Internet from 03-May-2011 12:00AMwww.cahfs.ucdavis.edu

26 words / < 1% match - Internet from 26-Jan-2015 12:00AMwww.science.gov

26 words / < 1% match - Internetwww.fccc.edu

26 words / < 1% match - PublicationsGiordani, Maria T. Fabris, Paolo Brunett. "Hepatitis E and Lymphocytic Leukemia in Man, Italy.(LETTERS)(Clinical report)(Letter to the editor)", Emerging Infectious Diseases, Dec 2013 Issue

25 words / < 1% match - Internet from 22-Nov-2012 12:00AMwww.pvj.com.pk

25 words / < 1% match - Internet from 08-Sep-2017 12:00AMhzi.openrepository.com

24 words / < 1% match - Internet from 31-Oct-2012 12:00AMwww.es.lancs.ac.uk

24 words / < 1% match - Internet from 03-Jul-2013 12:00AMblog.chinesemeddiets.com

24 words / < 1% match - Internet from 20-Oct-2013 12:00AMsu.diva-portal.org

24 words / < 1% match - Crossref Posted ContentNian Yang, Jennifer McLelland, David McLelland, Judy Clarke, Lucy Woolford, Paul Eden, David Phalen."Psittacid Adenovirus-2 infection in the critically endangered orange-bellied parrot (Neophemachrysogastor): A key threatening process or an example of a host-adapted virus?", Cold Spring HarborLaboratory, 2018

23 words / < 1% match - Internet from 31-Mar-2012 12:00AM



www.wjgnet.com


23 words / < 1% match - Internet from 01-Dec-2013 12:00AMwww.picornaviridae.com

23 words / < 1% match - Internet from 07-Aug-2012 12:00AMwww.isvhld2012.org

23 words / < 1% match - PublicationsLegrand-Abravanel, Florence Mansuy, Jean. "Hepatitis E virus genotype 3 diversity, France.(DISPATCHES)", Emerging Infectious Diseases, Jan 2009 Issue

23 words / < 1% match - Publications"New hepatitis E virus research from University of Berlin outlined.", Hepatitis Weekly, June 1 2009Issue

22 words / < 1% match - Internet from 03-Oct-2010 12:00AMwww.hotgen.com.cn

22 words / < 1% match - Internet from 07-Dec-2013 12:00AMwww.hivpepsingapore.com

22 words / < 1% match - PublicationsArbab, Ahmed H. Parvez, Mohammad K. Al-D. "Hepatoprotective and antiviral e�cacy of Acaciamellifera leaves fractions against hepatitis B vir", BioMed Research International, Annual 2015 Issue

21 words / < 1% match - Internetvir.sgmjournals.org

21 words / < 1% match - Internet from 16-Nov-2010 12:00AMetd.ohiolink.edu

21 words / < 1% match - PublicationsYENTÜR DONİ, Nebiye, ŞİMŞEK, Zeynep, GÜRSES, Gülcan, YILDIZ ZEYREK, Fadile and AKBABA,Muhsin. "The knowledge and high seroprevalence of hepatitis A in a high-risk group (agriculturalreproductive-aged women) in the southeastern region of Turkey", TÜBİTAK, 2017.

20 words / < 1% match - Internet from 03-Sep-2013 12:00AMphage-therapy.org



20 words / < 1% match - Internet from 25-Sep-2014 12:00AMwww3.niddk.nih.gov

20 words / < 1% match - Internet from 09-Jul-2016 12:00AMwww.intechopen.com

20 words / < 1% match - Internet from 11-Feb-2008 12:00AMwww.animalgenome.org

20 words / < 1% match - Internet from 26-Dec-2012 12:00AMwww.medworm.com


19 words / < 1% match - Internet from 17-Sep-2012 12:00AMwww.biomedcentral.com


19 words / < 1% match - Internet from 04-Oct-2016 12:00AMja.scribd.com

19 words / < 1% match - Internet from 29-Jul-2012 12:00AMwwwnc.cdc.gov

19 words / < 1% match - Internet from 17-Nov-2016 12:00AMwww.wjgnet.com

19 words / < 1% match - Internet from 24-May-2014 12:00AMwww.jalas.jp

19 words / < 1% match - Internet from 02-Dec-2013 12:00AMwww.researchgate.net

19 words / < 1% match - Internet from 19-Mar-2012 12:00AMwww.virologyj.com

19 words / < 1% match - Internet from 14-Oct-2011 12:00AMacademicjournals.org



19 words / < 1% match - Crossref Posted ContentMark Kowarsky, Iwijn De Vlaminck, Jennifer Okamoto, Norma F Neff et al. "Cell-free DNA RevealsPotential Zoonotic Reservoirs in Non-Human Primates", Cold Spring Harbor Laboratory, 2018

18 words / < 1% match - Internet from 31-May-2012 12:00AMen.fftc.org.tw

18 words / < 1% match - Internet from 06-Feb-2017 12:00AMonlinelibrary.wiley.com

18 words / < 1% match - Internet from 01-Mar-2015 12:00AMwww.cnrvha-vhe.org

18 words / < 1% match - Internet from 28-Oct-2013 12:00AMwww.nimr.mrc.ac.uk

18 words / < 1% match - Internet from 13-Dec-2013 12:00AMwww.jneuroin�ammation.com

18 words / < 1% match - PublicationsRAJANİ, Monika. "Hindistan kentsel kesimde bir üçüncü basamak hastanesinde fekal-oral yollabulaşan viral hepatit", Sağlık Araştırmaları Derneği, 2013.

18 words / < 1% match - PublicationsMartelli, Francesca <1980>(Ostanello, dott. Fabio). "L'epatite E nei suidi: epidemiologia, diagnosi e�logenesi", Alma Mater Studiorum - Università di Bologna, 2011.

16 words / < 1% match - Internet from 27-Aug-2012 12:00AMsuperstarsofscience.com

16 words / < 1% match - Internet from 04-Dec-2014 12:00AMwww.cdc.gov

16 words / < 1% match - Internet from 10-Jan-2014 12:00AMwww.biosecurity.govt.nz

16 words / < 1% match - PublicationsTan, Boon Hooi Leow, Thean Chor Foo, Hoo. "Molecular characterization of a recombinant manganesesuperoxide dismutase from Lactococcus lactis M", BioMed Research International, Annual 2014 Issue

15 words / < 1% match - Internet from 22-Sep-2010 12:00AMwww.jwildlifedis.org



15 words / < 1% match - Internet from 03-Aug-2012 12:00AMwww.biojournals.com

15 words / < 1% match - Internet from 15-Sep-2012 12:00AMwww.aasp.org

15 words / < 1% match - Internet from 13-Oct-2013 12:00AMwww.crosbi.znanstvenici.hr

15 words / < 1% match - Internet from 20-Nov-2013 12:00AMzhion.com

14 words / < 1% match - Internet from 21-Apr-2016 12:00AM948.indexcopernicus.com

14 words / < 1% match - Internetvetgate.ac.uk

14 words / < 1% match - Internet from 25-Mar-2012 12:00AMchori.academia.edu

14 words / < 1% match - Publications"New Virology Study Findings Recently Were Reported by Researchers at Shandong AgriculturalUniversit", Life Science Weekly, Dec 18 2012 Issue

14 words / < 1% match - PublicationsRutz, Sascha Kayagaki, Nobuhiko Phung, Q. "Deubiquitinase DUBA is a post-translational brake oninterleukin-17 production in T cells.(RESEARCH:", Nature, Feb 19 2015 Issue

13 words / < 1% match - Internet from 18-Sep-2012 12:00AMwww.biomedcentral.com

13 words / < 1% match - Internetbibd.uni-giessen.de

13 words / < 1% match - Internet from 01-Dec-2010 12:00AMwww.snarc.ars.usda.gov

13 words / < 1% match - Internet from 14-Oct-2010 12:00AMwww.cloetta-stiftung.ch

13 words / < 1% match - Internet from 11-Mar-2013 12:00AMen.wikipedia.org



13 words / < 1% match - Internet from 13-Aug-2013 12:00AMopexatherapeutics.com

13 words / < 1% match - Publications"VIRGINIA TECH RESEARCHER WORKS TO END GASTRIC ILLNESS IN PEOPLE, INCREASEPRODUCTION OF PIGS.", States News Service, April 17 2015 Issue

12 words / < 1% match - Internet from 11-Nov-2008 12:00AMjgv.sgmjournals.org

12 words / < 1% match - Internet from 02-Oct-2010 12:00AMlib.bioinfo.pl

12 words / < 1% match - Internet from 06-Dec-2012 12:00AMwww.rothamsted.ac.uk

12 words / < 1% match - Internet from 17-Jun-2011 12:00AMwww.todaysengineer.org

12 words / < 1% match - Internet from 14-Jun-2012 12:00AMwwwnc.cdc.gov

12 words / < 1% match - Internet from 29-Jul-2014 12:00AMwww.vetmed.vt.edu

12 words / < 1% match - Publications"Study Findings from Fujian Medical University Provide New Insights into Helicobacter pylori (Impact ",Health & Medicine Week, Oct 30 2015 Issue

12 words / < 1% match - Publications"New pig virus found to be a potential threat to humans.", Space Daily

12 words / < 1% match - Publications"Letters to the Editor.", Image: Journal of Nursing Scholarship, Fall 1999 Issue

11 words / < 1% match - Internet from 12-Nov-2008 12:00AMwww.vetmed.iastate.edu

11 words / < 1% match - Internet from 08-Aug-2014 12:00AMwww.oie.int



11 words / < 1% match - Internetwww.merckbooks.com

11 words / < 1% match - Internet from 13-Dec-2012 12:00AMscholar.lib.vt.edu

11 words / < 1% match - Internetwww.merckvetmanual.com

11 words / < 1% match - Internet from 04-Nov-2012 12:00AMwww.biosecurity.govt.nz

11 words / < 1% match - Internet from 18-Jul-2013 12:00AMwww.traveldoctoronline.net

11 words / < 1% match - Internet from 07-Nov-2013 12:00AMwww.biolegend.de

11 words / < 1% match - PublicationsTakahashi, Kazuaki Okamoto, Hiroaki Abe,. "Virulent strain of Hepatitis E virus genotype 3, Japan.(RESEARCH)", Emerging Infectious Diseases, May 2009 Issue

11 words / < 1% match - Publications"Research from China Agricultural University broadens understanding of hepatitis.", Hepatitis Weekly,July 13 2009 Issue

11 words / < 1% match - PublicationsMacLean, Dick J. Arthur, J. Richard Ward. "Common-source outbreak of acute infection due to theNorth American liver �uke Metorchis conjunctus", The Lancet, Jan 20 1996 Issue

11 words / < 1% match - Publications"Reports from Virginia Tech Describe Recent Advances in Reproduction and Fertility (Biallelic modi�c",Life Science Weekly, Nov 29 2016 Issue

11 words / < 1% match - PublicationsGuo, Peng Hirano, Masayuki Herrin, Brant. "Dual nature of the adaptive immune system in lampreys.(Report)", Nature, June 11 2009 Issue

10 words / < 1% match - Internet from 21-Sep-2011 12:00AMdels-old.nas.edu

10 words / < 1% match - Internet from 10-Sep-2013 12:00AMfacsmail.org



10 words / < 1% match - Internet from 24-Aug-2014 12:00AMwww.vetres.org

10 words / < 1% match - Internet from 19-Oct-2018 12:00AMonlinelibrary.wiley.com

10 words / < 1% match - Internet from 30-May-2014 12:00AMwwwnc.cdc.gov

10 words / < 1% match - Internet from 17-Feb-2014 12:00AMwww.uptodate.com

10 words / < 1% match - Internet from 20-Nov-2016 12:00AMwwwnc.cdc.gov

10 words / < 1% match - Internet from 07-Feb-2014 12:00AMwww.paza.ca

10 words / < 1% match - Internet from 25-Dec-2012 12:00AMhepatop.biopredictive.com

10 words / < 1% match - Internet from 29-Jun-2013 12:00AMwww.ilovereading.com.au

10 words / < 1% match - Internet from 21-Aug-2011 12:00AMwww.helpforhomeowners.org

10 words / < 1% match - Internet from 12-Mar-2012 12:00AMwww.multimericbio.com

10 words / < 1% match - Internet from 23-Nov-2013 12:00AMwww.vtnews.vt.edu

10 words / < 1% match - PublicationsSonder, Gerard J.B.. "Hepatitis E in Long-Term Travelers from the Netherlands to Subtropical andTropical Countries, 2008-2011.", Emerging Infectious Diseases

10 words / < 1% match - PublicationsBald, Tobias Quast, Thomas Landsberg, Jennifer Rogava, Meri Glodde, Nicole Lopez-Ramos, DorysKohlme. "Ultraviolet-radiation-induced in�ammation promotes angiotropism and metastasis inmelanoma.(RESEARC", Nature, March 6 2014 Issue

9 words / < 1% match - Internet from 07-Feb-2012 12:00AM



www.hepatologytextbook.com

9 words / < 1% match - Internet from 22-Sep-2013 12:00AMwww.jci.org

9 words / < 1% match - Internet from 06-Oct-2010 12:00AMwww.plosone.org

9 words / < 1% match - Internet from 30-May-2014 12:00AMwwwnc.cdc.gov

9 words / < 1% match - Internet from 15-Dec-2010 12:00AMwww.biomedcentral.com

9 words / < 1% match - Internet from 18-Sep-2014 12:00AMmicrobial-intelligence-group.us

9 words / < 1% match - Internet from 18-Oct-2011 12:00AMmemorias.ioc.�ocruz.br

9 words / < 1% match - Internet from 13-Dec-2010 12:00AMwww.biomedcentral.com

9 words / < 1% match - Internet from 11-Jun-2015 12:00AMresearchers.general.hokudai.ac.jp

9 words / < 1% match - Internet from 27-Nov-2015 12:00AMwww.who.int

9 words / < 1% match - Internet from 09-Oct-2011 12:00AMwww.veec.nl

9 words / < 1% match - Internet from 21-Apr-2013 12:00AMwww.nzpib.co.nz

9 words / < 1% match - Internet from 11-Jun-2012 12:00AMdels-old.nas.edu

9 words / < 1% match - Internetwww.poultryscience.org

9 words / < 1% match - Internet from 04-Aug-2012 12:00AM



endeavourpartners.net

9 words / < 1% match - Internet from 03-Aug-2013 12:00AMwww.affymetrix.co.jp

9 words / < 1% match - Internet from 15-Dec-2013 12:00AMwww.science.gov

9 words / < 1% match - PublicationsImamura, T. Yokosuka, O. Kurihara, T. Ka. "Distribution of hepatitis B viral genotypes and mutations inthe core promoter and precore regions i", Gut, Nov 2003 Issue

9 words / < 1% match - PublicationsRudolf, Rebeka Tomic, Sergej Anzel, Ivan Hartner, Tjasa Zupancic Colic, Miodrag. "Microstructure andbiocompatibility of gold-lanthanum strips.(ORIGINAL PAPER)(Report)", Gold Bulletin, Dec 2014 Issue

9 words / < 1% match - PublicationsWorld Veterinary Poultry Association(Klinik für Vögel, Reptilien, Amphibien und Fische). "Proceedings/ V. International Symposium on Avian Corona- and Pneumoviruses and Complicating Pathogens,Rauischholzhausen, Germany, 14-16 May 2006 ", Justus-Liebig-Universität Gießen, 2006.

9 words / < 1% match - PublicationsLiang, Chao Guo, Baosheng Wu, Heng Shao,. "Aptamer-functionalized lipid nanoparticles targetingosteoblasts as a novel RNA interference-based b", Nature Medicine, March 2015 Issue

paper text:

Pathogenesis and Cross-species Infection of Hepatitis E Virus Danielle M. Yugo

Dissertation submitted to the faculty of the Virginia Polytechnic Institute and State University in partial

ful�llment of the requirements for the degree of Doctor of Philosophy In Biomedical Sciences and

Pathobiology Dr. Xiang-Jin Meng, Committee Chair Dr. F. William Pierson Dr. Virginia Buechner-Maxwell Dr. Isis

Kanevsky December 11, 2018 Blacksburg, VA Keywords: Hepatitis E Virus (HEV); gnotobiotic pig; Ig heavy-

chain knock-out; novel model; animal reservoir; bovine; seroprevalence; cross-species infection Pathogenesis

and Cross-species Infection of Hepatitis E Virus Danielle M. Yugo ABSTRACT

Hepatitis E Virus (HEV), the causative agent of hepatitis E, is a zoonotic pathogen of worldwide

signi�cance. The genus Orthohepevirus A of the family Hepeviridae



includes all mammalian strains of HEV and consists of 8 recognized genotypes. Genotypes 1 and 2 HEVs only

infect humans and

genotypes 3 and 4 infect humans and several other animal species including pigs and

rabbits. An ever-expanding host range of genetically-diversi�ed strains of HEV now include bat, �sh, rat, ferret,

moose, wild boar, mongoose, deer, and camel. Additionally, the ruminant species goats, sheep, and cattle have

been implicated as potential reservoirs as well. My dissertation research investigates a novel animal model for

HEV, examines the immune dynamics during acute infection, and evaluates the possibility of additional animal

reservoirs of HEV. The �rst project established an immunoglobulin (Ig) heavy chain knock-out JH (-/-)

gnotobiotic piglet model that mimics the course of acute HEV infection observed in humans and evaluated the

pathogenesis of HEV infection in this novel animal model. The dynamics of acute HEV infection in gnotobiotic

pigs were systematically determined with a genotype 3 human strain of HEV. We also investigated the potential

role of immunoglobulin heavy-chain JH in HEV pathogenesis and immune dynamics during the acute stage of

virus infection. This novel gnotobiotic pig model will aid in future studies into HEV pathogenicity, an aspect

which has thus far been di�cult to reproduce in the available animal model systems. The objective of the

second project for my PhD dissertation was to determine if cattle in the United States are infected with a

bovine strain of HEV. We demonstrated serological evidence of an HEV-related agent in cattle populations with

a high level of IgG anti-HEV prevalence. We demonstrated that calves from a seropositive cattle herd

seroconverted to IgG binding HEV during a prospective study. We also showed that the IgG anti-HEV present in

cattle has an ability to neutralize genotype 3 human HEV in vitro. However, our exhaustive attempts to detect

HEV- related sequence from cattle in the United States failed, suggesting that one should be cautious in

interpreting the IgG anti-HEV serological results in bovine and other species. Collectively, the work from my

PhD dissertation delineated important mechanisms in HEV pathogenesis and established a novel animal

model for future HEV research. Pathogenesis and Cross-species Infection of Hepatitis E Virus Danielle M. Yugo

GENERAL AUDIENCE ABSTRACT

Hepatitis E Virus (HEV), the causative agent of hepatitis E, is a zoonotic pathogen of

worldwide signi�cance. According to the World Health Organization, there are approximately

20 million HEV infections annually, which result in 3. 3 million cases of acute hepatitis E and >44

,000 HEV-related deaths. Hepatitis E is

a self-limiting acute disease in general, but carries the ability to cause

high mortality in pregnant women and chronic hepatitis in immunocompromised

individuals. The underlying mechanisms of HEV host tropism and progression of disease to chronicity are

unknown. My dissertation work investigates a novel animal model for HEV, evaluates the possibility of

additional animal reservoirs of HEV, and examines the immune dynamics during acute infection. The �rst



project established an immunoglobulin (Ig) heavy chain knock-out JH (-/-) gnotobiotic piglet model that mimics

the course of acute HEV infection observed in humans. The dynamics of acute HEV infection were determined

in both the knock-out and wild-type piglets with a genotype 3 strain of human HEV. We also investigated the

potential role of immunoglobulin heavy-chain JH in HEV pathogenesis and virus infection. In the second

project, we determined if cattle in the United States are infected with a bovine strain of HEV. We showed

serological evidence of an HEV-related agent in cattle as well as calves born in a seropositive herd. Despite the

detection of speci�c antibodies recognizing HEV in cattle, de�nitive evidence of virus infection could not be

demonstrated. Our exhaustive attempts to detect HEV-related sequence from cattle in the United States failed,

suggesting that one should be cautious in interpreting the IgG anti-HEV serological results in bovine and other

species. Collectively, the work from my PhD dissertation research delineated important mechanisms in HEV

pathogenesis and established a novel animal model for future HEV research. ACKNOWLEDGEMENTS I am

extremely grateful to my advisor, Dr. X.J. Meng, for his continuing support, experience, and encouragement

throughout this journey. My success in graduate school was greatly impacted by his expertise and direction.

Under his mentorship, I have developed as a scientist, writer, veterinarian, and expert in our �eld. I am forever

thankful.

I would like to thank my committee members, Dr. Bill Pierson, Dr. Isis Kanevsky, and

Dr. Virginia Buechner-Maxwell for their continued encouragement, support, and assistance on my many

graduate career projects. I greatly appreciate the amount of time and effort they committed on my behalf.

I would also like to thank my collaborators, Dr. Lijuan Yuan and her lab, Dr.

Kiho Lee and his lab, Dr. Tanya LeRoith, Dr. Tom Cecere, Dr. Sherrie Clark-Deener, Dr. Tanja Opriessnig, Dr. Anbu

Karuppannan Dr. Amelia Woolums, Dr. David Hurley, Dr. Eric Delwart and his lab, and Dr. Amit Kapoor for the

assistance, samples, expertise, and editing that made my projects a success. I am forever grateful to my

current and past lab mates Dr. Caitlin Cossaboom, Dr. Yao-Wei Huang, Dr. Scott Kenney, Dr. Sakthivel

Subramaniam, Dr. Shannon Matzinger, Dr. Chris Overend, Dr. Dianjun Cao, Dr. Harini Sooryanarain, Dr. Pablo

Pineyro, Nick Catanzano, Dr. Qian Cao, Dr. Debin Tian, and Dr. Adam Rogers, who provided insight, support,

suggestions, and critiques and without them, the many animal projects would never have been completed. A

special thanks goes to my lab manager and friend Lynn Heffron who spent many weekends, evenings, and

holidays helping me complete my projects, providing never ending support and encouragement, and who

always made the journey memorable and fun. Lastly, I owe much gratitude to my family and friends who stood

by me every day as my biggest supporters. Most importantly, my boyfriend Matt who never fails to listen and

always makes me smile and my daughter Vienna who provided me endless support, never complained vi (too

much) about the late nights, my forgetfulness, or granola bars for dinner, and was the source of my drive and

ambition. This research was supported by grants from the National Institutes of Health (R01AI074667,

R01AI050611), VMCVM O�ce of Research and Graduate Studies, and Virginia Tech internal funds. I am

supported by a training grant from the National Institutes of Health (T32OD010430-06) vii ATTRIBUTIONS All of



this work would have been impossible without the contributions and dedication of many colleagues who were

an integral part of the research, writing, and editing of all projects in this dissertation. Chapters 1 through 5:

Xiang-Jin Meng, M.S., M.D., Ph.D. (Department of Biomedical Sciences) is a University Distinguished Professor

at Virginia Tech and is the corresponding author on these manuscripts. He aided in project development,

writing, and editing of all manuscripts and provided expertise throughout all projects. Chapters 2 and 5: Caitlin

M. Cossaboom,

D.V.M., M. P.H., Ph.D. was a Ph.D. student (Department of Biomedical and Veterinary

Sciences)

and a coauthor on these manuscript. She helped with writing and editing the manuscript for Chapter 2 and

helped with animal manipulation and editing of the manuscript for Chapter 5. Chapter 3: Ruediger Hauck, Ph.D.

is a coauthor on this manuscript and was a Postdoctoral Fellow at the University of California, Davis, CA

(Department of Population Health and Reproduction). He aided in writing and editing the manuscript and

provided the gross and histopathological lesion images. H.L. Shivaprasad, M.S., D.V.M., Ph.D., DACPV is a

coauthor on this manuscript and is currently a Professor of Avian Pathology with the

California Animal Health and Food Safety Lab, University of California, Davis.

He aided in writing and editing the manuscript and provided the gross and histopathological lesion images.

Chapters 4 through 5: C. Lynn Heffron, B.S. is a coauthor on these manuscripts and the current Laboratory

Manager of the Meng Lab (Department of Biomedical Sciences and Pathobiology, Virginia Tech). She helped

with project development, animal manipulation, sample collection, processing, data analysis, and editing of the

manuscripts. Scott. P. Kenney, B.S., Ph.D., is a coauthor on these manuscripts and is

an Assistant Professor (Department of Veterinary Preventive Medicine, Food Animal Health Research

Program,

Ohio State University). He helped with animal manipulation and editing of the manuscript for Chapter 4, and

animal manipulation, project development and design, and editing of the manuscripts for Chapters 5. viii

Chapter 4: Junghyun Ryu is a coauthor on this manuscript and a Ph.D. student (Department of Animal and

Poultry Science, Virginia Tech). He helped in the development and production of CRISPR/Cas9 Ig-heavy chain

knock-out piglets and aided in writing and editing the manuscript. Kyungjun Uh is a coauthor on this

manuscript and a Ph.D. student (Department of Animal and Poultry Science, Virginia Tech). He helped in the

development and production of CRISPR/Cas9 Ig-heavy chain knock-out piglets and aided in writing and editing

the manuscript. Sakthivel Subramaniam, D.V.M., Ph.D., is a coauthor on this manuscript and is currently a

Postdoctoral Associate (Department of Biomedical and Veterinary Sciences, Virginia Tech). He helped with

animal manipulation and editing of the manuscript. Shannon R. Matzinger, Ph.D., is a coauthor on this

manuscript and was a Research Scientist (Department of Biomedical and Veterinary Sciences, Virginia Tech).

She helped with animal manipulation and editing of the manuscript. Christopher Overend, Ph.D., is a coauthor



on this manuscript and was a Postdoctoral Associate (Department of Biomedical and Veterinary Sciences,

Virginia Tech). He helped with animal manipulation and editing of the manuscript. Dianjun Cao, D.V.M., Ph.D., is

a coauthor on this manuscript and was a Research Scientist (Department of Biomedical and Veterinary

Sciences, Virginia Tech). He helped with animal manipulation and editing of the manuscript. Harini

Sooryanarain, Ph.D., is a coauthor on this manuscript and is a Postdoctoral Associate (Department of

Biomedical and Veterinary Sciences, Virginia Tech). She helped with animal manipulation and editing of the

manuscript. Thomas Cecere, D.V.M., Ph.D., DACVP, is a coauthor on this manuscript and is currently

an Assistant Professor in Anatomic Pathology (Department of Biomedical Sciences and Pathobiology,

Virginia Tech).

He participated in the necropsies, completed the histopathological analyses, and aided in editing the

manuscript. Tanya LeRoith, D.V.M., Ph.D., DACVP, is a coauthor on this manuscript and is currently a Clinical

Professor in Anatomic Pathology (Department of Biomedical Sciences and Pathobiology, Virginia Tech). She

participated in the necropsies and aided in editing the manuscript. Lijuan Yuan, Ph.D., is a coauthor on this

manuscript and is currently

an Associate Professor in Virology and Immunology (Department of Biomedical Sciences and

Pathobiology, Virginia

Tech). She provided expertise in project development and helped edit the manuscript. Nathaniel Jue, B.S.,

D.V.M., is a coauthor on this manuscript and is currently a Masters Student and Surgical Resident (Department

of Large Animal Clinical Sciences, Virginia Tech). He helped in the animal manipulation and production of

CRISPR/Cas9 heavy-chain knock-out piglets and aided in editing the manuscript. ix Sherrie Clark-Deener,

D.V.M., Ph.D., DACT, is a coauthor on this manuscript and

an Associate Professor in Theriogenology (Department of Large Animal Clinical Sciences,

Virginia Tech). She aided in the animal manipulation, development and production of CRISPR/Cas9 heavy-

chain knock-out piglets, and aided in editing the manuscript. Kiho Lee, M.S., Ph.D., is a coauthor on this

manuscript and is currently an Assistant Professor (Department of Animal and Poultry Science, Virginia Tech).

He helped in the development and production of CRISPR/Cas9 Ig-heavy chain knock-out piglets and aided in

editing the manuscript. Chapter 5: Yao-Wei Huang, B.S., Ph.D., is a coauthor on this manuscript and was a

Research Scientist (Department of Biomedical Sciences and Pathobiology, Virginia Tech). He helped in project

development, training on assays and collection of data and aided in editing the manuscript. Amelia R.

Woolums, M.Sc., D.V.M., Ph.D., DACVIM, DACVM, is a coauthor on this manuscript and is currently a Professor

(Department of Pathobiology and Population Medicine, Mississippi State University). She provided the "Georgia

herd" samples for the project and aided in editing the manuscript. David J. Hurley, B.A., Ph.D., is a coauthor on

this manuscript and is currently a Professor



(Department of Large Animal Medicine, College of Veterinary Medicine, University of Georgia). He provided

the

"Georgia herd" samples for the project and aided in editing the manuscript. Linlin Li, R.N., Ph.D., is a coauthor

on this manuscript and a

Professor (Department of Family Health Care Nursing, University of California, San Francisco).

She helped in processing the samples using next generation sequencing (MiSeq) and aided in editing the

manuscript. Eric Delwart, B.Sc., M.Sc., Ph.D., is a coauthor on this manuscript and

is currently a Professor (Department of Laboratory Medicine, University of California, San Francisco).

He helped in providing expertise in project design, processed the samples using next generation sequencing

(MiSeq), and aided in editing the manuscript. Isis Kanevsky, B.S., Ph.D., is a coauthor on this manuscript and

was a Professor (Department of Dairy Science, Virginia Tech). She provided expertise in project design,

provided the "Virginia Dairy herd" for sampling, and aided in editing the manuscript. Tanja Opriessnig, BVSc.,

D.V.M., Ph.D., is a coauthor on these manuscripts and is currently a Professor at

Iowa State University (Veterinary Diagnostic Laboratory, Department of Veterinary Diagnostic and Production

Animal Medicine) and a

Professor

at the University of Edinburgh (Royal (Dick) School of Veterinary Medicine, Chair of

Infectious Disease Pathology). She provided the bovine samples from herds across the Midwestern United

States for analysis in the project for Chapter 5, helped with animal project organization, sample collection,

sample processing x DEDICATION For my daughter, Vienna. xi TABLE OF CONTENTS

ABSTRACT...................................................................................................................................ii GENERAL

AUDIENCE ABSTRACT.......................................................................................iv

ACKNOWLEDGEMENTS.........................................................................................................vi

ATTRIBUTIONS.......................................................................................................................viii

DEDICATION..............................................................................................................................xi

TABLE OF CONTENTS............................................................................................................ xii LIST OF

TABLES....................................................................................................................... xv LIST OF

FIGURES....................................................................................................................

xvi GENERAL INTRODUCTION..................................................................................................xix

REFERENCES...........................................................................................................................xxi CHAPTER I:

Hepatitis E Virus: Foodborne, Waterborne, and Zoonotic

Transmission..................................................................................................................................1



Abstract...................................................................................................................................2

Introduction............................................................................................................................3 HEV Classi�cation and

Biology............................................................................................3 HEV

Pathogenesis..................................................................................................................6 Epidemiology of HEV

Infection............................................................................................9 Environmental Contamination and

Waterborne Transmission......................................10 Foodborne Transmission and Food

Safety........................................................................13 Known and Potential Animal

Reservoirs...........................................................................16 Animal Handling and Zoonotic

Transmission...................................................................21

Conclusions...........................................................................................................................22

Acknowledgements...............................................................................................................23 References and

Notes...........................................................................................................25 CHAPTER II: Naturally Occurring

Animal Models of Human Hepatitis E Virus

Infection........................................................................................................................................41

Abstract.................................................................................................................................42

Introduction..........................................................................................................................43 Historical Animal

Models for Human Hepatitis E............................................................46 Naturally Occurring HEV Infections in

Animals..............................................................47 xii Naturally Occurring Animal Models for Human Hepatitis

E.........................................49 Application of Naturally Occurring Animal Models for HEV

Studies...........................56 Future

Perspectives..............................................................................................................64

Acknowledgements...............................................................................................................65

References.............................................................................................................................66

Tables.....................................................................................................................................73

Figure.....................................................................................................................................76 Chapter III: Hepatitis

Virus Infections in Poultry...................................................................77

Summary...............................................................................................................................78

Introduction..........................................................................................................................80 Avian Hepatitis E Virus

(Avian HEV) ..............................................................................80 Duck Hepatitis B Virus (DHBV)

........................................................................................86 Duck Hepatitis A Virus (DHAV-1, DHAV-2, DHAV-3)

..................................................92 Duck Hepatitis Virus (DHV II & III)

................................................................................94 Fowl Adenoviruses (FAdV)

................................................................................................97 Turkey Hepatitis Virus (THV)

.........................................................................................100

References...........................................................................................................................104

Acknowledgements.............................................................................................................113

Figures.................................................................................................................................114 Chapter IV:



Infection Dynamics of Hepatitis E Virus in Wild-Type and Immunoglobulin Heavy Chain Knockout JH (-/-)

Gnotobiotic Piglets...............................................................

118 Abstract...............................................................................................................................119

Importance..........................................................................................................................120

Introduction........................................................................................................................121

Results..................................................................................................................................123

Discussion............................................................................................................................130 Materials and

Methods......................................................................................................137


References...........................................................................................................................149

Tables...................................................................................................................................155

Figures.................................................................................................................................162 xiii Chapter V:

Evidence for an Unknown Agent Antigenically Related to the Hepatitis E Virus in Dairy Cows in the United

States...........................................................................................169

Abstract...............................................................................................................................170

Introduction........................................................................................................................171 Materials and

Methods......................................................................................................172

Results..................................................................................................................................177

Discussion............................................................................................................................181


References...........................................................................................................................186

Tables...................................................................................................................................191

Figures.................................................................................................................................195 Chapter VI: General

Conclusions............................................................................................198

References...........................................................................................................................202 xiv LIST OF TABLES

Chapter II — Table 1 (p. 73): Animals with naturally occurring HEV infections. Chapter II — Table 2 (p. 74):

Experimental susceptibility of different animal species to HEV strains. Chapter II — Table 3 (p. 75): Applications

of available animal models including naturally occurring animal models for various aspects of HEV studies.

Chapter IV — Table 1 (p. 155): Experimental infection of wild-type and immunoglobulin JH (- /-) knockout

gnotobiotic piglets with a genotype 3 human strain (US2) of hepatitis E virus. Chapter IV — Table 2 (p. 156):

E�cacy of CRISPR/Cas9 to introduce targeted modi�cations in Ig heavy chain locus during embryogenesis.

Chapter IV — Table 3 (p. 157): Phenotyping of Ig heavy-chain modi�ed piglets produced using CRISPR/Cas9

technology and retrieved by hysterectomy. Chapter IV — Table 4 (p. 158): Genotyping the Ig heavy chain

modi�ed piglets. Chapter IV — Table 5 (p. 160): Detection of HEV RNA in the serum (fecal) samples of wild-

type and Ig JH (-/-) knockout gnotobiotic piglets experimentally infected with the US2 strain of human. Chapter

IV — Table 6 (p. 161): Primers and double-stranded DNA (dsDNA) used for the development of Ig heavy-chain

knockout piglets. Chapter V — Table 1 (p. 191): Prevalence of IgG binding to HEV in cattle from different



geographic regions of the United States. Chapter V — Table 2 (p. 192): Serological evidence of HEV IgG in

dams and their corresponding calf from the prospective study in a university dairy herd. Chapter V — Table 3

(p. 193): Neutralizing capability of selected bovine serum samples from calves on the infectivity of a genotype

3 human HEV (Kernow P6 strain) in HepG2/C3A human liver cells. Chapter V — Supp. Table 1 (p. 194): Oligo

primers used for the detection of HEV RNA in fecal and serum samples by broad-spectrum nested RT-PCR

assays. xv LIST OF FIGURES Chapter II — Figure 1 (p. 76): A phylogenetic tree based on the full-length genomic

sequences with genotype classi�cation of known animal strains of HEV. Sequence alignment was completed

using ClustalW, MEGA version 5.2 (www.megasoftware.net) for the phylogenetic tree, and the

tree was constructed using the neighbor-joining method with the maximum composite likelihood

method

for evolutionary distances corresponding to each branch length and the units of the number of base

substitutions per site. Each of the four known genotypes (1-4) is labeled, with representative strains included

for each species, and novel strains from ferret, bat, rat, avian, and �sh identi�ed individually as separate new

putative genotypes or species. Chapter III — Figure 1 (p. 114): Enlarged and hemorrhagic liver in a 42-week-old

broiler breeder due to avian hepatitis E virus infection. Chapter III — Figure 2 (p. 114): Enlarged liver with

petechiae in a six-day-old duckling due to DHAV-1 infection. Chapter III — Figure 3 (p. 114): Histopathology of

the liver with severe diffuse necrosis of hepatocytes and hemorrhage due to DHAV–1 infection. Chapter III —

Figure 4 (p. 115): Diffusely enlarged and pale liver due to Fowl Adenovirus-1 (IBH) in a broiler chicken. Chapter

III — Figure 5 (p. 115): One diffusely enlarged and pale liver with petechiae and another liver with pale foci of

necrosis in a broiler chicken due to IBH. Chapter III — Figure 6 (p. 116): Histopathology of liver with

hepatocellular necrosis, in�ammation and intranuclear inclusion bodies in a case of IBH. Chapter III — Figure 7

(p. 116): Enlarged liver with pale foci of necrosis in a young turkey poult suffering from Turkey Viral Hepatitis.

Chapter III — Figure 8 (p. 117): Pancreas with pale patches of necrosis in a turkey poult to TVH. Chapter IV —

Figure 1 (p. 162): Ig heavy chain targeting CRISPR sequences and representative types of Ig heavy chain

mutations in this study. (A) Disruption of Ig heavy chain in pigs by CRISPR/Cas9 with a total of 4 target sites

designed using a web-based program. Bold letters indicate PAM sequence of target sites. Black arrows

indicate primers used to amplify the target region. (B) Types of genetic mutations of the Ig heavy chain in

single blastocyst. The sequencing results indicated either homozygous or biallelic mutation of Ig heavy chain

in single embryos with no wild-type alleles observed. (C) Representative genotype of Ig heavy chain knock-out

pigs. Arrows indicate sites of mutations. Chapter IV — Figure 2 (p. 163): B-lymphocyte cell counts in peripheral

blood samples of wild- type and immunoglobulin JH knockout gnotobiotic piglets experimentally-infected with

HEV. PBMCs were collected from each piglet at 28 days post-inoculation (dpi) at necropsy. Cells were xvi gated

based on CD3 and quanti�ed for the intracellular marker CD79a+ as a measure of the total B-cell population in

the peripheral blood. Asterisks indicate statistical signi�cance between designated groups determined by

Tukey’s t-test with a p value <0.001. Chapter IV — Figure 3 (p. 164): Quanti�cation of HEV RNA loads in serum,

fecal, and bile samples of wild-type and JH knockout gnotobiotic piglets experimentally-infected with HEV.



Viral RNAs were extracted from (A) fecal samples three times weekly, (B) intestinal contents and bile at 28

days post-inoculation (dpi), (C) as a scatterplot of fecal viral RNA, with each symbol indicating the value for an

individual piglet, and (D) serum samples at 0, 7, 14, 21, and 28 dpi for the quanti�cation of HEV RNA copy

numbers by qRT-PCR. Data are expressed as mean +/- SEM. The detection limit is 10 viral genomic copies,

which corresponds to 400 copies per 1mL sample or per gram of tissue. Titers below the reported detection

limit were considered negative. Asterisks indicate statistical signi�cance between designated groups as

determined by two-way ANOVA and p-value <0.05. Chapter IV — Figure 4 (p. 165): Circulating levels of liver

enzymes in serum samples collected weekly from HEV-infected wild-type and HEV-infected JH (-/-) knockout

gnotobiotic piglets. Serum was collected weekly from each piglet beginning with 0-week post-inoculation (wpi)

and continuing until necropsy at 4 wpi. Liver enzymes including (A) aspartate aminotransferase (AST), (B) total

bilirubin, (C) alkaline phosphatase, and (D) gamma-glutamyl transferase (GGT) were measured at the Iowa

State University Veterinary Diagnostic Lab. Normal limits were provided with the analysis based on the

laboratory’s standards for each speci�c test, which are indicated on each scatterplot graph as a dotted line.

Each sample indicates an individual piglet for each time point and are expressed as the mean +/- SEM.

Analysis was completed using two-way ANOVA. *p<0.05. Chapter IV — Figure 5 (p. 166): Histopathological

lesions in wild-type and JH knockout gnotobiotic piglets experimentally-infected with HEV. (A)

Histopathological lesions in the liver including lymphoplasmacytic hepatitis and hepatocellular necrosis.

Lymphoplasmacytic hepatitis was scored as follows:

0, no in�ammation; 1, 1- 2 focal lymphoplasmacytic in�ltrates/ 10 hepatic lobules; 2, 3- 5 focal

in�ltrates/ 10 hepatic lobules; 3, 6- 10 focal in�ltrates /10

hepatic lobules; and 4, >10 focal in�ltrates/10 hepatic lobules. Hepatocellular necrosis was characterized by

the presence of individual hepatocytes with an eosinophilic cytoplasm with or without fragmented or absent

nuclei. (B) Liver/body weight ratio: The liver weights were evaluated as a ratio of overall body weight. Asterisks

indicate statistical signi�cance as determined by two-way ANOVA.

*p<0.05, **p<0.01, ***p<0.001. Chapter IV — Figure

6 (p. 167): Frequencies of IFN-g and IL-4 intracellular cytokines in mononuclear cells isolated from spleen and

mesenteric lymph node tissues and PBMCs from peripheral blood of wild-type and JH knockout piglets

experimentally-infected with HEV. PBMCs and MNCs were collected from each piglet at 28 days post-

inoculation (dpi) at necropsy. Cells were gated on CD3 and stained for extracellular and intracellular markers

CD4+ and IFN-g and IL- 4, respectively, after stimulation with HEV-speci�c capsid protein. The mean

frequencies of (A) IFN-g, (B) IL-4, (C) CD4+, are indicated and expressed as mean +/- SEM. All frequencies were

determined by �ow cytometry with 100,000 events per sample. *p<0.05. xvii Chapter IV — Figure 7 (p. 168):

Frequencies of TGF-b and IL-10 intracellular cytokines in mononuclear cells isolated from spleen and

mesenteric lymph node tissues and PBMCs from peripheral blood of wild-type and JH knockout piglets

experimentally-infected with HEV. PBMCs and MNCs were collected from each piglet at 28 days post-



inoculation (dpi) at necropsy. Cells were gated on CD3 and stained for extracellular and intracellular markers

CD4+, CD25+, Foxp3, and TGF-b and IL-10 respectively after stimulation with HEV-speci�c capsid protein. The

mean frequencies of (A) CD25+ Foxp3+, (B) CD25- Foxp3+, (C) TGF-b, and (D) IL-10 are indicated and

expressed as mean +/- SEM. All frequencies were determined by �ow cytometry with 100,000 events per

sample. Chapter V — Figure 1 (p. 195): Seroconversion to IgG anti-HEV in calves in a closed university dairy

herd in Virginia in a prospective study. Ten newborn calves born to both IgG anti-HEV seropositive and

seronegative dams were monitored for evidence of HEV infection from the day of birth to 6 months of age. The

weekly serum samples from all calves were tested by the commercial Wantai ELISA assay for IgG anti-HEV.

(A): Calves tested negative for IgG anti-HEV in the prospective study; (B): Calves tested positive for IgG anti-

HEV in the prospective study. The speci�c signal (individual ELISA O.D.) values were collected and plotted as

S/C.O.

(Y-axis) as a function of the ages of the

animals (days after birth) indicating when the samples were collected. The ELISA cut-off value indicating

seropositivity to IgG anti-HEV is indicated as a dotted line at 1.0 based on the commercial Wantai ELISA assay

standard. Chapter V — Figure 2 (p. 196): Serum levels of liver enzymes over time in the prospective study in

calves from the time of birth to 6 months of age. Serum samples were collected weekly from each calf

beginning with the day of birth and continuing prospectively until approximately 6 months of age. Serum levels

of liver enzymes including (A) aspartate aminotransferase (AST), (B) glutamate dehydrogenase (GLDH), and

(C) gamma-glutamyl transferase (GGT) were measured in each serum samples at the Cornell University Animal

Health Diagnostic Center. Normal limits of each enzyme were provided with the analysis based on the

diagnostic laboratory’s standards for each speci�c test, which are indicated on each scatterplot graph as a

dotted line. Each sample indicates an individual calf serum sample for each time point and are expressed as

the mean +/- SEM. Analysis was completed using two-way ANOVA. Chapter V — Figure 3 (p. 197): Correlation

between seroconversion and serum levels of GLDH in serum samples collected prospectively from calves from

the time of birth to 6 months of age. Calves (A) #5078, (B) 5082, (C) 5083, (D) 5086, and (E) 5091

seroconversion to IgG anti-HEV correlated with the elevations in serum levels of GLDH. The speci�c signal

(individual ELISA O.D.) values were plotted as S/C.O. (left

y-axis) as a function of the age of the

animal (days after birth). The ELISA cut-off value indicating seropositivity to IgG anti-HEV is indicated as a

dotted line at 1.0 based on the commercial Wantai ELISA assay standard. The serum levels of GLDH were

plotted (right


animal (days after birth). The upper normal limit was provided with the analysis based on the diagnostic

laboratory’s standard for GLDH in bovine species and indicated as the dotted line at 83 u/L. xviii GENERAL



INTRODUCTION Hepatitis E virus (HEV), the causative agent of hepatitis E, is a fecal-orally transmitted virus (1)

and an important disease of public health concern worldwide (2-4). In developing regions of the world, poor

sanitary conditions lead to acute outbreaks due to contaminated food or water (5, 6), while here in the United

States and other industrialized countries, sporadic and autochthonous cases of hepatitis E prevail (7, 8).

Mortality rates for acute infections range from 0.5-4% with the majority of immunocompetent individuals

clearing the infection with limited clinical signs (5). However, HEV-infected pregnant women may reach a

mortality rate of 28-30% and experience complications including death of the fetus and mother, abortion, and

premature birth (9, 10). Likewise, immunocompromised individuals (11) such as solid organ transplant

recipients (12-14) or those with concurrent HIV/AIDS (15), other viral hepatitis infections (16), or

lymphosarcoma (17, 18) experience progressive disease with the development of chronic HEV infections.

Recently, progressive hepatitis E disease has emerged in a new extrahepatic manifestation as a neurological

disorder (19-23). The underlying mechanisms leading to increased severity of disease and hepatic damage in

these poplulations are not well understood and necessitate the identi�cation of animal models to replicate all

outcomes of HEV infection. HEV is a single-stranded, positive-sense RNA virus classi�ed as a Hepevirus in the

family Hepeviridae (24), which consists of eight genotypes, including four genotypes affecting the human

population. The genus Orthohepevirus A includes

genotypes 1 and 2 that infecting humans (25), and genotypes 3 and 4

that are zoonotic in nature and infect humans (4, 5) and a wide range of animal species including swine (26-

29), and rabbits (30-32). Numerous animal species serve as natural hosts and reservoirs for HEV with genetic

identi�cation in rats (33, 34), wild and domestic swine (35, 36), mongoose (37), rabbits (30-32), chickens (38-

40), ferrets (41), cutthroat trout (42), xix bats (43), deer (35, 44, 45), moose (46), and camel (47), with an ever-

expanding host range. However, swine remain the primary reservoir for HEV (48, 49) and zoonotic genotype 3

HEVs are de�nitely linked to human cases through direct contact with infected animals (50-52) or consumption

of contaminated animal products (2, 53-56). Ruminant species including bovine (57- 59), sheep (60, 61), and

goats (62) have been implicated as reservoirs due to the identi�cation of IgG antibodies binding to HEV in

serum; however, the virus has not yet been de�nitively genetically identi�ed from these species. The ability to

control HEV relies on identifying all reservoir species and methods of transmission and addressing the effect

on the human food chain. Additionally, the lack of an adequate animal model to assess pathogenesis of

disease, the course of infection seen in humans infected with HEV, and immune parameters important during

infection led the focus for this dissertation. xx REFERENCES 1. Purcell R, Emerson, S.U. 2001. Hepatitis E Virus,

p 3051-3061. In

Knipe D, Howley P, Gri�n D, Lamb R, Martin M, Roizman B, Straus S

(ed), Fields Virology 4th ed. Lippincott: Williams and Wilkins, Philadelphia, PA. 2.

Meng X-J. 2013. Zoonotic and foodborne transmission of hepatitis E virus. Semin Liv Dis 33:41-49. 3. Emerson

S, Purcell R.



2007. Hepatitis E. Pediatr Infect Dis J 26:1147-

1148. 4. Emerson S, Purcell R.

2003. Hepatitis E virus. Rev Med Virol 13:145-154.

5.

Meng XJ. 2010. Hepatitis E virus: animal reservoirs and zoonotic risk. Vet Microbiol

140:256-265.

6. Yugo DM, Meng XJ. 2013. Hepatitis E virus: foodborne, waterborne and zoonotic transmission.

Int J Environ Res Public Health 10:4507-4533. 7. Dalton H, Bendall, RP, Rashid, M, et al. 2011. Host risk factors

and autochthonous hepatitis e infection. Eur J Gastroenterol Hepatol 23:1200-1205. 8. Dalton H, Bendall R, Ijaz

S, Banks M. 2008. Hepatitis E: an emerging infection in developed countries. Lancet Infect Dis 8:698-709. 9.

Navaneethan U. 2009. Seroprevalence of hepatitis E infection in pregnancy - more questions than answers.

Indian J Med Res 130:677-679. 10. Navaneethan U, Al Mohajer M, Shata MT. 2008. Hepatitis E and pregnancy:

understanding the pathogenesis. Liver Int 28:1190-1199. 11. Singh A, Seth R, Gupta A, Shalimar, Nayak B,

Acharya SK, Das P. 2016. Chronic hepatitis E - an emerging disease in an immunocompromised host.

Gastroenterol Rep (Oxf) doi:10.1093/gastro/gow024.

12. Kamar N, Garrouste C, Haagsma EB, Garrigue V, Pischke S, Chauvet C, Dumortier J, Cannesson A, Cassuto-

Viguier E, Thervet E, Conti F, Lebray P, Dalton HR, Santella R, Kanaan N, Essig M, Mousson C, Radenne S, Roque-

Afonso AM, Izopet J, Rostaing L. 2011. Factors associated with chronic hepatitis in patients with hepatitis E virus

infection who have received solid organ transplants. Gastroenterol 140:1481-1489. 13. Kamar N,

Mansuy JM, Cointault O, Selves J, Abravanel F, Danjoux M, Otal P, Esposito L, Durand D, Izopet J, Rostaing L.

2008. Hepatitis E virus-related cirrhosis in kidney- and kidney-pancreas-transplant recipients. Am J Transplant

8:1744-1748. 14. Haagsma EB, van den Berg AP, Porte RJ, Benne CA, Vennema H, Reimerink JH, Koopmans

MP. 2008. Chronic hepatitis E virus infection in liver transplant recipients. Liver Transpl 14:547-553.

15. Dalton HR, Bendall RP, Keane FE, Tedder RS, Ijaz S. 2009. Persistent carriage of hepatitis E virus in

patients with HIV infection. N Engl J Med

361:1025-1027. 16. Péron J, Dalton H, Izopet J, Kamar N. 2011. Acute autochthonous hepatitis E in western

patients with underlying chronic liver disease: a role for ribavirin? J Hepatol 54:1323. 17. le Coutre P, Meisel H,

Hofmann J, Röcken C, Vuong G, Neuburger S, Hemmati P, Dörken B, Arnold R. 2009. Reactivation of hepatitis E

infection in a patient with acute lymphoblastic leukaemia after allogeneic stem cell transplantation. Gut

58:699-702. 18.

Ollier L, Bigaillon C, Tieulie N, Tesse S, Heudier P, Sanderson F, Giordanengo V, Nicand E, Fuzibet J-G. 2009.



[Hepatitis E initially serologically silent with prolonged evolution in a patient treated for a lymphoma]. Presse

Med 38:1700-1704. xxi 19. McLean BN, Gulliver J, Dalton HR. 2017. Hepatitis E virus and neurological

disorders. Pract Neurol 17:282-288. 20.

Kamar N, Bendall RP, Peron JM, Cintas P, Prudhomme L, Mansuy JM, Rostaing L, Keane F, Ijaz S, Izopet J,

Dalton HR. 2011. Hepatitis E virus and neurologic disorders. Emerg Infect Dis

17:173-179. 21. Ripellino P, Norton B, van Eijk J, Dalton HR. 2018. Non-traumatic neurological injury and

hepatitis E infection. Expert Rev Anti Infect Ther 16:255-257. 22. Sanchez Azofra M, Romero Portales M,

Tortajada Laureiro L, Garcia-Samaniego J, Mora Sanz P. 2018. Hepatitis E virus in neurological disorders: a

case of Parsonage-Turner syndrome. Rev Esp Enferm Dig 110:402-403. 23. Zheng X, Yu L, Xu Q, Gu S, Tang L.

2018. Guillain-Barre syndrome caused by hepatitis E infection: case report and literature review. BMC Infect Dis

18:50. 24.

Purdy MA, Harrison TJ, Jameel S, Meng XJ, Okamoto H, Van der Poel WHM, Smith DB, Ictv

Report C. 2017. ICTV Virus Taxonomy Pro�le: Hepeviridae. J Gen Virol 98:2645-2646. 25. Meng X, Halbur P,

Haynes J, Tsareva T, Bruna J, Royer R, Purcell R, Emerson S. 1998. Experimental infection of pigs with the

newly identi�ed swine hepatitis E virus (swine HEV), but not with human strains of HEV. Arch Virol 143:1405-

1415. 26.

Meng XJ, Purcell R, Halbur P, Lehman J, Webb D, Tsareva T, Haynes J, Thacker B,

Emerson S. 1997. A novel virus in swine is closely related to the human hepatitis E virus. Proc Natl Acad Sci

U S A 94:9860-9865. 27. Leblanc D, Ward P, Gagne MJ, Poitras E, Muller P, Trottier YL, Simard C, Houde A. 2007.

Presence of hepatitis E virus in a naturally infected swine herd from nursery to slaughter. Int J Food Microbiol

117:160-166.

28. de Deus N, Casas M, Peralta B, Nofrarías M, Pina S, Martín M, Segalés J. 2008. Hepatitis E virus infection

dynamics and organic distribution in naturally infected pigs in a farrow-to-�nish farm. Vet Microbiol 132:19-28.

29.

Feagins A, Opriessnig T, Huang Y, Halbur P, Meng XJ. 2008. Cross-species infection of speci�c-pathogen-free

pigs by a genotype 4 strain of human hepatitis E virus. J Med Virol 80:1379-1386. 30. Cossaboom C, Cordoba

L, Dryman B, Meng X-J. 2011. Hepatitis E virus in rabbits, Virginia, USA. Emerg Infect Dis 17:2047-2049. 31.

Izopet J, Dubois M, Bertagnoli S, Lhomme S, Marchandeau S, Boucher S, Kamar N, Abravanel F, Guerin JL.

2012.

Hepatitis E virus strains in rabbits and evidence of a closely related strain in humans, France.

Emerg Infect Dis 18:1274-1281. 32. Zhao C, Ma Z, Harrison TJ, Feng R, Zhang C, Qiao Z, Fan J, Ma H, Li M, Song

A, Wang Y. 2009. A novel genotype of hepatitis E virus prevalent among farmed rabbits in China. J Med Virol



81:1371-1379. 33. Johne R, Heckel G, Plenge-Bönig A, Kindler E, Maresch C, Reetz J, Schielke A, Ulrich R. 2011.

Novel hepatitis E virus genotype in Norway rats, Germany. Emerg Infect Dis 16:1452-1455. 34. Lack J, Volk K,

Van Den Bussche R. 2012.

Hepatitis E virus genotype 3 in wild rats, United States.

Emerg Infect Dis 18:1268-1273. 35. Sonoda H, Abe M, Sugimoto T, Sato Y, Bando M, Fukui E, Mizuo H,

Takahashi M, Nishizawa T, Okamoto H. 2004. Prevalence of hepatitis E virus (HEV) Infection in wild xxii boars

and deer and genetic identi�cation of a genotype 3 HEV from a boar in Japan. J Clin Microbiol 42:5371-5374.

36. Takahashi M, Nishizawa T, Sato H, Sato Y, Jirintai, Nagashima S, Okamoto H. 2011.

Analysis of the full- length genome of a hepatitis E virus

isolate obtained from a wild boar in Japan that is classi�able into a novel genotype. J Gen Virol 92:902-908. 37.

Nidaira M, Takahashi K, Ogura G, Taira K, Okano S, Kudaka J, Itokazu K, Mishiro S, Nakamura M. 2012.

Detection and phylogenetic analysis of hepatitis E viruses from mongooses in Okinawa, Japan.

J Vet Med Sci 74:1665-1668. 38. Haqshenas G, Shivaprasad H, Woolcock P, Read D, Meng XJ. 2001. Genetic

identi�cation and characterization of a novel virus related to human hepatitis E virus from

chickens with hepatitis-splenomegaly syndrome in the United States.

J Gen Virol 82:2449-2462. 39. Huang F, Haqshenas G, Shivaprasad H, Guenette D, Woolcock P, Larsen C,

Pierson F, Elvinger F, Toth T, Meng X. 2002. Heterogeneity and seroprevalence of a newly identi�ed avian

hepatitis e virus from chickens in the United States. Journal of clinical microbiology 40:4197-4202. 40. Marek

A, Bilic I, Proko�eva I, Hess M. 2010. Phylogenetic analysis of avian hepatitis E virus samples from European

and Australian chicken �ocks supports the existence of a different genus within the Hepeviridae comprising at

least three different genotypes. Vet Microbiol 145:54-61. 41. Raj V, Smits S, Pas S, Provacia L, Moorman-Roest

H, Osterhaus A, Haagmans B. 2012. Novel hepatitis E virus in ferrets, the Netherlands. Emerg Infect Dis

18:1369-1370. 42. Batts W, Yun S, Hedrick R, Winton J. 2011. A novel member of the family Hepeviridae from

cutthroat trout (Oncorhynchus clarkii). Virus Res 158:116-123. 43. Drexler J, Seelen A, Corman V, Fumie Tateno

A, Cottontail V, Melim Zerbinati R, Gloza-Rausch F, Klose S, Adu-Sarkodie Y, Oppong S, Kalko E, Osterman A,

Rasche A, Adam A, Müller M, Ulrich R, Leroy E, Lukashev A, Drosten C. 2012. Bats worldwide carry hepatitis E

virus-related viruses that form a putative novel genus within the family Hepeviridae. J Virol 86:9134-9147. 44.

Matsuura Y, Suzuki M, Yoshimatsu K, Arikawa J, Takashima I, Yokoyama M, Igota H, Yamauchi K, Ishida S,

Fukui D, Bando G, Kosuge M, Tsunemitsu H, Koshimoto C, Sakae K, Chikahira M, Ogawa S, Miyamura T, Takeda N,

Li TC. 2007. Prevalence of antibody to hepatitis E virus among wild sika deer, Cervus nippon, in Japan. Arch

Virol 152:1375-1381.

45. Tomiyama D, Inoue E, Osawa Y, Okazaki K. 2009. Serological evidence of infection with



hepatitis E virus among wild Yezo -deer, Cervus nippon yesoensis, in Hokkaido, Japan.

J Viral Hepat 16:524-528. 46.

Lin J, Norder H, Uhlhorn H, Belak S, Widen F. 2014. Novel hepatitis E like virus found in Swedish moose. J Gen

Virol 95:557-570.

47. Sridhar S, Teng JLL, Chiu TH, Lau SKP, Woo PCY. 2017. Hepatitis E Virus Genotypes and Evolution:

Emergence of Camel Hepatitis E Variants. Int J Mol Sci 18. 48.

Pavio N, Meng X-J, Renou C. 2010. Zoonotic hepatitis E: animal reservoirs and emerging risks. Vet Res

41:46.

49. Halbur PG,

Kasorndorkbua C, Gilbert C, Guenette D, Potters MB, Purcell RH, Emerson SU, Toth TE, Meng

XJ. 2001. Comparative pathogenesis of infection of pigs with hepatitis E viruses recovered from a pig and a

human. J Clin Microbiol 39:918-923.

xxiii

50. Bouwknegt M, Engel B, Herremans M, Widdowson M, Worm H, Koopmans M, Frankena K,

de Roda Husman A, De Jong M, Van Der Poel W. 2008. Bayesian estimation of hepatitis E virus

seroprevalence for populations with different exposure levels to swine in The Netherlands. Epidemiol Infect

136:567-576. 51.

Meng X,

Wiseman B, Elvinger F, Guenette D, Toth T, Engle R, Emerson S, Purcell R. 2002.

Prevalence of antibodies to hepatitis E virus in veterinarians working with swine and in normal blood donors in the

United States and other countries. J Clin Microbiol 40:117-

122. 52. Vulcano A, Angelucci M, Candelori E, Martini V, Patti AM, Mancini C, Santi AL, Calvani A, Casagni L,

Lamberti A. 2007. HEV prevalence in the general population and among workers at zoonotic risk in Latium

Region. Ann Ig 19:181-186.

53. Colson P, Borentain P, Queyriaux B, Kaba M, Moal V, Gallian P, Heyries L,

Raoult D, Gerolami R. 2010. Pig liver sausage as a source of hepatitis E virus transmission to humans. J Infect

Dis 202:825-834. 54. Meng X-J. 2011. From barnyard to food table: the omnipresence of hepatitis E virus and

risk for zoonotic infection and food safety. Virus Res 161:23-30.

55. Kasorndorkbua C, Guenette D, Huang F, Thomas P, Meng XJ, Halbur P. 2004. Routes of

transmission of swine hepatitis E virus in pigs. J Clin Microbiol 42:5047-5052.



56. Feagins AR, Opriessnig T, Guenette DK, Halbur PG, Meng XJ. 2007. Detection and characterization of

infectious Hepatitis E virus from commercial pig livers sold in local grocery stores in the USA. J Gen Virol

88:912-7. 57. Vitral CL, Pinto MA, Lewis-Ximenez LL, Khudyakov YE, dos Santos DR, Gaspar AM. 2005.

Serological evidence of hepatitis E virus infection in different animal species from the Southeast of Brazil.

Mem Inst Oswaldo Cruz 100:117-122. 58. Yan B,

Zhang L, Gong L, Lv J, Feng Y, Liu J, Song L, Xu Q, Jiang M, Xu A. 2016. Hepatitis E Virus

in Yellow Cattle, Shandong, Eastern China. Emerg Infect Dis 22:2211- 2212.

59.

Zhang W, Shen Q, Mou J, Gong G, Yang Z, Cui L, Zhu J, Ju G, Hua X. 2008. Hepatitis E virus infection among

domestic animals in eastern China. Zoonoses Public Hlth 55:291-

298. 60. Chang Y, Wang L, Geng J, Zhu Y, Fu H, Ren F, Li L, Wang X, Zhuang H. 2009.

Zoonotic risk of hepatitis E virus (HEV): A study of HEV infection in animals and humans in suburbs of Beijing.

Hepatol Res 39:1153-1158.

61.

El-Tras W, Tayel A, El-Kady N. 2012. Seroprevalence of hepatitis E virus in humans and

geographically matched food animals in Egypt. Zoonoses Public Hlth 60:244-251.

62. Sanford BJ, Emerson SU, Purcell RH, Engle RE, Dryman BA, Cecere TE, Buechner- Maxwell V, Sponenberg

DP, Meng XJ. 2012. Serological Evidence for a Hepatitis E Virus-Related Agent in Goats in the United States.

Transbound Emerg Dis 60:538-545. xxiv Chapter I: Hepatitis E Virus: Foodborne, Waterborne, and Zoonotic

Transmission Danielle M. Yugo and Xiang-Jin Meng

Department of Biomedical Sciences and Pathobiology, College of Veterinary Medicine, Virginia Polytechnic

Institute and State University, 1981 Kraft Drive, Blacksburg, VA 24061-0913,

U.S.A. International Journal of Environmental Research and Public Health. 2013; Sep; 10(10): 4507- 4533. ©

2013

by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed and

reprinted under the terms and conditions of the Creative Commons Attribution license

(http://creativecommons.org/licenses/by/3.0/).

ABSTRACT Hepatitis E virus (HEV) is responsible for epidemics and endemics of acute hepatitis in humans

mainly through waterborne, foodborne, and zoonotic transmission routes. HEV is a single- stranded, positive-

sense RNA virus classi�ed in the family Hepeviridae and encompasses four known genotypes (1-4), at least

two new putative genotypes of mammalian HEV, and one �oating genus of avian HEV. Genotypes 1 and 2 HEVs



only affect humans, while genotypes 3 and 4 are zoonotic and responsible for sporadic and autochthonous

infections in both humans and several other animal species worldwide. HEV has an ever-expanding host range

and has been identi�ed in numerous animal species. Swine serve as a reservoir species for HEV transmission

to humans; however, it is likely that other animal species may also act as reservoirs. HEV poses an important

public health concern with cases of the disease de�nitively linked to handling of infected pigs, consumption of

raw and undercooked animal meats, and animal manure contamination of drinking or irrigation water.

Infectious HEV has been identi�ed in numerous sources of concern including animal feces, sewage water,

inadequately-treated water, contaminated shell�sh and produce, as well as animal meats. Many aspects of

HEV pathogenesis, replication, and immunological responses remain unknown, as HEV is an extremely

understudied but important human pathogen. This article reviews the current understanding of HEV

transmission routes with emphasis on food and environmental sources and the prevalence of HEV in animal

species with zoonotic potential in humans. Keywords: hepatitis E virus; HEV; zoonosis; animal reservoir;

foodborne transmission; zoonotic transmission; waterborne transmission 1. Introduction Hepatitis E virus

(HEV), the causative agent of hepatitis E in humans, is an important public health disease in many parts of the

world [1,2,3,4]. Transmission is primarily via fecal-oral route through contaminated food or water [5]. In

developing countries in Asia and Africa, poor sanitation conditions lead to outbreaks of acute hepatitis E;

however, sporadic and autochthonous cases of hepatitis E also occur throughout many industrialized countries

in Europe, Asia, and North America [6,7].In humans, the mortality rate ranges from 0.5–4%for

immunocompetent individuals, however, mortality in HEV-infected pregnant women can reach up to 20% and

immunocompromised individuals may develop a chronic HEV infection [8,9]. In addition to humans, HEV has

been identi�ed in numerous other animal species including wild and domestic swine, deer, chicken, mongoose,

rat, ferret, �sh, and rabbits with an ever-expanding host range [1,7,10]. Hepatitis E is now a recognized zoonotic

disease with swine and likely other animals serving as the reservoir for human infections [1,8]. Food safety

associated with HEV contamination is an important public health concern with the recent identi�cation of

infectious HEV in meat and meat products and resultant sporadic cases of foodborne hepatitis E in the human

population [3,11,12,13,14]. This review article discusses the public and environmental health concerns and

risks associated with HEV infection with an emphasis on foodborne and zoonotic transmissions. 2. HEV

Classi�cation and Biology 2.1. Classi�cation HEV belongs to the genus Hepevirus in the family Hepeviridae

and consists of four recognized genotypes and at least two putative new genotypes [5]. Genotype 1 causes

large outbreaks of acute 3 hepatitis E in humans in Asia. Genotype 2 causes outbreaks in humans and includes

one Mexican strain and several African strains. Genotype 3 is associated with sporadic, cluster, and chronic

cases of hepatitis E in humans, mostly in industrialized countries. Genotype 3 HEV is known to be zoonotic and

has also been isolated from domestic and wild swine, deer, mongoose, rats, and rabbits [12,15,16,17,18,19].

Genotype 4HEV is also zoonotic and is associated with sporadic cases of hepatitis E in humans and infects

wild and domestic swine and reportedly cattle and sheep [1,5]. Avian HEV from chickens only shares

approximately 50% nucleotide sequence identity with mammalian HEV; therefore, avian HEV likely represents a

separate genus [20].The genus Avihepevirus has recently been proposed to include all three known genotypes



of avian HEV in chickens (genotype 1 in Australia and Korea, genotype 2 in the United States, and genotype 3 in

Europe and China) [1,21,22]. The recently-identi�ed rat HEV shares approximately 59.9% and 49.9% sequence

identities with human and avian HEV, respectively, while the ferret HEV shares the highest sequence identity

with rat HEV at 72.3% [18,23]. The genus Orthohepevirus has recently been proposed to encompass both the

rat and ferret strains of HEV as well as a novel wild boar HEV strain recovered in Japan that differed from the

known genotypes 1-4 HEV isolates by 22.6–27.7%in nucleotide sequence identity [1,24]. A bat HEV was

recently identi�ed from African, Central American, and European bats, and due to high sequence diversi�cation

from known HEV isolates at 47% amino acid sequence identity, the bat HEV forms a novel phylogenetic clade

[25]. The genus Chiropteranhepevirus has been proposed to include all variants of the bat HEV [1]. Finally, a

strain of HEV was also identi�ed in cutthroat trout in the United States with only 13–27% sequence homology

with mammalian or avian hepeviruses leading to a proposal of another tentative genus, Piscihepevirus, within

the Hepeviridae family [1,26]. The nomenclature of HEV will need to be modi�ed in the near future as more

genetically-divergent animal strains of HEV are identi�ed. 2.2. HEV Biology The

genome of HEV is a single-stranded, positive-sense, RNA molecule of approximately 7.

2kb in size [3,4,27].The genome consists of three open reading frames (ORFs), a 5’ non-coding region (NCR),

and a 3’ NCR [10]. ORF1 encodes non-structural proteins with conserved domains functioning as a

methyltransferase, helicase, RNA-dependent RNA polymerase (RdRp), and a papain-like cysteine protease

[20,28]. In addition, a hypervariable region (HVR) within ORF1 may play a role in viral pathogenesis despite

being shown to have no in�uence on viral infectivity [29]. ORF2 encodes the immunogenic capsid protein,

which interacts with 3’viral genomic RNA for encapsidation and contains an endoplasmic reticulum signal

peptide and 3 N-glycosylation sites [30,31]. ORF3 encodes a small phosphoprotein with incompletely

understood functions; however, the association with cytoskeleton and its necessity for in vivo viral infection in

rhesus macaques suggests that ORF3 plays a role in viral replication and assembly [20,32,33]. Avian HEV is

genetically related to mammalian HEV with conserved genomic organization and function despite a 600 bp

sequence deletion [34,35,36]. The capsid protein of avian HEV contains both unique and conserved antigenic

epitopes in comparison to the human and swine HEV capsid proteins [37]. The HEV replication cycle is

currently not well understood due to a lack of an e�cient cell culture system [38].Heparin sulfate

proteoglycans (HSPGs) likely act as receptors for the attachment of the viral capsid protein, and the heat

shock cognate protein 70 may be involved in HEV entry into the cell [38]. Following uncoating in the cell, the

HEV genomic RNA is likely utilized to translate the non-structural proteins and the viral RdRp is used to

produce progeny 5 virus [38]. Both ORF2 and ORF3 are translated from a bicistronic subgenomic RNA [32,39].

The negative-sense HEV RNA indicative of virus replication is detectable in hepatic and extrahepatic tissues of

experimentally-infected rhesus macaques and swine [38,40]. Post-translational processing of proteins and

mechanisms of virus assembly and release have yet to be fully elucidated, and the viral-host interactions

leading to a disease state are also poorly understood [5,20,38]. Development of a robust cell culture system to

e�ciently propagate HEV in the future should be a priority, and will facilitate our understanding the biology of



this important virus. 3. HEV Pathogenesis 3.1 HEV infection in humans In humans, HEV causes an acute icteric

disease that varies in symptoms from subclinical to fulminant hepatitis [4]. The asymptomatic patient typically

clears the virus rapidly, while the symptomatic patient experiences clinical signs including anorexia,

hepatomegaly, myalgia, jaundice and sometimes abdominal discomfort, nausea, vomiting, and fever [5,41]. In

immunocompromised patients such as organ transplant recipients, lymphoma and leukemia patients, or

patients with HIV infection, the course of disease may progress to a chronic state with cirrhosis of the liver and

persistence of viral shedding [42,43,44,45,46]. Of particular concern is the ability for HEV-infected

immunocompromised individuals to develop clinical disease well after the initial exposure [44,45,46,47].

Currently, chronic HEV infection in immunocompromised individuals is an emerging and signi�cant clinical

problem. Future studies are warranted to identify the immunological correlates and host factors leading to

chronicity. The typical infection begins with an incubation period of 2 weeks to 2 months and a transient

viremia followed by viral shedding in the feces, disappearance of viremia with the onset of clinical signs, and

regression of viral shedding with potential jaundice setting in around 2-3 weeks into the infection [46]. The

severity of HEV infection is considered dose-dependent and host factors such as concurrent hepatic disease

or alcohol overuse may also contribute to the disease course [41]. In studies from France, Germany, the United

Kingdom, and the United States, middle-aged, elderly men were more likely to experience autochthonous HEV

infection; however, the underlying host factors have not been understood [48,49,50,51]. Of major concern is the

relationship between pregnancy and increased mortality rates up to 20% in HEV endemic regions; however, this

relationship appears to be geographically dependent and may be associated with other underlying factors such

as virus genotype or concurrent infections with other pathogens [4,20,52,53,54]. Complications with concurrent

HEV infection during pregnancy include death of both the mother and fetus, abortion, premature birth, and

death of the baby shortly after birth [55]. Vertical transmission from the mother to fetus was reported in 33% of

cases and HEV RNA was reportedly detected in human colostrum as well [56,57]. Unfortunately it is not

understood why pregnancy resulted in severe hepatitis E manifestation. Understanding the mechanisms of

pregnancy- associated severe hepatitis E, especially fulminant hepatitis E, in the future will help devise

effective preventive measures against this disease. Genotypes 1 and 2 HEV strains are restricted to the human

population, while genotypes 3 and 4 HEV strains infect both humans and other animals with zoonotic

transmission routes. Human to human transmission of HEV is considered rare; although, blood-borne

transmission has been reported via blood transfusion [20,58,59,60]. A comparative study of genotype 3 and 4

HEV- infected individuals in Japan revealed that genotype 4 HEV is associated with a higher level of alanine

aminotransferase (ALT), higher prevalence of clinical infection, higher level of total bilirubin, higher level of

viremia, more frequent fulminant hepatitis development, and overall a more aggressive hepatitis [48]. The

mechanisms of cross-species HEV infection remain poorly understood. Identi�cation of both the viral genetic

elements and host factors that are important for cross-species HEV infection will be the key for devising

strategies to prevent and control zoonotic HEV infections. 3.2 HEV infection in animals Natural and

experimental HEV infections in swine (genotypes 3 and 4) result in a subclinical course of infection with only

mild microscopic lesions in the liver and associated lymph nodes [61,62]. Viremia lasts 1–2 weeks with fecal



virus shedding lasting 3–7 weeks [7,61,62]. HEV infection in swine is age-dependent with up to 86% of the pigs

infected by 18 weeks of age [63]. Additional studies from the United Kingdom, Spain, and Japan further

demonstrated that the highest fecal virus shedding occurred by 10–12 weeks, 13–16 weeks, and 1–3 months

of age, respectively [64,65,66]. Seroconversion to HEV antibodies in swine occurs following the typical waning

in maternal antibody levels around 8–10 weeks of age �rst with IgM anti-HEV antibodies peaking in

conjunction with fecal viral shedding followed by IgG anti-HEV antibodies peaking in conjunction with

clearance of virus from the feces [20,64,65,66].Transmission between swine is fecal-oral with large amounts of

infectious HEV being shed in the feces, and direct contact between animals, with other animals’ excreta, and

with potentially contaminate and water sources in swine facilities contributes to transmission within a herd

[7,67,68,69,70]. Although HEV infection in pigs does not pose a major economical concern in swine production,

the risk of zoonotic transmission to humans is an important public health concern. Therefore, development of

an effective vaccine to immunize susceptible swine herds in the future will minimize the risk of zoonotic

infection and improve pork safety. Avian HEV genotypes 1-3 carry a slightly different course of infection with a

high level of subclinical infection in �ocks and mortality rates up to 0.3–1.0% [36,71,72]. Clinical signs may

include egg drop in some �ocks up to 20%, enlargement of the liver and spleen, and acute death of affected

birds [73]. Post-mortem evaluations show enlarged, hemorrhagic, and focally necrotic livers, in�ammatory

cellular in�ltrations in the liver tissue, serosanguinous abdominal �uid, and regressing ovaries in some affected

birds [73,74]. It appears that avian HEV does not infect humans, and thus is not a concern for food and

environmental safety. Nevertheless, more studies are needed to fully assess the potential of avian HEV cross-

species infection. 4. Epidemiology of HEV Infection HEV is considered hyperendemic in many developing

countries such as India, Bangladesh, Egypt, Mexico, and China. Hyperendemic countries carry an HEV

prevalence of 25% of all non- A, non-B, acute hepatitis cases or have experienced a major waterborne outbreak

of hepatitis E according to the Centers for Disease Control and Prevention [75]. HEV is considered endemic

where there is a prevalence of less than 25% of all reported non-A, non-B acute hepatitis [75]. Endemic

countries include much of Western Europe, the United States, New Zealand, many countries in South America,

much of Asia, and the Middle East [75,76,77]. Trends throughout the world point to continued high anti-HEV

seroprevalence and HEV infection likely due to increases in interest, awareness and surveillance efforts as well

as increased spread among known animal reservoirs and hosts [20,75,76,77,78,79,80,81].Seroprevalence

reports vary dramatically from country to country and study to study with some studies reporting overall

declines in seroprevalence over time, while other yield continued high levels of seroprevalence [80,82,83]. 9

Prevalence of anti-HEV IgG tends to increase with age especially in men [80,84,85,86,87]. Humans and other

animals excrete a considerable amount of virus early in the acute phase of HEV infection and likely contribute

to maintain the cycle of endemicity [76]. The lack of a standardized serological assay further complicated the

interpretation of the sero-epidemiological data. Therefore, development of an FDA-approved diagnostic assay

for HEV should be a priority in the future. 5. Environmental Contamination and Waterborne Transmission 5.1

HEV Transmission from Sewage and Animal Manure Run-off HEV is typically transmitted via fecal-oral route

within an animal species, from animals to humans in infectious body �uids, and from contaminated food or



water sources to humans and other animals. Inadequate disposal and treatment of sewage and contamination

of drinking and irrigation water lead to the many epidemics in developing countries [2,88,89]. Increased rates of

human HEV infection in Turkey and certain countries in Southeast Asia are associated with utilizing untreated

river water for everyday tasks such as bathing, drinking, and disposal of waste products [90,91,92,93].

Environmental catastrophes and annual �ooding are also associated with elevated HEV attack rates especially

in regions where river, pond, or well water use is prevalent [10,92,93,94]. In both industrialized and developing

countries, raw sewage water has been shown to contain infectious HEV strains that are closely related to the

strains circulating in humans(genotypes 1 and 2) and other animals (genotypes 3 and 4) [95,96,97,98,99]. In

the Netherlands, genotype 3 HEV RNA was detected in river water which likely originated from sewage

[100].Run-offs from animal facilities such as hog operations have been implicated in human HEV infections

with the detection of infectious genotype 3 HEV in the animal manure and wastewater [100,101]. Professionals

working in close proximity to swine, swine manure, or sewage may become infected with HEV during

occupational activities [70,100,102,103,104]. For example, swine workers in Valencia, Spain were found to be

5.4 times more likely to be positive for anti-HEV IgG than those not exposed to swine [104]. Utilizing a Bayesian

model to account for imperfections in sero-assays leading to differences in the interpretation of serology

results, Bouwknegt et al [103] found that approximately 11% of swine veterinarians, 6% of non-swine

veterinarians, and 2% of the general population were positive for anti-HEV antibodies. Variation in assays,

validity of serologic tests for determining HEV prevalence, the lack of standardized diagnostic tools, the

potential for multiple routes of transmission, and incompletely understood transmission routes particularly in

small de�ned populations lead to di�culty in assessing the exact risk factors for HEV infection [105,106]. For

example, Vulcano et al [107] identi�ed male housekeepers and speci�c pig breeders as carrying a higher

prevalence of IgG anti-HEV seropositivity than previously identi�ed in Italy and found a 5.5% seropositivity in

subjects from Rieti in comparison to 2.5% from Rome, despite an overall lack of association with swine

contact. In addition, pig farmers and the general population in Sweden were found to have 13% and 9%

seropositivity respectively, which was higher than previously reported for populations in Europe (1-9%) and

contributes to uncertainty in our current knowledge of transmission routes and risk factors for HEV infection

[108]. Again, standardized serological and molecular diagnostic tests are in critical need for the study of HEV

transmission and prevalence. During natural contact routes of transmission, HEV RNA is also detectable in the

urine of infected swine, which likely contributes to the ease of spread in con�ned swine operations and may

pose as an alternate route of exposure for humans [109]. Contaminated water and sewage may serve as

sources for HEV infection in both humans and other animals. Current research indicates the potential for

transmission through these sources; however, further analysis of these sources in regards to all genotypes of

HEV will better assess the overall public health risk. 5.2 Surface Water Contamination and Transmission of

HEV Surface water is easily contaminated by stable fecal-shed viruses such as HEV and acts as a public health

hazard [110]. The quality of surface water directly affects populations utilizing the source since drinking water,

and intensive farming practices lead to higher detection rates of viruses within these sources [110,111]. In

Canada, HEV genotype 3 detected from �eld-grown strawberries shared 99% nucleotide sequence identity with



local swine HEV strains [112,113]. In Slovenia, genotype 3 HEV was recovered from surface waters as well as

from 20% of fecal samples in local pig farms [114]. Typical irrigation practices allow HEV and other enteric and

hepatic viruses to impact surface water quality and elevate the potential for human exposure to pathogens

[115,116]. Contaminated produce may serve as a source for autochthonous HEV cases in non-endemic regions

[112,117]. In all cases of HEV detection in water or produce, the contamination levels were not assessed for

further infectivity of humans or animals. The ability to recover infectious virus both from the local pig farms,

the surface waters, and from produce receiving contaminated water would indicate that the virus is stable

enough to be transmitted in these sources. Therefore, further infectivity studies should be done to assess the

ability to transmit and cause infection especially in cases where the virus contamination levels are low. 5.3

Coastal Water Contamination and Transmission of HEV Coastal waters may also be contaminated by HEV

leading to accumulation of the virus in the digestive tissues of shell�sh, which poses a risk of human infection

through ingestion. Most often, mussels, cockles, and oysters are eaten raw or slightly cooked, and HEV is

stable in both alkaline and acidic environments, frozen for more than 10 years, and remains infectious at up to

60C, suggesting that a raw, rare-cooked, or slightly steamed contaminated seafood may transmit HEV to

consumers [118,119]. Shell�sh have been implicated in an outbreak of HEV occurring aboard a cruise ship in

European waters and HEV has been identi�ed in commercial mussels obtained from three European countries

(Finland, Greece, and Spain) [120,121]. In Scotland, 92% of bivalve mussels collected were tested positive for

HEV RNA with the viral sequences clustering with genotype 3 human and swine HEV [122]. Case reports of

hepatitis E in England, Italy, and France reveal shell�sh consumption as a common source risk factor for HEV

infection [79,123,124]. In addition, genotype 3 swine HEV has been detected in shell�sh in Korea and Japan

[125,126,127]. Travelers to hyperendemic and endemic regions of the world are at an increased risk of

acquiring HEV infection from contaminated water and seafood, but industrialized countries are not exempt

[77]. 6. Foodborne Transmission and Food Safety The meat products from HEV-infected reservoir animal

species are capable of transmitting HEV to humans and are a public health concern [75,76,88]. HEV primarily

replicates in the liver of infected animals; however, extra-hepatic sites of HEV replication have also been

demonstrated in the gastrointestinal tissues, mesenteric and hepatic lymph nodes, and spleen [20].In addition

to the liver tissues, HEV RNA has been detected from the stomach, kidney, salivary glands, tonsils, lungs, and

multiple muscle masses of pigs and chickens when inoculated intravenously [128,129,130]. Consumption of

undercooked or raw organs or tissues from infected swine has been linked to numerous cases of hepatitis E

worldwide. For example, three cases of hepatitis E in Japan were associated with the consumption of

undercooked or raw pork presumably from the same barbeque restaurant [131]. Nine of ten clinical cases of

hepatitis E from 2001 to 2002 had a history of consuming undercooked pork 2-8 weeks before the onset of

clinical signs and 1.9% of pig livers tested from local groceries in Hokkaido, Japan were positive for genotype 3

or 4 HEV RNA [13]. Consumption of pig liver or intestines is considered as a risk factor for HEV infection [131].

Cases of hepatitis E in Japan were also linked to the consumption of contaminated wild boar meat

[132,133,134,135].Wild boar populations in Italy and South-eastern France had detectable levels of HEV RNA in

2.5% of liver samples and 25% of bile samples, respectively [136,137]. Boar meat consumption was positively



associated with HEV infection in a case-control study in Germany [138]. Cases of acute hepatitis E associated

with genotype 4 HEV have been con�rmed in South Korea, presumably due to the consumption of raw wild

boar bile juice [139]. Human patients with acute HEV infections in France were linked to the consumption of

�gatellu sausage (Corsican raw pig liver dish). The HEV sequences recovered from the �gatellu products in

local grocery stores were essentially indistinguishable from the viral sequences recovered from the human

patients, thus providing compelling evidence for foodborne HEV transmission [11,140]. The HEV present in the

pig liver sausage from manufacturers in France was shown to be infectious utilizing a 3D HEV cell-culture

system [141]. Commercial pig livers tested in the United States, Germany, and the Netherlands also carried

detectable levels of HEV RNA in 11%, 4%, and 6.5% of the samples tested, respectively [142,143,144]. At

slaughterhouses in Bavaria, Germany, 68.6% of the serum samples and 67.6% of meat juice samples were

tested seropositive for HEV antibody, indicating animal exposures to HEV prior to slaughter [145]. In Italy, an

overall 87% anti-HEV seropositivity was detected in slaughterhouse swine and 64.6% were positive for HEV

RNA indicating both a high level of exposure to HEV and a similarly high level of active virus infection at the

time of slaughter [146]. Similar investigations of pork production chains in the Czech Republic, Spain, and the

United Kingdom revealed detectable, infectious HEV at both processing locations and point of sale

[147].Genotype 4 HEV has also been identi�ed in a small percentage of pig livers collected from markets in

India and carry a 90–91% nucleotide sequence identity with the local swine HEV isolates [148]. Other reports

identify Indian strains of genotype 4 swine HEV as genetically distinct from genotype 1 human HEV strains

circulating in the region further convoluting the route of transmission [149]. Human consumption of genotype 4

HEV- contaminated pork livers leading to disease has not yet been reported in India, which may be due to

differing culinary habits [11,140]. It is likely that the genotype 4 swine HEV in India does cause sporadic cases

of acute hepatitis E in humans through zoonotic infection, although such rare and sporadic cases of genotype

4 hepatitis E may be masked by the more prevalent and explosive form of genotype 1 hepatitis E in India. In

addition to pork, game meats such as deer have also been implicated as sources for HEV transmission to

humans following the detection of near identical HEV sequences from leftover Sika deer meat and four

hepatitis E patients in Japan who previously consumed the deer meat as sushi [14,20,150]. A locally caught

wild deer carried a nearly identical HEV isolate that was later con�rmed in local wild boar populations in Japan

as well [150]. Sashimi style deer meat is usually consumed in Japan where a case-control study attributed raw

deer meat as a risk factor for anti- HEV seropositivity after identifying a positive association between deer

meat consumption and a previous case of hepatitis E [14,151]. Elevated risks indicate that within this de�ned

case-control population, those who consumed raw deer meat were more likely to be positive for HEV

antibodies indicating exposure to the virus, while those who did not consume the deer meat had a lower level

of exposure based on seropositivity [14,151]. Consumption of game meats including wild boar, deer, and hare

was independently associated with HEV infection in organ transplant recipients in France with an odds ratio of

2.32 [152]. Combined, these studies clearly identify wild and domestic pork products and game meats as

sources for human HEV infection and implicate foodborne transmission as a common route for HEV infection.

7. Known and Potential Animal Reservoirs A number of animals are known to serve as the natural hosts and



reservoirs for HEV. HEV has been genetically identi�ed from rat, wild boar, domestic swine, mongoose, rabbits,

chickens, ferrets, cutthroat trout, bats, and deer [17,18,19,23,25,26,34,61,139,153

].Anti-HEV antibodies have been detected in a number of other animal species including

cattle, sheep, and goats with the potential to carry novel strains of HEV [1,154]. With the advance of modern

molecular biology techniques such as metagenomics and pyrosequencing, it is expected that the host range of

HEV will expand and novel strains of HEV will be identi�ed from other animal species in the near future. 7.1

HEV in Avian Species Avian HEV was identi�ed as such in 2001 from

chickens with Hepatitis-Splenomegaly (HS) syndrome in the United States

[34]. Likewise, Big Liver and Spleen Disease virus (BLSV) in Australia presented similarly with an approximately

80%nucleotide sequence identity to avian HEV [34,73]. These two previously identi�ed syndromes (HS and

BLS) are assumed to be caused 16 by variant strains of the same virus, avian HEV, which now encompasses

three distinct, but related genotypes worldwide [24,73,155,156]. In the United States, an estimated 71% of

chicken �ocks and 30% of individual chickens are positive for avian HEV [36]. Avian HEV infection in chickens

is age-dependent with 17% of seropositive chickens under 18 weeks of age and 36% of seropositive adult

chickens [36,157]. Avian HEV has been shown to cross species barriers and infect turkeys [71]. It is currently

unknown, however, whether avian HEV is capable of transmission to humans or other mammalian species;

although, rhesus monkeys and mice are not susceptible to infection by avian HEV under experimental

conditions [1,73]. 7.2 HEV in Domestic and Wild Swine Species Since its discovery in domestic swine in the

United States in 1997, swine HEV strains have been identi�ed worldwide in both domestic and wild swine with

widely variable prevalence [11,61]. Studies of prevalence across Japan revealed that anti-HEV antibody is

present in 93% of all domestic swine farms tested and that all swine HEV isolates belong to either genotype 3

or 4 [24,48,158,159]. Prevalence of anti-HEV antibodies in wild boars in Japan is also widely variable ranging

from 4.5% to 34.3% based on geographic regions with genotype 3 or 4 HEV RNA detection rates ranging from

1.1% to 13.3% [48]. In the Netherlands, domestic swine farms carried a prevalence of 55% for HEV RNA in the

feces, while 86.2% and 47.1% of 18-week-old pigs in Canada shed HEV virus in feces and serum, respectively,

with a declination as the pigs aged [63,160]. In Spain, the prevalence of anti-HEV antibodies on commercial

swine farms reached 98%, while the anti-HEV prevalence in New Zealand, Laos and Brazil is90%, 46% and 81%,

respectively [20,161,162,163,164]. The anti-HEV seropositivity in wild boars varied from 17-50.3% with HEV

RNA detected in up to 25% of samples in Germany, Italy, Spain, Australia, and Hungary

[15,136,137,165,166,167]. In the United States, swine HEV infection in pig farms is 17 also widespread, and the

majority of pigs became seropositive to HEV antibodies at approximately 3 months of age [61]. It appears that

genotype 3 or 4 HEV infection in pigs is widespread in the pig population worldwide, thus raising a concern for

zoonotic infection and pork safety. 7.3 HEV in Deer Deer have been implicated both acting as animal reservoirs

for HEV and acting as vehicles for human infection [12,14,20,150]. The Sika and Yezo deer in Japan carried a

3% and 35% anti-HEV seroprevalence respectively, with a positive association with HEV infection in humans



and nearly identical nucleotide sequence identity with HEV strains from local wild boars [7,14,150,168]. In

Hungary, the European roe deer was implicated as a reservoir species for HEV, and in the Netherlands 5% of

red deer were also found positive for antibodies to HEV [165,167,169]. White- tailed deer in Northern Mexico

carried a 62.7% anti-HEV seropositivity [170].Increasing management of deer including feeding, watering,

movement of groups, and fencing for hunting purposes in Mexico offers the ability for pathogens such as HEV

to transfer between groups of deer and humans readily and may serve to disseminate pathogens to animals

within the United States [170]. Sharing of habitats between wild boar and deer may play a role in the ability to

harbor and transmit HEV to humans. However, without additional direct evidence of transmission within the

deer species, it is di�cult to determine whether deer acts as incidental or natural hosts to HEV infection

[1,20,76]. 7.4 HEV in Ruminants Ruminant (cattle, sheep and goat) strains of HEV have yet to be uncovered;

however, multiple studies of anti-HEV seroprevalence indicated the possibility of their existence [7,165]. In

Egypt, 11% of cows, 14% of buffalo, 4.4% of sheep, and 9.4% of goats were tested positive for HEV 18

antibodies [171]. Approximately 4.4–6.9% of cows and 0% of goats in India, 1.4% of cows and 0% of sheep and

goats in Brazil were reportedly tested positive for anti-HEV antibodies [172,173]. Reports of anti-HEV

seropositivity from China varied drastically from 6-93% of cattle and 10- 12% of sheep [174,175,176,177]. A

short sequence (189 bp) of a genotype 4 HEV has been reportedly identi�ed in bovid species, although

independent con�rmation of this unsubstantiated report is still lacking [1,7,76]. Despite the abundant

serological evidence for an HEV-related agent in ruminants, de�nitive genetic identi�cation of HEV from

ruminants is still lacking. It is possible that the strain carried by ruminants is very divergent genetically from the

known HEV strains thus leading to failure to genetically identify the virus based upon current techniques. The

serological data from ruminants is based upon cross-reaction of the ruminant serum samples with known HEV

proteins such as ORF2 [7,165,171,172]. The validity of such serological data has been questioned due to the

fact that the assays may not be speci�c, they do not identify the actual virus, and they may allow cross-

reactivity with non-viral proteins that share a certain level of sequence homology. Research in this area must

continue to better address these concerns and con�rm the source of anti-HEV seropositivity in ruminants.

Given the wide use of cattle, sheep, and goats in the human food chain, the genetic identi�cation of these

ruminant strains of HEV would be of a potential public health concern. 7.5 HEV in Rats The rat strain of HEV

was identi�ed in wild Norway rats from Hamburg, Germany with 59.9% and 49.9% nucleotide sequence identity

with known human and avian HEV strains, respectively [18]. Rats in the United States, Germany, Indonesia,

China, and Japan are also tested seropositive for HEV antibodies in several studies with variable prevalence

[18,178,179,180,181]. 19 Overall, 44% of rats in Louisiana, 77% in Maryland, 90% in Hawaii, 59.7% of rats of the

genus Rattus from across the United States, 32% of Norway rats in Japan, and 13% of black rats in Japan were

tested positive for antibodies to HEV [178,179,182,183]. Most recently in China, 23.3% of rats were positive for

anti-HEV IgG with the highest prevalence of 45.3% from rats caught at garbage dump sites [180]. In Indonesia,

18.1% of rats were tested positive for anti-HEV antibodies and 14.7% positive for HEV RNA [181]. Recently,

genotype 3 rat HEV strains have been genetically detected from wild rats in the United States, suggesting the

potential for zoonotic transmission and the genetic variability of rat HEV [1,182]. Further studies are warranted



to independently con�rm the existence of genotype 3 HEV in rats, especially since, under experimental

condition, laboratory rats are not susceptible to experimental infection by genotype 3 HEV [184]. 7.6 HEV in

Rabbits Rabbits may serve as reservoir hosts for HEV transmission to humans given the genetic identi�cation

of zoonotic genotype 3 strains of HEV from rabbits in China, the United States, and France [17,153,174,185].

Rabbits are susceptible to experimental infection by genotype 4 human HEV, and the infected rabbits

developed viremia, seroconversion to anti-HEV, and fecal virus shedding [153,185]. The rabbit HEV is

genetically and antigenically closely related to other mammalian HEV. The capsid protein of the genotype 3

rabbit strain of HEV was capable of cross- reacting with antibodies from other strains of HEV including rat,

swine, human, and chicken [1,185,186]. The prevalence of HEV antibodies in farmed rabbits is reportedly 57%

in the Gansu province in China, 54.6% in Beijing, China, and 36.5% in two rabbit farms in Virginia, USA, while

HEV RNA has been identi�ed in 7.5%, 7.0%, 16.5%, and 15.3% of the rabbits, respectively [17,153,174]. In

France, HEV RNA was also identi�ed from 7.0% of farmed rabbits, 20 while 23.0% of wild rabbits were also

positive for HEV RNA [185]. It appears that rabbits could be an important reservoir for HEV infection in

humans, and in-depth studies of its ability to infect across species barriers and associated zoonotic risks in the

future are needed. 7.7 HEV in Other Species Other known animal strains of HEV genetically identi�ed thus far

include mongoose, ferret, bat, and �sh [1,23,25,26,187,188]. Wild mongoose in Okinawa, Japan carried

genotype 3 HEV strains and the prevalence of anti-HEV seropositivity varied from8 to21% [187,188]. In the

Netherlands, ferrets carried a strain of HEV that shared a 72.3% nucleotide sequence identity with that of the

rat HEV [23]. The cutthroat trout in the United States also carried a unique strain of HEV with only 13 to 27%

sequence identity with known mammalian and avian HEV strains [26]. The zoonotic potentials of these novel

animal strains of HEV are not altogether understood, but the ever-expanding host range and high levels of anti-

HEV seropositivity among mammalian species suggests transmission is common and thus may pose a

potential public health concern. 8. Animal Handling and Zoonotic Transmission Contact exposure to infected

animals leads to an elevated risk for HEV transmission in humans. Swine veterinarians in the United States

were shown to have a27% seropositivity to genotype 3 swine HEV in comparison to 16% of the normal blood

donors [189]. Individuals from states in which swine production plays a key role were more likely to be

seropositive to HEV than other non-major swine states [189]. Incidents such as needle sticks while working

with swine were found to be1.9 times more likely positive for HEV antibodies in swine veterinarians [189]. Pig

handlers such as veterinarians, breeders, and farmers in China, Thailand, the Netherlands, Sweden, Moldova,

and the United States were also more likely seropositive to swine 21 HEV [103,108,190,191,192]. In Sweden,

13% of pig breeders were positive for antibodies to HEV [190]. In the Netherlands, 11% of swine veterinarians

were positive in comparison to 6% of non-swine veterinarians and 2% of the general population [108]. In North

Carolina, swine handlers carried a 4.5 times higher rate of seropositivity in comparison to non-swine workers

[191]. In Moldova, 51% of swine farmers were positive in comparison to 25% of non-swine occupations [103].

Taken together, swine are a major reservoir for HEV and occupational contact with infected swine is a risk

factor for zoonotic HEV transmission in humans. Contact with swine is the most widely recognized route for

occupational exposure to HEV; however, the multitude of novel strains of HEV in wildlife and other domestic



animal species suggest additional mechanisms of transmission. For example, �eld workers at the Iowa

Department of Natural Resources who work with a variety of wildlife species had a higher prevalence for HEV

antibodies in comparison to normal blood donors [193]. While exposure to HEV, identi�ed by the presence of

anti-HEV antibodies in these populations does not in itself indicate a disease, it does identify a route of

transmission and exposure that should be further assessed and acknowledged as a preventive measure

against this important disease. Examination of these additional mechanisms is vital to understanding the full-

spectrum of public health risk associated with HEV infection. 9. Conclusions The zoonotic risk of HEV is well

established; however, the ever-expanding host range and identi�cation of new animal reservoir species poses a

signi�cant public health concern. Seroprevalence in human and other animal species varies drastically

between studies and countries with no clear understanding of the overall problem, and this is largely due to the

lack of an established FDA-approved serological diagnostic assay. Numerous animal species were tested 22

seropositive for IgG anti-HEV, although HEV was not genetically identi�ed from all seropositive animal species.

Detection of HEV in sewage, water sources, coastal and surface waters, and produce poses environmental

safety concerns even in industrialized countries where waterborne origins of human hepatitis E cases were

previously considered rare. Foodborne cases of hepatitis E in humans are increasingly common and likely

underestimated in the medical community. Sporadic and cluster cases of hepatitis E occur after consumption

of undercooked or raw animal meats. Prevention of foodborne HEV transmission relies on avoiding

consumption of undercooked animal meats especially when immunocompromised, following good hygiene

practices, and being aware of increased risks when traveling to endemic or hyperendemic regions of the world.

Despite the clear risk, prevention strategies are currently minimally implemented. A vaccine against HEV has

recently become available in China but not in other countries. Surveillance, vaccination, de- contamination of

sewage and water sources, and public education will help prevent current and future endemics or epidemics

lowering the human burden. The development of a vaccine against the zoonotic swine HEV would reduce

foodborne and swine contact cases in humans as well as diminish the spread of the virus between animal

species. Control of animal waste, run-off, and decontaminated sewage is key to limiting the spread of HEV to

coastal and surface waters and in turn reducing concomitant contamination of shell�sh. Acknowledgments

The authors’ research on HEV is supported by grants from the National Institutes of Health (R01AI074667, and

R01AI050611).D.M.Y. is supported by a training grant from the National Institutes of Health (T32OD010430-

06). This review article encompasses a comprehensive literature review with a focus on food and

environmental safety and zoonotic risk of HEV. Due to the narrow scope of the topic and space 23 constraints,

many important articles regarding HEV may be unintentionally excluded from this review. We have attempted

to include the most recent publications including review articles in order to provide the reader with up to date

and comprehensive information on the topic.

Con�ict of Interest The authors declare no con�ict of interest.

References and Notes 1. Meng, X.J. Zoonotic and foodborne transmission of hepatitis E virus. Semin. Liver.

Dis. 2013, 33, 41–49. 2. 3. Emerson, S.; Purcell, R. Hepatitis E. Pediatr. Infect. Dis. J. 2007, 26, 1147–1148.



Sanford, B.; Dryman, B.; Huang, Y.-W.; Feagins, A.; Leroith, T.; Meng, X.-J. Prior infection of pigs with a genotype

3 swine hepatitis E virus (HEV) protects against subsequent challenges with homologous and heterologous

genotypes 3 and 4 human HEV. Virus Res. 2011, 159, 17–22. 4. 5. Emerson, S.; Purcell, R.

Hepatitis E virus. Rev Med Virol 2003, 13, 145-154.

Meng, X.J.

Hepatitis E virus: animal reservoirs and zoonotic risk. Vet. Microbiol. 2010, 140,

256–265. 6. Dalton, H.; Bendall, R.; Ijaz, S.; Banks, M. Hepatitis E: an emerging infection in developed countries.

Lancet Infect. Dis. 2008, 8, 698–709. 7. Meng, X.J. From barnyard to food table: the omnipresence of hepatitis

E virus and risk for zoonotic infection and food safety. Virus Res. 2011, 161, 23–30. 8. Purcell, R.; Emerson, S.

Hepatitis E: an emerging awareness of an old disease. J. Hepatol. 2008, 48, 494–503.

9. Péron, J.; Dalton, H.; Izopet, J.; Kamar, N. Acute autochthonous hepatitis E in western patients with

underlying chronic liver disease: a role for ribavirin? J. Hepatol. 2011, 54, 1323. 10. Kumar, S.; Subhadra, S.;

Singh, B.; Panda, B. Hepatitis E virus: the current scenario. Int. J. Infect. Dis. 2013, 17, 33. 11. Colson, P.;

Borentain, P.; Queyriaux, B.; Kaba, M.; Moal, V.r.; Gallian, P.; Heyries, L.; Raoult, D.; Gerolami, R. Pig liver sausage

as a source of hepatitis E virus transmission to humans. J Infect. Dis. 2010, 202, 825-834. 12.

Tei, S.; Kitajima, N.; Takahashi, K.; Mishiro, S. Zoonotic transmission of hepatitis E virus from deer to human

beings. Lancet 2003, 362, 371-

373. 13. Yazaki, Y.; Mizuo, H.; Takahashi, M.; Nishizawa, T.; Sasaki, N.; Gotanda, Y.; Okamoto, H. Sporadic acute

or fulminant hepatitis E in Hokkaido, Japan, may be food-borne, as suggested by the presence of hepatitis E

virus in pig liver as food. J. Gen. Virol. 2003, 84, 2351-2357 14.

Takahashi, K.; Kitajima, N.; Abe, N.; Mishiro, S. Complete or near-complete nucleotide sequences of

hepatitis E virus genome recovered from a wild boar, a deer, and four patients who ate the deer. Virology 2004,

330, 501-

505. 15. de Deus, N.; Peralta, B.; Pina, S.; Allepuz, A.; Mateu, E.; Vidal, D.; Ruiz-Fons, F.; Martín, M.; Gortazar, C.;

Segales, J. Epidemiological study of hepatitis E virus infection in European wild boars (Sus scrofa) in Spain.

Vet. Microbiol. 2008, 129, 163-170. Zhao, C.; Ma, Z.; Harrison, T.J.; Feng, R.; Zhang, C.; Qiao, Z.; Fan, J.; Ma, H.;

Li, M.; Song, A.; Wang, Y. A novel genotype of hepatitis E virus prevalent among farmed rabbits in China. J. Med.

Virol. 2009, 81, 1371-1379. 17. Cossaboom, C.; Córdoba, L.; Dryman, B.; Meng, X.J. Hepatitis E virus in rabbits,

Virginia, USA. Emerg. Infect. Dis. 2012, 17, 2047–2049. 18. Johne, R.; Heckel, G.; Plenge-Bönig, A.; Kindler, E.;

Maresch, C.; Reetz, J.; Schielke, A.; Ulrich, R. Novel hepatitis E virus genotype in Norway rats, Germany. Emerg.

Infect. Dis. 2011, 16, 1452–1455. 19. Nidaira, M.; Takahashi, K.; Ogura, G.; Taira, K.; Okano, S.; Kudaka, J.;

Itokazu, K.; Mishiro, S.; Nakamura, M.



Detection and phylogenetic analysis of hepatitis E viruses from mongooses in Okinawa, Japan.

J. Vet. Med. Sci. 2012, 74, 1665-1668. 20.

Pavio, N.; Meng, X.J.; Renou, C. Zoonotic hepatitis E: animal reservoirs and emerging risks. Vet. Res.

2010, 41, 46. 21. Marek, A.; Bilic, I.; Proko�eva, I.; Hess, M. Phylogenetic analysis of avian hepatitis E virus

samples from European and Australian chicken �ocks supports the existence of a different genus within the

Hepeviridae comprising at least three different genotypes. Vet. Microbiol. 2010, 145, 54–61. 22. Kwon, H.;

Sung, H.; Meng, X.J. Serological prevalence, genetic identi�cation, and characterization of the �rst strains of

avian hepatitis E virus from chickens in Korea. Virus Genes 2012, 45, 237–245. 23. Raj, V.; Smits, S.; Pas, S.;

Provacia, L.; Moorman-Roest, H.; Osterhaus, A.; Haagmans, B. Novel hepatitis E virus in ferrets, the

Netherlands. Emerg. Infect. Dis. 2012, 18, 1369–1370. 24. Takahashi, M.; Nishizawa, T.; Sato, H.; Sato, Y.;

Jirintai; Nagashima, S.; Okamoto, H.

Analysis of the full- length genome of a hepatitis E virus

isolate obtained from a wild boar in Japan that is classi�able into a novel genotype. J. Gen. Virol. 2011, 92,

902–908. 25. Drexler, J.; Seelen, A.; Corman, V.; Fumie Tateno, A.; Cottontail, V.; Melim Zerbinati, R.; Gloza-

Rausch, F.; Klose, S.; Adu-Sarkodie, Y.; Oppong, S.; Kalko, E.; Osterman, A.; Rasche, A.; Adam, A.; Müller, M.;

Ulrich, R.; Leroy, E.; Lukashev, A.; Drosten, C. Bats worldwide carry hepatitis E virus-related viruses that form a

putative novel genus within the family Hepeviridae. J. Virol. 2012, 86, 9134–9147. 26. Batts, W.; Yun, S.;

Hedrick, R.; Winton, J. A novel member of the family Hepeviridae from cutthroat trout (Oncorhynchus clarkii).

Virus Res. 2011, 158, 116–123. 27. Emerson, S.; Nguyen, H.;

Torian, U.; Mather, K.; Firth, A. An essential RNA element resides in a central region of hepatitis E virus

ORF2. J. Gen. Virol. 2013, 94, 1468-76.

28. Koonin, E.; Gorbalenya, A.; Purdy, M.; Rozanov, M.; Reyes, G.; Bradley, D.

Computer- assisted assignment of functional domains in the nonstructural polyprotein of hepatitis E virus:

delineation of an additional group of positive-strand RNA plant and animal viruses. P. Natl. Acad. Sci.

U.S.A. 1992, 89, 8259–8263. Pudupakam, R.; Huang, Y.; Opriessnig, T.; Halbur, P.; Pierson, F.; Meng, X.J.

Deletions of the hypervariable region (HVR) in open reading frame 1 of hepatitis E virus do not abolish virus

infectivity: evidence for attenuation of HVR deletion mutants in vivo. J. Virol. 2009, 83, 384–395. 30.

Surjit, M.; Jameel, S.; Lal, S. Cytoplasmic localization of the ORF2 protein of hepatitis E virus is dependent

on its ability to undergo retrotranslocation from the endoplasmic reticulum. J. Virol.

2007, 81, 3339–3345. 31.



Graff, J.; Zhou, Y.-H.; Torian, U.; Nguyen, H.; St Claire, M.; Yu, C.; Purcell, R.; Emerson, S. Mutations

within potential glycosylation sites in the capsid protein of hepatitis E virus prevent the formation of infectious

virus particles. J. Virol. 2008, 82, 1185–1194.

32. Graff, J.; Nguyen, H.; Kasorndorkbua, C.; Halbur, P.; St Claire, M.; Purcell, R.; Emerson, S. In vitro and in vivo

mutational analysis of the 3'-terminal regions of hepatitis e virus genomes and replicons. J. Virol. 2005, 79,

1017–1026. 33. Graff, J.; Nguyen, H.; Yu, C.; Elkins, W.; St Claire, M.; Purcell, R.; Emerson, S. The open reading

frame 3 gene of hepatitis E virus contains a cis-reactive element and encodes a protein required for infection of

macaques. J. Virol. 2005, 79, 6680–6689. 34.

Haqshenas, G.; Shivaprasad, H.; Woolcock, P.; Read, D.; Meng, X.J. Genetic identi�cation and

characterization of a novel virus related to human hepatitis E virus from chickens with hepatitis-splenomegaly

syndrome in the United States. J. Gen. Virol. 2001, 82, 2449– 2462. 35. Huang, F.; Sun,

Z.; Emerson, S.; Purcell, R.; Shivaprasad, H.; Pierson, F.; Toth, T.; Meng, X.J.

Determination and analysis of the complete genomic sequence of avian hepatitis E virus (avian HEV) and

attempts to infect rhesus monkeys with avian HEV. J. Gen. Virol. 2004, 85, 1609–

1618. 36. Huang, F.F.; Haqshenas, G.; Shivaprasad, H.L.; Guenette, D.K.; Woolcock, P.R.; Larsen, C.T.; Pierson,

F.W.; Elvinger, F.; Toth, T.E.; Meng, X.J. Heterogeneity and seroprevalence of a newly identi�ed avian hepatitis e

virus from chickens

in the United States. J. Clin. Microbiol. 2002, 40,

4197–4202. 37. Bouquet, J.; Cherel, P.; Pavio, N. Genetic characterization and codon usage bias of full- length

Hepatitis E virus sequences shed new lights on genotypic distribution, host restriction and genome evolution.

Infect. Genet. Evol. 2012, 12, 1842–1853. 38. Cao, D.; Meng, X.J. Molecular biology and replication of hepatitis

E virus. Emerg. Microbe. Infect. 2012, 1, e17; doi:10.1038/emi.2012.7 39. Graff, J.; Torian, U.; Nguyen, H.;

Emerson, S. A bicistronic subgenomic mRNA encodes both the ORF2 and ORF3 proteins of hepatitis E virus. J.

Virol. 2006, 80, 5919–5926. 40. Meng, X.J.; Halbur, P.; Shapiro, M.; Govindarajan, S.; Bruna, J.; Mushahwar, I.;

Purcell, R.; Emerson, S. Genetic and experimental evidence for cross-species infection by swine hepatitis E

virus. J. Virol. 1998, 72, 9714–9721. Purcell, R.E., S.U., Hepatitis E Virus. In Fields Virology 4th ed.; Knipe, D.,

Howley, P., Gri�n, D., Lamb,R., Martin, M., Roizman, B., et al., Ed. Lippincott: Williams and Wilkins: Philadelphia,

PA, 2001; pp 3051–3061. 42. Kamar, N.; Selves, J.; Mansuy, J.-M.; Ouezzani, L.; Péron , J.-M.; Guitard, J.l.;

Cointault, O.; Esposito, L.; Abravanel, F.; Danjoux, M.; Durand, D.; Vinel, J.-P.; Izopet, J.; Rostaing, L.

Hepatitis E virus and chronic hepatitis in organ-transplant recipients. New Engl. J.

Med. 2008, 358, 811–817. 43. le Coutre, P.; Meisel, H.; Hofmann, J.; Röcken, C.; Vuong, G.; Neuburger, S.;

Hemmati, P.; Dörken, B.; Arnold, R. Reactivation of hepatitis E infection in a patient with acute lymphoblastic

leukaemia after allogeneic stem cell transplantation. Gut 2009, 58, 699–702. 44. Ollier, L.; Bigaillon, C.; Tieulie,



N.; Tesse, S.; Heudier, P.; Sanderson, F.; Giordanengo, V.; Nicand, E.; Fuzibet, J.-G. Hepatitis E initially

serologically silent with prolonged evolution in a patient treated for a lymphoma. Presse. Med. 2009, 38, 1700–

1704. 45. Dalton, H.R.; Bendall, R.P.; Keane, F.E.; Tedder, R.S.; Ijaz, S. Persistent carriage of hepatitis E virus in

patients with HIV infection. N. Engl. J. Med. 2009, 361, 1025–1027. 46. Haagsma, E.; van den Berg, A.; Porte,

R.; Benne, C.; Vennema, H.; Reimerink, J.; Koopmans, M. Chronic hepatitis E virus infection in liver transplant

recipients. Liver Transplant. 2008, 14, 547–553. 47.

Teshale, E.H.; Hu, D.J.; Holmberg, S.D. The two faces of hepatitis E virus. Clin. Infect. Dis.

2010, 51, 328-334. 48.

Takahashi, M.; Okamoto, H. Features of hepatitis E virus infection in humans and animals in Japan.

Hepatol. Res. 2013, in press.

doi: 10.1111/hepr.12175. 49. Mansuy, J.M.;

Abravanel, F.; Miedouge, M.; Mengelle, C.; Merviel, C.; Dubois, M.;

Kamar, N.; Rostaing, L.; Alric, L.; Moreau, J.; Peron, J.M.; Izopet, J.

Acute hepatitis E in south-west France over a 5-year period. J. Clin. Virol. 2009, 44, 74–

77. 50. Dalton, H., Bendall, RP, Rashid, M, et al. Host risk factors and autochthonous hepatitis e infection. Eur. J.

Gastroenterol. Hepatol. 2011, 23, 1200–1205. 51. Brost, S.; Wenzel, J.J.; Ganten, T.M.; Filser, M.;

Flechtenmacher, C.; Boehm, S.; Astani, A.; Jilg, W.; Zeier, M.; Schnitzler, P.

Sporadic cases of acute autochthonous hepatitis E virus infection in Southwest Germany. J.

Clin. Virol. 2010, 47, 89–92. 52. Hussaini, S.; Skidmore, S.; Richardson, P.; Sherratt, L.; Cooper, B.; O'Grady, J.

Severe hepatitis E infection during pregnancy. J. Viral. Hepatitis 1997, 4, 51–54. 53. Khuroo, M.; Kamili, S.;

Jameel, S. Vertical transmission of hepatitis E virus. Lancet 1995, 345, 1025–1026. 54. Renou, C.; Pariente, A.;

Nicand, E.; Pavio, N. Pathogenesis of Hepatitis E in pregnancy. Liver Int. 2008, 28, 1465. 55. Mushahwar, I.

Hepatitis E virus: molecular virology, clinical features, diagnosis, transmission, epidemiology, and prevention. J.

Med. Virol. 2008, 80, 646–658. Kumar, A.; Beniwal, M.; Kar, P.; Sharma, J.; Murthy, N. Hepatitis E in pregnancy.

Int. J. Gynecol. Obstet. 2004, 85, 240–244. 57. Chibber, R.; Usmani, M.; Al-Sibai, M. Should HEV infected

mothers breast feed? Arch. Gynecol. Obstet. 2004, 270, 15–20. 58.

Matsubayashi, K.; Kang, J.-H.; Sakata, H.; Takahashi, K.; Shindo, M.; Kato, M.; Sato, S.; Kato, T.; Nishimori, H.;

Tsuji, K.; Maguchi, H.; Yoshida, J.-I.; Maekubo, H.; Mishiro, S.; Ikeda, H. A case of transfusion-transmitted

hepatitis E caused by blood from a donor infected with hepatitis E virus via zoonotic food-borne route.

Transfusion 2008, 48, 1368–1375.

59.



Boxall, E.; Herborn, A.; Kochethu, G.; Pratt, G.; Adams, D.; Ijaz, S.; Teo, C.G. Transfusion- transmitted

hepatitis E in a 'nonhyperendemic' country. Transfus. Med. 2006, 16, 79–83.

60. Arankalle, V.; Chobe, L. Retrospective analysis of blood transfusion recipients: evidence for post-transfusion

hepatitis E. Vox Sang. 2000, 79, 72–74. 61. Meng, X.J.; Purcell, R.; Halbur, P.; Lehman, J.; Webb, D.; Tsareva, T.;

Haynes, J.; Thacker, B.; Emerson, S.

A novel virus in swine is closely related to the human hepatitis E virus. P. Natl. Acad. Sci. U.S.A. 1997, 94,

9860–

9865. 62.

Halbur, P.; Kasorndorkbua, C.; Gilbert, C.; Guenette, D.; Potters, M.; Purcell, R.; Emerson, S.; Toth, T.; Meng, X.J.

Comparative pathogenesis of infection of pigs with hepatitis E viruses recovered from a pig and a human. J. Clin.

Microbiol.

2001, 39, 918–923. 63. Leblanc, D.; Ward, P.; Gagné , M.-J.e.; Poitras, E.; Müller , P.; Trottier, Y.-L.; Simard, C.;

Houde, A. Presence of hepatitis E virus in a naturally infected swine herd from nursery to slaughter. Int. J. Food

Microbiol. 2007, 117, 160–166. 64.

de Deus, N.; Casas, M.; Peralta, B.; Nofrarías , M.; Pina, S.; Martín, M.; Segalés, J. Hepatitis E virus infection

dynamics and organic distribution in naturally infected pigs in a farrow-to- �nish farm. Vet. Microbiol.

2008, 132, 19–28. 65. McCreary, C.; Martelli, F.; Grierson, S.; Ostanello, F.; Nevel, A.; Banks, M. Excretion of

hepatitis E virus by pigs of different ages and its presence in slurry stores in the United Kingdom. Vet. Rec.

2008, 163, 261–265. 66.

Nakai, I.; Kato, K.; Miyazaki, A.; Yoshii, M.; Li, T.-C.; Takeda, N.; Tsunemitsu, H.; Ikeda, H. Different fecal

shedding patterns of two common strains of hepatitis E virus at three Japanese swine farms. Am. J.

Trop. Med. Hyg. 2006, 75, 1171–1177. 67. Kasorndorkbua, C.; Opriessnig, T.; Huang, F.; Guenette, D.; Thomas,

P.; Meng, X.J.; Halbur, P. Infectious swine hepatitis E virus is present in pig manure storage facilities on United

States farms, but evidence of water contamination is lacking. Appl. Environ. Microb. 2005, 71, 7831–7837. 68.

Feagins, A.; Opriessnig, T.; Huang, Y.; Halbur, P.; Meng, X.J. Cross-species infection of speci�c-pathogen-free

pigs by a genotype 4 strain of human hepatitis E virus. J. Med. Virol. 2008, 80, 1379–1386. Kasorndorkbua, C.;

Guenette, D.K.; Huang, F.F.; Thomas, P.J.; Meng, X.J.; Halbur, P.G. Routes of transmission of swine

hepatitis E virus in pigs. J. Clin. Microbiol. 2004, 42,

5047– 5052. 70. Bouwknegt, M.; Frankena, K.; Rutjes, S.; Wellenberg, G.; de Roda Husman, A.; van der Poel, W.;

de Jong, M. Estimation of hepatitis E virus transmission among pigs due to contact- exposure. Vet. Res. 2008,

39, 40. 71. Sun, Z.; Larsen, C.; Dunlop, A.; Huang, F.; Pierson, F.; Toth, T.; Meng, X.J. Genetic identi�cation of

avian hepatitis E virus (HEV) from healthy chicken �ocks and characterization of the capsid gene of 14 avian



HEV isolates from chickens with hepatitis- splenomegaly syndrome in different geographical regions of the

United States. J. Gen. Virol. 2004, 85, 693–700. 72. Peralta, B.; Biarnés, M.; Ordóñez, G.; Porta, R.n.; Martín, M.;

Mateu, E.; Pina, S.; Meng, X.J. Evidence of widespread infection of avian hepatitis E virus (avian HEV) in

chickens from Spain. Vet. Microbiol. 2009, 137, 31–36. 73. Meng, X.J.,

Shivaprasad, HL., Payne, C., Hepatitis E Virus infections. In Diseases of Poultry, 12th Edition ed.; Saif,

M., et al, Ed. Blackwell Publishing Press: 2008; pp 443–452. 74. Billam, P.; Huang, F.; Sun, Z.; Pierson, F.;

Duncan, R.; Elvinger, F.; Guenette, D.; Toth, T.; Meng, X.J. Systematic pathogenesis and replication of avian

hepatitis E virus in speci�c- pathogen-free adult chickens. J. Virol. 2005, 79, 3429–3437. 75. Teo, C. Hepatitis

E. In:

Center for Disease Control and Prevention. CDC Health Information for International Travel

2010. US

Department of Health and Human Services: Public Health Service:

Atlanta, GA, 2009; pp 335–337. 76. Teo, C.

Much meat, much malady: changing perceptions of the epidemiology of hepatitis E. Clin. Microbiol. Infect.

2010, 16, 24–32.

77. Zuckerman, J.

Hepatitis E and the traveler. Travel Med. Infect. Dis. 2003, 1, 73–

76. 78. Buti, M.; Dominguez, A.; Plans, P.; Jardi, R.; Schaper, M.; Espunes, J.; Cardenosa, N.; Rodriguez-Frias, F.;

Esteban, R.; Plasencia, A.; Salleras, L. Community-based seroepidemiological survey of hepatitis E virus

infection in Catalonia, Spain. Clin. Vaccine Immunol. 2006, 13, 1328-1332 79.

Ijaz, S.; Arnold, E.; Banks, M.; Bendall, R.P.; Cramp, M.E.; Cunningham, R.;

Dalton, H.R.; Harrison, T.J.; Hill, S.F.; Macfarlane, L.; Meigh, R.E.; Sha�, S.; Sheppard, M.J.; Smithson, J.; Wilson,

M.P.; Teo, C.G. Non-travel-associated hepatitis E in England and Wales: demographic, clinical, and molecular

epidemiological characteristics. J. Infect. Dis. 2005, 192, 1166-1172. 80. Fukuda, S.; Ishikawa, M.; Ochiai, N.;

Suzuki, Y.; Sunaga, J.; Shinohara, N.; Nozawa, K.; Tsuda, F.; Takahashi, M.; Okamoto, H. Unchanged high

prevalence of antibodies to hepatitis E virus (HEV) and HEV RNA among blood donors with an elevated alanine

aminotransferase level in Japan during 1991-2006. Arch. Virol. 2007, 152, 1623-1635. Mansuy, J.M.; Bendall, R.;

Legrand-Abravanel, F.; Saune, K.; Miedouge, M.; Ellis, V.; Rech, H.; Destruel, F.; Kamar, N.; Dalton, H.R.; Izopet, J.

Hepatitis E virus antibodies in blood donors, France. Emerg. Infect. Dis. 2011, 17, 2309-2312. 82. Christensen,

P.B.; Engle, R.E.; Hjort, C.; Homburg, K.M.; Vach, W.; Georgsen, J.; Purcell, R.H. Time trend of the prevalence of



hepatitis E antibodies among farmers and blood donors: a potential zoonosis in Denmark. Clin. Infect. Dis.

2008, 47, 1026-1031. 83. Purdy, M.A.; Khudyakov, Y.E.

Evolutionary history and population dynamics of hepatitis E virus. PloS One 2010, 5, e14376.

84.

Takahashi, M.; Nishizawa, T.; Gotanda, Y.; Tsuda, F.; Komatsu, F.; Kawabata, T.; Hasegawa, K.; Altankhuu, M.;

Chimedregzen, U.; Narantuya, L.; Hoshino, H.; Hino, K.; Kagawa, Y.; Okamoto, H. High prevalence of

antibodies to hepatitis A and E viruses and viremia of hepatitis B, C, and D viruses among apparently healthy

populations in Mongolia. Clin. Diagn. Lab. Immun. 2004, 11, 392-398.

85. Li, R.C.; Ge, S.X.; Li, Y.P.; Zheng, Y.J.; Nong, Y.; Guo, Q.S.; Zhang, J.; Ng, M.H.; Xia, N.S. Seroprevalence of

hepatitis E virus infection, rural southern People's Republic of China. Emerg. Infect. Dis. 2006, 12, 1682-1688.

86. Wong, K.H.; Liu, Y.M.; Ng, P.S.; Young, B.W.; Lee, S.S.

Epidemiology of hepatitis A and hepatitis E infection and their determinants in adult Chinese community in

Hong Kong. J. Med. Virol. 2004, 72, 538-

544. 87. Arankalle, V.A.; Chadha, M.S.; Chitambar, S.D.; Walimbe, A.M.; Chobe, L.P.; Gandhe, S.S.

Changing epidemiology of hepatitis A and hepatitis E in urban and rural India (1982- 98). J. Viral Hepat.

2001, 8, 293-303.

88. Aggarwal, R.; Naik, S. Epidemiology of hepatitis E: current status. J. Gastroenterol. Hepatol. 2009, 24, 1484-

1493. 89. Fu, H.; Li, L.; Zhu, Y.; Wang, L.; Geng, J.; Chang, Y.; Xue, C.; Du, G.; Li, Y.; Zhuang, H. Hepatitis E virus

infection among animals and humans in Xinjiang, China: possibility of swine to human transmission of

sporadic hepatitis E in an endemic area. Am. J. Trop. Med. Hyg. 2010, 82, 961-966. 90. Toole, M.;

Claridge, F.; Anderson, D.; Zhuang, H.; Morgan, C.; Otto, B.; Stewart, T.

Hepatitis E virus infection as a marker for contaminated community drinking water sources in Tibetan villages.

Am. J. Trop. Med. Hyg. 2006, 74, 250–254. 91. Sedyaningsih-Mamahit, E.; Larasati, R.; Laras, K.; Sidemen, A.;

Sukri, N.; Sabaruddin, N.; Didi, S.; Saragih, J.; Myint, K.; Endy, T.; Sulaiman, A.; Campbell, J.; Corwin, A. First

documented outbreak of hepatitis E virus transmission in Java, Indonesia. T. Roy. Soc. Trop. Med. H. 2002, 96,

398–404. 92. Corwin, A.; Tien, N.; Bounlu, K.; Winarno, J.; Putri, M.; Laras, K.; Larasati, R.; Sukri, N.; Endy, T.;

Sulaiman, H.; Hyams, K. The unique riverine ecology of hepatitis E virus transmission in South-East Asia. T. Roy.

Soc. Trop. Med. H. 1999, 93, 255–260.

Ceylan, A.; Ertem, M.; Ilcin, E.; Ozekinci, T. A special risk group for hepatitis E infection: Turkish agricultural

workers who use untreated waste water for irrigation. Epidemiol. Infect. 2003,



131, 753–756. 94. Bile, K.; Isse, A.; Mohamud, O.; Allebeck, P.; Nilsson, L.; Norder, H.; Mushahwar, I.; Magnius, L.

Contrasting roles of rivers and wells as sources of drinking water on attack and fatality rates in a hepatitis E

epidemic in Somalia. Am. J. Trop. Med. Hyg. 1994, 51, 466– 474. 95.

Clemente-Casares, P.; Pina, S.; Buti, M.; Jardi, R.; MartIn, M.; Bo�ll-Mas, S.l.; Girones,

R. Hepatitis E virus epidemiology in industrialized countries. Emerg. Infect. Dis. 2003, 9, 448– 454. 96.

Ippagunta, S.K.; Naik, S.; Sharma, B.; Aggarwal, R. Presence of hepatitis E virus in sewage in Northern India:

frequency and seasonal pattern. . Med. Virol. 2007, 79, 1827–1831. 97. Jothikumar, N.; Aparna, K.;

Kamatchiammal, S.; Paulmurugan, R.; Saravanadevi, S.; Khanna, P. Detection of hepatitis E virus in raw and

treated wastewater with the polymerase chain reaction. Appl. Environ. Microbiol. 1993, 59, 2558–2562. 98.

Pina, S.; Buti, M.; Cotrina, M.; Piella, J.; Girones, R. HEV identi�ed in serum from humans with acute

hepatitis and in sewage of animal origin in Spain. J. Hepatol. 2000, 33, 826–

833. 99. Vaidya, S.; Tilekar, B.; Walimbe, A.; Arankalle, V. Increased risk of hepatitis E in sewage workers from

India. J. Occup. Environ. Med. 2003, 45, 1167–1170. 100. Rutjes, S.; Lodder, W.; Lodder-Verschoor, F.; van den

Berg, H.; Vennema, H.; Duizer, E.; Koopmans, M.; de Roda Husman, A. Sources of hepatitis E virus genotype 3 in

The Netherlands. Emerg. Infect. Dis. 2009, 15, 381–387. 101.

Borgen, K.; Herremans, T.; Duizer, E.; Vennema, H.; Rutjes, S.; Bosman, A.; de Roda Husman, A.M.; Koopmans,

M. Non-travel related Hepatitis E virus genotype 3 infections in the Netherlands; a case series 2004 - 2006. BMC

Infect. Dis. 2008, 8, 61.

102. El-Esnawy, N.A. Examination for hepatitis E virus in wastewater treatment plants and workers by nested

RT-PCR and ELISA. J. Egypt. Public Health Assoc. 2000, 75, 219–231. 103.

Bouwknegt, M.; Engel, B.; Herremans, M.; Widdowson, M.; Worm, H.; Koopmans, M.; Frankena,

K.; de Roda Husman, A.; De Jong, M.; Van Der Poel, W. Bayesian estimation of hepatitis E virus

seroprevalence for populations with different exposure levels to swine in The Netherlands. Epidemiol. Infect.

2008, 136, 567-576. 104. Galiana, C.; Fernandez-Barredo, S.; Garcia, A.; Gomez, M.T.; Perez-Gracia, M.T.

Occupational exposure to hepatitis E virus (HEV) in swine workers. Am. J. Trop. Med. Hyg. 2008, 78, 1012-

1015. 105. Bendall, R.; Ellis, V.; Ijaz, S.; Ali, R.; Dalton, H. A comparison of two commercially available anti-HEV

IgG kits and a re-evaluation of anti-HEV IgG seroprevalence data in developed countries. J Med Virol 2010, 82,

799-805. 106. Baylis, S.A.; Blumel, J.; Mizusawa, S.; Matsubayashi, K.; Sakata, H.; Okada, Y.; Nubling, C.M.;

Hanschmann, K.M.; Group, H.E.V.C.S. World Health Organization International Standard to harmonize assays

for detection of hepatitis E virus RNA. Emerg. Infect. Dis. 2013, 19, 729-735. 107. Vulcano, A.; Angelucci, M.;

Candelori, E.; Martini, V.; Patti, A.M.; Mancini, C.; Santi, A.L.; Calvani, A.; Casagni, L.; Lamberti, A. HEV prevalence

in the general population and among workers at zoonotic risk in Latium Region. Ann. Ig. 2007, 19, 181-186.

108. Olsen, B.; Axelsson-Olsson, D.; Thelin, A.; Weiland, O. Unexpected high prevalence of IgG-antibodies to



hepatitis E virus in Swedish pig farmers and controls. Scand. J. Infect. Dis. 2006, 38, 55-58. 109.

Kasorndorkbua, C.; Opriessnig, T.; Huang, F.F.; Guenette, D.K.; Thomas, P.J.; Meng, X.J.; Halbur, P.G. Infectious

swine hepatitis E virus is present in pig manure storage facilities on United States farms, but evidence of water

contamination is lacking. Appl. Environ. Microbiol. 2005, 71, 7831–7837. 110.

Rodriguez-Lazaro, D.; Cook, N.; Ruggeri, F.M.; Sellwood, J.; Nasser, A.; Nascimento, M.S.; D'Agostino, M.;

Santos, R.; Saiz, J.C.; Rzezutka, A.; Bosch, A.; Girones, R.; Carducci, A.; Muscillo, M.; Kovac, K.; Diez-Valcarce, M.;

Vantarakis, A.; von Bonsdorff, C.H.; de Roda Husman, A.M.; Hernandez, M.; van der Poel, W.H. Virus hazards from

food, water and other contaminated environments. FEMS Microbiol. Rev.

2012, 36, 786–814. 111. Jimenez-Clavero, M.A.; Escribano-Romero, E.; Mansilla, C.; Gomez, N.; Cordoba, L.;

Roblas, N.; Ponz, F.; Ley, V.; Saiz, J.C. Survey of bovine enterovirus in biological and environmental samples by a

highly sensitive real-time reverse transcription-PCR. Appl. Environ. Microbiol. 2005, 71, 3536–3543. 112.

Brassard, J.; Gagné, M.J.; Généreux, M.; Côté , C. Detection of human food-borne and zoonotic viruses on

irrigated, �eld-grown strawberries. Appl. Environ. Microbiol. 2012, 78, 3763–3766. 113. Ward, P.; Muller, P.;

Letellier, A.; Quessy, S.; Simard, C.; Trottier, Y.L.; Houde, A.; Brassard, J.

Molecular characterization of hepatitis E virus detected in swine farms in

the province of Quebec. Can. J. Vet. Res. 2008, 72, 27–31. 114.

Steyer, A.; Naglič , T.; Močilnik, T.; Poljšak-Prijatelj, M.; Poljak, M. Hepatitis E virus in domestic pigs and surface

waters in Slovenia: prevalence and molecular characterization of a novel genotype 3 lineage. Infect. Genet. Evol.

2011, 11, 1732–1737.

115.

Tyrrel, S.F.; Quinton, J.N. Overland �ow transport of pathogens from agricultural land receiving faecal wastes.

J. Appl. Microbiol. 2003, 94 Suppl, 87S-93S.

116. Ziemer, C.;

Bonner, J.; Cole, D.; Vinjé, J.; Constantini, V.; Goyal, S.; Gramer, M.; Mackie,

R.; Meng, X.J.; Myers, G.; Saif, L. Fate and transport of zoonotic, bacterial, viral, and parasitic pathogens during

swine manure treatment, storage, and land application. J. Anim. Sci. 2010, 88, 94. 117. Lewis, H.C.;

Wichmann, O.; Duizer, E. Transmission routes and risk factors for autochthonous hepatitis E virus infection in

Europe: a systematic review.

Epidemiol. Infect. 2010, 138, 145–166. 118.

Namsai, A.; Louisirirotchanakul, S.; Wongchinda, N.; Siripanyaphinyo, U.; Virulhakul, P.; Puthavathana, P.; Myint,

K.; Gannarong, M.; Ittapong, R. Surveillance of hepatitis A and E viruses contamination in shell�sh in Thailand.



Lett. Appl. Microbiol. 2011,

53, 608–613. 119.

Emerson, S.; Arankalle, V.; Purcell, R. Thermal stability of hepatitis E virus. J. Infect. Dis.

2005, 192, 930–933. 120.

Said, B.; Ijaz, S.; Kafatos, G.; Booth, L.; Thomas, H.; Walsh, A.;

Ramsay, M.; Morgan, D.; Hepatitis, E.I.I.T.

Hepatitis E outbreak on cruise ship. Emerg. Infect. Dis.

2009, 15, 1738– 1744. 121.

Diez-Valcarce, M.; Kokkinos, P.; Söderberg, K.; Bouwknegt, M.; Willems, K.; de Roda-

Husman, A.; von Bonsdorff, C.-H.; Bellou, M.; Hernández, M.; Maunula, L.; Vantarakis, A.; Rodríguez-Lázaro, D.

Occurrence of human enteric viruses in commercial mussels at retail level in three European countries. Food

Environ. Virol. 2012, 4, 73–80. 122. Crossan, C.; Baker, P.; Craft, J.; Takeuchi, Y.; Dalton, H.; Scobie, L. Hepatitis E

virus genotype 3 in shell�sh, United Kingdom. Emerg. Infect. Dis. 2012, 18, 2085–2087. 123.

Cacopardo, B.; Russo, R.; Preiser, W.; Benanti, F.; Brancati, G.; Nunnari, A. Acute hepatitis E in Catania (eastern

Sicily) 1980– 1994. The role of hepatitis E virus. Infection

1997, 25, 313–316. 124.

Renou, C.; Moreau, X.; Pariente, A.; Cadranel, J.F.; Maringe, E.; Morin, T.; Causse, X.;

Payen, J.L.; Izopet, J.; Nicand, E.; Bourliere, M.; Penaranda, G.; Hardwigsen, J.; Gerolami, R.; Peron, J.M.; Pavio,

N.; Angh, F. A national survey of acute hepatitis E in France. Aliment. Pharmacol. Ther. 2008, 27, 1086–1093.

125. Song, Y.J.; Jeong, H.J.; Kim, Y.J.; Lee, S.W.; Lee, J.B.; Park, S.Y.; Song, C.S.; Park, H.M.; Choi, I.S.

Analysis of complete genome sequences of swine hepatitis E virus

and possible risk factors for transmission of HEV to humans in Korea. J. Med. Virol. 2010, 82, 583-591. 126. Li,

T.C.; Miyamura, T.; Takeda, N. Detection of

hepatitis E virus RNA from the bivalve Yamato-Shijimi (Corbicula japonica) in Japan. Am. J.

Trop. Med. Hyg. 2007, 76, 170-172 127.

Kamar, N.; Bendall, R.; Legrand-Abravanel, F.; Xia, N.S.; Ijaz, S.; Izopet, J.; Dalton, H.R. Hepatitis E.

Lancet 2012, 379, 2477-2488.



128. Billam, P.; Pierson, F.; Li, W.; LeRoith, T.; Duncan, R.; Meng, X.J. Development and validation of a negative-

strand-speci�c reverse transcription-PCR assay for detection of a chicken strain of hepatitis E virus:

identi�cation of nonliver replication sites. J. Clin. Microbiol. 2008, 46, 2630–2634. 129. Bouwknegt, M.; Rutjes,

S.A.; Reusken, C.B.; Stockhofe-Zurwieden, N.; Frankena, K.; de Jong, M.C.; de Roda Husman, A.M.; Poel, W.H.

The course of hepatitis E virus infection in pigs after contact-infection and intravenous inoculation. BMC Vet.

Res. 2009, 5, 7. 130. Williams, T.; Kasorndorkbua, C.; Halbur, P.; Haqshenas, G.; Guenette, D.; Toth, T.; Meng, X.

Evidence of extrahepatic sites of replication of the hepatitis E virus in a swine model. J. Clin. Microbiol. 2001,

39, 3040-3046. 131.

Miyashita, K.; Kang, J.-H.; Saga, A.; Takahashi, K.; Shimamura, T.; Yasumoto, A.;

Fukushima, H.; Sogabe, S.; Konishi, K.; Uchida, T.; Fujinaga, A.; Matsui, T.; Sakurai, Y.; Tsuji, K.; Maguchi, H.;

Taniguchi, M.; Abe, N.; Fazle Akbar, S.; Arai, M.; Mishiro, S. Three cases of acute or fulminant hepatitis E caused

by ingestion of pork meat and entrails in Hokkaido, Japan: Zoonotic food-borne transmission of hepatitis E

virus and public health concerns. Hepatol. Res. 2012, 42, 870–878. 132.

Li, T.-C.; Chijiwa, K.; Sera, N.; Ishibashi, T.; Etoh, Y.; Shinohara, Y.; Kurata, Y.; Ishida, M.; Sakamoto, S.;

Takeda, N.; Miyamura, T.

Hepatitis E virus transmission from wild boar meat. Emerg. Infect. Dis.

2005, 11, 1958-1960. 133.

Matsuda, H.; Okada, K.; Takahashi, K.; Mishiro, S. Severe hepatitis E virus infection after ingestion of uncooked

liver from a wild boar. J. Infect. Dis. 2003, 188, 944.

134.

Tamada, Y.; Yano, K.; Yatsuhashi, H.; Inoue, O.; Mawatari, F.; Ishibashi, H. Consumption of wild boar linked to

cases of hepatitis E. J. Hepatol. 2004, 40, 869-

870 135. Hijioka, S.; Sato, Y.; Iwashita, Y.; Indou, Y. [A case of acute hepatitis E who had a history of frequent

ingestion of raw meat and viscera from wild deer and boars]. Nihon Shokakibyo Gakkai zasshi 2005, 102, 723-

728. 136. Martelli, F.; Caprioli, A.; Zengarini, M.; Marata, A.; Fiegna, C.; Di Bartolo, I.; Ruggeri, F.; Delogu, M.;

Ostanello, F. Detection of hepatitis E virus (HEV) in a demographic managed wild boar (Sus scrofa scrofa)

population in Italy. Vet. Microbiol. 2008, 126, 74–81. 137. Kaba, M.; Davoust, B.; Marié J.-L.; Colson, P. Detection

of hepatitis E virus in wild boar (Sus scrofa) livers. Vet. J. 2010, 186, 259–261. 138. Wichmann, O.; Schimanski,

S.; Koch, J.; Kohler, M.; Rothe, C.; Plentz, A.; Jilg, W.; Stark, K. Phylogenetic and case-control study on hepatitis E

virus infection in Germany. J. Infect. Dis. 2008, 198, 1732–1741. 139. Sonoda, H.; Abe, M.; Sugimoto, T.; Sato,

Y.; Bando, M.; Fukui, E.; Mizuo, H.; Takahashi, M.; Nishizawa, T.; Okamoto, H. Prevalence of hepatitis E virus



(HEV) Infection in wild boars and deer and genetic identi�cation of a genotype 3 HEV from a boar in Japan. J.

Clin. Microbiol. 2004, 42, 5371–5374. 140. Christou, L.; Kosmidou, M.

HepatitisÂ E virus in the Western world-a pork-related zoonosis.

Clin. Microbiol. Infect. 2013, 19, 600–604. 141. Berto, A.; Grierson, S.; Hakze-van der Honing, R.; Martelli, F.;

Johne, R.; Reetz, J.; Ulrich, R.; Pavio, N.; Van der Poel, W.; Banks, M. Hepatitis E virus in pork liver sausage,

France. Emerg. Infect. Dis. 2013, 19, 264–266. 142. Wenzel, J.J.; Preiss, J.; Schemmerer, M.; Huber, B.; Plentz,

A.; Jilg, W. Detection of hepatitis E virus (HEV) from porcine livers in Southeastern Germany and high sequence

homology to human HEV isolates. J. Clin. Virol. 2011, 52, 50–54. 143. Bouwknegt, M.; Lodder-Verschoor, F.; van

der Poel, W.; Rutjes, S.; de Roda Husman, A. Hepatitis E virus RNA in commercial porcine livers in The

Netherlands. J. Food. Protect. 2007, 70, 2889–2895. 144. Feagins, A.R.; Opriessnig, T.; Guenette, D.K.; Halbur,

P.G.; Meng, X.J. Detection and characterization of infectious Hepatitis E virus from commercial pig livers sold

in local grocery stores in the USA. J. Gen. Virol. 2007, 88, 912–917. 145. Wacheck, S.; Werres, C.; Mohn, U.;

Dorn, S.; Soutschek, E.; Fredriksson-Ahomaa, M.; Märtlbauer, E. Detection of IgM and IgG against hepatitis E

virus in serum and meat juice samples from pigs at slaughter in Bavaria, Germany. Foodborne Pathog. Dis.

2012, 9, 655– 660. 146.

Di Bartolo, I.; Ponterio, E.; Castellini, L.; Ostanello, F.; Ruggeri, F .M. Viral and antibody HEV prevalence

in swine at slaughterhouse in Italy. Vet. Microbiol.

2011, 149, 330–338. 147.

Di Bartolo, I.; Diez-Valcarce, M.; Vasickova, P.; Kralik, P.; Hernandez, M.; Angeloni, G.;

Ostanello, F.; Bouwknegt, M.; Rodríguez-Lázaro, D.; Pavlik, I.; Ruggeri, F. Hepatitis E virus in pork production

chain in Czech Republic, Italy, and Spain, 2010. Emerg. Infect. Dis. 2010, 18, 1282–1289. 148. Kulkarni, M.A.;

Arankalle, V.A. The detection and characterization of hepatitis E virus in pig livers from retail markets of India.

J. Med. Virol. 2008, 80, 1387–1390. 149. Shukla, P.; Chauhan, U.K.; Naik, S.; Anderson, D.; Aggarwal, R. Hepatitis

E virus infection among animals in northern India: an unlikely source of human disease. J. Viral Hepat. 2007,

14, 310-317 150. Tomiyama, D.; Inoue, E.; Osawa, Y.; Okazaki, K. Serological evidence of infection with

hepatitis E virus among wild Yezo -deer, Cervus nippon yesoensis, in Hokkaido, Japan.

J. Viral Hepat. 2009, 16, 524–528. 151. Tei, S.; Kitajima, N.; Ohara, S.; Inoue, Y.; Miki, M.; Yamatani, T.; Yamabe,

H.; Mishiro, S.; Kinoshita, Y. Consumption of uncooked deer meat as a risk factor for hepatitis E virus infection:

an age- and sex-matched case-control study. J. Med. Virol. 2004, 74, 67–70. 152. Legrand-Abravanel, F.; Kamar,

N.; Sandres-Saune, K.; Garrouste, C.; Dubois, M.; Mansuy, J.-M.; Muscari, F.; Sallusto, F.; Rostaing, L.; Izopet, J.

Characteristics of autochthonous hepatitis E virus infection in solid-organ transplant recipients in France. J.

Infect. Dis. 2010, 202, 835–844. 153. Geng, Y.; Zhao, C.; Song, A.; Wang, J.; Zhang, X.; Harrison, T.; Zhou, Y.;

Wang, W.; Wang, Y. The serological prevalence and genetic diversity of hepatitis E virus in farmed rabbits in



China. Infect. Genet. Evol. 2011, 11, 476–482. 154. Sanford, B.; Emerson, S.; Purcell, R.; Engle, R.; Dryman, B.;

Cecere, T.; Buechner-Maxwell, V.; Sponenberg, D.; Meng, X.J. Serological Evidence for a Hepatitis E Virus-

Related Agent in Goats in the United States. Transbound. Emerg. Dis. 2012. 155. Haqshenas, G.; Huang, F.F.;

Fenaux, M.; Guenette, D.K.; Pierson, F.W.; Larsen, C.T.; Shivaprasad, H.L.; Toth, T.E.; Meng, X.J. The putative

capsid protein of the newly identi�ed avian hepatitis E virus shares antigenic epitopes with that of swine and

human hepatitis E viruses and chicken big liver and spleen disease virus. J. Gen. Virol. 2002, 83, 2201–2209.

156. Bilic, I.; Jaskulska, B.; Basic, A.; Morrow, C.; Hess, M. Sequence analysis and comparison of avian hepatitis

E viruses from Australia and Europe indicate the existence of different genotypes. J. Gen. Virol. 2009, 90, 863–

873. 157. Huang, F.F.; Sun, Z.F.; Emerson, S.U.; Purcell, R.H.; Shivaprasad, H.L.; Pierson, F.W.; Toth, T.E.; Meng,

X.J. Determination and analysis of the complete genomic sequence of avian hepatitis E virus (avian HEV) and

attempts to infect rhesus monkeys with avian HEV. J. Gen. Virol. 2004, 85, 1609–1618. 158. Sato, Y.; Sato, H.;

Naka, K.; Furuya, S.; Tsukiji, H.; Kitagawa, K.; Sonoda, Y.; Usui, T.; Sakamoto, H.; Yoshino, S.; Shimizu, Y.;

Takahashi, M.; Nagashima, S.; Jirintai; Nishizawa, T.; Okamoto, H. A nationwide survey of hepatitis E virus

(HEV) infection in wild boars in Japan: identi�cation of boar HEV strains of genotypes 3 and 4 and

unrecognized genotypes. Arch. Virol. 2011, 156, 1345–1358. 159. Takahashi, M.; Nishizawa, T.; Tanaka, T.;

Tsatsralt-Od, B.; Inoue, J.; Okamoto, H. Correlation between positivity for immunoglobulin A antibodies and

viraemia of swine hepatitis E virus observed among farm pigs in Japan. J. Gen. Virol. 2005, 86, 1807–1813.

160. Rutjes, S.A.; Lodder, W.J.; Bouwknegt, M.; de Roda Husman, A.M. Increased hepatitis E virus prevalence on

Dutch pig farms from 33 to 55% by using appropriate internal quality controls for RT-PCR. J. Virol. Methods

2007, 143, 112–116. 161. Seminati, C.; Mateu, E.; Peralta, B.; de Deus, N.; Martin, M. Distribution of hepatitis E

virus infection and its prevalence in pigs on commercial farms in Spain. Vet. J. 2008, 175, 130– 132. 162.

Garkavenko, O.; Obriadina, A.; Meng, J.; Anderson, D.A.; Benard, H.J.; Schroeder, B.A.; Khudyakov, Y.E.; Fields,

H.A.; Croxson, M.C.

Detection and characterisation of swine hepatitis E virus in New Zealand. J. Med. Virol. 2001, 65, 525–

529. 163. Blacksell, S.D.; Myint, K.S.; Khounsy, S.; Phruaravanh, M.; Mammen, M.P., Jr.; Day, N.P.; Newton, P.N.

Prevalence of hepatitis E virus antibodies in pigs: implications for human infections in village-based

subsistence pig farming in the Lao PDR. Trans. Roy. Soc. Trop. Med. Hyg. 2007, 101, 305–307. 164.

dos Santos, D.R.; Vitral, C.L.; de Paula, V.S.; Marchevsky, R.S.; Lopes, J.F.; Gaspar, A.M.; Saddi, T.M.; Junior,

N.C.; Guimaraes Fde, R.; Junior, J.G.; Ximenes, L.L.; Souto, F.J.; Pinto, M.A. Serological and molecular evidence of

hepatitis E virus in swine in Brazil. Vet. J.

2009, 182, 474–480. 165. Reuter, G.b.; Fodor, D.; Forgách , P.; Kátai, A.; Szucs, G. Characterization and zoonotic

potential of endemic hepatitis E virus (HEV) strains in humans and animals in Hungary. J. Clin. Virol. 2009, 44,

277–281. 166. Schielke, A.; Sachs, K.; Lierz, M.; Appel, B.; Jansen, A.; Johne, R. Detection of hepatitis E virus in

wild boars of rural and urban regions in Germany and whole genome characterization of an endemic strain.

Virol. J. 2009, 6, 58. 167. Forgach, P.; Nowotny, N.; Erdelyi, K.; Boncz, A.; Zentai, J.; Szucs, G.; Reuter, G.; Bakonyi,



T. Detection of hepatitis E virus in samples of animal origin collected in Hungary. Vet. Microbiol. 2010, 143,

106-116. 168.

Matsuura, Y.; Suzuki, M.; Yoshimatsu, K.; Arikawa, J.; Takashima, I.; Yokoyama, M.; Igota,

H.; Yamauchi, K.; Ishida, S.; Fukui, D.; Bando, G.; Kosuge, M.; Tsunemitsu, H.; Koshimoto, C.; Sakae, K.; Chikahira,

M.; Ogawa, S.; Miyamura, T.; Takeda, N.; Li, T.C. Prevalence of antibody to hepatitis E virus among wild sika

deer, Cervus nippon, in Japan. Arch. Virol. 2007, 152, 1375-1381. 169. Rutjes, S.A.; Lodder-Verschoor, F.; Lodder,

W.J.; van der Giessen, J.; Reesink, H.; Bouwknegt, M.; de Roda Husman, A.M. Seroprevalence and molecular

detection of hepatitis E virus in wild boar and red deer in The Netherlands. J. Virol. Methods 2010, 168, 197-

206. 170.

Medrano, C.; Boadella, M.; Barrios, H.; Cantu, A.; Garcia, Z.; de la Fuente, J.; Gortazar, C. Zoonotic

pathogens among white-tailed deer, northern Mexico, 2004-2009. Emerg. Infect. Dis.

2012, 18, 1372-1374. 171. El-Tras, W.; Tayel, A.; El-Kady, N. Seroprevalence of hepatitis E virus in humans and

geographically matched food animals in Egypt. Zoonoses Public Hlth. 2012, 60, 244-251. 172. Arankalle, V.;

Joshi, M.; Kulkarni, A.; Gandhe, S.; Chobe, L.; Rautmare, S.; Mishra, A.; Padbidri, V. Prevalence of anti-hepatitis E

virus antibodies in different Indian animal species. J. Viral Hepat. 2001, 8, 223-227. 173. Vitral, C.L.; Pinto, M.A.;

Lewis-Ximenez, L.L.; Khudyakov, Y.E.; dos Santos, D.R.; Gaspar, A.M. Serological evidence of hepatitis E virus

infection in different animal species from the Southeast of Brazil. Mem. Inst. Oswaldo Cruz 2005, 100, 117-

122. 174. Geng, Y.; Wang, C.; Zhao, C.; Yu, X.; Harrison, T.J.; Tian, K.; Wang, Y. Serological prevalence of hepatitis

E virus in domestic animals and diversity of genotype 4 hepatitis E virus in China. Vector-borne Zoonot. 2010,

10, 765-770. 175. Yu, Y.; Sun, J.; Liu, M.; Xia, L.; Zhao, C.; Harrison, T.J.; Wang, Y. Seroepidemiology and genetic

characterization of hepatitis E virus in the northeast of China. Infect. Genet. Evol. 2009, 9, 554-561. 176.

Zhang, W.; Shen, Q.; Mou, J.; Gong, G.; Yang, Z.; Cui, L.; Zhu, J.; Ju, G.; Hua, X. Hepatitis E virus infection

among domestic animals in eastern China. Zoonoses Public Hlth.

2008, 55, 291-298. 177. Meng, X.

Swine hepatitis E virus: cross-species infection and risk in xenotransplantation. Curr. Top. Microbiol.

2003, 278, 185-216. 178. Kabrane-Lazizi, Y.; Fine, J.B.; Elm, J.; Glass, G.E.; Higa, H.; Diwan, A.; Gibbs, C.J., Jr.;

Meng, X.J.; Emerson, S.U.; Purcell, R.H. Evidence for widespread infection of wild rats with hepatitis E virus in

the United States. Am. J. Trop. Med. Hyg. 1999, 61, 331-335. 179. Hirano, M.; Ding, X.; Li, T.C.; Takeda, N.;

Kawabata, H.; Koizumi, N.; Kadosaka, T.; Goto, I.; Masuzawa, T.; Nakamura, M.; Taira, K.; Kuroki, T.; Tanikawa, T.;

Watanabe, H.; Abe, K. Evidence for widespread infection of hepatitis E virus among wild rats in Japan. Hepatol.

Res. 2003, 27, 1-5. 180. Li, W.; Guan, D.; Su, J.; Takeda, N.; Wakita, T.; Li, T.C.; Ke, C.W. High prevalence of rat

hepatitis E virus in wild rats in China. Vet. Microbiol. 2013, 165, 275–280. 181. Mulyanto; Depamede, S.N.;

Sriasih, M.; Takahashi, M.; Nagashima, S.; Jirintai, S.; Nishizawa, T.; Okamoto, H. Frequent detection and



characterization of hepatitis E virus variants in wild rats (Rattus rattus) in Indonesia. Arch. Virol. 2013, 158, 87–

96. 182. Lack, J.; Volk, K.; Van Den Bussche, R.

Hepatitis E virus genotype 3 in wild rats, United States.

Emerg. Infect. Dis. 2012, 18, 1268–1273. 183. Favorov, M.O.; Kosoy, M.Y.; Tsarev, S.A.; Childs, J.E.; Margolis,

H.S. Prevalence of antibody to hepatitis E virus among rodents in the United States. J. Infect. Dis. 2000, 181,

449–455. 184. Li, T.C.; Ami, Y.; Suzaki, Y.; Takeda, N.; Takaji, W. No evidence for hepatitis e virus genotype 3

susceptibility in rats. Emerg. Infect. Dis. 2013, 19(8), 1343-5. 185. Izopet, J.; Dubois, M.; Bertagnoli, S.; Lhomme,

S.; Marchandeau, S.; Boucher, S.; Kamar, N.; Abravanel, F.; Guerin, J.L.


Emerg. Infect. Dis. 2012, 18, 1274–1281. 186. Cossaboom, C.M.; Cordoba, L.; Sanford, B.J.; Pineyro, P.; Kenney,

S.P.; Dryman, B.A.; Wang, Y.; Meng, X.J. Cross-species infection of pigs with a novel rabbit, but not rat, strain of

hepatitis E virus isolated in the United States. J. Gen. Virol. 2012, 93, 1687–1695. 187. Li, T.C.; Saito, M.; Ogura,

G.; Ishibashi, O.; Miyamura, T.; Takeda, N. Serologic evidence for hepatitis E virus infection in mongoose. Am. J.

Trop. Med. Hyg. 2006, 74, 932–936. 188.

Nakamura, M.; Takahashi, K.; Taira, K.; Taira, M.; Ohno, A.; Sakugawa, H.;

Arai, M.; Mishiro, S. Hepatitis E virus infection in wild mongooses of Okinawa, Japan: Demonstration of anti-

HEV antibodies and a full-genome nucleotide sequence. Hepatol. Res. 2006, 34, 137–140. 189. Meng, X.J.;

Wiseman, B.; Elvinger, F.; Guenette, D.; Toth, T.; Engle, R.; Emerson, S.; Purcell, R.

Prevalence of antibodies to hepatitis E virus in veterinarians working with swine and in normal blood donors in the

United States and other countries. J. Clin. Microbiol.

2002, 40, 117–122. 190. Meng, X.J.; Dea, S.; Engle, R.E.; Friendship, R.; Lyoo, Y.S.; Sirinarumitr, T.; Urairong, K.;

Wang, D.; Wong, D.; Yoo, D.; Zhang, Y.; Purcell, R.H.; Emerson, S.U. Prevalence of antibodies to the hepatitis E

virus in pigs from countries where hepatitis E is common or is rare in the human population. J. Med. Virol.

1999, 59, 297–302. 191. Withers, M.; Correa, M.; Morrow, M.; Stebbins, M.; Seriwatana, J.; Webster, W.; Boak, M.;

Vaughn, D. Antibody levels to hepatitis E virus in North Carolina swine workers, non-swine workers, swine, and

murids. Am. J. Trop. Med. Hyg. 2002, 66, 384–388. 192.

Drobeniuc, J.; Favorov, M.; Shapiro, C.; Bell, B.; Mast, E.; Dadu, A.; Culver, D.; Iarovoi, P.;

Robertson, B.; Margolis, H. Hepatitis E virus antibody prevalence among persons who work with swine. J.

Infect. Dis.

2001, 184, 1594–1597. 193. Karetnyi, Y.V.; Gilchrist, M.J.; Naides, S.J. Hepatitis E virus infection prevalence

among selected populations in Iowa. J. Clin. Virol. 1999, 14, 51–55. Chapter II: Naturally Occurring Animal

Models of Human Hepatitis E Virus Infection Danielle M. Yugo, Caitlin M. Cossaboom, and Xiang-Jin Meng



Department of Biomedical Sciences and Pathobiology, College of Veterinary Medicine, Virginia Polytechnic

Institute and State University, 1981 Kraft Drive, Blacksburg, VA 24061-0913,

U.S.A. ILAR Journal. 2014; April; 5(1): 187-199.

This is a pre- copyedited, author-produced PDF of an article accepted for publication in ILAR Journal

following peer review. The version

of record

[Yugo, DM, Cossaboom, CM, and Meng, XJ. Naturally occurring animal models of human hepatitis E virus

infection, ILAR,

2014 April; 5(1): 187-199.] is available online at: https://doi.org/10.1093/ilar/ilu007. Abstract

Hepatitis E virus (HEV) is a single-stranded, positive-sense RNA virus

in the family Hepeviridae. Hepatitis E caused by HEV is a clinically important global disease. There are

currently four well-characterized genotypes of HEV in mammalian species, although numerous novel strains of

HEV likely belonging to either new genotypes or species have recently been identi�ed from several other

animal species. HEV genotypes 1 and 2 are limited to infection in humans, while genotypes 3 and 4 infect an

expanding host range of animal species, and are zoonotic to humans. Historical animal models include various

species of non-human primates which have been indispensable for the discovery of human HEV and for

understanding its pathogenesis and course of infection. With the genetic identi�cation and characterization of

animal strains of HEV, a number of naturally-occurring animal models such as swine, chicken and rabbit have

recently been developed for various aspects of HEV research including vaccine trials, pathogenicity, cross-

species infection, mechanism of virus replication, and molecular biology studies. Unfortunately, the current

available animal models for HEV are still inadequate for certain aspects of HEV research. For instances, an

animal model is still lacking to study the underlying mechanism of severe and fulminant hepatitis E during

pregnancy. Also, an animal model that can mimic chronic HEV infection is critically needed to study the

mechanism leading to chronicity in immunocompromised individuals. Genetic identi�cation of additional novel

animal strains of HEV may lead to the development of better naturally-occurring animal models for HEV. This

article reviews the current understanding of animal models of HEV infection in both the natural and

experimental infection setting and identi�es key research needs and limitations. Keywords: Hepatitis E virus

(HEV); Animal models; Cross-species infection; Rabbit; Swine; Chicken Introduction Hepatitis E virus (HEV)

HEV is classi�ed in

the genus Hepevirus of the family Hepeviridae (Meng et al. 2012) The mammalian HEV

is comprised of four recognized genotypes and at least two putative genotypes that are distinct in geographic

locale as well as host. Genotype 1 HEV causes the majority of outbreaks of hepatitis E in humans in Asia.

Genotype 2 HEV includes one Mexican strain and multiple African strains and causes large outbreaks in



humans. In addition to humans, genotype 3 HEV has been isolated from a wide variety of animal species

including wild and domestic swine (de Deus et al. 2008; Meng et al. 1997; Takahashi et al. 2004), deer

(Takahashi et al. 2004), mongoose (Nakamura et al. 2006), rats (Lack et al. 2012), and rabbits (Cossaboom et

al. 2011; Zhao et al. 2009) and is associated with zoonotic transmission causing sporadic, cluster, and chronic

cases of hepatitis E in humans (Meng 2010). Genotype 4 HEV infects humans as well as wild and domestic

swine with zoonotic transmission to humans causing sporadic cases of hepatitis E (Meng 2013). (Table 1) In

addition to the zoonotic genotypes 3 and 4 HEV strains mentioned above, genetically divergent strains of HEV

have also been identi�ed from several other animal species including chicken (Haqshenas et al. 2001; Marek et

al. 2010; Payne et al. 1999), bat (Drexler et al. 2012), �sh (Batts et al. 2011), rat (Johne et al. 2011), ferret (Raj

et al. 2012), and wild boar (Takahashi et al. 2011) . Additionally, antibodies to HEV have been reportedly

detected from horses (Saad et al. 2007) and ruminant species including cattle, sheep, and goats (Sanford et al.

2012a); although the source of seropositivity in these species remains unknown (Meng 2013). The animal host

range of HEV has expanded dramatically over the past decade from the initial identi�cation of HEV in swine in

1997 (Meng et al. 1997) and chickens in 2001 (Haqshenas et al. 2001), to a multitude of animal species acting

as both reservoir and host more recently. Further research will likely expand the host range of the virus to

include additional novel strains from many more other animal species. Reclassi�cation and nomenclature

changes for HEV are eminent with the recent identi�cation of several novel strains (Table 1). Hepatitis E HEV is

transmitted via fecal-oral route through contaminated food or water and typically causes an acute icteric

disease known as hepatitis E (Meng 2010; Purcell 2001). The majority of patients experience an asymptomatic

course of disease in which the virus is quickly cleared with no major complication (Meng 2010). Symptomatic

patients experience a range of symptoms including anorexia, jaundice, darkened urine coloration,

hepatomegaly, myalgia, elevated ALT levels in the blood, and occasionally abdominal pain, nausea, vomiting,

and fever (Purcell 2001). Acute HEV infection in humans begins with a typical incubation period of 2 weeks to

2 months, a transient viremia period with viral shedding in the feces, a symptomatic phase lasting days to

weeks, and jaundice apparent 2-3 weeks into the course of infection (Purcell 2001). The severity of HEV

infection is considered dose-dependent with alcohol use or other concurrent hepatic diseases as contributing

factors (Purcell 2001). Immunocompromised individuals infected with HEV such as organ transplant recipients

are at a high risk of developing chronic hepatitis E (Kamar et al. 2013; Kamar et al. 2008). Pregnancy

associated complications with concurrent HEV infection include death of both the mother and fetus, abortion,

premature birth, and death of the baby shortly after birth with no known mechanism for the severe hepatitis E

manifestation (Navaneethan et al. 2008). The mortality rate ranges from 0.5-4% in immune competent

individuals and concurrent pregnancy attributed to increases in mortality up to 20% (Aggarwal 2011) . Hepatitis

E affects humans in both industrialized and developing countries worldwide. Industrialized countries

experience sporadic and cluster cases of hepatitis E associated with ingestion of contaminated animal meats,

shell�sh, and contact with infected animals (Meng 2013; Teo 2010). Developing countries such as Bangladesh,

Egypt, Mexico, China, India, and parts of Africa experience large waterborne outbreaks due to poor sanitation

conditions and a hyperendemic status in the population (Teo 2010). Genotypes 1 and 2 HEV strains are limited



to the human population, while genotypes 3 and 4 strains are zoonotic and infect humans and other animals.

Human to human transmission of HEV is considered rare; however, transmission through blood products by

transfusion has been reported (Pavio et al. 2010). Animal models of human hepatitis E virus Several animal

species serve as useful models for human HEV due to their susceptibility to infection by human HEV strains

(Table 2). Cynomolgus and rhesus monkeys are susceptible to genotypes 1-4 HEV and serve as the primary

model for genotypes 1 and 2 human HEV strains (Meng 2010; Purcell and Emerson 2001). Swine serve as a

reservoir for genotypes 3 and 4 human HEV and a natural animal host for HEV infection (Halbur et al. 2001).

Despite production of e�cient virus replication, both the non-human primate and swine models have

limitations in reproducing clinical aspects of hepatitis with minimal elevations in serum levels of liver enzymes

and moderate pathological liver lesions present (Halbur et al. 2001; Meng 2010). Rabbit HEV recently identi�ed

in China (Zhao et al. 2009), the United States (Cossaboom et al. 2011), and France (Izopet et al. 2012) likely

serves as a useful model of genotype 3 human HEV infection with successful transmission of the virus to

cynomolgus monkeys (Liu et al. 2013) and pigs (Cossaboom et al. 2012) thereby demonstrating the potential

for cross-species infection (Table 2). Historical Animal Models for Human Hepatitis E In 1983, an experimental

transmission study to a human volunteer as well as cynomolgus monkeys identi�ed virus-like-particles (VLP) in

stool by immune electron microscopy that became what is now HEV (Balayan et al. 1983). After ingestion of

the stool samples collected from Afghan patients with signs consistent with viral hepatitis, the human

volunteer developed clinical symptoms consistent with acute viral hepatitis with a non-A, non-B hepatitis

etiology and VLPs were identi�ed in the volunteer’s stool samples (Balayan et al. 1983). In addition,

cynomolgus macaques inoculated with fecal samples containing the VLPs responded similarly with elevations

of serum liver enzymes, histopathologic liver lesions, excretion of VLPs in feces, and antibody responses with

con�rmed reaction to the VLPs (Bradley et al. 1987). Anti-viral antibodies were con�rmed in serum samples

obtained from patients involved in outbreaks of non- A, non-B, acute hepatitis in various other countries,

con�rming an association between the identi�ed virus and human infections (Khuroo 2011; Purcell and

Emerson 2001). Non-human primates such as rhesus macaque and chimpanzee have served as important

animal models for HEV. Following the initial infection of cynomolgus monkeys with fecal samples containing

VLPs, various species of non-human primates were utilized in an attempt to better characterize the then

unknown virus (Balayan et al. 1983; Bradley et al. 1987). Macaques developed clinical signs consistent with

acute viral hepatitis, occasionally excreted the VLPs in feces, and developed antiviral antibodies (Arankalle et

al. 1995; Tsarev et al. 1993a). Chimpanzees and tamarins were inconsistently infected in these initial attempts

(Arankalle et al. 1988; Bradley et al. 1987; McCaustland et al. 2000). Subsequent attempts to infect other non-

human primate species have yielded mixed results with tamarins occasionally developing infection, but

chimpanzees (Arankalle et al. 1988), pig-tailed macaques (Tsarev et al. 1993b), vervets (Tsarev et al. 1993b),

owl monkeys (Ticehurst et al. 1992), squirrel monkeys (Tsarev et al. 1993b), and patas monkeys were all

susceptible through experimental infection. Rhesus and cynomolgus monkeys both in captivity and wild-

caught had serological evidence of natural exposure to HEV and the seroprevalence was age-dependent with



the majority positive for anti-HEV antibodies at 1 year and older for both species (Arankalle et al. 1994; Purcell

and Emerson 2001; Tsarev et al. 1993a). Based on the transmission studies, chimpanzees (Arankalle

et al. 1988), rhesus (Arankalle et al. 1995), and cynomolgus monkeys (Bradley et al.

1988; Tsarev et al. 1993a) were the most susceptible to both human strains of HEV (genotypes 1-4) and animal

strains of HEV (genotypes 3 and 4) and are considered suitable models for HEV studies (Purcell and Emerson

2001) (Table 2). However, the restricted procedures, limited animal resources and ethical concerns have

limited the widespread use of these historical non-human primate models in HEV research today. Naturally

Occurring HEV Infections in Animals Known animal strains of HEV The ever-expanding host range for HEV

currently includes a variety of animal species that serve as both reservoirs for human infections as well as

hosts of genetically diverse but related viruses (Table 1). The most well-characterized animal strains of HEV

include genotypes 3 and 4 swine HEV from domestic and wild pigs (Meng et al. 1997), and avian HEV

genotypes 1-3 (Haqshenas et al. 2001; Huang et al. 2002). Rabbit HEV has recently been identi�ed and

genetically characterized as a genotype 3 from rabbits in China (Zhao et al. 2009), the United States

(Cossaboom et al. 2011), and France (Izopet et al. 2012). Rats (Johne et al. 2011) and ferrets (Raj et al. 2012)

each carry HEV-related strains genetically distinct from other mammalian and avian HEV and cluster together

as a new putative genus proposed as Orthohepevirus (Meng 2013). Cutthroat trout virus (Batts et al. 2011)

resembles mammalian HEV in its genomic organization despite low nucleotide sequence identity and likely

represents a putative genus proposed as Piscihepevirus (Meng 2013). Genotype 3 HEV has also been isolated

from wild mongooses in Japan (Nakamura et al. 2006). Recently, a novel phylogenetic clade of HEV obtained

from Western African, Central American, and European bat species was identi�ed, although evidence for

transmission from bats to humans was lacking (Drexler et al. 2012). Deer have been implicated in foodborne

transmission of genotype 3 HEV to humans and share high nucleotide sequence identity to genotype 3 wild

boar HEV in Japan (Takahashi et al. 2004). The genetic identi�cation of these diverse animal strains of HEV

provided opportunities for developing new and useful naturally-occurring animal models for HEV in the future.

Animal species with only serological evidence of HEV infection The presence of anti-HEV antibodies in serum

indicates the exposure to and potential infection by HEV. Ruminant species including goats (Sanford et al.

2012a), cattle, and sheep have been reported as seropositive to anti-HEV antibodies without de�nitive genetic

identi�cation of HEV (Meng 2013). Horses were reportedly a potential reservoir of HEV by the presence of anti-

HEV antibodies and viral RNA; however, the close-relatedness of virus from horses to human HEV strains in

Cairo (97-100% nucleotide sequence identity) raises questions about the authenticity of these sequences as

true virus from horses (Saad et al. 2007). Anti-HEV antibodies have also been reportedly detected in both dogs

and cats with no detection of HEV-related sequences (Pavio et al. 2010). De�nitive genetic identi�cation of the

sources for anti-HEV seropositivity in these animal species will discover new animal strains of HEV, and thus

leading to the potential development of additional naturally-occurring animal models for HEV in the future.

Naturally Occurring Animal Models for Human Hepatitis E Swine model Discovery and prevalence of swine

HEV in pigs. Discovered from pigs in the United States in 1997, swine HEV became the �rst known animal



strain of HEV (Meng et al. 1997) and has since been identi�ed in domestic and wild swine worldwide. Swine

HEV was initially discovered via identi�cation of anti-HEV seropositive adult pigs followed by a prospective

study on piglets from a herd in Illinois that lead to the recovery of a novel virus (Meng et al. 1997). The novel

virus was successfully transmitted to speci�c-pathogen-free (SPF) pigs and the same virus was recovered

from the experimentally infected SPF pigs, thereby satisfying Koch’s postulates (Meng 2010). Swine serve as a

major reservoir for zoonotic genotypes 3 and 4 HEV (Meng 2010). Serological and molecular prevalence

studies of swine HEV yield widely variable results in both domestic and wild swine species in essentially all

swine-producing countries. In the United States, the majority of pigs develop seropositivity to HEV by 3 months

of age with dispersion of the virus in most herds

(Meng et al. 1997). In Canada (Leblanc et al. 2007),

Japan (Takahashi and Okamoto 2013), many European countries (Pavio et al. 2010; Rutjes et al. 2009), and

China (Meng et al. 1999), swine HEV infection is highly prevalent in both domestic and wild swine species

irrespective of the human population. Swine HEV is equally dispersed in developing and industrialized

countries worldwide. Pathogenesis and course of infection of swine HEV in the pig model. Following the

subclinical course of HEV infection, swine develop only mild microscopic lesions in the liver and associated

lymph nodes (Meng et al. 1997). Microscopic lesions include mild to moderate multifocal and periportal

lymphoplasmacytic hepatitis and mild focal hepatocellular necrosis (Halbur et al. 2001). A prospective study of

four piglets naturally infected by swine HEV identi�ed no apparent gross lesions in 19 different tissues

during necropsy, but characteristic microscopic lesions of hepatitis and lymphoplasmacytic enteritis

in all as well as multifocal lymphoplasmacytic interstitial nephritis in three of the four (Meng et al. 1997). Under

experimental conditions, pigs infected with swine HEV developed no clinical abnormalities, but were consistent

in microscopic liver lesions as the naturally infected pigs, and HEV RNA was detectable in feces, liver tissues,

and bile (Halbur et al. 2001). Pathological lesions in wild boars have not been investigated; however, the

similarity between domestic and wild swine strains leads to speculation that clinical and pathologic effects are

likely similar. Domestic pigs are typically infected by HEV at 2-4 months of age with a transient viremia lasting

1-2 weeks and fecal viral shedding lasting 3-7 weeks (de Deus et al. 2008). By 18 weeks of age, up to 86% of

pigs are naturally infected (Leblanc et al. 2007). The source of infection is thought to be virus shed in large

amounts in feces with transmission via fecal-oral route most common (Meng 2011). Naïve pigs acquire and

spread the virus through direct contact between pigs as well as fecally-contaminated feed and water sources

in their environment. Following the waning of maternal antibodies around 8 weeks of age, piglets become

infected by swine HEV and seroconvert �rst with IgM anti-HEV antibodies that peak in conjunction with peak

fecal viral shedding followed by seroconversion of IgG anti-HEV antibodies with subsequent clearance of the

virus from the feces (de Deus et al. 2008; Leblanc et al. 2007). Genotypes 3 and 4 HEV infections carry a

subclinical course in both naturally and experimentally infected swine with no observable clinical disease or

elevation in liver enzymes (Halbur et al. 2001). Experimentally, swine are readily infected via intravenous



inoculation; however, oral route of inoculation is ine�cient (Meng 2011). Wild boars are assumed to be a

natural reservoir for HEV as well due to the recovery of nearly genetically identical strains of HEV in deer

cohabiting forestry land in Japan (Takahashi et al. 2004). As a model for human HEV infections, swine

e�ciently produce infection with genotypes 3 and 4 HEV and act as the main reservoir for foodborne and

zoonotic HEV transmission to humans. Therefore, this naturally-occurring swine model is very useful for the

study of various aspects of HEV replication, pathogenesis and cross-species infection (Meng 2010) (Table 2).

The major drawback of the naturally-occurring swine HEV model is that it does not reproduce a hepatic

disease with overt clinical signs, thus limiting its usefulness in pathogenicity studies. Chicken model Discovery

and prevalence of avian HEV in chickens. Avian HEV was identi�ed in the United States in 2001 from chickens

with Hepatitis-Splenomegaly syndrome (HSS) (Haqshenas et al. 2001). Big Liver and Spleen Disease Virus

(BLSV) presented similarly in chickens in Australia with approximately 80% nucleotide sequence identity to

avian HEV (Marek et al. 2010; Payne et al. 1999). These two syndromes (HSS and BLS) are now known to be

caused by variants of the same virus within the avian HEV clade. Avian HEV currently consists of at least three

genotypes (1-3) throughout the world and shares approximately 60% nucleotide sequence identity with human

HEV strains (Marek et al. 2010), but is not known to infect humans. Avian HEV infection in chickens affects

approximately 71% of chicken �ocks and 30% of individuals overall within the United States (Huang et al.

2002). Avian HEV transmits most likely via fecal-oral route and spreads easily between and within chicken

�ocks (Meng et al. 2008). The infection in chickens is age-dependent affecting 17% of chickens under 18

weeks of age but 36% of adults were positive for anti-HEV antibodies (Huang et al. 2002). Pathogenesis and

course of infection of avian HEV in the chicken model. Following avian HEV infection, few birds show clinical

signs prior to death. Post-mortem evaluations reveal regressive ovaries, serosanguinous abdominal �uid,

enlarged, hemorrhagic, and necrotic livers, and enlarged spleens (Meng et al. 2008). Microscopic evaluations

identify in�ammatory cellular in�ltrations within the liver parenchyma (Billam et al. 2005). Likewise,

experimentally infected birds consistently present with lymphocytic periphlebitis and phlebitis in the liver at

microscopic evaluation with enlarged and hemorrhagic livers in approximately 25% of the infected birds at

gross evaluation (Meng et al. 2008). Avian HEV has

been shown to successfully cross species barrier and infect turkeys

(Sun et al. 2004); however, attempts to experimentally infect rhesus macaques (Huang et al. 2004) and mice

were unsuccessful (Meng et al. 2008). Avian HEV genotypes 1-3 correspond with mortality rates in chickens

ranging from 0.3- 1.0% of the overall �ock and a high level of subclinical infection. Typical clinical signs include

egg drop, hepato-splenomegaly, and acute death of birds. In �ocks displaying signs of avian HEV infection, up

to 20% of hens present egg drop signi�cantly reducing production (Meng et al. 2008). In an age-dependent

fashion, broiler breeders and laying hens of 30-72 weeks of age display the highest level of mortality (Huang et

al. 2002). As a model for HEV infection in humans, avian HEV genotypes 1-3 are far more limited in their host

range, but this naturally-occurring chicken model offers a unique hepatic disease model (HSS) that can be

used to study at least some aspects of human hepatitis E disease (Table 2). Rabbit model Discovery and



prevalence of rabbit HEV in rabbits. Farmed rabbits from the Gansu Province in China were tested positive for

anti-HEV antibodies and full-length genomic sequences of HEV were determined and found to be most closely

related to the zoonotic genotype 3 HEV (Zhao et al. 2009). Subsequently, studies on farmed and wild rabbits in

the United States (Cossaboom et al. 2011) and France (Izopet et al. 2012) con�rmed the presence of rabbit

HEV related to genotype 3. Anti-HEV antibody presence in rabbits is highly prevalent with 57%, 54.6%, and

34.6% of farmed rabbits in the Gansu province of China, Beijing, and Virginia, USA testing positive respectively

(Cossaboom et al. 2011; Zhao et al. 2009). The detection of rabbit HEV RNA in fecal and serum samples also

indicate a widespread infection of the virus with 7.5%, 7.0%, and 15.9% of respective farmed rabbits positive

(Cossaboom et al. 2011; Zhao et al. 2009). A study in France identi�ed a similar proportion of farmed rabbits

positive for HEV RNA at 7.0%, while 23.0% of wild rabbits were also positive (Izopet et al. 2012). Pathogenesis

and course of infection of rabbit HEV in the rabbit model. The rabbit likely acts as a reservoir for HEV since the

rabbit HEV belongs to the zoonotic genotype 3 that infects humans. The close genetic and antigenic

relationship to other mammalian HEV strains indicates the potential of rabbit HEV infection in rabbits to serve

as a useful naturally-occurring animal model for human HEV study. Experimentally, rabbits are susceptible to

infection by human HEV genotype 4, and rabbit HEV has been successfully transmitted to pigs (Cossaboom et

al. 2012) and cynomolgus macaques (Liu et al. 2013). Anti-HEV antisera from rat, swine, human, and chicken

strains of HEV cross-react with the rabbit HEV capsid protein (Cossaboom et al. 2012). Experimental infection

studies in rabbits indicate the ability to produce local hepatocellular necrosis on microscopic evaluation;

however, rabbits respond subclinically to experimental infection with HEV with little to no overt signs of

disease. Following experimental infection, rabbits shed virus in their feces, seroconvert, and show elevations in

serum alanine aminotransferase levels, indicating acute liver damage (Ma et al. 2010). More in depth studies

on pathogenicity and cross-species infections are warranted to further characterize the usefulness of rabbit

HEV as a naturally-occurring model for human HEV. Other potential naturally-occurring animal models of

hepatitis E Rat model. A rat strain of HEV was identi�ed in Hamburg, Germany in 2009 from Norway rats

collected in sewers (Johne et al. 2011). The strain shared 59.9% and 49.9% nucleotide sequence identity with

human and avian HEV strains indicating a putative new mammalian genotype. Studies from Japan, China,

Indonesia, the United States, and Germany also indicate the presence of a rat strain of HEV based upon the

presence of anti-HEV antibodies, and in addition to Germany, rat HEV has been genetically identi�ed from rats

in a number of other countries including the United States (Purcell et al.

2011) and Japan. In the United States, a variable prevalence of anti- HEV antibodies in rats of the genus Rattus

exists ranging from 44%-90% in different states, and in addition to the rat HEV (Purcell et al., 2011), a genotype

3 HEV RNA has been reportedly detected in wild rats in the United States (Lack et al. 2012), although

independent con�rmation of this report is still lacking . Naturally infected rats had no overt signs of illness

related to HEV infection. In experimental studies on laboratory rats infected with rat HEV, seroconversion and

fecal shedding of virus were detected; however, no clinical signs were apparent (Li et al. 2013). Histopathologic

evaluation of hepatic tissues from the infected laboratory rats identi�ed mild portal in�ammation, parenchymal



foci of necrosis, and aggregates of lymphocytes and Kupffer cells within the lobules indicating evidence of

mild hepatitis consistent with acute HEV infection (Purcell et al. 2011). As a potential model for human HEV

infection, inoculation of rats with mammalian HEV genotypes 1, 2, and 4 failed to produce an e�cient infection

and rat HEV failed to infect rhesus monkeys (Purcell et al. 2011) (Table 2). In a separate report, Wistar rats

were not susceptible to experimental infection by genotypes 1, 3, or 4 HEV, while rat HEV elicited evidence of

infection as expected (Li et al. 2013). Additionally, both swine HEV and avian HEV also failed to elicit a

productive infection in rats further demonstrating the limited utility of rats as a naturally-occurring model or an

experimental model of human HEV infection (Krawczynski et al. 2011; Purcell et al. 2011). Ferret. A ferret strain

of HEV was genetically identi�ed in the Netherlands in 2010. Phylogenetic analysis revealed its clustering with

the rat HEV (Raj et al. 2012). Nucleotide sequence identity with known genotypes 1-4, rabbit, and avian strains

of HEV ranged from 54.5% to 60.5% with the highest sequence identity to rat HEV at 72.3% (Raj et al. 2012).

Little is known about the ferret HEV and the current knowledge relies on one set of samples obtained from

household pets with no known illness (Raj et al. 2012). Whether ferret HEV can serve as a useful model for

HEV is unclear, however, given the close genetic relatedness of the ferret HEV to rat HEV, the usefulness of

ferret HEV as a naturally-occurring animal model for HEV is likely limited. Application of Naturally Occurring

Animal Models for HEV Studies Vaccine studies The mouse models have been used for identi�cation of

immunogenic properties of HEV antigen and preliminary immunization trials in HEV vaccine development

(Table 3). However, the mice species were non-permissive for HEV infection and were unable to be used for

HEV challenge studies (Krawczynski et al. 2011). Therefore, the mouse models are mainly used for preliminary

assessment of HEV vaccine antigen immunogenicity studies. HEV DNA vaccine constructs, puri�ed VLPs, and

recombinant subunit capsid protein all lead to the development of immune responses in the mouse model

(Krawczynski et al. 2011). Rhesus and cynomolgus monkeys were utilized in the vaccine preclinical and

challenge studies to identify potential candidate vaccines that elicit protective immunity against known HEV

genotypes (Krawczynski et al. 2011). The HEV capsid-based recombinant vaccine candidates elicit protective

immune responses. A recombinant vaccine proved to be e�cacious in phase II clinical trials in young men with

95% protection against HEV genotype 1 in Nepal (Shrestha et al. 2007). Another recombinant vaccine proved to

be e�cacious in phase II and III clinical trials in the general population (ages 16-65 years) and in pregnant

women for human HEV genotypes 1 and 4 with 100% protection (Zhu et al. 2010). E�cacy was achieved with

both 2 and 3-dose regimens with no serious adverse events and minimal side effects (Shrestha et al. 2007; Zhu

et al. 2010). Rhesus monkeys immunized with the candidate vaccines were subsequently challenged by

intravenous inoculation of human HEV genotypes 1, 2 and 3 for evaluation of protective immunity (Krawczynski

et al. 2011). In both cases, the macaques were protected against homologous and heterologous challenge by

HEV strains (Krawczynski et al. 2011). The large-scale clinical trial of a capsid-based recombinant vaccine

involving 11,165 individuals (Zhu et al. 2010) has led to the approval of the �rst commercial HEV vaccine in

China (Pro�tt 2012). Pigs have been used as a model for HEV vaccine trials and assessment of cross-

protective potentials of recombinant HEV antigens, which is essential for the development of vaccines that

protect against the zoonotic genotypes 3 and 4 strains of HEV. Pigs vaccinated with truncated recombinant



capsid antigens derived from three different animal strains of HEV speci�cally induce strong anti-HEV IgG

responses, and these responses are partially cross-protective against a genotype 3 mammalian HEV (Sanford

et al. 2012b). In addition, prior infection of pigs with a genotype 3 swine HEV induces protective immunity

enabling resistance against challenge by heterologous and homologous strains of genotypes 3 and 4 HEV

(Sanford et al. 2011), further demonstrating that swine are a good naturally-occurring animal model for HEV

vaccine research. Chicken has also been used as a model for HEV vaccine studies. Immunization of chickens

with avian HEV capsid protein induces protective immunity against avian HEV challenge (Guo et al. 2007), thus

con�rming the role of HEV capsid protein in eliciting protective immunity. The identi�cation of B-cell epitopes

within the

avian HEV capsid protein that are unique to avian, swine, or human

strains of HEV are useful for future diagnostic immunoassays as well as vaccine design (Guo et al. 2006). In

chickens

immunized with KLH (keyhole limpet hemocyanin)- conjugated capsid peptides, protection against

avian HEV

challenge was not achieved. In contrast, in chickens immunized with recombinant avian HEV capsid antigen,

complete protective immunity against avian HEV challenge was obtained, indicating that the immunodominant

epitopes in avian HEV capsid are not protective (Guo et al. 2008). Rabbits may also be useful for HEV vaccine

challenge and e�cacy trials with further characterization of the course of infection and disease (Cheng et al.

2012). Pathogenesis studies Historically, primates served as the main animal model for HEV pathogenicity

studies; however, due to ethical concerns, availability of animals, restrictions on their use, and di�culty in

assessing clinical relevance since primates are not the natural host for HEV, additional naturally- occurring

animal models have recently been used for pathogenicity studies (Billam et al. 2005; Purcell and Emerson

2001) (Table 3). Rhesus (Arankalle et al. 1995) and cynomolgus monkeys (Aggarwal et al. 2001; Bradley et al.

1987; Tsarev et al. 1993a) have been widely used to study HEV infection and pathogenesis; however,

differences in liver enzyme elevations, virus excretion, serologic, and histopathologic results between species

and in relation to a human host exist. The chimpanzee model has also been useful in analyzing the course of

human infections and pathogenicity with genotype 1 and 2 human HEV, and host gene responses to HEV;

although, the use of chimpanzees in HEV study is currently less frequent and more restricted (Arankalle et al.

1988; McCaustland et al. 2000). The mechanisms leading to a chronic course of HEV infection in

immunocompromised individuals as well as elevated mortality rates in pregnant women of up to 25% are

largely unknown due to the inability to identify an appropriate animal model (Meng 2013). Inoculation of

pregnant rhesus monkeys with genotype 1 HEV failed to identify a difference with non-pregnant monkeys and

was unsuccessful in reproducing the elevated mortality rates seen in pregnant women or the development of

the reported severe and fulminant hepatitis E (Tsarev et al. 1995). With the discovery of swine HEV, domestic

swine became a potential model for HEV pathogenicity study; although such studies are limited due to the fact



that swine infected by swine or human HEV develop only subclinical infection with mild-to-moderate pathologic

lesions of hepatitis (Meng 2003; Meng et al. 1997). Experimental infections of pigs with HEV are also limited

by the inability to produce a natural course of infection via natural oral route of inoculation. Even using high

titers of infectious HEV stocks, many experiments have failed to initiate a productive infection via the oral route

in swine (Kasorndorkbua et al. 2004). However, intravenous route of inoculation of swine HEV and human HEV

in the pig model produced characteristic pathological liver lesions; although, clinical sign of hepatitis is lacking

(Halbur et al. 2001). To assess the enhanced pathogenic effect of HEV infection during pregnancy observed in

humans, pregnant gilts were inoculated with swine HEV (Kasorndorkbua et al. 2003). While the gilts developed

active HEV infection, the offspring remained seronegative, and no clinical disease was noted (Kasorndorkbua

et al. 2003), further con�rming the results from the pregnant monkey study. Therefore, the naturally-occurring

swine model is limited for HEV pathogenicity studies, although this model has been useful for various other

aspects of HEV research (Feagins et al. 2008; Huang et al. 2005). Avian HEV infection in chickens leads to

Hepatitis-Splenomegaly Syndrome including egg drop, regressive ovaries, and serosanguinous abdominal �uid

(Meng et al. 2008). The presence of liver gross abnormalities in the chicken model shares similarities with the

course of HEV infection and disease in humans allowing a better characterization of HEV pathogenesis in this

naturally-occurring chicken model (Billam et al. 2005). Additionally, the chicken model affords the opportunity

to mimic the natural route of HEV infection with oronasal delivery of virus inocula (Billam et al. 2005). While the

route of virus inoculation affects the timing of seroconversion (i.v. develops earlier than oronasal), the patterns

of seroconversion, viremia, and development of clinical and pathologic lesions are similar to those seen in HEV

infection in humans (Billam et al. 2005). In a comparative pathogenicity study utilizing a strain of avian HEV

(HEV-VA strain) obtained from a clinically healthy chicken and the prototype avian HEV strain recovered from a

diseased chicken, no signi�cant differences were seen in pathogenicity indicating that other unknown factors

may also be involved in the HEV pathogenesis (Billam et al. 2009). In another study, avian HEV-VA was capable

of inducing histopathologic liver lesions despite failing to elicit a clinical disease in the chicken model (Kwon et

al. 2011). With chickens being a naturally- occurring animal model mimicking certain aspects of the human

disease, identi�cation of viral and host factors that determine pathogenicity in chickens would serve as a

baseline for identifying these same factors in HEV infection in humans. A major drawback for this model is

that chickens are not susceptible to infection by mammalian HEV strains. Rabbits inoculated with human HEV

genotypes 1 and 4 failed to produce clinical disease, elevated liver enzymes, or signi�cant histopathologic

lesions as seen in rabbits inoculated with rabbit HEV (Ma et al. 2010). Genotype 4 human HEV was capable of

infecting only 2 of 9 rabbits, thus con�rming the ability for cross-species infection but at an ine�cient level (Ma

et al. 2010). Genotype 1 human HEV was incapable of eliciting any markers of HEV infection in rabbits, and

thus the usefulness of the rabbit model for HEV pathogenicity study remains to be determined. Molecular

biology and virus replication studies Experimental infections of rhesus and cynomolgus monkeys have been

widely used for infectivity and replication studies through intravenous and intrahepatic inoculations (Aggarwal

et al. 2001; Krawczynski et al. 2011; Tsarev et al. 1993a) (Table 3). Hepatic expression of HEV antigens

indicating viral replication in conjunction with the detection of HEV RNA in bile and feces were identi�ed in



rhesus macaques prior to appearance of gross lesions within the liver parenchyma (Krawczynski et al. 2011).

Chimpanzees and rhesus macaques have been successfully used to determine the infectivity of infectious

cDNA clones of HEV via intrahepatic inoculation of RNA transcripts synthesized from cloned cDNA genome of

HEV (Emerson et al., 2001). The non-human primate model has been indispensable in studying HEV replication

especially during the early days after the virus discovery. The naturally-occurring swine model has played

important roles in understanding the molecular mechanism of HEV replication. By using the swine model, a

genotype 3 swine HEV infectious clone was established without the need of an in vitro cell culture system

(Huang et al. 2005; Krawczynski et al. 2011). Intrahepatic inoculation of pigs with capped RNA transcripts from

HEV infectious clones provided a unique means to study the effect of in vitro genetic manipulation of HEV

genome on virus replication and pathogenicity (Huang et al. 2005). The identi�cation of an attenuated mutant

HEV (pSHEV-1) led to the characterization of speci�c amino acid residues (F51L, T59A, and S390L) in the

capsid protein that are important for virus attenuation in the swine model (Cordoba et al. 2011). Both the T59A

and S390L mutations drastically lowered viral RNA loads in intestinal contents, bile, and liver, and shortened

the duration of fecal viral shedding (Cordoba et al. 2011). The hypervariable region (HVR) in ORF1 of HEV

varies considerably between different HEV genotypes and among HEV strains. By using the swine model, it

was demonstrated that the HVR of HEV is dispensable for HEV infectivity, although a near complete deletion of

the HVR attenuated the virus (Pudupakam et al. 2009). By using the chicken model, the impact of complete

HVR deletion on virus infectivity was further tested using an avian HEV mutant with a complete HVR deletion.

Although the HVR deletion mutant was still replication competent in LMH chicken cells in vitro, the complete

HVR-deletion mutant resulted in a loss of avian HEV infectivity in the chicken model (Pudupakam et al. 2011).

The small ORF3 protein of HEV is multifunctional and involved in virus replication in vivo (Huang et al. 2007;

Kenney et al. 2012). Using a homologous naturally-occurring pig model, the authentic initiation site for HEV

ORF3 translation was identi�ed as the third in-frame AUG codon in the junction region (Huang et al. 2007). A

mutant virus with a mutation in the third in- frame AUG completely abolished the virus infectivity in the pig

model, whereas mutations in the �rst and second in-frame AUG codons in the junction region did not affect the

virus infectivity in pigs (Huang et al. 2007). Furthermore, by utilizing the naturally-occurring chicken model, it

was demonstrated that the PSAP motif in the ORF3 of avian HEV is involved in particle release from the cell

and viral fecal shedding (Kenney et al. 2012). Taken together, in the absence of an e�cient cell culture system

for HEV, these naturally-occurring swine and chicken models are important for studying the molecular

mechanisms of HEV replication. Cross-species HEV infection studies Rhesus monkeys are widely used in HEV

cross-species infection studies due to the ability to be infected by all four genotypes of human HEV and

development of virologic, pathologic, and serologic characteristics consistent with HEV infection (Krawczynski

et al. 2011) (Table 3). Two rhesus monkeys and one chimpanzee were successfully infected with a genotype 3

swine HEV resulting in acute viral hepatitis, seroconversion to anti-HEV antibodies, fecal virus shedding,

viremia, and slight elevations in ALT, thus serving as experimental surrogates for human HEV infections (Meng

et al. 1998). Rhesus macaques were also successfully infected with an Indian strain of genotype 4 swine HEV

as evidenced by viremia and seroconversion to anti-HEV antibodies (Arankalle et al. 2006). In addition,



cynomolgus monkeys were readily infected with rabbit HEV with the development of viremia, elevated liver

enzymes, presence of fecal virus shedding, and seroconversion to HEV antibodies indicating that, similar to

other genotype 3 HEV strains, the rabbit HEV may likely infect humans (Liu et al. 2013). The swine model has

been used to study the cross-species infection and susceptibility of human HEV. Speci�c-pathogen-free pigs

are readily infected by the genotypes 3 and 4 strains of human HEV (Cordoba et al. 2012; Feagins et al. 2008;

Meng 2003). In infected pigs, seroconversion occurred by 28 dpi and fecal viral shedding and viremia occurred

by 7-56 dpi indicating that swine serve as an excellent model for human HEV infection (Feagins et al. 2008). By

using the swine model, it was demonstrated that intergenotypic chimeric

HEVs with the genotype 4 human HEV capsid gene cloned in the backbone of

genotype 3 swine HEV are infectious in pigs, furthering con�rming the zoonotic nature of genotypes 3 and 4

HEV (Feagins et al. 2011). Swine were also shown to be susceptible to infection by rabbit HEV, but resistant to

infection with the rat HEV (Cossaboom et al. 2012). The pig model will be important in identifying the genetic

elements in the virus genome that determine the cross-species HEV infection between humans and swine.

Under experimental conditions, avian HEV from chickens has been demonstrated to cross species barriers and

infect turkeys (Sun et al. 2004); however, attempts to infect rhesus monkeys with avian HEV were unsuccessful

(Huang et al. 2004), suggesting that avian HEV has a limited host range and is not zoonotic. Turkeys inoculated

with avian HEV seroconverted by 4-6 weeks post-infection, viremia was detected by 2-6 weeks, and a control

negative turkey became infected by direct contact (Sun et al. 2004) indicating that the infection is readily

transmissible in a new host. Rodents including Balb/c nude mice (Huang et al. 2009), C57BL/6 mice (Li et al.

2008), Wistar rats (Li et al. 2013), and Mongolian gerbils (Li et al. 2009) may potentially serve as animal

models for some aspects of HEV study; however, few transmission studies in these species resulted in

productive infections, and some of these reports have not yet been independently con�rmed. Rabbits serve as

a natural host for genotype 3 HEV and are susceptible experimentally to infection by human HEV genotype 4

(Liu et al. 2013). Experimental HEV inoculations in rabbits yield viremia with fecal virus shedding,

seroconversion, and mild hepatic lesions consistent with HEV infection (Ma et al. 2010). The rabbit strain of

HEV was shown capable of infecting swine and rhesus monkeys indicating the ability of rabbit HEV to infect

across species barrier (Cossaboom et al. 2012). The susceptibility to cross-species infection of rabbits by

human HEV genotypes 3 and 4 indicated the potential use of rabbits as an alternate model for human HEV.

Future Perspectives Despite recent advances in the genetic identi�cation of novel animal strains of HEV,

characterization of the course of infection and disease in a variety of animal hosts, the underlying molecular

mechanisms of HEV replication, pathogenesis and cross-species infection remain largely unknown in part due

to the lack of an e�cient cell culture and a practical animal model for HEV. Several naturally-occurring animal

models such as swine, chicken and rabbit have recently been developed and shown to be useful for various

aspects of HEV studies. However, there still lacks a reproducible hepatic disease animal model for the study of

human HEV pathogenesis. For examples, the observed severe and fulminant hepatitis E in pregnant women

could not be reproduced in pregnant pigs or pregnant rhesus monkeys. Such an animal model will be critical in



identifying the underlying mechanisms of fulminant hepatitis E during pregnancy. Currently, chronic and

persistent HEV infection is an emerging and signi�cant clinical problem in immunocompromised individuals

such as organ transplant recipients. Unfortunately, a useful animal model that can mimic chronic HEV infection

is still lacking, and thus hindering our understanding the mechanism for progression into chronicity and the

progress of developing effective antivirals against chronic hepatitis E. Clearly, identifying additional animal

models that can more adequately mimic the course of HEV infection and outcomes of disease in humans are

important for future HEV research. The expanding host range of HEV offers the opportunities to identify

potential new animal strains of HEV that could lead to the development of better naturally- occurring animal

model(s) for HEV. Therefore, genetic identi�cation and characterization of additional novel animal strains of

HEV are warranted, and development of an e�cient cell line to propagate different strains of HEV in vitro will

be the key for future development of a cost- effective modi�ed live-attenuated vaccine against HEV.

Acknowledgements The author’s research on HEV is supported by grants from the National Institutes of Health

(R01AI074667, and

R01AI050611). D.M.Y. is supported by a training grant from the National Institutes of Health (T32OD010430-

06). We thank Dr. Dianjun Cao for his expert help in the construction of the phylogenetic tree. References

Aggarwal R. 2011. Clinical presentation of hepatitis e. Virus Res 161(1):15-22. Aggarwal R, Kamili S, Spelbring

J, Krawczynski K.

2001. Experimental studies on subclinical hepatitis e virus infection in cynomolgus macaques. J Infect Dis

184(11):1380-

1385.

Arankalle VA, Chadha MS, Chobe LP, Nair R, Banerjee K. 1995. Cross-challenge studies in rhesus monkeys

employing different indian isolates of hepatitis e virus. J Med Virol 46(4 ):358-

363. Arankalle VA, Chobe LP, Chadha MS. 2006. Type-iv indian swine hev infects rhesus monkeys. J Viral Hepat

13(11):742-745. Arankalle VA, Goverdhan MK,

Banerjee K. 1994. Antibodies against hepatitis e virus in old world monkeys. J Viral Hepat 1(2):

125-129. Arankalle VA, Ticehurst J, Sreenivasan MA, Kapikian AZ, Popper H, Pavri KM, Purcell RH.

1988. Aetiological association of a virus-like particle with enterically transmitted non-a, non-b hepatitis. Lancet

1 (8585):

550-554.

Balayan MS, Andjaparidze AG, Savinskaya SS, Ketiladze ES, Braginsky DM, Savinov AP, Poleschuk VF. 1983.

Evidence for a virus in non-a, non-b hepatitis transmitted via the fecal-oral route. Intervirology 20(1 ):23-31.



Batts W, Yun S, Hedrick R, Winton J. 2011. A novel member of the family hepeviridae from cutthroat trout

(oncorhynchus clarkii). Virus Res 158(1-2):116-123. Billam P, Huang F, Sun Z, Pierson F, Duncan R, Elvinger F,

Guenette D, Toth T, Meng XJ. 2005. Systematic pathogenesis and replication of avian hepatitis e virus in

speci�c- pathogen-free adult chickens. J Virol 79(6):3429-3437. Billam P, LeRoith T, Pudupakam RS, Pierson

FW, Duncan RB, Meng XJ. 2009. Comparative pathogenesis in speci�c-pathogen-free chickens of two strains

of avian hepatitis e virus recovered from a chicken with hepatitis-splenomegaly syndrome and from a clinically

healthy chicken. Vet Microbiol 139(3-4):253-261. Bradley D, Andjaparidze A, Cook EH, Jr., McCaustland K,

Balayan M, Stetler H, Velazquez O, Robertson B, Humphrey C, Kane M, et al. 1988. Aetiological agent of

enterically transmitted non-a, non-b hepatitis. J Gen Virol 69 ( Pt 3):731-738. Bradley DW, Krawczynski K, Cook

EH, Jr., McCaustland KA, Humphrey CD, Spelbring JE, Myint H, Maynard JE. 1987. Enterically transmitted non-a,

non-b hepatitis: Serial passage of disease in cynomolgus macaques and tamarins and recovery of disease-

associated 27- to 34-nm viruslike particles. Proc Natl Acad Sci U S A 84(17):6277-6281. Cheng X, Wang S, Dai

X, Shi C, Wen Y, Zhu M, Zhan S, Meng J. 2012.

Rabbit as a novel animal model for hepatitis e virus infection and vaccine evaluation.

PLoS One 7(12):e51616. Cordoba L, Feagins AR, Opriessnig T, Cossaboom CM, Dryman BA, Huang YW, Meng

XJ. 2012. Rescue of a genotype 4 human hepatitis e virus from cloned cdna and characterization of

intergenotypic chimeric viruses in cultured human liver cells and in pigs. J Gen Virol 93(Pt 10):2183-2194.

Cordoba L, Huang YW, Opriessnig T, Harral KK, Beach NM, Finkielstein CV, Emerson SU, Meng XJ. 2011. Three

amino acid mutations (f51l, t59a, and s390l) in the capsid protein of the hepatitis e virus collectively contribute

to virus attenuation. J Virol 85(11):5338- 5349. Cossaboom C, Cordoba L, Dryman B, Meng X-J. 2011. Hepatitis

e virus in rabbits, virginia, USA. Emerg Infect Dis 17(11):2047-2049. Cossaboom CM, Cordoba L, Sanford BJ,

Pineyro P, Kenney SP, Dryman BA, Wang Y, Meng XJ. 2012. Cross-species infection of pigs with a novel rabbit,

but not rat, strain of hepatitis e virus isolated in the united states. J Gen Virol 93(Pt 8):1687-1695.

de Deus N, Casas M, Peralta B, Nofrarías M, Pina S, Martín M, Segalés J. 2008. Hepatitis e virus infection

dynamics and organic distribution in naturally infected pigs in a farrow-to- �nish farm. Vet Microbiol 132(

1-2):19-28. Drexler J, Seelen A, Corman V, Fumie Tateno A, Cottontail V, Melim Zerbinati R, Gloza- Rausch F,

Klose S, Adu-Sarkodie Y, Oppong S, Kalko E, Osterman A, Rasche A, Adam A, Müller M, Ulrich R, Leroy E,

Lukashev A, Drosten C. 2012. Bats worldwide carry hepatitis e virus-related viruses that form a putative novel

genus within the family hepeviridae. J Virol 86(17):9134-9147. Feagins A, Opriessnig T, Huang Y, Halbur P,

Meng XJ. 2008. Cross-species infection of speci�c-pathogen-free pigs by a genotype 4 strain of human

hepatitis e virus. J Med Virol 80(8):1379-1386. Feagins AR, Cordoba L, Sanford BJ, Dryman BA, Huang YW,

LeRoith T, Emerson SU, Meng XJ. 2011. Intergenotypic chimeric hepatitis e viruses (hevs) with the genotype 4

human hev capsid gene in the backbone of genotype 3 swine hev are infectious in pigs. Virus Res 156(1-

2):141-146.



Guo H, Zhou EM, Sun ZF, Meng XJ. 2007. Protection of chickens against avian hepatitis e virus (avian

hev) infection by immunization with recombinant avian hev capsid protein. Vaccine 25(15 ):2892-2899. Guo

H, Zhou EM, Sun ZF, Meng XJ.

2008.

Immunodominant epitopes mapped by synthetic peptides on the capsid protein of avian hepatitis e virus are

non-protective. Viral Immunol

21(1):61-67.

Guo H, Zhou EM, Sun ZF, Meng XJ, Halbur PG. 2006. Identi�cation of b-cell epitopes in the capsid protein

of avian hepatitis e virus (avian hev) that are common to human and swine hevs or unique to avian hev. J Gen

Virol 87 (Pt 1):217-

223. Halbur PG,

Kasorndorkbua C, Gilbert C, Guenette D, Potters MB, Purcell RH, Emerson SU, Toth TE, Meng

XJ. 2001. Comparative pathogenesis of infection of pigs with hepatitis e viruses recovered from a pig and a

human. J Clin Microbiol 39(

3):918-923. Haqshenas G, Shivaprasad H, Woolcock P, Read D, Meng XJ. 2001. Genetic identi�cation and

characterization of a novel virus related to human hepatitis e virus from

chickens with hepatitis-splenomegaly syndrome in the united states.

J Gen Virol 82(Pt 10):2449-2462. Huang F, Sun Z, Emerson S, Purcell R, Shivaprasad H, Pierson F, Toth T, Meng

XJ. 2004. Determination and analysis of the complete genomic sequence of avian hepatitis e virus (avian hev)

and attempts to infect rhesus monkeys with avian hev. J Gen Virol 85(Pt 6):1609-1618. Huang F, Zhang W,

Gong G, Yuan C, Yan Y, Yang S, Cui L, Zhu J, Yang Z, Hua X. 2009.

Experimental infection of balb/c nude mice with hepatitis e virus. BMC Infect Dis 9 :93.

Huang FF, Haqshenas G, Shivaprasad HL, Guenette DK, Woolcock PR, Larsen CT, Pierson FW, Elvinger F, Toth

TE, Meng XJ. 2002. Heterogeneity and seroprevalence of a newly identi�ed avian hepatitis e virus from

chickens in the united states. J Clin Microbiol 40(11):4197-4202. Huang YW, Haqshenas G, Kasorndorkbua C,

Halbur PG, Emerson SU, Meng XJ. 2005. Capped rna transcripts of full-length cdna clones of swine hepatitis e

virus are replication competent when transfected into huh7 cells and infectious when intrahepatically

inoculated into pigs. J Virol 79(3):1552-1558. Huang YW, Opriessnig T, Halbur PG, Meng XJ. 2007. Initiation at

the third in-frame aug codon of open reading frame 3 of the hepatitis e virus is essential for viral infectivity in

vivo. J Virol 81(6):3018-3026. Izopet J, Dubois M, Bertagnoli S, Lhomme S, Marchandeau S, Boucher S, Kamar

N, Abravanel F, Guerin JL. 2012.



Hepatitis e virus strains in rabbits and evidence of a closely related strain in humans, france.

Emerg Infect Dis 18(8):1274-1281. Johne R, Heckel G, Plenge-Bönig A, Kindler E, Maresch C, Reetz J, Schielke

A, Ulrich R. 2011. Novel hepatitis e virus genotype in norway rats, germany. Emerg Infect Dis 16(9):1452- 1455.

Kamar N, Rostaing L, Izopet J. 2013. Hepatitis e virus infection in immunosuppressed patients: Natural history

and therapy. Semin Liver Dis 33

(1):62-70. Kamar N, Selves J, Mansuy JM,

Ouezzani L, Peron JM, Guitard J, Cointault O, Esposito L, Abravanel F, Danjoux M, Durand D, Vinel JP, Izopet J,

Rostaing L. 2008.

Hepatitis e virus and chronic hepatitis in organ-transplant recipients. N Engl J

Med 358(8):811-817. Kasorndorkbua C, Guenette D, Huang F, Thomas P, Meng XJ, Halbur P. 2004. Routes of

transmission of swine hepatitis e virus in pigs. J Clin Microbiol 42(11):5047-5052. Kasorndorkbua C, Thacker

BJ, Halbur PG, Guenette DK, Buitenwerf RM, Royer RL, Meng XJ.

2003. Experimental infection of pregnant gilts with swine hepatitis e virus. Can J Vet Res 67(4):303-

306. Kenney SP, Pudupakam RS, Huang YW, Pierson FW, LeRoith T, Meng XJ. 2012. The psap motif within the

orf3 protein of an avian strain of the hepatitis e virus is not critical for viral infectivity in vivo but plays a role in

virus release. J Virol 86(10):5637-5646. Khuroo MS. 2011. Discovery of hepatitis e: The epidemic non-a, non-b

hepatitis 30 years down the memory lane. Virus Res 161(1):3-14. Krawczynski K, Meng X-J, Rybczynska J.

2011. Pathogenetic elements of hepatitis e and animal models of hev infection. Virus Res 161(1):78-83. Kwon

HM, LeRoith T, Pudupakam RS, Pierson FW, Huang YW, Dryman BA, Meng XJ. 2011. Construction of an

infectious cdna clone of avian hepatitis e virus (avian hev) recovered from a clinically healthy chicken in the

united states and characterization of its pathogenicity in speci�c-pathogen-free chickens. Vet Microbiol 147(3-

4):310-319. Lack J, Volk K, Van Den Bussche R. 2012.

Hepatitis e virus genotype 3 in wild rats, united states.

Emerg Infect Dis 18(8):1268-1273.

Leblanc D, Ward P, Gagne MJ, Poitras E, Muller P, Trottier YL, Simard C, Houde A. 2007. Presence of

hepatitis e virus in a naturally infected swine herd from nursery to slaughter. Int J Food Microbiol 117(2):

160-166. Li TC, Suzaki Y, Ami Y, Tsunemitsu H, Miyamura T, Takeda N. 2008. Mice are not susceptible to

hepatitis e virus infection. J Vet Med Sci 70(12):1359-1362. Li TC, Yoshizaki S, Ami Y, Suzaki Y, Yasuda SP,

Yoshimatsu K, Arikawa J, Takeda N, Wakita T. 2013. Susceptibility of laboratory rats against genotypes 1, 3, 4,

and rat hepatitis e viruses. Vet Microbiol 163(1-2):54-61. Li WG, Sun Q, She RP, Wang DC, Duan XH, Yin J, Ding

Y. 2009. Experimental infection of mongolian gerbils by a genotype 4 strain of swine hepatitis e virus. J Med

Virol 81(9):1591-1596. Liu P, Bu QN, Wang L, Han J, Du RJ, Lei YX, Ouyang YQ, Li J, Zhu YH, Lu FM, Zhuang H.



2013. Transmission of hepatitis e virus from rabbits to cynomolgus macaques. Emerg Infect Dis 19(4):559-

565. Ma H, Zheng L, Liu Y, Zhao C, Harrison TJ, Ma Y, Sun S, Zhang J, Wang Y. 2010. Experimental infection of

rabbits with rabbit and genotypes 1 and 4 hepatitis e viruses. PLoS One 5(2):e9160. Marek A, Bilic I, Proko�eva

I, Hess M. 2010. Phylogenetic analysis of avian hepatitis e virus samples from european and australian chicken

�ocks supports the existence of a different genus within the hepeviridae comprising at least three different

genotypes. Vet Microbiol 145(1-2):54-61. McCaustland KA, Krawczynski K, Ebert JW, Balayan MS, Andjaparidze

AG, Spelbring JE, Cook EH, Humphrey C, Yarbough PO, Favorov MO, Carson D, Bradley DW, Robertson BH. 2000.

Hepatitis e virus infection in chimpanzees: A retrospective analysis. Arch Virol 145(9):1909-1918. Meng X-J.

2011. From barnyard to food table: The omnipresence of hepatitis e virus and risk for zoonotic infection and

food safety. Virus Res 161(1):23-30. Meng X-J. 2013. Zoonotic and foodborne transmission of hepatitis e virus.

Semin Liv Dis 33(1):41-49.

Meng XJ. 2003. Swine hepatitis e virus: Cross-species infection and risk in xenotransplantation. Curr Top

Microbiol

Immunol 278:185-216.

Meng XJ. 2010. Hepatitis e virus: Animal reservoirs and zoonotic risk. Vet Microbiol 140(3- 4 ):256-

265.

Meng XJ, Anderson DA, Arankalle VA, Emerson SU, Harrison TJ, Jameel S, Okamoto H. 2012. Hepeviridae.

London, United Kingdom. Meng XJ, Dea S, Engle RE, Friendship R, Lyoo YS, Sirinarumitr T, Urairong K, Wang D,

Wong D, Yoo D, Zhang Y, Purcell RH, Emerson SU. 1999. Prevalence of antibodies to the hepatitis e virus in pigs

from countries where hepatitis e is common or is rare in the human population. J Med Virol 59(3):297-302.

Meng XJ, Halbur P, Shapiro M, Govindarajan S, Bruna J, Mushahwar I, Purcell R, Emerson S. 1998. Genetic and

experimental evidence for cross-species infection by swine hepatitis e virus. J Virol 72(12):9714-9721.


Emerson S. 1997. A novel virus in swine is closely related to the human hepatitis e virus. Proc Natl Acad Sci

U S A 94(18):9860-9865.

Meng XJ, Shivaprasad H, Payne CJ. 2008. Hepatitis e virus infections.

In: Saif YM, Fadly AM, Glisson JR, McDougald LR, Nolan LK, Swayne DE, editors. Diseases of

Poultry.

13th ed. Ames, Iowa: Blackwell Publishing Press. p. 443-452.

Nakamura M, Takahashi K, Taira K, Taira M, Ohno A, Sakugawa H,

Arai M, Mishiro S. 2006.



Hepatitis e virus infection in wild mongooses of okinawa, japan: Demonstration of anti- hev antibodies and a

full-genome nucleotide sequence. Hepatol Res 34(3 ):137-

140. Navaneethan U, Al Mohajer M, Shata MT. 2008. Hepatitis e and pregnancy: Understanding the

pathogenesis. Liver Int 28(9):1190-1199.

Pavio N, Meng X-J, Renou C. 2010. Zoonotic hepatitis e: Animal reservoirs and emerging risks. Vet Res 41(

6):46. Payne CJ, Ellis TM, Plant SL, Gregory AR, Wilcox GE. 1999. Sequence data suggests big liver and spleen

disease virus (blsv) is genetically related to hepatitis e virus. Vet Microbiol 68(1-2):119-125. Pro�tt A. 2012.

First hev vaccine approved. Nat Biotech 30(4):300. Pudupakam RS, Huang YW, Opriessnig T, Halbur PG,

Pierson FW, Meng XJ. 2009. Deletions of the hypervariable region (hvr) in open reading frame 1 of hepatitis e

virus do not abolish virus infectivity: Evidence for attenuation of hvr deletion mutants in vivo. J Virol 83(1):384-

395. Pudupakam RS, Kenney SP, Cordoba L, Huang YW, Dryman BA, Leroith T, Pierson FW, Meng XJ. 2011.

Mutational analysis of the hypervariable region of hepatitis e virus reveals its involvement in the e�ciency of

viral rna replication. J Virol 85(19):10031-10040. Purcell R, Engle R, Rood M, Kabrane-Lazizi Y, Nguyen H,

Govindarajan S, St Claire M, Emerson S. 2011.

Hepatitis e virus in rats, los angeles, california, USA. Emerg Infect Dis 17(

12):2216-2222. Purcell RE, S.U. 2001. Hepatitis e virus. In: Knipe D, Howley P, Gri�n D, Lamb R, Martin M,

Roizman B, al. e, editors. Fields Virology 4th ed. Philadelphia, PA: Lippincott: Williams and Wilkins. p. 3051-

3061. Purcell RH, Emerson SU.

2001. Animal models of hepatitis a and e. ILAR J 42(2):

161-177. Raj V, Smits S, Pas S, Provacia L, Moorman-Roest H, Osterhaus A, Haagmans B. 2012. Novel hepatitis

e virus in ferrets, the netherlands. Emerg Infect Dis 18(8):1369-1370. Rutjes S, Lodder W, Lodder-Verschoor F,

van den Berg H, Vennema H, Duizer E, Koopmans M, de Roda Husman A. 2009. Sources of hepatitis e virus

genotype 3 in the netherlands. Emerg Infect Dis 15(3):381-387.

Saad MD, Hussein HA, Bashandy MM, Kamel HH, Earhart KC, Fryauff DJ, Younan M, Mohamed AH. 2007.

Hepatitis e virus infection in work horses in egypt. Infect Genet Evol 7(3):368-373.

Sanford BJ, Dryman BA, Huang YW, Feagins AR, Leroith T, Meng XJ. 2011. Prior infection of

pigs with a genotype 3 swine hepatitis e virus (hev) protects against subsequent challenges with homologous

and heterologous genotypes 3 and 4 human hev. Virus Res 159(1):17-22. Sanford BJ, Emerson SU, Purcell RH,

Engle RE, Dryman BA, Cecere TE, Buechner-Maxwell V, Sponenberg DP, Meng XJ. 2012a. Serological evidence

for a hepatitis e virus-related agent in goats in the united states. Transbound Emerg Dis 60(6):538-545. Sanford

BJ, Opriessnig T, Kenney SP, Dryman BA, Cordoba L, Meng XJ. 2012b. Assessment of the cross-protective

capability of recombinant capsid proteins derived from pig, rat, and avian hepatitis e viruses (hev) against



challenge with a genotype 3 hev in pigs. Vaccine 30(44):6249-6255. Shrestha MP, Scott RM, Joshi DM,

Mammen MP, Jr., Thapa GB, Thapa N, Myint KS, Fourneau M, Kuschner RA, Shrestha SK, David MP, Seriwatana

J, Vaughn DW, Safary A, Endy TP, Innis BL. 2007. Safety and e�cacy of a recombinant hepatitis e vaccine. N

Engl J Med 356(9):895-903. Sun ZF, Larsen CT, Huang FF, Billam P, Pierson FW, Toth TE, Meng XJ. 2004.

Generation and infectivity titration of an infectious stock of avian hepatitis e virus (hev) in chickens and cross-

species infection of turkeys with avian hev. J Clin Microbiol 42(6):2658-2662.

Takahashi K, Kitajima N, Abe N, Mishiro S. 2004. Complete or near-complete nucleotide sequences of

hepatitis e virus genome recovered from a wild boar, a deer, and four patients who ate the deer. Virology 330(2

):501-

505. Takahashi M, Nishizawa T, Sato H, Sato Y, Jirintai, Nagashima S, Okamoto H. 2011.

Analysis of the full- length genome of a hepatitis e virus

isolate obtained from a wild boar in japan that is classi�able into a novel genotype. J Gen Virol 92(Pt 4):902-

908.

Takahashi M, Okamoto H. 2013. Features of hepatitis e virus infection in humans and animals in japan.

Hepatol Res. Teo C. 2010.

Much meat, much malady: Changing perceptions of the epidemiology of hepatitis e. Clin Microbiol Infect

16(1):24-32.

Ticehurst J, Rhodes LL, Jr., Krawczynski K, Asher LV, Engler WF, Mensing TL, Caudill JD, Sjogren MH, Hoke CH,

Jr., LeDuc JW, et al. 1992. Infection of owl monkeys (aotus trivirgatus) and cynomolgus monkeys (macaca

fascicularis) with hepatitis e virus from mexico. J Infect Dis 165(5):835-845.

Tsarev SA, Emerson SU, Tsareva TS, Yarbough PO, Lewis M, Govindarajan S, Reyes GR, Shapiro M, Purcell RH.

1993a. Variation in course of hepatitis e in experimentally infected cynomolgus monkeys. J Infect Dis

167(6):1302-1306. Tsarev SA, Tsareva TS, Emerson SU,

Kapikian AZ, Ticehurst J, London W, Purcell RH. 1993b. Elisa for antibody to hepatitis e virus (hev) based on

complete open-reading frame-2 protein expressed in insect cells: Identi�cation of hev infection in primates. J

Infect Dis 168(2):369-378. Tsarev SA, Tsareva TS, Emerson SU, Rippy MK, Zack P, Shapiro M, Purcell RH. 1995.

Experimental hepatitis e in pregnant rhesus monkeys: Failure to transmit hepatitis e virus (hev) to offspring and

evidence of naturally acquired antibodies to hev. J Infect Dis 172(1):31-37. Zhao C, Ma Z, Harrison TJ, Feng R,

Zhang C, Qiao Z, Fan J, Ma H, Li M, Song A, Wang Y. 2009. A novel genotype of hepatitis e virus prevalent

among farmed rabbits in china. J Med Virol 81(8):1371-1379.

Zhu FC, Zhang J, Zhang XF, Zhou C, Wang ZZ, Huang SJ, Wang H, Yang CL, Jiang HM, Cai



JP, Wang YJ, Ai X, Hu YM, Tang Q, Yao X, Yan Q, Xian YL, Wu T, Li YM, Miao J, Ng MH, Shih JW, Xia NS. 2010.

E�cacy and safety of a recombinant hepatitis e vaccine in healthy adults: A large-scale, randomised, double-

blind placebo-controlled, phase 3 trial. Lancet 376(9744):895-902. TABLES Table 1: Animals with Naturally

Occurring HEV Infections Species HEV Genotype Genetically con�rmed infection Domestic Swine 3, 4 Wild

boar 3, 4, unclassi�ed new genotype Deer 3 Chicken Avian HEV genotypes 1, 2, 3 Rabbit 3 Rat unclassi�ed new

genotype, 3 (not independently con�rmed) Mongoose 3 Moose unclassi�ed new hepevirus Ferret unclassi�ed

new hepevirus Bat unclassi�ed new hepevirus Cutthroat Trout unclassi�ed new hepevirus Serological evidence

of infection Rhesus Macaque Cynomolgus Goat Sheep Cattle Unknown Unknown Unknown Unknown Unknown

Table 2: Experimental Susceptibility of Different Animal Species to HEV strains Species Non-Human Primates:

Cynomolgus monkey Rhesus monkey Chimpanzee Tamarins Owl Monkey Vervet Squirrel Monkey Patas

Domestic Swine Rabbit Chicken Turkey Lamb HEV genotypes Human 1, 2 Rabbit HEV Human 1, 2, 3, 4 Swine 3,

4 Avian HEV Human 1, 2, 3, 4 Swine 3, 4 Human 1, 2 Human 1, 2 Human 1, 2 Human 1, 2 Human 1, 2 Human 3,

4 Human 1 Human 2 Rabbit HEV Avian HEV Rat HEV Human 4 Human 1 Swine 4 Human 1 Swine 3 Avian HEV

Avian HEV Human 1 Experimental susceptibility Yes Yes Yes Yes No Yes Yes Yes Yes Yes Yes Yes Yes No No

Yes No No Yes No Ine�cient No No Yes Yes Yes (not independently con�rmed) Rodents: Rat Human 1, 2, 3, 4

No Swine 3 No Avian HEV No Balb/C mice Swine 4 Yes C57BL/6 mice Human 1 No Swine 3,4 No Mongolian

Gerbil Swine 4 Yes (not independently con�rmed) Table 3: Applications of available animal models including

naturally occurring animal models for various aspects of HEV studies Species Application Chimpanzee

Pathogenesis, Molecular Biology and Virus Replication, Cross-species Infection Rhesus monkey Cynomolgus

Monkey Owl Monkey Rodents Swine Chicken Rabbit Vaccine, Pathogenesis, Molecular Biology and Virus

Replication, Cross-species Infection Vaccine, Pathogenesis, Molecular Biology and Virus Replication, Cross-

species Infection Cross-species Infection Vaccine, Cross-species Infection Vaccine, Pathogenesis, Molecular

Biology and Virus Replication, Cross-species Infection Vaccine, Pathogenesis, Molecular Biology and Virus

Replication, Cross-species Infection Vaccine, Pathogenesis, Cross species Infection FIGURE

Figure 1: Figure 1: A phylogenetic tree based on the full- length genomic sequences with

genotype classi�cation of known

animal strains of HEV. Sequence alignment was completed using ClustalW, MEGA version 5.2

(www.megasoftware.net) for the phylogenetic tree, and the

tree was constructed using the neighbor-joining method with the maximum composite likelihood

method

for evolutionary distances corresponding to each branch length and the units of the number of base

substitutions per site. Each of the four known genotypes (1-4) is labeled, with representative strains included

for each species, and novel strains from ferret, bat, rat, avian, and �sh identi�ed individually as separate new

putative genotypes or species. Chapter III: Hepatitis Virus Infections in Poultry Danielle M. Yugo1, Ruediger

Hauck2, H. L. Shivaprasad3, and Xiang-Jin Meng1* 1Department of



Biomedical Sciences and Pathobiology, Virginia-Maryland College of Veterinary Medicine, Virginia

Polytechnic Institute and State University, Blacksburg, VA 24061-0913;

2Department of Population Health and Reproduction,

School of Veterinary Medicine, University of California, Davis, CA

95616; 3California

Animal Health and Food Safety Laboratory System, University of California-Davis, Tulare, CA 93274

Avian Diseases. 2016; Sep; 60(3): 576-588.

This is a pre- copyedited, author-produced PDF of an article accepted for publication in

Avian Diseases following peer review. The version of record

[Yugo, DM, Hauck, R, Shivaprasad, HL, and Meng, XJ, Hepatitis Virus Infections in Poultry, Avian Dis.

2016 Sep; 60(

3): 576-588.] is available online at: https://doi.org/10.1637/11229-070515-Review.1. Summary Viral hepatitis in

poultry is a complex disease syndrome caused by several viruses belonging to different families including

avian hepatitis E virus (HEV),

duck hepatitis B virus (DBHV), duck hepatitis A virus (DHAV-1, -2, -3), duck hepatitis virus

types 2 and 3, fowl adenoviruses (FAdV), and Turkey hepatitis virus (THV). While these hepatitis viruses share

the same target organ, the liver, they each possess unique clinical and biological features. In this article, we

aim to review the common and unique features of major poultry hepatitis viruses in an effort to identify the

knowledge gaps and aid the prevention and control of poultry viral hepatitis. Avian HEV is an Orthohepevirus B

in the family Hepeviridae that naturally infects chickens and consists of 3 distinct genotypes worldwide. Avian

HEV is associated with Hepatitis-Splenomegaly syndrome or Big Liver and Spleen Disease in chickens,

although the majority of the infected birds are subclinical. Avihepadnaviruses in the family of Hepadnaviridae

have been isolated from ducks, snow geese, white storks, grey herons, cranes, and parrots. DHBV evolved with

the host as a noncytopathic form without clinical signs and rarely progressed to chronicity. The outcome for

DHBV infection varies by the host’s ability to elicit an immune response and is dose and age dependent in

ducks, thus mimicking the pathogenesis of human HBV infections and providing an excellent animal model for

human HBV. DHAV

is a picornavirus that causes a highly contagious virus infection in ducks with up to

100% �ock mortality in ducklings under 6 weeks of age, while older birds remain unaffected. The high

morbidity and mortality have an economic impact on intensive duck production farming. DHV types 2 and 3 are

astroviruses in the family of Astroviridae with similarity phylogenetically to turkey astroviruses implicating the



potential for cross-species infections between strains. DAstV causes acute, fatal infections in ducklings with a

rapid decline within 1-2 hours and clinical and pathological signs virtually indistinguishable from DHAV. DAstV-

1 has only been recognized in the United Kingdom and recently in China, while DAstV-2 has

been reported in ducks in the United States. Fowl adenoviruses (FAdV), the causative agent of

Inclusion Body Hepatitis (IBH), is a group I avian adenovirus in the genus Aviadenovirus. The affected birds

have a swollen, friable and discolored liver, sometimes with necrotic or hemorrhagic foci. Histological lesions

include multifocal necrosis of hepatocytes and acute hepatitis with intranuclear inclusion bodies in the nuclei

of the hepatocytes. Turkey Hepatitis Virus (THV) is a picornavirus that is likely the causative agent of Turkey

viral hepatitis (TVH). Currently there are more questions than answers about THV, and the pathogenesis and

clinical impacts remain largely unknown. Future research in viral hepatic diseases of poultry is warranted to

develop speci�c diagnostic assays, identify suitable cell culture systems for virus propagation, and develop

effective vaccines. Key Words/Index Terms Avian hepatitis E (avian HEV); Duck hepatitis B virus (DHBV); Duck

hepatitis virus type 2 (DAstV-1, DAstV-2); Duck hepatitis A (DHAV); Fowl Adenovirus (FAdV); Turkey hepatitis

virus (THV) Introduction Viral hepatitis in poultry is an important disease syndrome caused by a number of

viruses including avian hepatitis E virus (avian HEV),

duck hepatitis B virus (DBHV), duck hepatitis A virus (DHAV), duck hepatitis virus

types 2 and type 3, fowl adenoviruses, and Turkey hepatitis virus. While these avian hepatitis viruses have the

same target organ, the liver, they are very different in virus biology and pathogenesis as each of these viruses

belongs to a different family. Therefore, understanding the common and unique features of these hepatitis

viruses in poultry will aid the diagnosis and differential diagnosis of viral hepatitis in poultry and help develop

more effective �ock management, preventive and control measures. Avian Hepatitis E Virus (Avian HEV)

History: A disease,

referred to as Big Liver and Spleen (BLS) Disease

(1, 2), was �rst reported in chickens in Australia (3). The estimated impact of BLS on Australia chicken

producers was a loss of 8 eggs per hen in affected broiler-breeder �ocks leading to a total 2.8 million

Australian dollar loss to the industry and nearly 50% of all �ocks affected. A similar disease, referred to as

Hepatitis-Splenomegaly (HS) syndrome, was also reported in layer and broiler- breeder chickens in the United

States and Canada in 1991(1, 2). The disease presented as a decrease in overall mortality and egg production,

while �eld veterinarians reported serosanguinous abdominal �uid or clotted blood in the abdomen and

enlarged livers and spleens at necropsy (3). Initially, attempts to link the syndrome to any speci�c agent were

unsuccessful (3-5) and only one outbreak was able to be linked to a strain of Campylobacter spp (3).

Avian hepatitis E virus (avian HEV) was �rst identi�ed from chickens with HS syndrome in the United

States



in 2001 (1). HS syndrome and BLS are caused by variants of the same avian HEV (1, 2, 6, 7). Classi�cation: The

BLS virus from Australia shares approximately 80% of nucleotide sequence identity with avian HEV from HS

syndrome (2, 6), while all known strains of avian HEV worldwide share approximately 60% of nucleotide

sequence identity and are divided into three separate genotypes (genotypes 1-3) (6). A recent ICTV proposal

includes division of the HEV strains among three genera: Orthohepevirus A which includes all genotypes 1-4

strains that infect humans, camels, wild boars, deer, rabbits, rats, and mongooses, Orthohepevirus B including

all avian HEV strains, Orthohepevirus C consisting of all ferret and most rat HEV strains, Orthohepevirus D

including variants of bat HEV strains, and Piscihepevirus including all strains of cutthroat trout hepeviruses (8).

Seroprevalence and transmission: Chickens are the only known reservoir for avian HEV infection under natural

conditions. Approximately 71% of chicken �ocks within the United States are seropositive to avian HEV based

on a survey of 1,276 chickens from 76 �ocks within �ve states (7). The virus appears to spread easily within

and between �ocks via the fecal-oral route of transmission (3). In an age-dependent manner, 17% of young

chickens (under 18 weeks of age) are positive for anti-HEV antibodies, while 36% of adult chickens are

seropositive (7, 9). Avian HEV infections in chickens have been described throughout the United States (1, 9,

10), Canada (7, 11), the United Kingdom (12), Australia (13), Taiwan, China (14), and Russia (15). Caged

leghorn chickens are frequently affected with reoccurrence on many farms due to circulation of the virus within

the �ock (5, 15). Broiler breeder hens, dual-purpose hens, and smaller �ocks may be infected by avian HEV with

sporadic mortality especially when housed on litter allowing for the accumulation and ease of transmission

between birds (7). In a prospective transmission study monitoring 14 seronegative chickens beginning at 12

weeks of age, all birds seroconverted to anti- HEV antibodies by 21 weeks of age (9).

Large amounts of virus are shed in feces of chickens infected

experimentally by avian HEV; therefore, feces likely serve as the main source for virus spread within the �ock

(3, 16). Other routes of transmission including aerosol, vertical, vector- borne, or mechanical carrier have not

been demonstrated in natural or experimental avian models (16). Clinical signs and pathobiology: The

mortality rate for chickens infected with avian HEV genotypes 1-3 ranges from 0.3% to 1.0% of the overall �ock

(3); therefore, many birds carry subclinical avian HEV infections, thus expediting and masking transmission

between birds. Few birds show clinical signs prior to acute death (3-5, 7, 9); however, egg drop with up to 20%

of hens presenting with reduced production and hepato-splenomegaly are described in some outbreaks (5),

while others do not appear to affect overall production. The incubation period ranges between 1-3 weeks in

birds infected via oronasal route in an experimental setting (17). In the �eld, broiler breeder and laying hens

experience the highest incidence of mortality at ages 30-72 weeks, with mortality typically lasting several

weeks during the mid-production period for these �ocks (7, 16, 18, 19). Clinical signs in BLSV-infected �ocks in

Australia have more severe infections with birds presenting with pale wattles and combs, pasty droppings,

soiled vents, anorexia, depression, and elevations in egg drop and mortality for 3-4 weeks (3, 5, 18-20). While

the eggs produced in infected chickens retain commercial value based on comparable quality, fertility, and

hatchability, the shells themselves are lacking pigment and thin (3). The appearance of IgG antibodies



following avian HEV infection characterizes the humoral immune response in chickens (17, 21), while

knowledge is lacking as to the cell-mediated immune response. Following inoculation via intravenous or

oronasal route, chickens seroconvert between 1-4 weeks post-infection (21). The capsid protein (ORF2) of

avian HEV shares conserved antigenic epitopes with swine and human HEV capsids and elicits a protective

immune response against avian HEV infection (22). In vitro analysis of recombinant HEV capsid proteins

demonstrates cross-reactivity between avian HEV capsid and antisera raised against human HEV (Sar-55

genotype 3 strain), swine HEV (Meng strain), and human HEV (US-2 genotype 2 strain) (22-24). Clinico-

pathological parameters of liver disease including elevations in aspartate aminotransferase (AST),

albumin/globulin (A/G) ratios, or bile acids are not present in chickens experimentally infected with avian HEV;

however, lactate dehydrogenase (LDH) levels varied with progression of virus infection with intravenously-

infected chickens exhibiting peak LDH levels one week post-infection (wpi), and oronasally-infected chickens

exhibiting peak LDH elevations from 1-4 and 6 wpi prior to returning to baseline level by 7 wpi (17). At necropsy,

birds infected with avian HEV display regressed ovaries, enlarged, hemorrhagic, friable, and necrotic livers with

subcapsular or capsular hematomas (Fig. 1), enlarged spleens, and serosanguinous �uid within the abdominal

cavity (1, 3, 7, 21). Experimental avian HEV infections in chickens display similar gross lesions at necropsy with

nearly 25% presenting with enlarged hemorrhagic livers (17). Microscopic evaluations of natural and

experimental infections in chickens consistently show in�ammatory cellular in�ltrations within the parenchyma

of the liver and a lymphocytic periphlebitis and phlebitis in the liver (17). Lesions vary from multifocal to

extensive areas of necrosis, hemorrhage, heterophillic and mononuclear in�ammatory in�ltrates as well as

segmental lymphocytic and plasma cell in�ltrates around the portal veins. Commonly, hepatocytes are

separated by interstitial accumulation of eosinophillic amyloid deposits (4, 17). The pathogenesis of avian HEV

in chickens remains mostly unknown. Presumably, the virus enters the host by direct contact with

contaminated feces via oronasal inoculation and travels to the gastrointestinal tissues where virus replication

takes place as the primary site (17, 25). The detection of avian HEV in experimentally infected chickens in the

colon, cecum as early as 5 days post-infection (dpi), jejunum by 20 dpi, ileum by 7 dpi, duodenum by 20 dpi,

and cecal tonsils by 35 dpi further con�rms a gastrointestinal site of primary virus replication. Following entry

and replication in the GI tissues, the virus travels to the liver as a secondary site of virus replication based on

experimental infections of mammalian HEV in primates and swine, and is released from hepatocytes into the

gallbladder (26). The gallbladder expels contents containing infectious avian HEV particles during normal

digestion into the small intestines where the virus is capable of traveling throughout to �nally be expelled in

excrement into the environment. The exact mechanisms of avian HEV replication and release remain largely

unknown however, and studies thus far rely solely upon the ability to detect infectious virus as con�rmation of

virus replication (16, 27). Understanding the importance of these extrahepatic sites of virus replication and

their roles in transmission are crucial in understanding and diminishing the spread of virus. Cross-species

infection: Avian HEV is limited to chickens under �eld conditions; however, turkeys were successfully infected

with avian HEV under experimental conditions as evidenced by seroconversion to anti-HEV antibodies, fecal

virus shedding, and viremia (21). The inoculated turkeys seroconverted at 4-6 wpi with viremia detectable by 2-



6 weeks. In addition, contact between control and infected turkeys allowed for transmission of the virus

indicating the ease of transmission in birds (21). Subsequent

attempts to infect mice (3) and rhesus macaques with avian HEV (28) were unsuccessful.

Experimentally, all ages of chickens are susceptible to infection with avian HEV by intravenous and oronasal

routes of inoculation (17, 21, 29). Embryonic chicken eggs; however, were only susceptible to avian HEV

infection when inoculated intravenously (30). Prevention and control: A vaccine against avian HEV is not yet

available. Avian HEV capsid protein has been used to induce protective immunity when challenged with avian

HEV in chickens (23). Chickens immunized with keyhole limpet hemocyanin-conjugated avian HEV capsid

(KLH) peptides did not induce protection when challenged with avian HEV (31). However, chickens immunized

with recombinant avian HEV capsid antigens had complete protection against avian HEV challenge. Identifying

speci�c B-cell epitopes within avian HEV capsid protein is useful in future vaccine design and development of

diagnostic immunoassays (24). In the lack of a vaccine, strict biosecurity and better hygiene practices on the

farm help prevent the spread of avian HEV infection in �ocks. Unanswered questions and future prospective:

Even though avian HEV was discovered more than a decade ago, there remain many unanswered questions.

Due to the lack of a cell culture system to propagate avian HEV, the biology and pathogenesis of

the virus are still poorly understood. The lack of a cell culture system signi�cantly hinders the development of

an effective and practical vaccine against avian HEV. The extent of infection and genetic variations of avian

HEV from chickens worldwide are also unknown, as thus far only three genotypes were identi�ed from

chickens in just a few countries. Although most avian HEV infections are subclinical, the effect of co-infection

between avian HEV and other poultry pathogens on disease manifestation is unknown. A commercial

diagnostic assay for avian HEV is still lacking, even though homemade RT-PCR and ELISA assays have been

used for research purpose. Future research is warranted to identify suitable cell culture systems that can

e�ciently propagate avian HEV, to develop avian HEV-speci�c diagnostic assays, to understand the effect of

avian HEV co-infection with other agents in chicken �ocks, and to develop an effective vaccine against avian

HEV.

Duck Hepatitis B Virus (DHBV) History: Following the discovery of human hepatitis B virus

(HBV) in 1970 (32) and subsequent discovery of HBV-like viruses in numerous primate species (33-36) and

non-primate species (37-39), the �rst Avihepadnavirus was identi�ed in Pekin ducks (Anas platyrhynchos

forma domestica) in 1980 (40, 41). Avihepadnaviruses have now been isolated from snow geese (Anser

caerulescens) (42), white storks (Ciconia ciconia) (43), grey herons (Ardea cinerea) (44), cranes (Grus genus)

(45), and parrots (Psittacula krameri) (46). The virus is detectable in many commercially bred �ocks. The

narrow host range of Avihepadnaviruses limits virus infection to each respective species with little cross-

species infectivity including in chickens or other Anseriformes such as Muscovy ducks (Cairina moschata)

(47). Except in cases in which a�atoxin carcinogens are present, Duck hepatitis B virus (DHBV) does not induce



clinical signs of pathogenicity and only rarely progress into chronicity and liver cancer (48); therefore, the virus

is assumed to have evolved with the host as a noncytopathic form (49). Classi�cation: Hepadnaviridae family

consists of Orthohepadnavirus and Avihepadnavirus genera for those viruses infecting mammals and birds,

respectively (50). Aviahepadnaviruses include

duck hepatitis B (DHBV) (41), heron hepatitis B (HHBV) (44), Ross goose hepatitis (RGHV) (42),

stork hepatitis B

(STHBV) (43), and parrot hepatitis B (PHBV) (46) viruses. DHBV is the most characterized virus of the genera

and shares approximately 40% nucleotide sequence identity with human HBV (50). Orthohepadnaviruses

include human HBV, non-human primate hepatitis viruses such as chimpanzee (ChHBV) (34), gorilla (GoHBV)

(51), orangutan (OuHBV) (52), woolly monkey (WMHBV) (33, 36), and gibbon (GiHBV) (53), rodent hepatitis

viruses such as ground squirrel (GSHV) (39), arctic squirrel (ASHV) (38), and woodchuck (WHV) (37), as well

as bat hepadnavirus from Burmese bats (BtHV) (54). All 10 genotypes (A-J) of human HBV varied with more

than 8% nucleotide sequence diversity (50, 55). The non-human primate strains carry 7-9% divergence (50) and

form geographical clusters (56), while sequence divergence with human HBV strains ranges from 10-15% for

most strains aside from WMHBV, which carries 28% nucleotide sequence diversity with other primate strains

(36). Non-primate strains of HBV constitute a separate species of Orthohepadnavirus with sequence identities

varying by 53% for BtHV, 37% for ASHV, 45% for GSHV, and 30% for WHV (50) with human HBV. Clinical signs

and pathobiology: The pathogenesis of DHBV in ducks mimics human HBV infections with an ability to lead to

an acute and transient infection or a chronic infection. Young ducks develop an age-dependent and dose-

dependent predisposition to carrying a persistent infection, while older ducks tend to clear the virus infection

transiently (57). Natural infection of DHBV occurs by

vertical transmission from an infected hen to the embryonic eggs through the bloodstream and

subsequent infection of embryonic hepatocytes at day 6 of development resulting in infected offspring (58).

Viral replication occurs in the yolk sac and developing embryonic hepatocytes resulting in a congenital

infection (58, 59) followed by continued virus replication in the hepatocytes and a small percentage in

pancreatic, kidney, and splenic cells (60) of infected ducks and geese with a very high serum viral titer (1010

virions or 1013 viral particles per ml) when persistent infection is established (49, 61). Additionally, it has been

shown that only one genome copy of the virus is needed to successfully infect a duckling and spread to nearly

full hepatocyte infection within 14 days post-inoculation (62). Chinese domestic ducks, American Pekin ducks,

and a few geese species are infected with DHBV with poor e�ciency outside the narrow host range (63).

Hepadnaviruses are cell type- and host-speci�c allowing for infections in only a few closely related species.

Infected adult ducks face a far different outcome by carrying a transient acute infection that is cleared by

neutralizing antibodies. These outcomes mimic the range of human HBV infections with neonates resulting in

persistent infections, adults resulting in transient infections, and those persistently infected resulting in varying

degrees of severity from mild chronic hepatitis to a chronic active hepatitis, liver cirrhosis, and hepatocellular



carcinoma (60). The outcome for DHBV infection varies based on the host’s ability to elicit an immune

response. Variability in non-cytopathic viruses include the dose of inoculum, viral replication, and cell, tissue,

and host tropism being balanced with the humoral and cell-mediated immunity of the host (60, 64). It has been

suggested that the number of lymphoid cells present or the overall maturity of the immune system affects the

ability to elicit a virus-clearing immune response resulting in the disparity seen between neonates and adults

infected with DHBV (60). The age of the duck with neonates primarily being persistently infected with DHBV

and the dose of inoculum resulting in a more severe infection consistently supports this theory (57, 59). In

young ducks inoculated experimentally with DHBV, persistent infection is evidenced by a mild mononuclear

cellular in�ltration within the portal tracts of the liver, but no lobular hepatitis (57). In one study, goose and duck

embryos exhibited mononuclear and heterophillic cell in�ltrations perivascularly without severe in�ammation

(65). GHBV-infected goose embryos predominantly exhibited hepatic bile ductular cell proliferation and varying

degrees of hepatocellular vacuolization. Adult ducks experimentally infected with DHBV clear the infection

without pathological changes in most cases. However, in one study, one out of �ve adult ducks developed

severe chronic hepatitis and a prolonged infection (57). DHBV results in little clinical disease or lesions for

congenitally infected or acute experimentally infected birds (65), unlike its mammalian counterparts.

Hepatocellular carcinoma as an outcome has not been established with congenital or experimental DHBV

infections in ducks, likely due to the short lifespan and period of 25-30 years required for adequate chronic

in�ammation, cell regeneration, cirrhosis, and �nally HCC in humans (60). In ducks infected with DHBV, anti-

DHBV surface antibodies are detectable by 17 days post-inoculation (dpi). By 40 dpi, serum containing DHBV

antibodies was capable of neutralizing DHBV infections in 1-day-old ducklings (66, 67). In addition, ducks

ranging from 3-8 weeks of age were seropositive for anti-DHBV antibodies in 20-40% of cases (68). Anti-DBHV

core antibodies are present in the sera of persistently infected ducklings by 7-10 dpi; however, there is no

clearance of virus infection, and anti-DBHV surface antibodies fail to develop (57). Increasing dosages of

inoculum in 4 month-old ducks both increased the levels of detectable antibodies with a correlative level of

infection of the liver as well as shortening the time to serum antibody appearance (57). DHBV and WHV

infections lead to >95% of hepatocytes participating in viral replication, and clearance occurred coincidentally

with anti-viral surface antibody increases in the serum (57, 69). In both cases, only minimal cellular in�ltration

and liver enzyme elevations were observed. IgM antibodies predominate early in the immune response with a

switch to two distinct forms of IgY later in the response. Likewise, a cell-mediated immune response

speci�cally by cytotoxic T-cells is necessary for complete viral clearance during persistent DHBV infection (60).

In studies completed in transgenic mice, HBV-speci�c CTLs lead to apoptosis of hepatocytes leading to

clearance of cells expressing HBV antigens (70). Non-cytolytic mechanisms of viral clearance likely play a role

with HBV infections as well. In HBV transgenic mice, IFN-γ and TNF- α secretions were capable of suppressing

HBV surface antigens in hepatocytes (71). Previously, HBV mRNA expression was hampered by IFN-γ and TNF-

α in transgenic mice (70, 71). Cross-species infection: Hepadnaviruses are generally considered as host

speci�c; however, it is well established that recombination occurs between genotypes of human HBV (72) as

well as between human and ape and different non-human primate variants (73). Much like mammalian



hepadnaviruses, the avihepadnaviruses also infect a narrow host range. DHBV is not able to infect the

Muscovy duck or chickens and remains limited in susceptibility to only a few species of ducks or geese (47).

CHBV (crane) is capable of infecting primary duck hepatocytes (45), although the full clinical spectrum of

infection in ducks in vivo and the ability to establish chronicity are uncertain (63). HHBV (grey heron) only

ine�ciently infects primary duck hepatocytes (PDHs) in vitro and does not infect ducks in vivo (44). Alterations

in the

HHBV- speci�c preS domain of the large envelope protein (L protein) with the appropriate

sequence from DHBV

allows for e�cient infection of PDHs by HHBV due to conservation of the biological function of this region (63,

74). The same was shown to be true for woolly monkey hepatitis B virus for use in infecting human

hepatocytes (63, 75). Evidence is lacking for zoonotic transmission of avihepadnaviruses to humans.

Experimental animal models for human HBV: DHBV as a model system for the study of human HBV is well

established and particularly advantageous due to the ability to reproduce infection in ducks and the use of

PDHs for both in vitro and in vivo molecular studies. HBV and DHBV share many characteristics including

being partially double-stranded DNA viruses that use an RNA intermediate with reverse transcription as a

replication strategy (76, 77), overlapping open reading frames (ORFs) in viral DNA genomes (63), infections

primarily occurring in hepatocytes, and extensive similarities in genomic organization, biological

characteristics, and virus replication life cycles. The clinical syndrome between ducks and humans infected

with HBV varies considerably however, with ducks exhibiting no clinical signs and remaining healthy despite

establishing a chronic persistent virus infection and transmission to subsequent progeny, while in humans liver

injury and either hepatocellular carcinoma or cirrhosis of the liver ensues due to chronic HBV infection (63).

Adult birds infected with DHBV also clear the virus with no outward signs of infection or long-lasting effects,

while humans develop acute or fulminant hepatitis without elimination. Due to the ability to transfect

cloned DHBV into a chicken hepatoma cell line (LMH) (78), mutations

to the genome regarding replication strategies, host tropism, treatments, and vaccination strategies can now

be studied (63) using the duck model for human HBV infections. Unanswered questions and future

prospective: Despite providing a valuable model for the study of human HBV infection, DBHV infections in

ducks are unable to reproduce all aspects of infection and pathogenesis including the typical clinical

syndrome, immunopathology, and progression to chronic infection and hepatocellular carcinoma. The

mechanisms underlying chronic infections are poorly understood and necessary in order to devise future

antiviral therapies to ameliorate infections. In addition, the natural course of virus infection characterized by

cyclical clearance and reinfection paired with individualistic immune responses to infection complicates our

understanding of the pathogenesis and leads to vast differences in therapeutic responses. The effect of a co-

infection between DHBV and other pathogens is not understood and long-term treatment strategies cannot be

replicated in the duck model for use in human HBV patients. Thus far, very little research has focused on HBV



within each avian species nor the interaction and opportunity for cross-species infection. The variable clinical

pathology and disease syndrome of HBV in domestic and wild birds warrants further investigation. Lastly, the

potential for cross- species infection by hepadnaviruses between humans and mammalian and avian species

highlights the need for additional research and surveillance in this poorly understood arena.

Duck Hepatitis A Virus (DHAV-1, DHAV-2, and DHAV-3) DHAV classi�cation and

characteristics: DHAV is

a member of the Picornaviridae family in a new genus Avihepatovirus

as classi�ed by ICTV and is referred to as “duck virus hepatitis A” informally. This new genus contains all three

serotypes of

duck hepatitis A virus, namely DHAV-1, DHAV-2 from Taiwan, and DHAV-3 from South Korea and

China (79-82). Recently, novel picornaviruses have also been identi�ed in turkeys (avisivirus A, AsV-A) (83) and

ducks (84) that are genetically and antigenically related to DHAV. DHAV is a typical picornavirus as a single-

stranded, non-enveloped, positive-sense, and polyadenylated RNA virus with a genome consisting of one single

ORF encoding a polyprotein �anked by 5’ and 3’ untranslated regions (UTRs). Clinical signs and pathobiology:

DHAV-1 is a highly contagious virus in ducks associated with diseases in mallard, Pekin, and Muscovy species

(85). In natural infection, young ducklings of 6 weeks of age and younger present with lethargy, ataxia,

opisthotonos, and a very rapid death, often taking as little as 1-2 hours (86). Due to the high morbidity within a

�ock of up to 100%, the vast majority of ducklings will be affected with �ock mortality of 95-100% occurring

within 3-4 days but older birds are not affected (87). At necropsy, the liver is typically enlarged with petechial

and ecchymotic hemorrhages throughout (Fig. 2). Microscopic lesions in the liver include extensive hepatocyte

necrosis (Fig. 3), bile duct hyperplasia, hemorrhages, and in�ammatory cell in�ltrations dispersed throughout

(88). The spleen and kidneys often swell with congestion of the blood vessels often apparent. The clinical and

pathological lesions are characteristic for DHAV-1 infections and with little information on

DHAV-2 and DHAV-3 infections, the clinical presentation for DHAV-

2 and -3 is assumed similar (86). One study showed that DHAV-3 induced apoptosis and necrosis of multiple

organs including the liver, but the mechanism is not understood (88). While no public health signi�cance is

noted due to DHAV infections, economically, the highly lethal and rapidly spreading infection may affect

intensive duck production farming regions of the world (85). DHAV is controlled by vaccination of breeder

ducks with a live-attenuated virus in order to transfer maternal immunity to the hatched ducklings (86) with

protection waning over the �rst 2 weeks of life, but re-immunization with a live-attenuated vaccine at 7-10 days

of age allows for protection through the susceptible period (89). Hatchling ducks may also be immunized with

a live-attenuated vaccine that confers immunity within 48-72 hours lasting through the susceptible period (90)

or passive introduction of antibodies for short-lived immunity (86). DHAV diagnosis: Con�rmation of DHAV



infection is completed by recovery of virus from the liver of affected ducklings and inoculation of 1-7 day-old

naïve ducklings, 10-14 day-old embryonated duck eggs, or primary cultures of duck embryo liver cells (DEL)

(86). Ducklings follow a characteristic course of infection with death within 18-48 hours, duck embryos die

within 24-72 hours, and DEL cells develop a cytopathic effect characterized by rounding and necrosis of the

infected cells (86). Necropsy lesions in embryos follow the natural infection characteristics with stunting and

hemorrhaging of the entire body, subcutaneous edema of the abdomen and hind limbs, and focal necrosis of

the liver parenchyma. Neutralization assays (91-93) have been described for diagnosing DHAV-1 infections;

however they are not typically used as con�rmation, and diversity between DHAV isolates limits reactivity with

hyperimmune sera (93). Nucleic acid recognition techniques including reverse transcriptase PCR (80, 82, 94-

96)

and real time RT-PCR (97) have been described for the identi�cation of

the 3D gene of DHAV-1 and to identify genotypic variation among isolates. Unanswered questions and future

prospective: Despite the lack of public health signi�cance of DHAV-1, -2, and -3 infections, the economic

impact on duck production warrants further investigation into the mechanisms of pathogenesis and

immunopathology implicated in the infectious disease process. Speci�cally, the age-dependent differences in

clinical outcome and mortality between ducklings and adult ducks is of importance for management and

control of outbreaks within the �ock. Future research into the differences between genotypes of DHV type 1

and their interaction with one another within the host species will greatly enhance the ability to properly

diagnose and prevent outbreaks leading to less mortality within the �ock. The extent of infection and genetic

variation worldwide is currently unknown, in part due to the lack of a DHAV- speci�c assay outside of research

settings, which limits our full understanding of the economic impact as well as the impact of co-infections on

the production industry. Duck Hepatitis Virus (DHV II & III) DHV type 2 (DAstV-1, DAstV-2) classi�cation and

characteristics: DHV type II is an Astrovirus as classi�ed by ICTV and is referred to as duck Astrovirus type 1

(DAstV-1) (98). The electron microscopy morphology of DAstV-1 resembles that of a typical Astrovirus with 28-

30 nm in diameter (99).

Astroviruses are single-stranded, positive-sense, non-enveloped, RNA viruses with

three ORFs (1a, 1b, 2) and are capable of infecting numerous mammalian and avian hosts (100). DAstV-1 has

been identi�ed from ducks in the United Kingdom (101, 102) and recently in eastern China (103). DHV type III

(DAstV-2) is considered as genetically distinct (98, 104), while still a member of Astroviridae family. DAstV-2

has only been reported from ducks in the United States (105). Recently, DAstV-3 (106) and DAstV-4 (107), two

distinct astroviruses have been identi�ed in Pekin ducks, Shaoxing ducks and Landes geese and Pekin ducks

respectively. In another study reporting a novel isolate of DAstV in China, a phylogenetic analysis revealed a

stronger relationship with

turkey astrovirus (TAstV) type 2, TAstV-3 and TAstV/MN/01),



thus indicating the potential for cross species infection between astrovirus strains (108). More work is

warranted to fully understand these new isolates of astroviruses and their potential for cross species

transmission. Clinical signs and pathobiology: DAstV-1 causes an acute, fatal infection in ducklings typically

between the ages of 10 days to 6 weeks of age (99). Similarly, DAstV-2 causes an acute infection with losses

up to 20% of those immune to DHV type 1 (86, 105). The natural clinical infection is similar to DHAV in that

lethargy, ataxia, opisthotonos are commonly seen with a rapid decline to death within 1-2 hours (86, 101). Sick

ducklings may present with polydipsia prior to death as the only differentiating sign. At necropsy, ducks

present with splenomegaly, swollen pale kidneys with congested vessels, empty, mucous �lled alimentary

tracts with areas of hemorrhage, petechial hemorrhages in the heart, and petechial to diffusely con�uent

hemorrhages throughout the liver (99, 109). Microscopic changes are similar to those of DHAV with extensive

hepatocyte necrosis, bile duct hyperplasia, hemorrhages, and in�ammatory cell in�ltrations dispersed

throughout, but with a relative increase in bile duct hyperplasia noted (109). Under experimental �eld

conditions (110, 111), DAstV-1 may be protected with a live-attenuated vaccine; however, DAstV-2 infections

are routinely prevented with immunity transferred to hatching ducklings using a live-attenuated vaccine (86).

DAstV-1 and -2 diagnosis: Diagnosis of DAstV-1 infection is achieved by recovery of the virus from the livers of

affected ducklings and inoculation into susceptible ducklings or embryonated chicken or duck eggs resulting

in only a 20% mortality of ducks (101) and stunting of embryos with green necrotic livers after 6-10 days of

infection (109), which is in stark contrast with DHAV infections in which the mortality rate is much higher and

the progression of disease much faster. Neutralization assays for the identi�cation of virus as well as cross

protection tests (101) in ducklings in order to distinguish between DAstV types 1 and 2 have been described,

but neither are used routinely. Serological responses to infection are poor in ducklings and duck embryos, thus

rendering an immunological test not applicable. RT-PCR has been described for con�rmation that DAstV-1 is

indeed an astrovirus (104, 112); however, further analyses have not been completed. Diagnosis of DAstV-2

infections are achieved by the inoculation into susceptible ducklings or the

chorioallantoic membrane of 10-day-old embryonated duck eggs

resulting in a 20% mortality following 60% morbidity in ducklings and embryonic mortality in 7-10 days (86).

Much like DAstV-1 infections, embryos exhibit stunting, edema, and skin hemorrhages, but infection may also

result in enlargement of the kidneys, liver, and spleen (86). In cell culture, DAstV-1 is reportedly capable of

infecting primary chicken embryo liver cell lines with plaques formed at 5 dpi (113), while DAstV-2 is capable of

detection by immuno�ouorescence in infected DEL and duck embryo kidney (DEK) cultures (105). RT-PCR has

also been used to con�rm the identi�cation of DAstV-2 as a distinct astrovirus from DAstV-1 (104, 112).

Unanswered questions and future prospective: The mechanisms leading to pathogenesis and clinical disease

in ducks infected with DAstV-1 and -2 are poorly understood; therefore, hindering differentiation with other viral

hepatic diseases and limiting the ability to establish an e�cient diagnostic aid or practical vaccine. Recent

research on astroviruses in poultry primarily focuses on the identi�cation and phylogenetic analyses for the

purposes of understanding the ecology and evolution. Therefore, additional work is necessary to understand



the implications for disease development and pathogenesis. Given the recently reported variability of

astroviruses in poultry and the potential for cross-species infection and evolution, future research must aim to

focus on the signi�cance of each individual virus as well as co-infection potential in these commercial poultry

species. Fowl Adenoviruses (FAdV) Classi�cation: Inclusion Body Hepatitis (IBH) is caused by fowl

adenoviruses (FAdV) of the genus Aviadenovirus (Group I avian adenoviruses) (114).

Group II avian adenoviruses are the hemorrhagic enteritis (HE) virus of turkeys and marble

spleen disease (MSD) virus of pheasants,

both of which belong to the genus Siadenovirus. Duck adenovirus A causing egg drop syndrome (EDS) in laying

hens is a member of the genus Atadenovirus and designated as Group III avian adenovirus. Within the genus

Aviadenovirus, six species (FAdV A – E and goose adenovirus) and three tentative species (duck adenovirus B,

pigeon adenovirus and turkey adenovirus B) are recognized (114). Twelve serotypes can be distinguished

within FAdV A-E (115, 116). FAdVs causing IBH have predominantly been typed as fowl adenovirus D or E (115,

117). Transmission and prevalence: All FAdVs including those responsible for IBH are assumed to transmit

similarly. Horizontal transmission occurs mainly by the fecal-oral route (118). The virus is shed in the feces for

up to six weeks (119). Adenoviruses are very resistant in the environment, and therefore fomites contaminated

with feces are important in spreading virus. Airborne transmission is probable, since the virus can be re-

isolated from the trachea and experimental intratracheal infection or infection by eye drop was successful

(119). Vertical transmission is an important route of infection. Infected breeder hens shed virus in their eggs,

thus infecting their progeny, as early as one week after experimental infection for at least �ve weeks (120).

Several serotypes can be detected sequentially during the live time of a �ock or at the same time without

necessarily be correlated to disease (121, 122). In Canada, approximately 77% of 231 randomly selected broiler

�ocks had been exposed to FAdV, with approximately 39% positive for FAdV D or E viral DNA (123). Outbreaks

of IBH are often epidemic, such as those in the early 1970s in England (124) and Canada (125), and more

recently in Korea and Japan (126, 127). Clinical signs and pathobiology:

The clinical course of IBH varies depending on the virulence of the virus, the age

of the infected chickens and the presence of other pathogens, especially the immunosuppressive Chicken

Infectious Anemia Virus (CIAV) and Infectious Bursal Disease Virus (IBDV). IBH has been observed in vertically

infected chickens as young as �ve days with mortality up to 5% and was experimentally reproduced in one day

old SPF chickens who subsequently developed signs of the disease three days later (128). On the other hand,

FAdV was repeatedly isolated from layers and broiler breeders of up to 45 weeks of age having IBH (129).

Generally, older chickens seem to be less susceptible than younger ones. Mortalities after experimental

infection of 2 days old chickens were between 50% and 83%, depending on the infective dose and route of

infection, but only between 0% and 43% in 2 weeks old chickens (130). Co-infections with IBDV or CIAV

aggravate the disease, and it was even doubted that FAdV were primary pathogens for IBH during co-infection

(131). However, a high number of IBH cases was observed in New Zealand and Asia without the presence of



IBDV and CIAV, and there was no correlation between cases of IBH or FAdV antibodies, respectively, with

antibodies against IBDV and CIAV in Canada and Belgium (123, 132). Clinical signs of IBH are nonspeci�c;

chickens are depressed with ru�ed feathers and having watery droppings (133). After experimental oral or

ocular infection of chickens, deaths were observed between �ve and twelve days post-infection with varying

mortality (128, 134). Hepatic lesions are characterized by diffusely swollen, friable and pale liver (Fig. 4),

sometimes with necrotic or hemorrhagic foci (Fig. 5) (127, 128, 135). Jaundice, especially in recovering birds,

has also been described. Histological lesions are characterized by multifocal necrosis of hepatocytes and

acute hepatitis. The namesake intranuclear inclusion bodies are located in the nuclei of the hepatocytes (Fi. 6)

(134, 136, 137). Lesions in other organs have rarely been described. The mechanism of pathogenesis of IBH is

largely unknown. Cross species infection: Hepatitis with inclusion bodies caused by adenoviruses has been

described in pigeons, parrots, cockatiels, falcons as well as turkeys (138-141). However, in most cases with a

few exceptions, it is unclear if these viruses were FAdV or other adenoviruses. An adenovirus isolated from

various psittacine species all exhibiting hepatitis with inclusion bodies was shown to be similar to FAdV D

(138). Diagnosis: Diagnosis in acute cases is primarily based on pathological lesions with laboratory

con�rmation by detection of FAdV, which is also required for typing. Since FAdV are almost ubiquitous, mere

detection of FAdV does not prove the causal relationship with observed lesions. FAdV can be isolated in

embryonated chicken eggs as well as in cell culture (142, 143). Serological methods such as ELISAs, serum

neutralization test (SNT) and AGPT using anti-FAdV antisera can detect either all FAdV or only speci�c

serotypes, depending on the test (144, 145). Numerous PCR assays have been used to detect FAdV followed by

typing (146, 147). Liver samples generally yielded more positive results than fecal samples for the PCR assays.

Prevention and control: Autogenous vaccines against IBH-causing FAdV are used in some countries.

Furthermore, an inactivated vaccine against FAdV is commercially available in China, and a live vaccine is

available in Australia. Since IBH is of most concern in younger broilers, and maternal antibodies are capable to

protect progeny against IBH, broiler breeders are vaccinated with inactivated FAdV to induce maternal

antibodies, which are then passed on to their progeny (133). In Australia, a live FAdV E vaccine is used to

control IBH by vaccinating parent �ocks in order to protect the progeny since 1989 (148). However, in spite of

the vaccination, there are still sporadic outbreaks of IBH in Australia. Unanswered questions and future

perspectives: IBH is an old disease, but the increasing number of reported cases of IBH during the last �ve

years indicates a need for better means to control the disease. Currently there are very good tools in place to

diagnose the disease and type the causative viruses. However, there is a lack of understanding of the

pathogenesis and of virulence factors of the virus. Therefore, future research is necessary to delineate the

basis of viral pathogenesis and understand the structural and functional relationship of viral genes in order to

develop better vaccines. Turkey Hepatitis Virus (THV) Classi�cation: For a long time, a picornavirus had been

suspected as possible causative agent for Turkey Viral Hepatitis (TVH) (149-151). In 2011, a novel picornavirus

was identi�ed by pyrosequencing as the likely causative agent of TVH and tentatively named Turkey Hepatitis

Virus (THV) (152). Two strains of the novel picornavirus were identi�ed with a 96.8% amino acid and 89.9%

nucleotide sequence identities to each other. Phylogenetic analyses revealed that the novel picornavirus is



distinct from other known picornaviruses, including Avian Encephalomyelitis Virus (AEV) (152). Transmission:

Experimental infections using the oral, intravenous, intraperitoneal, intraocular, and intratracheal routes were

successful (149, 151-153). Since the virus is shed in the feces and very resistant to inactivation, it can be

assumed

that the fecal-oral route is the main route of transmission.

Since AEV is transmitted vertically, it is assumed that THV may also transmit vertically, although experimental

evidence of vertical transmission is still lacking thus far (154). The disease seems to be most prevalent in

winter, presumably due to the fact that cold weather favors the survival of the virus in the environment (154).

Clinical signs and pathobiology: Eleven of 17 THV cases in turkey �ocks had been diagnosed in �ocks younger

than �ve weeks, and only two in �ocks of 6-8 weeks of age (155). In a more recent study, TVH was observed in

turkey �ocks between 7 and 61 days old, with a median age of 28 days (154). Experimentally, the same virus

inoculum caused the disease in two days old turkeys but not in four weeks old turkeys, suggesting potential

age resistance against THV (150). In �eld cases, however, there was no correlation between the age of

diseased �ocks and the presence of gross lesions in the liver, and also the disease was experimentally

reproduced in turkeys as old as eleven weeks in one study (154, 155). Under experimental conditions, clinical

signs or mortality are lacking in infected birds, even though the infected birds at necropsies had pathological

lesions (149-151, 155). Under �eld conditions, mortality was reported to be 1-25% in the late 1950s and early

1960s (155), and 0.03-5% daily mortality in the 2000’s (154). Other diseases were frequently observed in

addition to TVH. Whitish or tan foci in livers of affected birds are typical TVH gross lesions (Fig, 7) at post

mortem (149, 151, 155, 156). However, analysis of 76 cases, in which TVH was diagnosed mainly based on

histopathological lesions, showed that whitish or tan foci were only present in 46% of cases. In 28% of the

cases, gross lesions were not present in the liver, while in the rest of cases, dark, congested, enlarged or

greenish livers were observed (154). Histopathological liver lesions include mostly coagulative necrosis of

hepatocytes and different stages of in�ammation characterized by an in�ux of mononuclear in�ammatory

cells primarily composed of lymphocytes, macrophages and a few plasma cells and heterophils. Sometimes in

subacute or chronic cases multifocal hepatitis without necrosis is present. Other hepatic lesions which have

been described include biliary hyperplasia and the presence of giant cells or syncytia as well as vacuolation of

hepatocytes (149, 151, 154-156). In addition to liver lesions, pale patchy areas in the pancreas (Fig. 8)

characterized by focal necrosis of acinar cells with different stages of in�ammation were also observed. .

Gross lesions in the pancreas were observed in 28% of cases and histopathological lesions in 46% of cases

(154). Virus was re-isolated from liver, bile, feces, kidney, spleen and blood of experimentally-infected birds.

THV genome was detected by PCR in liver, pancreas, intestines, feces and serum of naturally-infected birds

(152, 155). It has been speculated that, after fecal-oral transmission, THV initially replicates in the intestine,

subsequently the birds become then viremic, and the virus eventually localizes in the liver and pancreas

causing lesions in these organs (154). Diagnosis: Until recently, diagnosis was based mainly on the

identi�cation of gross and characteristic histopathological lesions. The causative agent, assumed to be THV,



can be isolated in the yolk sac of embryonated chicken eggs causing high mortality of the embryos. The virus

does not multiply after inoculation into the allantoic sac (156). More recently, a PCR assay and

in situ hybridization have been reported for the detection of

THV (152). Transmission electron microscopy can also be used to detect the virus with a low sensitivity.

Immunhistochemistry using convalescent sera from naturally infected turkeys can detect virus antigen in livers

of diseased poults (152). Unanswered questions and future perspectives: Currently there are more questions

than answers about TVH, despite the fact that the disease was �rst described more than �ve decades ago.

While there is a strong evidence that THV is the causative agent of TVH, the Koch postulates have not been

ful�lled yet. The pathogenesis is unknown, the described syncytia in the liver require further study as there

does not seem to be a relationship between a picornavirus and syncytia yet. It remains to be explored if TVH is

in any way related to poult enteritis. Since the signs of TVH are subtle and can be easily missed, it is unknown

how prevalent TVH and THV are. Lesions in the liver are also of nonspeci�c etiology and can be easily

confused with bacterial infections, Ascarid larval migration and occasionally with histomonosis. THV-speci�c

PCR and serology would certainly aid in diagnosis. The identi�cation of two different strains in California and

of a related strain in Hungary, which was associated with enteric disease, also raises the possibility that variant

strains or genotypes may exist. Only when these questions are answered, the economic impact of TVH can

then be more accurately assessed.

References 1. Haqshenas, G., H. Shivaprasad, P. Woolcock, D. Read, and X.J. Meng Genetic

identi�cation and characterization of a novel virus related to human hepatitis E virus from chickens with

hepatitis-splenomegaly syndrome in the United States.

The Journal of general virology 82:2449-2462. 2001. 2. Payne, C.J., T.M. Ellis, S.L. Plant, A.R. Gregory, and G.E.

Wilcox Sequence data suggests big liver and spleen disease virus (BLSV) is genetically related to hepatitis E

virus. Veterinary microbiology 68:119-125. 1999. 3. Meng, X.J., H. Shivaprasad, and C.J. Payne Hepatitis E

Virus infections.

In: Diseases of Poultry, 13th ed. Y.M. Saif, A.M. Fadly, J.R. Glisson, L.R. McDougald, L .K. Nolan and

D.E. Swayne, eds. Blackwell Publishing Press, Ames, Iowa. pp 443-452. 2008.

4. Tablante, N.L., J.P. Vaillancourt, and R.J. Julian Necrotic, haemorrhagic, hepatomegalic hepatitis associated

with vasculitis and amyloidosis in commercial laying hens. Avian pathology : journal of the W.V.P.A 23:725-732.

1994. 5. Ritchie, S.J., and C. Riddell British Columbia. "Hepatitis-splenomegaly"

syndrome in commercial egg laying hens. The Canadian veterinary journal.

La revue veterinaire canadienne 32:500-501. 1991. 6. Marek, A., I. Bilic, I. Proko�eva, and M. Hess Phylogenetic

analysis of avian hepatitis E virus samples from European and Australian chicken �ocks supports the

existence of a different genus within the Hepeviridae comprising at least three different genotypes. Veterinary



microbiology 145:54-61. 2010. 7. Huang, F., G. Haqshenas, H. Shivaprasad, D. Guenette, P. Woolcock, C. Larsen,

F. Pierson, F. Elvinger, T. Toth, and X. Meng Heterogeneity and seroprevalence of a newly identi�ed avian

hepatitis e virus from chickens in the United States. Journal of clinical microbiology 40:4197-4202. 2002. 8.

Smith, D.B., P. Simmonds, G. members of the International Committee on the Taxonomy of Viruses

Hepeviridae Study, S. Jameel, S. U. Emerson, T.J. Harrison, X .J. Meng, H. Okamoto, W

.H. Van der Poel, and M.A. Purdy Consensus proposals for classi�cation of the family Hepeviridae.

The Journal of general virology 96:1191-1192. 2015. 9. Sun, Z., C. Larsen, A. Dunlop, F. Huang, F. Pierson, T.

Toth, and X.J. Meng Genetic identi�cation of avian hepatitis E virus (HEV) from healthy chicken �ocks and

characterization of the capsid gene of 14 avian HEV isolates from chickens with hepatitis-splenomegaly

syndrome in different geographical regions of the United States. The Journal of general virology 85:693-700.

2004. 10. Huang, F.F., G. Haqshenas, H.L. Shivaprasad, D.K. Guenette, P.R. Woolcock, C.T. Larsen, F.W. Pierson,

F. Elvinger, T.E. Toth, and X.J. Meng Heterogeneity and seroprevalence of a newly identi�ed avian hepatitis e

virus from chickens in the United States. Journal of clinical microbiology 40:4197-4202. 2002. 11. Agunos,

A.C., D. Yoo, S.A. Youssef, D. Ran, B. Binnington, and D.B. Hunter

Avian hepatitis E virus in an outbreak of hepatitis--splenomegaly syndrome and fatty liver haemorrhage

syndrome in two �axseed-fed layer �ocks in Ontario.

Avian pathology : journal of the W.V.P.A 35:404-412. 2006. 12. Todd, D., K.A. Mawhinney, V.A. McAlinden, and

A.J. Douglas Development of an

enzyme-linked immunosorbent assay for the serological diagnosis of

big liver and spleen disease. Avian diseases 37:811-816. 1993. 13. Bilic, I., B. Jaskulska, A. Basic, C. Morrow,

and M. Hess Sequence analysis and comparison of avian hepatitis E viruses from Australia and Europe

indicate the existence of different genotypes. The Journal of general virology 90:863-873. 2009. 14. Zhang, W.,

Q. Shen, J. Mou, G. Gong, Z. Yang, L. Cui, J. Zhu, G. Ju, and X. Hua Hepatitis E virus infection among domestic

animals in eastern China. Zoonoses and public health 55:291-298. 2008. 15. Meng, X.J., D.A. Anderson, V.A.

Arankalle, S.U. Emerson, T.J. Harrison, S. Jameel, and H. Okamoto Hepeviridae. In:

Virus taxonomy: ninth report of the International Committee on Taxonomy of Viruses.

A.

King, M.J. Adams, E.B. Carstens and E.J. Lefkowitz, eds., London, United Kingdom. pp

1021-1028. 2012. 16. Meng, X.-J. From barnyard to food table: the omnipresence of hepatitis E virus and risk

for zoonotic infection and food safety. Virus research 161:23-30. 2011. 17. Billam, P., F. Huang, Z. Sun, F.

Pierson, R. Duncan, F. Elvinger, D. Guenette, T. Toth, and



X.J. Meng Systematic pathogenesis and replication of avian hepatitis E virus in speci�c- pathogen-free

adult chickens. Journal of virology 79:3429- 3437. 2005.

18. Handlinger, J.H., and W. Williams An egg drop associated with splenomegaly in broiler breeders. Avian

diseases 32:773-778. 1988. 19. Crerar, S.K., and G.M. Cross Epidemiological and clinical investigations into

big liver and spleen disease of broiler breeder hens. Australian veterinary journal 71:

410-413. 1994. 20.

Crerar, S.K., and G.M. Cross The experimental production of big liver and spleen disease in broiler

breeder hens. Australian veterinary journal 71:414-417.

1994. 21. Sun, Z.F., C.T. Larsen, F.F. Huang, P. Billam, F.W. Pierson, T.E. Toth, and X.J. Meng Generation and

infectivity titration of an infectious stock of avian hepatitis E virus (HEV) in chickens and cross-species

infection of turkeys with avian HEV. Journal of clinical microbiology 42:2658-2662. 2004. 22. Haqshenas, G.,

F.F. Huang, M. Fenaux, D.K. Guenette, F.W. Pierson, C.T. Larsen, H.L. Shivaprasad, T.E. Toth, and X.J. Meng The

putative capsid protein of the newly identi�ed avian hepatitis E virus shares antigenic epitopes with that of

swine and human hepatitis E viruses and chicken big liver and spleen disease virus. The Journal of general

virology 83:2201-2209. 2002. 23. Guo, H., E.M. Zhou, Z.F. Sun, and X.J. Meng

Protection of chickens against avian hepatitis E virus (avian HEV) infection by immunization with recombinant

avian HEV capsid protein. Vaccine

25:2892-2899. 2007. 24. Guo, H., E.M. Zhou, Z.F. Sun, X.J. Meng, and P.G. Halbur

Identi�cation of B-cell epitopes in the capsid protein of avian hepatitis E virus (avian HEV) that are common to

human and swine HEVs or unique to avian HEV.

The Journal of general virology 87:217-223. 2006. 25. Billam, P., F. Pierson, W. Li, T. LeRoith, R. Duncan, and X.

Meng Development and validation of a negative-strand-speci�c reverse transcription-PCR assay for detection

of a chicken strain of hepatitis E virus: identi�cation of nonliver replication sites. Journal of clinical

microbiology 46:2630-2634. 2008. 26. Williams, T.P., C. Kasorndorkbua, P.G. Halbur, G. Haqshenas, D.K.

Guenette, T.E. Toth, and X.J. Meng Evidence of extrahepatic sites of replication of the hepatitis E virus in a

swine model. Journal of clinical microbiology 39:3040-3046. 2001. 27.

Chandra, V., S. Taneja, M. Kalia, and S. Jameel Molecular biology and pathogenesis of hepatitis E

virus. Journal of biosciences 33:451-464. 2008.

28. Huang, F., Z. Sun, S. Emerson, R. Purcell, H. Shivaprasad, F. Pierson, T. Toth, and X.J. Meng

Determination and analysis of the complete genomic sequence of avian hepatitis E virus (avian HEV) and

attempts to infect rhesus monkeys with avian HEV.



The Journal of general virology 85:1609-1618. 2004. 29. Huang, F.F., F.W. Pierson, T.E. Toth, and X.J. Meng

Construction and characterization of infectious cDNA clones of a chicken strain of hepatitis E virus (HEV),

avian HEV. The Journal of general virology 86:2585-2593. 2005. 30. Payne,

C.J., S .L. Plant, T.M. Ellis, P.W. Hillier, and W. Hopkinson

The detection of the big liver and spleen agent in infected tissues via intravenous chick embryo inoculation.

Avian pathology : journal of the W.V.P.A 22:245-256. 1993. 31. Guo, H., E.M. Zhou, Z.F. Sun, and X.J. Meng

Immunodominant epitopes mapped by synthetic peptides on the capsid protein of avian hepatitis E virus are

non-protective. Viral Immunol 21:61-67. 2008.

32.

Dane, D.S., C.H. Cameron, and M. Briggs Virus-like particles in serum of patients with Australia-

antigen-associated hepatitis. Lancet 1:695-698. 1970. 33. Kock, J.,

M. Nassal, S. MacNelly, T.F. Baumert,

H.E. Blum, and F. von Weizsacker E�cient infection of primary tupaia hepatocytes with puri�ed human

and woolly monkey hepatitis B virus. Journal of virology 75:5084-

5089. 2001. 34. Will, H., R. Cattaneo, H.G. Koch, G. Darai, H. Schaller, H. Schellekens, P.M. van Eerd, and F.

Deinhardt

Cloned HBV DNA causes hepatitis in chimpanzees. Nature 299:740-

742. 1982. 35. Schultz, U.,

E. Grgacic, and M. Nassal Duck hepatitis B virus: an invaluable model system for HBV infection.

Advances in virus research 63:1-70.

2004. 36.

Lanford, R.E., D. Chavez, K.M. Brasky, R.B. Burns, 3rd, and R. Rico-Hesse Isolation of a hepadnavirus from

the woolly monkey, a New World primate.

Proceedings of the National Academy of Sciences of the United States of America 95:5757-

5761. 1998. 37. Summers, J., J.M. Smolec, and R. Snyder

A virus similar to human hepatitis B virus associated with hepatitis and hepatoma in woodchucks.

Proceedings of the National Academy of Sciences of the United States of America 75:4533-

4537. 1978. 38.



Testut, P., C.A. Renard, O. Terradillos, L. Vitvitski-Trepo, F. Tekaia, C. Degott, J. Blake, B. Boyer, and M.A.

Buendia A new hepadnavirus endemic in arctic ground squirrels in Alaska. Journal of virology 70:

4210-4219. 1996. 39.

Marion, P.L., L.S. Oshiro, D.C. Regnery, G.H. Scullard, and W.S. Robinson A virus in Beechey ground squirrels

that is related to hepatitis B virus of

humans. Proceedings of the National Academy of Sciences of the United States of America 77:2941-

2945. 1980. 40.

Mason, W.S., M.S. Halpern, J.M. England, G. Seal, J. Egan, L. Coates, C. Aldrich, and J. Summers Experimental

transmission of duck hepatitis B virus. Virology 131:375-384.

1983. 41.

Mason, W.S., G. Seal, and J. Summers Virus of Pekin ducks with structural and biological relatedness to human

hepatitis B virus. Journal of virology 36:829-836.

1980. 42.

Chang, S.F., H.J. Netter, M. Bruns, R. Schneider, K. Frolich, and H. Will A new avian hepadnavirus infecting snow

geese (Anser caerulescens) produces a signi�cant fraction of virions containing single-stranded DNA. Virology

262:39-54.

1999. 43.

Pult, I., H.J. Netter, M. Bruns, A. Prassolov, H. Sirma, H. Hohenberg, S.F. Chang, K. Frolich, O. Krone, E.F. Kaleta,

and H. Will Identi�cation and analysis of a new hepadnavirus in white storks. Virology 289:114-128.

2001. 44.

Sprengel, R., E.F. Kaleta, and H. Will Isolation and characterization of a hepatitis B virus endemic in

herons. Journal of virology 62:3832-3839. 1988.

45. Prassolov,

A., H. Hohenberg, T. Kalinina, C. Schneider, L. Cova, O. Krone, K. Frolich, H. Will, and H. Sirma New hepatitis B

virus of cranes that has an unexpected broad host range. Journal of virology 77:1964-1976.

2003. 46.

Piasecki, T., B. Kurenbach, K. Chrzastek, K. Bednarek, S. Kraberger, D.P. Martin, and A.

Varsani Molecular characterisation of an avihepadnavirus isolated from Psittacula krameri (ring-necked parrot).

Archives of virology 157:585-590.



2012. 47.

Pugh, J.C., and H. Simmons Duck hepatitis B virus infection of Muscovy duck hepatocytes and nature of virus

resistance in vivo. Journal of virology 68:2487-2494. 1994.

48.

Cova, L., R. Mehrotra, C.P. Wild, S. Chutimataewin, S.F. Cao, A. Du�ot, M. Prave, S.Z. Yu, R. Montesano, and C.

Trepo Duck hepatitis B virus infection, a�atoxin B1 and liver cancer in domestic Chinese ducks. British journal

of cancer 69:104-109.

1994. 49.

Lenhoff, R.J., C.A. Luscombe, and J. Summers Competition in vivo between a cytopathic variant and a

wild-type duck hepatitis B virus. Virology 251:85-95.

1998. 50. Locarnini, S.,

M. Littlejohn, M.N. Aziz, and L. Yuen Possible origins and evolution of the hepatitis B virus (HBV). Seminars in

cancer biology

23:561-575. 2013. 51. Njouom, R., S.A. Mba, E. Nerrienet, Y. Foupouapouognigni, and D. Rousset

Detection and characterization of hepatitis B virus strains from wild-caught gorillas and chimpanzees in

Cameroon, Central Africa. Infection,

genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases

10:790-796. 2010. 52.

Warren, K.S., J.L. Heeney, R.A. Swan, Heriyanto, and E.J. Verschoor A new group of

hepadnaviruses naturally infecting orangutans (Pongo pygmaeus). Journal of virology 73:7860- 7865.

1999. 53.

Lanford, R.E., D. Chavez, R. Rico-Hesse, and A. Mootnick Hepadnavirus infection in captive

gibbons. Journal of virology 74:2955-2959.

2000. 54. He, B., Q. Fan, F. Yang, T. Hu, W. Qiu, Y. Feng, Z. Li, Y. Li, F. Zhang, H. Guo, X. Zou, and C. Tu Hepatitis

virus in long-�ngered bats, Myanmar. Emerging infectious diseases 19:638- 640. 2013. 55. Norder, H., A.M.

Courouce, and L.O. Magnius

Complete genomes, phylogenetic relatedness, and structural proteins of six strains of the hepatitis B virus, four

of which represent two new genotypes. Virology

198:489-503. 1994. 56.



Starkman, S.E., D.M. MacDonald, J.C. Lewis, E.C. Holmes, and P. Simmonds Geographic and species

association of hepatitis B virus genotypes in non-human primates. Virology 314:381-

393. 2003. 57.

Jilbert, A.R., J.A. Botten, D.S. Miller, E.M. Bertram, P. M. Hall, J. Kotlarski, and C.J. Burrell

Characterization of age- and dose-related outcomes of duck hepatitis B virus infection. Virology 244 :273-

282.

1998. 58. Urban, M.K., A.P. O'Connell, and W.T. London

Sequence of events in natural infection of Pekin duck embryos with duck hepatitis B virus. Journal of virology

55:16-22.

1985. 59.

Jilbert, A.R., T.T. Wu, J.M. England, P.M. Hall, N.Z. Carp, A.P. O'Connell, and W.S. Mason Rapid resolution of

duck hepatitis B virus infections occurs after massive hepatocellular involvement. Journal of virology

66:1377-1388.

1992. 60. Jilbert, A.R., and I. Kotlarski Immune responses to duck hepatitis B virus infection. Developmental

and comparative immunology 24:285-302. 2000. 61. Lenhoff, R.J., C.A. Luscombe, and J. Summers Acute liver

injury following infection with a cytopathic strain of duck hepatitis B virus. Hepatology 29:563-571. 1999. 62.

Jilbert, A.R., D.S. Miller, C.A. Scougall, H. Turnbull, and C.J. Burrell Kinetics of duck hepatitis B virus infection

following low dose virus inoculation: one virus DNA genome is infectious in neonatal ducks. Virology 226:338-

345.

1996. 63.

Funk, A., M. Mhamdi, H. Will, and H. Sirma Avian hepatitis B viruses: molecular and cellular

biology, phylogenesis, and host tropism. World

journal of gastroenterology : WJG 13:91-103. 2007. 64.

Zinkernagel, R.M. Immunology taught by viruses. Science 271:173-178. 1996. 65. Bidin, M.,

M. Tisljar, Z. Bidin, I. Lojkic, and D. Majnaric Genetic characterization of hepadnaviruses associated with

histopathological changes in the liver of duck and goose embryos. Veterinary microbiology 174:302-308. 2014.

66. Halpern, M.S., W.S. Mason, L. Coates, A.P. O'Connell, and J.M. England

Humoral immune responsiveness in duck hepatitis B virus-infected ducks. Journal of virology 61:916-920.

1987. 67. Vickery, K., J.S. Freiman, R.J. Dixon, R. Kearney, S. Murray, and Y.E. Cossart Immunity in Pekin ducks

experimentally and naturally



infected with duck hepatitis B virus. Journal of medical virology

28:231-236. 1989. 68.

Qiao, M., E.J. Gowans, S .E. Bailey, A.R. Jilbert, and C.J. Burrell Serological analysis of duck

hepatitis B virus infection. Virus research 17:3-

13. 1990. 69.

Kajino, K., A.R. Jilbert, J. Saputelli, C.E. Aldrich, J. Cullen, and W.S. Mason

Woodchuck hepatitis virus infections: very rapid recovery after a prolonged viremia and infection of virtually

every hepatocyte. Journal of virology 68:5792-5803.

1994. 70. Guidotti, L.G., K. Ando, M.V. Hobbs, T. Ishikawa, L. Runkel, R.D. Schreiber, and F.V. Chisari Cytotoxic T

lymphocytes inhibit hepatitis B virus gene expression by a noncytolytic mechanism

in transgenic mice. Proceedings of the National Academy of Sciences of the United States of America

91:3764-3768. 1994. 71. Guidotti, L.G., T. Ishikawa, M.V. Hobbs, B. Matzke, R. Schreiber, and F.V. Chisari

Intracellular inactivation of the hepatitis B virus by cytotoxic T lymphocytes. Immunity 4:25-36.

1996. 72. Shi, W., Z. Zhang, C. Ling, W. Zheng, C. Zhu, M.J. Carr, and D.G. Higgins Hepatitis B virus

subgenotyping: history, effects of recombination, misclassi�cations, and corrections.

Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious

diseases 16:355-361. 2013.

73. Bonvicino, C.R., M.A. Moreira, and M.A. Soares Hepatitis B virus lineages in mammalian hosts: potential for

bidirectional cross-species transmission. World journal of gastroenterology : WJG 20:7665-7674. 2014. 74.

Ishikawa, T., and D. Ganem The pre-S domain of the large viral envelope protein determines host range in avian

hepatitis B

viruses.

Proceedings of the National Academy of Sciences of the United States of America 92:

6259-6263. 1995. 75. Chouteau, P., J. Le Seyec,

I. Cannie, M. Nassal, C. Guguen-Guillouzo, and P. Gripon A short N-proximal region in the large envelope

protein harbors a determinant that contributes to the species speci�city of human hepatitis B virus. Journal

of virology 75:11565-

11572. 2001. 76.



Summers, J., and W.S. Mason Replication of the genome of a hepatitis B--like virus by reverse transcription of

an RNA intermediate. Cell 29:403-415.

1982. 77.

Wang, G.H., and C. Seeger The reverse transcriptase of hepatitis B virus acts as a protein primer for viral DNA

synthesis. Cell 71:663-670.

1992. 78.

Condreay, L.D., C.E. Aldrich, L. Coates, W.S. Mason, and T.T. Wu E�cient duck hepatitis B virus

production by an avian liver tumor cell line. Journal of virology 64:3249-3258.

1990. 79. Fu, Y., M. Pan, X. Wang, Y. Xu, H. Yang, and D. Zhang

Molecular detection and typing of duck hepatitis A virus directly from clinical specimens. Veterinary

microbiology 131:247- 257. 2008.

80.

Kim, M.C., Y.K. Kwon, S .J. Joh, S .J. Kim, C. Tolf, J.H. Kim, H.W. Sung, A.M.

Lindberg, and J.H. Kwon Recent Korean isolates of duck hepatitis virus reveal the presence of a new geno-

and serotype when compared to duck hepatitis virus type 1 type strains. Archives of virology 152:2059-2072.

2007. 81. Tseng, C.H., N.J. Knowles, and H.J. Tsai Molecular analysis of

duck hepatitis virus type 1 indicates that it should be assigned to a new genus. Virus research 123:190-

203.

2007. 82.

Kim, M.C., Y.K. Kwon, S .J. Joh, J.H. Kwon, and A.M. Lindberg Differential diagnosis between

type-speci�c duck hepatitis virus type 1 (DHV-1) and recent Korean DHV-1-like isolates using a multiplex

polymerase chain reaction. Avian

pathology : journal of the W.V.P.A 37:171-177. 2008. 83. Boros, A., C. Nemes, P. Pankovics, B. Kapusinszky, E.

Delwart, and G. Reuter

Genetic characterization of a novel picornavirus in turkeys (Meleagris gallopavo) distinct from turkey

galliviruses and megriviruses and distantly related to the members of the genus Avihepatovirus.

The Journal of general virology 94:1496-1509. 2013. 84. Wang, X., N. Liu, F. Wang, K. Ning, Y. Li, and D. Zhang

Genetic characterization of a novel duck-origin picornavirus with six 2A proteins. The Journal of general

virology 95:1289- 1296. 2014. 85.



Woolcock, P.R. Duck hepatitis. In: Diseases of Poultry, 11th ed. Y.M. Saif, Barnes, H.J., Glisson, J.R.,

Fadly, A.M., McDougald, L.R., & Swayne, D.E., ed. Iowa State Press, IA. pp 343- 354. 2003. 86. OIE

Duck Hepatitis Virus. In:

Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2015 (Terrestrial Manual),

7th ed. 2012. 87. Okda, F.A., S. Yassein, A.R. Ahmed, H. Soufy, and S.M. Nasr

Some Haematological and Biochemical Investigations on Duck Virus Hepatitis following Administration of

Glycyrrhizin. ISRN pharmacology 2013:

849412. 2013. 88. Zhang, H., J. Pi, C. Tang, H. Yue, and F. Yang

An experimental study of the pathogenicity of a duck hepatitis A virus genotype C isolate in speci�c pathogen

free ducklings.

Avian pathology : journal of the W.V.P.A 41:613-620. 2012. 89.

Hanson, L.E., and D.N. Tripathy Oral immunization of ducklings with attenuated duck hepatitis virus.

Developments in biological standardization 33:357-363.

1976. 90.

Crighton, G.W., and P.R. Woolcock Active immunisation of ducklings against duck virus hepatitis.

The Veterinary record 102:358-361.

1978. 91.

Chalmers, W.S., and P.R. Woolcock The effect of animal sera on duck hepatitis virus. Avian

pathology : journal of the W.V.P.A 13:727-732. 1984. 92. Woolcock, P.R., W.S. Chalmers, and D. Davis

A plaque assay for duck hepatitis virus. Avian pathology

: journal of the W.V.P.A 11:607-610. 1982. 93. Wu, X., X. Li, Q. Zhang, S. Wulin, X. Bai, T. Zhang, Y. Wang, M. Liu,

and Y. Zhang Identi�cation of a conserved B-cell epitope on duck hepatitis A type 1 virus VP1 protein. PloS one

10:e0118041. 2015. 94.

Anchun, C., W. Mingshu, X. Hongyi, Z. Dekang, L. Xinran, C. Haijuen, J. Renyong, and

Y. Miao

Development and application of a reverse transcriptase polymerase chain reaction to detect Chinese isolates of

duck hepatitis virus type 1. Journal of microbiological methods 77:332-336.

2009. 95.



Kim, M.C., Y.K. Kwon, S .J. Joh, J.H. Kwon, J.H. Kim, and S .J. Kim Development of one-

step reverse transcriptase-polymerase chain reaction to detect duck hepatitis virus type 1. Avian diseases

51:540-545.

2007. 96. Huang, Q., H. Yue, B. Zhang, P. Nie, and C. Tang

Development of a real-time quantitative PCR for detecting duck hepatitis a virus genotype C.

Journal of clinical microbiology 50:3318-3323. 2012. 97. Yang, M., A. Cheng, M. Wang, and H. Xing

Development and application of a one-step real-time Taqman RT-PCR assay for detection of Duck hepatitis

virus type1.

Journal of virological methods 153:55-60. 2008. 98.

Pantin-Jackwood, M.J., K.O. Strother, E. Mundt, L. Zsak, J.M. Day, and E. Spackman Molecular characterization

of avian astroviruses. Archives of virology 156:235-244.

2011. 99. Koci, M.D., and S. Schultz-Cherry Avian astroviruses. Avian pathology : journal of the W.V.P.A 31:213-

227. 2002. 100.

Monroe, S.S., Carter, M.J., Herrmann, J., Mitchel, D.K.,

& Svensson, L.

Astroviridae. In: Virus Taxonomy. Eighth Report of the International Committee on Taxonomy of Viruses. C.M.

Fauquet, Mayo, A., Maniloff, J., Desselberger, U., & Ball, L.A., ed. Elsevier Academic Press, California. pp

859-864.

2005. 101.

Gough, R.E., E.D. Borland, I.F. Keymer, and J.C. Stuart An outbreak of duck hepatitis type II in

commercial ducks. Avian pathology

: journal of the W.V.P.A 14:227-236. 1985. 102.

Asplin, F.D. Duck Hepatitis. The Veterinary record 77:487-

488. 1965. 103. Chen, L., Q. Xu, R. Zhang, J. Li, Z. Xie, Y. Wang, Y. Zhu, and S. Jiang

Complete genome sequence of a duck astrovirus discovered in eastern China. Journal of virology

86:13833-13834. 2012. 104.

Todd, D., V.J. Smyth, N.W. Ball, B.M. Donnelly, M. Wylie, N.J. Knowles, and B.M. Adair Identi�cation of chicken

enterovirus-like viruses, duck hepatitis virus type 2 and duck hepatitis virus type 3 as astroviruses. Avian



pathology


Haider, S.A., and B.W. Calnek In vitro isolation, propagation, and characterization of duck hepatitis virus

type III. Avian diseases 23:715-729.

1979. 106. Liu, N., F. Wang, and D. Zhang Complete sequence of a novel duck astrovirus. Archives of virology

159:2823-2827. 2014. 107. Liao, Q., N. Liu, X. Wang, F. Wang, and D. Zhang Genetic characterization of a novel

astrovirus in Pekin ducks. Infection, genetics and evolution : journal of molecular epidemiology and

evolutionary genetics in infectious diseases 32:60-67. 2015. 108.

Fu, Y., M. Pan, X. Wang, Y. Xu, X. Xie, N.J. Knowles, H. Yang, and D. Zhang Complete sequence of a duck

astrovirus associated with fatal hepatitis in ducklings. The Journal of general virology 90:1104-1108.

2009. 109. Bidin, M., I. Lojkic, M. Tisljar, Z. Bidin, and D. Majnaric

Astroviruses associated with stunting and pre-hatching mortality in duck and goose embryos. Avian pathology


Gough, R.E., and D. Spackman Studies with inactivated duck virus hepatitis vaccines in breeder ducks. Avian

pathology


Asplin, F.D. Duck hepatitis: vaccination against two serological types. The Veterinary record 77:1529-1530.

1965. 112.

Cavanagh, D. Innovation and discovery: the application of nucleic acid-based technology to avian virus

detection and characterization. Avian

pathology : journal of the W.V.P.A 30:

581- 598. 2001. 113. Baxendale, W., and T. Mebatsion The isolation and characterisation of astroviruses from

chickens. Avian pathology : journal of the W.V.P.A 33:364-370. 2004. 114. Harrach B., M.B., G. W. Both, M.

Brown, A. J. Davison, M. Echavarria, M. Hess, A. Kajon, H. D. Lehmkuhl, V. Mautner, S. K. Mittal and G. Wadell.

Adenoviridae. Elsevier, London ; Waltham, MA. . 2011. 115. Marek, A., A. Gunes, E. Schulz, and M. Hess

Classi�cation of fowl adenoviruses by use of phylogenetic analysis and high-resolution melting-curve

analysis of the hexon L1 gene region. Journal of

virological methods 170:147-154. 2010. 116.



Meulemans, G., B. Couvreur, M. Decaesstecker, M. Boschmans, and T.P. van den Berg

Phylogenetic analysis of fowl adenoviruses. Avian

pathology : journal of the W.V.P.A 33:164- 170. 2004. 117. Ojkic, D., E. Martin, J. Swinton, J.P. Vaillancourt, M.

Boulianne, and S. Gomis Genotyping of Canadian isolates of fowl adenoviruses. Avian pathology : journal of

the W.V.P.A 37:95-100. 2008. 118. Kohn, A. Gallus adeno-like virus in chickens--studies on infection, excretion,

and immunity. American journal of veterinary research 23:562-568. 1962. 119. Cook, J.K. Spread of an avian

adenovirus (CELO virus) to uninoculated fowls. Research in veterinary science 16:156-161. 1974. 120.

Toro, H., O. Gonzalez, C. Escobar, L. Cerda, M.A. Morales, and C. Gonzalez Vertical induction of the inclusion

body hepatitis/hydropericardium syndrome with fowl adenovirus and chicken anemia virus. Avian diseases

45:215-

222. 2001. 121.

Cowen, B., G.B. Mitchell, and B.W. Calnek An adenovirus survey of poultry �ocks during the growing

and laying periods. Avian diseases 22:115-121.

1978. 122. Cook, J.K. Incidence of chick embryo lethal orphan virus antibody in the fowl (Gallus domesticus) in

Britain. Research in veterinary science 11:343-348. 1970. 123. Eregae, M.E., C.E. Dewey, S.A. McEwen, R.

Ouckama, D. Ojkic, and M.T. Guerin Flock

prevalence of exposure to avian adeno-associated virus, chicken anemia virus, fowl adenovirus, and infectious

bursal disease virus among Ontario broiler chicken �ocks. Avian

diseases 58:71- 77. 2014. 124. Macpherson, I.,

J.S. McDougall, and A.P. Laursen-Jones Inclusion body hepatitis in a broiler integration. The Veterinary

record 95:286-289. 1974. 125. Pettit, J. R., and

H.C. Carlson Inclusion-body hepatitis in broiler chickens. Avian diseases 16:858-863. 1972.

126. Choi,

K.S., S .J. Kye, J.Y. Kim, W.J. Jeon, E.K. Lee, K.Y. Park, and H.W. Sung

Epidemiological investigation of outbreaks of fowl adenovirus infection in commercial chickens in Korea.

Poultry science 91:2502-2506. 2012. 127.

Nakamura, K., M. Mase, Y. Yamamoto, K. Takizawa, M. Kabeya, T. Wakuda, M.

Matsuda, T. Chikuba, Y. Yamamoto, T. Ohyama, K. Takahashi, N. Sato, N. Akiyama, H.

Honma, and K. Imai Inclusion body hepatitis caused by fowl adenovirus in broiler chickens in Japan, 2009-

2010. Avian diseases 55:719-723. 2011.



128. Steer, P.A., J.R. Sandy, D. O'Rourke, P.C. Scott, G.F. Browning, and A.H. Noormohammadi Chronological

analysis of gross and histological lesions induced by �eld strains of fowl adenovirus serotypes 1, 8b and 11 in

one-day-old

chickens. Avian pathology : journal of the W.V.P.A

44:106-113. 2015. 129. Lim, T.H., H.J. Lee,

D.H. Lee, Y.N. Lee, J.K. Park, H.N. Youn, M.S. Kim, H. S. Youn, J. B. Lee, S.Y.

Park, I.S. Choi, and C.S. Song Identi�cation and virulence characterization of fowl adenoviruses in Korea. Avian

diseases 55:554-560. 2011. 130. Dar, A., S. Gomis, I. Shirley, G. Mutwiri, R. Brownlie, A. Potter, V. Gerdts, and

S.K. Tikoo

Pathotypic and molecular characterization of a fowl adenovirus associated with inclusion body hepatitis in

Saskatchewan chickens. Avian diseases 56:73-81. 2012.

131.

Fadly, A.M., R.W. Winter�eld, and H.J. Olander Role of the bursa of Fabricius in the pathogenicity of inclusion

body hepatitis and infectious bursal disease viruses. Avian diseases 20:467-477. 1976. 132. Gomis, S.,

A.R. Goodhope, A.

D. Ojkic, and P. Willson Inclusion body hepatitis as a primary disease in broilers in Saskatchewan, Canada.

Avian diseases 50:550-555. 2006.

133.

Alvarado, I.R., P. Villegas, J. El-Attrache, E. Jensen, G. Rosales, F. Perozo, and L.B. Purvis Genetic

characterization, pathogenicity, and protection studies with an avian adenovirus isolate associated with inclusion

body hepatitis. Avian diseases 51:27-32. 2007.

134. Zhao, J., Q. Zhong, Y. Zhao, Y.X. Hu, and G.Z. Zhang Pathogenicity and Complete Genome

Characterization of Fowl Adenoviruses Isolated from Chickens Associated with Inclusion Body

Hepatitis and Hydropericardium Syndrome in

China. PloS one 10:e0133073. 2015. 135.

Christensen, N.H., and M. Saifuddin A primary epidemic of inclusion body hepatitis in broilers. Avian

diseases 33:622-630. 1989. 136. Howell, J.,

D.W. MacDonald, and R.G. Christian Inclusion body hepatitis in chickens.

The Canadian veterinary journal. La revue veterinaire canadienne 11:99-101. 1970. 137.



Erny, K.M., D.A. Barr, and K.J. Fahey Molecular characterization of highly virulent fowl adenoviruses associated

with outbreaks of inclusion body hepatitis. Avian

pathology : journal of the W.V.P.A 20:

597-606. 1991. 138. Capua, I., L. Liberti, R.E. Gough, C. Casaccia, and G. Asdrubali

Isolation and characterization of an adenovirus associated with inclusion body hepatitis in psittacine birds.

Avian pathology


Shivaprasad, H.L., P.R. Woolcock, and M.D. McFarland Group I avian adenovirus and avian adeno-

associated virus in turkey poults with inclusion body hepatitis. Avian pathology

: journal of the W.V.P.A 30:661-666. 2001. 140. Schelling, S.H.,

D.S. Garlick, and J. Alroy Adenoviral hepatitis in a merlin (Falco columbarius). Veterinary pathology

26:529-530. 1989. 141. Takase, K., N. Yoshinaga, T. Egashira, T. Uchimura, and M. Yamamoto Avian adenovirus

isolated from pigeons affected with inclusion body hepatitis.

Nihon juigaku zasshi. The Japanese journal of veterinary science

52:207-215. 1990. 142.

McFerran, J.B., and B.M. Adair Avian adenoviruses--a review. Avian pathology : journal of the W.V.P.A 6:189-

217.

1977. 143.

Cowen, B.S. Chicken embryo propagation of type I avian adenoviruses. Avian diseases 32:347-352.

1988. 144.

McFerran, J.B., B. Adair, and T.J. Connor Adenoviral antigens (CELO, QBV, GAL). American journal of veterinary

research 36:527-529.

1975. 145.

Grimes, T.M., D.H. Culver, and D.J. King Virus-neutralizing antibody titers against 8 avian adenovirus serotypes

in breeder hens in Georgia by a microneutralization procedure. Avian diseases 21:220-229.

1977. 146.

Meulemans, G., M. Boschmans, T.P. Berg, and M. Decaesstecker Polymerase chain reaction combined with

restriction enzyme analysis for detection and differentiation of fowl adenoviruses. Avian pathology



: journal of the W.V.P.A 30:655-660. 2001. 147. Xie, Z., A.A. Fadl, T. Girshick, and M.I. Khan

Detection of avian adenovirus by polymerase chain reaction. Avian diseases 43:

98-105. 1999. 148. Steer, P.A., D. O'Rourke, S.A. Ghorashi, and A.H. Noormohammadi

Application of high- resolution melting curve analysis for typing of fowl adenoviruses in �eld cases of inclusion

body hepatitis. Australian veterinary journal 89:184-192. 2011.

149.

Klein, P.N., A.E. Castro, C.U. Meteyer, B. Reynolds, J.A. Swartzman-Andert, G. Cooper,

R.P. Chin, and H.L. Shivaprasad Experimental transmission of turkey viral hepatitis to day-old poults

and identi�cation of associated viral particles resembling picornaviruses. Avian diseases 35:115-125.

1991. 150.

MacDonald, J.W., C.J. Randall, M.D. Dagless, and E.W. Gray Picorna-like virus causing hepatitis

and pancreatitis in turkeys. The Veterinary record 111:323.

1982. 151. Snoeyenbos GH, B.H.,

Sevoian M An Infectious Agent Producing Hepatitis in Turkeys. Avian diseases 3:377-388.

1959. 152. Honkavuori,

K.S., H.L. Shivaprasad, T. Briese, C. Street, D.L. Hirschberg, S.K. Hutchison, and W.I. Lipkin Novel

picornavirus in Turkey poults with hepatitis, California, USA. Emerging infectious diseases 17:

480-487. 2011. 153. Tzianabos, T., and G.H. Snoeyenbos Some Physicochemical Properties of Turkey Hepatitis

Virus. Avian diseases 9:152-156. 1965. 154. Hauck, R.,

R.P. Chin, G. Senties-Cue, B. Charlton, and H.L. Shivaprasad

Retrospective study of turkey viral hepatitis in California turkey �ocks, 2000-2012. Avian diseases 58:205- 210.

2014. 155. Snoeyenbos GH, B.H. Further Studies of Virus Hepatitis of Turkeys. Avian diseases 4:477-485. 1960.

156.

Mongeau, N. Hepatic Distomatosis and Infectious Canine Hepatitis in Northern Manitoba.

The Canadian veterinary journal. La revue veterinaire canadienne 2:33-38. 1961. Acknowledgments X.J.M.’s

research on hepatitis viruses is supported by the U.S. National Institutes of Health (R01AI074667, and

R01AI050611). D.M.Y. is supported by a grant from the U.S. National Institutes of Health (T32OD010430-06).

FIGURES Figures 1 and 2: 1 2 Fig. 1. Enlarged and hemorrhagic liver in a 42-week-old broiler breeder due to

avian hepatitis E virus infection. Fig. 2. Enlarged liver with petechiae in a six-day-old duckling due to DHAV-1



infection. Figure 3: Fig. 3. Histopathology of the liver with severe diffuse necrosis of hepatocytes and

hemorrhage due to DHAV–1 infection. Figure 4: 4 4 Fig. 4. Diffusely enlarged and pale liver due to Fowl

Adenovirus-1 (IBH) in a broiler chicken. Figure 5: 5 Fig. 5. One diffusely enlarged and pale liver with petechiae

and another liver with pale foci of necrosis in a broiler chicken due to IBH. Figure 6: Fig. 6. Histopathology of

liver with hepatocellular necrosis, in�ammation and intranuclear inclusion bodies in a case of IBH. Figure 7: 7

Fig. 7. Enlarged liver with pale foci of necrosis in a young turkey poult suffering from Turkey Viral Hepatitis.

Figure 8: 8 Fig. 8. Pancreas with pale patches of necrosis in a turkey poult to TVH. Chapter IV:

Infection Dynamics of Hepatitis E Virus in Wild-Type and Immunoglobulin Heavy Chain Knockout JH (-/-)

Gnotobiotic Piglets

Danielle M. Yugoa, C. Lynn Heffrona, Junghyun Ryub, Kyungjun Uhb, Sakthivel Subramaniama, Shannon R.

Matzingera†, Christopher Overenda‡, Dianjun Caoa, Scott P. Kenneyd, Harini Sooryanaraina, Thomas Cecerea,

Tanya LeRoitha, Lijuan Yuana, Nathaniel Juec, Sherrie Clark- Deenerc, Kiho Leeb, and Xiang-Jin Menga

aDepartment of


Polytechnic Institute and State University, Blacksburg, VA 24061;

bDepartment of Animal and Poultry Sciences,

Virginia Polytechnic Institute and State University, Blacksburg, VA 24061;

cDepartment of Large Animal Clinical Sciences, Virginia-Maryland

College of Veterinary Medicine, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061;

dDepartment of

Veterinary Preventive Medicine, Food Animal Health Research Program, Ohio Agricultural Research and

Development Center, The Ohio State University, Wooster, OH 44691

†Present address: Colorado Department of Public Health and Environment, Denver, CO80230 ‡Present

address: Environmental Health and Safety, University of Florida, Gainesville, FL32611 Journal of Virology. 2018;

Oct; 92(21) e01208-18. Copyright © American Society for Microbiology, J Virol. 2018 Oct; 92(21)e01208-18;

DOI: 10.1128/JVI.01208-18. ABSTRACT Hepatitis E virus (HEV), the causative agent of hepatitis E, is an

important but incompletely understood pathogen causing high mortality during pregnancy and leading to

chronic hepatitis in immunocompromised individuals. The underlying mechanisms leading to hepatic damage

remain unknown; however, the humoral immune response is implicated. In this study, immunoglobulin (Ig)

heavy chain JH (-/-) knockout gnotobiotic pigs were generated using CRISPR/Cas9 technology to deplete the

B-lymphocyte population resulting in an inability to generate a humoral immune response to genotype 3 HEV

infection. Compared to wild-type gnotobiotic piglets, the frequencies of B-lymphocytes in Ig heavy chain JH



(-/-) knockouts were signi�cantly lower, despite similar levels of other innate and adaptive T-lymphocyte cell

populations. The dynamic of acute HEV infection was subsequently determined in heavy chain JH (-/-)

knockout and wild-type gnotobiotic pigs. The data showed that wild-type piglets had higher viral RNA loads in

feces and sera when compared to the JH (-/-) knockout pigs, suggesting that the Ig heavy chain JH (-/-)

knockout in pigs actually decreased level of HEV replication. Both HEV-infected wild-type and JH (-/-) knockout

gnotobiotic piglets developed more pronounced lymphoplasmacytic hepatitis and hepatocellular necrosis

lesions than other studies with conventional pigs. The HEV-infected JH (-/-) knockout pigs also had

signi�cantly enlarged livers both grossly and as a ratio of liver/body weight when compared with PBS-

inoculated groups. This novel gnotobiotic pig model will aid in future studies into HEV pathogenicity, an aspect

which has thus far been di�cult to reproduce in the available animal model systems. Keywords: Hepatitis E

virus (HEV); gnotobiotic pig; Ig heavy chain knockout; B cell depletion IMPORTANCE According to World Health

Organization, approximately 20 million HEV infections occur annually, resulting in 3.3 million cases of hepatitis

E and > 44,000 deaths. The

lack of an e�cient animal model that can mimic the full -spectrum of

infection outcomes hinders our ability to delineate the mechanism of HEV pathogenesis. Here, we successfully

generated immunoglobulin heavy chain JH (-/-) knockout gnotobiotic pigs using CRISPR/Cas9 technology,

established a novel JH (-/-) knockout and wild-type gnotobiotic pig model for HEV, and systemically determined

the dynamic of acute HEV infection in gnotobiotic pigs. It was demonstrated that knockout of the Ig heavy

chain in pigs decreased the level of HEV replication. Infected wild-type and JH (-/-) knockout gnotobiotic

piglets developed more pronounced HEV-speci�c lesions than other studies using conventional pigs, and the

infected JH (-/-) knockout pigs had signi�cantly enlarged livers. The availability of this novel model will

facilitate future studies of HEV pathogenicity. INTRODUCTION Hepatitis E, caused by hepatitis E virus (HEV), is

typically an acute icteric disease of worldwide importance. Transmission of HEV occurs by the fecal-oral route,

which often results in large explosive waterborne outbreaks in developing countries and sporadic foodborne

cases in industrialized countries including the United States (1-4). The mortality rate for HEV infection ranges

from 0.4-2% in immunocompetent healthy individuals (5); however, infected pregnant women experience a

signi�cantly elevated level of mortality, up to 28-30% (6, 7). While hepatitis E is generally recognized as a self-

limiting acute disease, immunosuppressed individuals such as solid organ transplant recipients (8), individuals

with concurrent HIV infections (9), and patients with lymphoma or leukemia tend to progress to a state of

chronicity (10) with cirrhotic disease and elevated mortality (11). The underlying mechanisms of disease

severity and hepatic damage experienced by these populations are currently not understood, nor do we

possess an adequate animal model for addressing the current knowledge gaps. HEV is a single-stranded,

positive-sense RNA virus classi�ed in the family Hepeviridae (12), which consists of two genera:

Orthohepevirus and Piscihepevirus. Within the genus Orthohepevirus, 4 species are recognized. Species

Orthohepevirus A includes all HEV strains that are known to infect humans and numerous other mammalian



species. At least 8 distinct genotypes have been identi�ed thus far within species Orthohepevirus A: genotypes

1-4 are known to infect humans (1, 12, 13) with genotypes 1 and 2 affecting only humans whereas

genotypes 3 and 4 affect humans and several other animal species

such as domestic pigs (14), deer (15), and rabbits (16, 17). Genotype 5 and 6 HEVs infect wild boars (18),

genotype 7 HEV infects dromedary camels (19) and possibly humans (20), and genotype 8 HEV infects the

Bactrian camel (19). Species Orthohepevirus B consists of HEV strains that infect avian species (21-23),

Orthohepevirus C infects rodents (24, 25), and Orthohepevirus D infects bats (26). The genus Piscipehevirus

includes the sole strain of HEV infecting cutthroat trout (27). Pigs are a major animal

reservoir for HEV and a major source of zoonotic infections in humans

(4). As the natural host for genotypes 3 and 4 HEV infections in humans (13, 28), the pig model has been used

to study HEV biology and cross-species infections (13, 29). However, the typical outbred conventional pig

experimentally infected with HEV does not develop the level of pathogenicity and progression of disease seen

in immunocompromised and pregnant populations (30). Infection with HEV in conventional pigs are in general

clinically asymptomatic with only mild to moderate hepatic changes observed (31). The typical course of HEV

infection includes fecal shedding of HEV RNA in infected individuals at 1 week post-infection (wpi), which can

persist for up to 8 wpi with a peak in viral titer at approximately 4 wpi (32, 33), a viremic phase lasting 1-2

weeks, followed by clearance of the virus at 8-9 wpi with the development of IgG anti- HEV at 2-4 wpi (34).

Replication of HEV occurs primarily in the gastrointestinal tract (31, 35) with only limited level of virus

replication in hepatocytes. As a result, direct viral effects within hepatic tissue is limited. Consequently, the

humoral immune response has long been thought to exacerbate the hepatic disease process as an immune-

mediated event, leading to the development of the observed liver lesions (36). Likewise, in non-human primates

(37, 38) and chickens (39) experimentally infected with HEV, hepatic lesions and alterations in serum levels of

liver enzymes often correspond to the appearance of HEV antibodies, further suggesting that anti-HEV IgG may

play a role in the development of hepatic lesions. Here we report the successful establishment of an

immunoglobulin (Ig) heavy chain knockout JH (-/-) gnotobiotic piglet model that better mimics the course of

acute HEV infection observed in humans. The dynamic of acute HEV infection was systematically determined

in both Ig heavy chain knockout and wild-type gnotobiotic piglets experimentally-infected with a genotype 3

human HEV. The presence and magnitude of viremia and fecal viral shedding, IgG anti-HEV antibody response

to infection, immune correlates of infection, magnitude of infection and presence of viral RNA in extrahepatic

sites, and liver pathology associated with HEV infection were determined. RESULTS Successful development of

Ig heavy chain JH (-/-) knockout gnotobiotic piglets. In order to delineate the differentiating characteristics

between Ig heavy chain JH (-/-) knockout and wild-type gnotobiotic piglets, CRISPR/Cas9 technology was

utilized to alter the region designated as the Ig heavy chain leading to the generation of “JH (-/-) knockout”

piglets (Table 1). Similarly, as demonstrated in our previous studies (40-42), no wild-type allele was observed in

any of the genotyped embryos (Table 2 and Fig. 1), suggesting that the approach is effective in producing Ig



heavy-chain knockout pigs. Pigs carrying the Ig heavy-chain knockout phenotype were produced by transferring

CRISPR/Cas9 injected embryos into estrus matched surrogate sows. Included in this study was a total of 21

live piglets and one stillborn that were born from 6 surrogate dams (Tables 3 and 4). Genotyping results

indicated that all Ig heavy-chain knockout pigs carried the modi�ed Ig heavy chain region (Fig. 1 and Table 2).

All wild-type gnotobiotic piglets were derived by embryo transfer of in vitro fertilized embryos carrying identical

parental line as the Ig heavy-chain knockout pigs. Gnotobiotic piglets were retrieved by hysterectomy of

pregnant sows with the removal of the entire uterus under sterile conditions and revived and housed in

individual sterile isolators where all procedures occurred for the duration of the study. Sterility of the surgical

set-up, recovery chamber, and individual isolators was determined and con�rmed by swabbing of the

respective equipment and streaking on blood agar plates for any bacterial growth. The sterility of the

gnotobiotic piglets was determined through the veri�cation of a lack of bacterial growth (on both blood agar

plates and Luria broth) from fecal swab samples throughout the course of the experiment. The JH (-/-) Ig heavy

chain knockout gnotobiotic piglets were characterized and exhibited signi�cantly reduced the numbers of

CD79a+ B-lymphocytes (Fig. 2A and 2B) in the peripheral blood mononuclear cell (PBMC) populations, despite

having normal levels of CD3+CD4+ lymphocytes and no alteration in CD16+ natural killer cell populations.

Lower fecal viral RNA loads in HEV-infected JH (-/-) gnotobiotic piglets than in wild-type piglets. In general, HEV

infected conventional pigs shed virus in the feces by 1 week post- inoculation (wpi) with peak fecal viral

shedding at 4 wpi and virus clearance by 7-8 wpi (33). In the Ig JH (-/-) gnotobiotic piglets infected with US-2

HEV in this study, viral RNAs were detected in feces as early as 4 days post-inoculation (dpi) with all piglets

testing positive by 7 dpi and remained positive through necropsy at 28 dpi (Table 5). Likewise, the wild-type

gnotobiotic piglets had detectable viral RNA in the feces from 7 dpi with all piglets testing positive by 9 dpi

(Table 5) and remained so until necropsy at 28 dpi. Quanti�cation of HEV RNA loads in fecal samples (three

times per week), weekly serum samples, intestinal content, bile, and hepatic as well as extrahepatic tissues

including thymus, duodenum, jejunum, ileum, large intestine, gall bladder, spleen, liver, brain and spinal cord,

and mesenteric lymph node was determined by qRT-PCR. The infected Ig JH (-/-) gnotobiotic piglets reached

peak viral RNA loads in the feces at 16 dpi, whereas the viral RNA loads in infected wild- type gnotobiotic

piglets increased until 23 dpi (Fig. 3A and 3C). Viral RNA loads in both groups tapered but remained positive

throughout the experimental period in accordance with the typical course of HEV infection. Neither group

experienced a signi�cant decrease in viral RNA loads by the 4 wpi necropsy timepoint. The fecal viral RNA

loads were signi�cantly higher in the HEV- infected wild-type gnotobiotic pigs than the JH (-/-) knockout

gnotobiotic pigs (p<0.05) (Fig. 3A and 3C) at 23 dpi. The infected wild-type pigs also had numerically higher

amounts of fecal viral RNA loads at other time points compared to the JH (-/-) knockout pigs, although the

difference was not statistically signi�cant at other time points. Likewise, the viral RNA loads in the intestinal

content were also higher in the infected wild-type piglets than JH (-/-) knockout pigs; although, the difference

was not signi�cant (Fig. 3B). Overall, the JH (-/-) knockout pigs exhibited a reduced level of fecal HEV RNA

shedding in the �rst 4 wpi compared to wild-type pigs; however, a signi�cant difference was observed only at

23 dpi due to individual pig variations in both groups (Fig. 3A and 3C). Lower serum viral RNA loads and fewer



incidence of viremia in HEV-infected JH (-/-) piglets compared to wild-type piglets under gnotobiotic condition.

In the HEV-infected JH (-/-) knockout pigs, when tested by a nested RT-PCR assay, 4/6 pigs became viremic by

14 dpi and 3/6 remained positive at necropsy at 28 dpi (Table 5). However, when tested by a quantitative qRT-

PCR assay, which is less sensitive than nested RT-PCR and has a detection limit of 400 copies/µL sample, only

2 piglets in the JH (-/-) knockout pig group were positive for HEV RNA in the serum and none were positive until

3 wpi (Fig. 3D). In the infected wild-type pig group, viremia was detected as early as at 7 dpi with 4/6 pigs being

positive at 14 dpi and 3/6 pigs remaining positive at necropsy at 28 dpi (Table 5). When tested by the qRT-PCR

assay for the sera from the infected wild-type pig group, the results were similar with that obtained by the

nested RT-PCR assay: 1/6 positive at 7 dpi (Fig. 3D) and 4/6 positive at 14 dpi and remained positive by 28 dpi.

The infected wild-type pigs had numerically higher amount of viral RNA loads in the serum than the JH (-/-)

knockout pigs, although the difference was not signi�cant (Fig. 3D). Overall, the data suggests that the level of

viral RNA loads in serum is reduced in the JH (-/-) knockout pigs with fewer positive piglets when compared to

the wild-type pigs. Both the IgM and IgG anti-HEV responses in the JH knock-out and wild-type pigs were

analyzed by ELISA. Anti-HEV antibody responses are typically observed during acute HEV infections by

approximately 4-5 wpi in humans and conventional pigs (5, 32, 33). In this study, seroconversion to HEV

antibodies was not detected in gnotobiotic pigs by the necropsy time point at 28 dpi (data not shown). No

difference in the amount of viral RNAs in extrahepatic tissues between HEV-infected JH (-/-) knockout pigs and

wild-type pigs. During the acute phase of HEV infection in pigs, viral RNA is typically detectable in a variety of

hepatic and extrahepatic tissues due to the circulating virus in the blood during the viremic stage. A qRT-PCR

assay was used

to quantify the amount of HEV RNA in samples of liver and various extrahepatic tissues

including thymus, duodenum, jejunum, ileum, large intestine, gall bladder, spleen, brain and spinal cord, and

mesenteric lymph node. HEV RNA was present in all tissues for the majority of piglets in both groups except in

thymus and mesenteric lymph node. All thymus samples had very low viral RNA titers in only 2/6 JH (-/-)

knockout piglets and 0/6 wild-type pigs. Mesenteric lymph node samples were positive at low levels in 3/6 JH

(-/-) knockout piglets, but in all wild-type piglets (Data not shown). In the bile sample, the amount of HEV RNA

was signi�cantly higher (P=0.0169) in wild-type pigs than in JH (-/-) knockout pigs (Figure 3B); although, there

was no difference in viral RNA loads in other extrahepatic tissues between the JH (-/-) knockout and wild-type

groups (Data not shown). Elevation of serum level of liver enzyme g-glutamyl transferase (GGT), but not other

enzymes, in HEV-infected JH (-/-) knockout gnotobiotic pigs at 3 wpi. The serum levels of liver enzymes

including aspartate aminotransferase (AST) (Fig. 4A), total bilirubin (Fig. 4B), and alkaline phosphatase (Fig.

4C) were assessed and found to be similar among the mock-infected JH (-/-) knockout, HEV-infected JH (-/-)

knockout, mock-infected wild-type, and HEV-infected wild- type piglets. Total bilirubin appeared to be different

between HEV-infected JH (-/-) knockout pigs and mock-infected JH (-/-) knockout piglets at 2-4 wpi; however,

the differences were not statistically signi�cant (Fig. 4B). The serum level of g-glutamyl transferase (GGT) were

found to be statistically elevated at 3 wpi (Fig. 4D) in HEV-infected JH (-/-) knockout gnotobiotic pigs when



compared to the JH (-/-) knockout PBS group. There were abnormally elevated levels of GGT (10- 100 IU/L

considered within normal limits), AST, (10-100 IU/L), and total bilirubin (<1.0 mg/dL) in serum samples from all

groups at various timepoints. In addition, all serum samples for all piglets in all groups had elevated alkaline

phosphatase (>100 IU/L) from 0 wpi to 4 wpi (36 days of age) (Fig. 4C). Histological liver lesions characterized

by lymphoplasmacytic hepatitis and hepatocellular necrosis in both HEV-infected JH (-/-) knockout and wild-

type pigs. At necropsy at 28 dpi, the histological lesions in the liver of infected pigs were characterized as

lymphoplasmacytic hepatitis and hepatocellular necrosis (Fig. 5A). The average lesion score of

lymphoplasmacytic hepatitis in HEV-infected JH (-/-) knockout pigs was signi�cantly higher (P=0.0111) than

that in PBS- inoculated JH (-/-) knockout pigs. Similarly, the average lymphoplasmacytic hepatitis lesion score

was also higher (P <0.05) in HEV-infected wild-type pigs than in PBS inoculated wild-type pigs (Fig. 5A). The

hepatocellular necrosis lesion score in HEV-infected wild-type pigs was also signi�cantly higher (P<0.05) than

that in PBS-inoculated wild-type pigs but there was not a difference in lymphoplasmacytic hepatitis or

hepatocellular necrosis lesion score between HEV- infected wild-type pigs and HEV-infected JH (-/-) knockout

pigs (Fig. 5A). Higher liver/body weight ratio in HEV-infected JH (-/-) knockout pigs compared to PBS-

inoculated controls. The liver and body weights of each pig were measured at necropsy and the liver/body

weight ratio was calculated to determine if the livers were enlarged. The average liver/body weight ratio in HEV-

infected JH (-/-) knockout pigs was signi�cantly higher than that of the PBS-inoculated JH (-/-) knockout

(P<0.01) or wild-type pigs (p<0.05) (Fig. 5B), indicating that the presence of hepatic lesions and in�ammation

in this group led to larger livers than in the PBS-inoculated group. There was

no signi�cant difference in liver/body weight ratio between the wild-type pig infected and

mock-infected groups (Fig. 5B). IFN-g- and IL-4-speci�c CD4+ T-cell responses were not signi�cantly altered in

HEV- infected JH (-/-) knockout piglets when compared to HEV-infected wild-type pigs and mock- infected

groups at 28 dpi. PBMCs from heparinized plasma and mononuclear cells (MNCs) from spleen and mesenteric

lymph nodes were isolated and stimulated with HEV-speci�c recombinant capsid antigen followed by staining

and �ow cytometry analysis (Fig. 6). HEV-speci�c T-cell (Th1) responses were analyzed for the frequency of

IFN-g and IL-4 expression and compared between mock-infected JH (-/-) knockout, HEV-infected JH (-/-)

knockout, mock-infected wild- type, and HEV-infected wild-type groups. Despite an apparent numerically lower

level of expression of IFN-g (Fig. 6A) in the PBMC T-cell population for all groups, the observed difference was

not statistically signi�cant. Expression of IL-4 (Fig. 6B) appeared to be numerically elevated in both mock-

infected wild-type and HEV-infected groups when compared with the mock-infected and HEV-infected JH (-/-)

knockout groups, again the difference was not statistically signi�cant. In addition, total CD3+ CD4+ T-cells

(Th1) in the spleen and mesenteric lymph node were signi�cantly elevated in both the mock-infected and HEV-

infected JH (-/-) knockout groups when compared with wild-type infected groups (P<0.01) (Fig. 6C). The

difference was discernible between both JH (-/-) knockout pig groups and the wild-type infected group at

p<0.01; while, the difference between JH (-/-) infected and wild-type infected was more signi�cant at p<0.001.

IL-10- and TGF-b-producing CD4+CD25+Foxp3+ and



CD4+CD25-Foxp3+ T- reg cell populations were not signi�cantly altered in

HEV-infected JH (-/-) knockout piglets when compared to HEV-infected wild-type pigs and mock-infected

groups at 28 dpi. To examine the in�uence of HEV infection on the functionality of Treg-cell subsets, we

determined the frequencies of IL-10 and TGF-b expression as intracellular cytokines in PBMCs from

heparinized plasma and MNCs from both splenic and mesenteric lymph node preparations. The mean

frequencies of CD4+CD25+ and CD4+CD25- Treg cell subsets (Fig. 7A and 7B) were similar among all groups

in blood, spleen, and mesenteric lymph node. Likewise, the total Foxp3+ Treg cells in blood, spleen, and

mesenteric lymph node were not signi�cantly altered between the mock- infected and HEV-infected wild-type

or JH (-/-) knockout groups of piglets (Fig. 7B).

There was no discernible difference in the frequency of TGF -b

(Fig. 7C) expression in any of the aforementioned groups. Likewise, the IL-10 expression (Fig. 7D) was not

signi�cantly altered based on pig phenotype (wild-type versus JH (-/-) knockout) or infection status (HEV

versus mock- infected). There was an overall lower level of expression of IL-10+ CD4+ CD25+ Treg cells in the

blood versus MNCs isolated from spleen or lymph nodes but this difference was consistent in all four groups

regardless of infection or pig phenotype status (Fig. 7D). DISCUSSION HEV is an important but understudied

pathogen with the potential to cause signi�cant mortality in immunocompromised populations such as organ

transplant recipients (8), those with concurrent systemic immunosuppressive diseases such as lymphoma

(10) or HIV/AIDS (43, 44), and in HEV-infected pregnant women who are burdened with a higher mortality rate

reaching up to 28-30% (5). In this study, we successfully established a novel gnotobiotic pig model for HEV

infection, and systematically determined the dynamics of acute HEV infection in wild-type and Ig heavy chain

JH (-/-) knockout gnotobiotic piglets. We also attempted to investigate the role of immunoglobulin heavy-chain

JH in HEV pathogenesis and acute virus infection. Pigs are the natural host for genotypes 3 and 4 HEVs (13,

45, 46), which cause the majority of sporadic, cluster and chronic cases of hepatitis E in humans mostly from

industrialized countries (4, 43). As an animal model, aside from non-human primates, pigs match humans (47)

more closely than any other animals in terms of physiological characteristics and immunological parameters

and responses. The gnotobiotic piglet model is extremely attractive especially for studying viral pathogenicity

and immune responses, since the animals are raised in isolated sterile conditions with no interference from

other infectious agents. In this case, infection with HEV was the only experimental manipulation in the piglets;

therefore, the obtained results are solely attributable and speci�c to HEV. In addition, it has been shown that

gnotobiotic piglets are more susceptible to virus infection (48, 49) and tend to develop more progressive

disease with discernible lesions. Lacking maternal antibodies at the time of infection may allow for the

increased pathogenesis of HEV and afford the opportunity to utilize a model that more closely matches

symptomatic human infection. This is important in the study of HEV infection because the conventional pig

model develops only mild-to-moderate hepatitis lesions and clears the infection asymptomatically (33, 50). The

application of the CRISRP/Cas9 system to produce Ig JH (-/-) knockout piglets signi�cantly impacts the

production of large animal models for biomedical research and in this case, allowed for the identi�cation and



isolation of each arm of the immune system in response to HEV infection. The CRISPR/Cas9 system allows for

effective site-speci�c genome modi�cation or targeted modi�cations during embryogenesis; therefore,

bypassing the need for somatic cell nuclear transfer (SCNT), which is associated with developmental defects

in animal production. In a previous study, we

generated RAG2/IL2RG double knockout pigs using direct injection of CRISRP /Cas9 system

(41), thus eliminating the breeding step in generating these pigs. The e�ciency of this approach was high

enough (100%) to place these pigs into a human norovirus challenge study without genotyping. Similarly, in this

HEV infection study, all JH (-/-) knockout genetically modi�ed pigs were generated

using direct injection of CRISPR/Cas9 into developing embryos

without reversion to wild-type genotyping. In addition, none of the Ig heavy-chain knockout piglets carried a

mosaic genotype, which can be a shortcoming of the direct injection of the CRISPR/Cas9 system. These

results suggest that the CRISPR/Cas9 system is a valid approach to use for animal production without having

to establish a breeding program or herd for such use. Large animal models, namely pigs, closely recapitulate

the clinical signs of disease in human patients (51). However, use of the pig model in biomedical research is

limited due to the cost of housing, housing requirements, and relatively prolonged gestation period. Using

CRISPR/Cas9 system in large animal production may help reduce these costs through increased e�ciency as

well as opening up the opportunity to develop speci�c knock-out models in order to assess various

immunological parameters. During the acute phase of HEV infection, fecal virus shedding is typically apparent

by 1 wpi and continues for ~3-4 weeks (32, 33, 52). By this time, the development of anti-HEV IgG is able to

clear the infection, usually resulting in an asymptomatic course of infection devoid of clinical signs in both

immunocompetent humans and pigs. The viremic phase typically lasts 1-3 weeks (34) and the acute infection

is considered peak at 4 wpi. In the present study, it was important to demonstrate that this novel gnotobiotic

pig model mimics the typical course of HEV infection in humans as this is the �rst reported use of gnotobiotic

piglets for the study of HEV. To evaluate the gross and microscopic lesions in the liver attributable to HEV

infection, the infected animals had to be euthanized at 28 days post-infection at which time the pathological

liver lesions usually peak. In all HEV-inoculated gnotobiotic piglets, HEV was detectable in the feces during the

�rst wpi and remained positive with relatively high viral RNA levels until necropsy at 28 dpi (Table 5, Fig. 3A and

3C). Fecal virus shedding appeared much earlier at 2 dpi in JH (-/-) knockout gnotobiotic piglets than in wild-

type piglets (7 dpi). Interestingly, the viral RNA loads in fecal samples, intestinal content collected at necropsy,

and serum samples were generally higher with signi�cant differences observed at 23 dpi in the HEV-infected

wild-type gnotobiotic piglets when compared to the HEV-infected JH (-/-) knockout gnotobiotic piglets.

Furthermore, the incidence of viremia and viral RNA loads in sera were also higher in HEV-infected wild-type

piglets than in HEV infected JH (-/-) knockout gnotobiotic piglets. It is possible that the decreased level of HEV

replication in JH (-/-) knockout gnotobiotic piglets is attributable to the lack of Ig heavy chain in the infected

pigs. Unfortunately, due to the limited scope of the study, which is to study the infection dynamic and



pathogenicity during acute infection, the animal experiment was terminated during the time of peak

pathological liver lesions prior to the appearance of anti-HEV antibodies in pigs, which typically occurs at 4-5

weeks post-infection. The lack of detectable anti-HEV antibodies in infected JH (-/-) knockout and wild-type

pigs at all time points validates the gnotobiotic pig model in that there are no maternal effects carried over

after birth since piglets were retrieved via hysterectomy. Speci�cally, these piglets were naïve to colostrum and

were maintained on sterile whole cow’s milk. Future studies are warranted to extend the infection period

beyond the 4-week acute infection in order to de�nitively determine the role that the Ig heavy chain plays in

susceptibility to virus infection and clearance. It is likely that the differences in virus replication level observed

during the 4 weeks post-infection between the HEV-infected JH (-/-) knockout and wild-type groups will be

greatly exacerbated with a prolonged experimental period, thus highlighting the importance of the humoral

immune response to HEV infection. HEV infection in immunocompetent humans and outbred conventional

pigs generally causes only mild-to moderate hepatic lesions without clinical disease (2). In this study, both

wild- type and JH (-/-) knockout gnotobiotic piglets experimentally infected with HEV developed more

pronounced lymphoplasmacytic hepatitis and hepatocellular necrosis lesions than other studies using

conventional pigs (Fig. 5A). All HEV-infected gnotobiotic piglets recorded a histopathologic score of 2, which

corresponds to 3-5 focal in�ltrates per 10 liver lobules or a 3 corresponding with 6-10 focal in�ltrates per 10

liver lobules (33). Pigs with an assessed score of 3 also had hepatocellular necrosis or apoptosis, which was

indicative of HEV-speci�c liver lesions. In addition, the HEV-infected JH (-/-) knockout pigs had signi�cantly

enlarged livers both grossly and as a ratio of liver/body weight (Fig. 5B) when compared with PBS-inoculated

group. Therefore, it appears that the HEV-infected gnotobiotic pigs induced more severe histological and gross

liver pathology and in�ammation than the conventional pigs. This presented as expected since gnotobiotic

pigs are more sensitive to virus infection and are considered as an excellent model for pathogenicity studies of

viral infections (48, 49). Therefore, the gnotobiotic pig model may aid in future studies of HEV pathogenesis

and disease, an aspect which has thus far been di�cult to reproduce in the available animal model systems.

Serum levels of liver enzymes during HEV infections tend to elevate at the time of peak virus infection (30, 53,

54). In this study, we showed that the serum levels of liver enzymes, with the exception of GGT (Fig. 4A-D),

were not good indicators for liver damage nor do they assess overall liver health in the HEV-infected

gnotobiotic piglets. Alkaline phosphatase was dramatically, yet inconsequentially elevated (Fig. 4C) in these

piglets and likely due to the chosen feed source as well as the young age of the gnotobiotic piglets. It is likely

that this enzyme will return to normal values after approximately 60 days of age. Furthermore, feeding sterile

boxed cow’s milk in order to retain their sterility have had an adverse effect on the alkaline phosphatase levels,

rendering it an insigni�cant biomarker in the gnotobiotic piglet model (55). Total bilirubin (Fig. 4B) and AST

(Fig. 4A) were observed to be at similar levels in both the PBS mock-infected and HEV-infected groups. All

animals presented with elevated values, albeit with no discernible trend or signi�cance. The serum level of the

liver enzyme GGT (Fig. 4D) was signi�cantly elevated in HEV-infected JH (-/-) knockout gnotobiotic pigs at 23

dpi, which may indicate liver damage in HEV-infected JH (-/-) knockout pigs, since the predominant source of

GGT is the biliary epithelium, and signi�cantly higher HEV RNA loads were observed in bile (P=0.0169) in wild-



type versus JH (-/-) knockout pigs. At necropsy, neither the Ig heavy chain JH (-/-) knockout or wild-type piglets

had developed the antibodies necessary for clearance of HEV infection. By infecting gnotobiotic piglets at an

early age (8 days) and completing the study by 35 days of age, the piglets are less immunocompetent than

conventional pigs, which may result in a reduced humoral immune response and play a role in the level of HEV

replication and pathogenesis. However, gnotobiotic piglets have been widely used to study other enteric

viruses such as rotavirus infection dynamics and respond with a strong antibody response following infection

by 28 dpi (56, 57). Therefore, the lack of antibodies is less likely in�uenced by the age of piglet, rather the

typical time course for HEV infection. It has long been suspected that liver damage during HEV infection is a

result of an immune-mediated (especially antibody-mediated) event and not due to the result of direct virus

replication in hepatocytes (37, 38). Studies in non-human primates (38) demonstrated a correlation between

liver lesions, elevated levels of liver enzymes, and symptomatic hepatic disease with the appearance of anti-

HEV antibodies. Therefore, a longer term gnotobiotic pig infection study is needed to determine the

signi�cance of IgG anti-HEV antibodies in control of virus infection and pathogenesis and to determine the

immune response of gnotobiotic piglets infected with HEV at an early age. Unfortunately, gnotobiotic piglets

do have a rather limited lifespan due to the diet (sterile milk) and housing (plastic sterile bubble) requirements.

The presence of liver lesions in the current study prior to an antibody response suggests that the liver damage

is not solely mediated by the humoral immune response and requires further validation. Cytokines play

important roles regulating the immune response during virus infection but are currently not well understood in

the context of HEV infection. During the acute HEV infection (up to 28 dpi) in the gnotobiotic pigs, we

systematically determined the Treg, Th1, and Th2 cytokine responses in PBMC and splenic and mesenteric

lymph node MNC populations. When gated on CD3+, CD4+ Th1 cell frequencies in �ow cytometric analyses

were signi�cantly elevated in the mock-infected and HEV-infected Ig heavy chain JH (-/-) knockout groups

when compared with wild-type piglets (Fig. 6C). However, the IFNg+ Th cells, which are the critical effector

memory T-cells (58) used in pigs to mount cell-mediated immune responses, were not signi�cantly different

between any of the groups. The frequency of expression of IFN-g+ T cells appeared to be numerically lower in

PBMCs and to a lesser degree in lymph node MNCs in both JH (-/-) knockout groups when compared to the

wild-type pig groups (Fig. 6A), but not in the MNCs populations isolated from spleen. Although the difference

was not signi�cant, it points to a trend in a somewhat dampened cell-mediated immune response in JH (-/-)

knockout pigs when compared to the wild- type piglet. In addition to the Th responses, Treg cells are also

important in maintaining the balance between clearing virus infection and minimizing immune-mediated

pathology during infection (59, 60). In this study, there was no difference in Treg cell populations (CD25+ or

CD25-) between mock-infected and HEV-infected groups (Fig. 7A and 7B), regardless of the phenotypes of the

pigs. Similarly, the Treg speci�c cytokines TGF-b and IL-10, typically expressed as a functional determination of

the Treg cell population (Fig. 7C and 7D), were not signi�cantly different among any of the groups. Therefore,

while Treg cells may play a role in viral clearance or mitigation of immune-mediated pathology, this was not

evident during the �rst 28 dpi of HEV infection in gnotobiotic pigs. Overall, the results from this study showed a

weak cell-mediated immune response in both the JH (-/-) knockout and wild-type pigs at the presumptive peak



virus infection at 28 dpi. Since this was the �rst attempt at HEV infection of gnotobiotic piglets with a limited

study scope focusing on acute virus infection, the full course of infection from virus inoculation to clearance

has not been evaluated. We demonstrated that Ig JH (-/-) knockout phenotype pigs exhibit a reduction in the

mean frequencies of B lymphocytes while maintaining other cell populations including T-cells and NK cells.

However, this study did not reach a time point when the wild-type pigs produced HEV-speci�c antibodies, which

is a limitation. Therefore, a prolonged follow-up study is needed to fully discern the differences in immune

responses between these JH (-/-) knockout and wild-type animals. Nevertheless, a discernible difference was

observed with respect to liver lesions in HEV-infected gnotobiotic groups, a difference in the liver size both

grossly and as a ratio of liver/body weight in the HEV-infected JH (-/-) knockout group, and a signi�cant

difference in viral RNA loads in bile at 28 dpi. The HEV infection dynamic data in gnotobiotic piglets from this

study will help design future experiments using gnotobiotic pig model. Clearly, the JH (-/-) knockout

gnotobiotic pig model for HEV requires further re�nement to determine if anti-HEV antibodies play a role in

pathogenicity and virus clearance and the presence of liver damage prior to the onset of an antibody response

requires investigation. MATERIALS AND METHODS Generation of Ig JH (-/-) knockout gnotobiotic pigs by

CRISPR/Cas9 technology. To disrupt the Ig heavy chain, a total of four target sites were designed using a web-

based program (http://www.crispr-cas.org/p/resources.html) (Fig. 1A and Table 6). To minimize potential off-

targeting events, target sequences were blasted against the whole pig genome and those carrying 17 or more

identities with other loci in the pig genome were excluded. The four sgRNAs, containing a target sequence and

tracker RNA, were synthesized by in vitro transcription via MEGAshortscript™ Kit (Ambion) using a double-

stranded DNA as a template (IDT). Cas9 mRNA was generated as described in our previous studies (40-42).

Pig oocytes were obtained either from ovaries collected at a local abattoir or purchased commercially (DeSoto,

Inc). To collect oocytes from ovaries, medium-sized follicles were aspirated using an 18-gauge needle attached

to a 10 ml syringe. Cumulus cell-oocyte complexes (COC) were washed twice with pre-warmed TL-Hepes

medium and COCs with a multiple layer of cumulus cells, stimulated to mature in vitro in a TCM-199 based

maturation media containing 0.5 IU/ml FSH, 0.5 IU/ml LH, 0.82 mM cysteine, 3.02 mM glucose, 0.91 mM

sodium pyruvate, and 10 ng/ml EGF for 42-44 hours at 38.5 °C and 5% CO2 incubator. After maturation, COCs

were denuded by 0.1% hyaluronidase. Oocytes were then extruded and the �rst polar body was used for in vitro

fertilization (IVF). Groups of 30 oocytes were placed in 50 µl droplets of IVF medium (modi�ed Tris-buffered

medium with 113.1

mM NaCl, 3 mM KCl, 7 .5 mM CaCl2, 11 mM glucose, 20 mM

Tris, 2 mM caffeine, 5 mM sodium pyruvate, and 2 mg/ml BSA) and covered with mineral oil. Extended semen

was washed with PBS at 720 rcf, 3 min thrice. After the wash, the sperm pellet was resuspended with mTBM

media. Subsequently, 50 µl of diluted sperm (2.5 × 105 sperm/ml) was added into mTBM drops that contained

oocytes. The gametes were co- incubated for 5 hours at 38.5 °C and 5% CO2. Presumable zygotes were

washed thrice with Porcine Zygote Media 3 (PZM-3) (61) then placed in PZM-3and incubated at 38.5 °C, 5%

CO2, and 5% O2. Two hours after IVF, sgRNAs and Cas9 mRNA were introduced into presumptive zygotes to



disrupt Ig heavy chain via microinjection. Each zygote received 10 ng/µl of sgRNAs and 20 ng/µl of Cas9

mRNA by direct injection into the cytoplasm using a FemtoJet microinjector (Eppendorf, Hamburg, Germany).

Microinjection was conducted in manipulation medium (TCM199 with 0.6 mM NaHCO3, 2.9 mM HEPES, 30

mM NaCl, 10 ng/ml gentamicin, and 3 mg/ml BSA) and covered with mineral oil on the heated stage of a Nikon

inverted microscope (Nikon Corporation, Tokyo, Japan). Injected zygotes were washed with PZM-3, then

cultured in PZM-3 until further analyses. For embryo transfer, embryos were cultured in PZM-3 in the presence

of 10 ng/ml GM-CSF (62). To con�rm mutations of the Ig heavy chain region, PCR veri�cation was performed

using the primers listed in Table 6. Genomic DNA was extracted from an individual blastocyst by incubating

blastocysts in the embryo

lysis buffer (50 mM KCl, 1.5 mM MgCl2, 10 mM Tris- HCl pH 8.5, 0.5% Nonidet P40, 0.5% Tween- 20 and

200 µg/ml proteinase K)

for 30 min at 65 °C, followed by 10 min at 95 °C.

Genomic DNA was extracted from the tissue of each piglet using PureLink Genomic DNA kit (Thermo Fisher

Scienti�c) following the manufacturer’s instructions. The predicted mutation sites were ampli�ed by using

Platinum Taq DNA Polymerase (Thermo Fisher Scienti�c). PCR was conducted using the following conditions:

initial denature

at 95 °C for 2 min, denature at 95 °C for 30 sec,

annealing at 55 °C for 30 sec and extension at 72 °C for 1min for 34 cycles,

�nal extension at 72 °C for 5 min, and holding at 4 °C.

The PCR products were either directly sequenced or inserted into a cloning vector (TOPO, Invitrogen) to

con�rm the mutations introduced by CRISPR/Cas9 system. At day 5-6 post IVF, blastocysts and embryos

carrying over 16 cells were transferred into surrogate gilts. The embryos were surgically transferred into the

oviduct of the gilts. Pregnancy was determined by ultrasound examination at day 30-35 of gestation. Sows

impregnated with wild- type or knock-out embryos, respectively, underwent hysterectomy at 111-113 days of

gestation for the retrieval of gnotobiotic piglets. Piglets were further maintained in plastic sterile

microbiological isolators (“bubbles”) for the duration of the study. All animals were delivered and housed at

Virginia Polytechnic Institute and State University (Blacksburg, VA) in accordance with the approved

procedures of the Institutional Animal

Care and Use Committee (IACUC). Twenty- one gnotobiotic piglets were used, corresponding with 6 litters

(IACUC no. 13-127-CVM). Virus inoculum. A genotype 3 strain of human HEV (US-2) originally isolated from a

patient in the United States was used in this study (63). The infectious stock of the US-2 HEV was prepared as

a 10% fecal suspension in 0.01M PBS using the feces of a pig experimentally infected with the



US-2 strain of human HEV from a previous study (34). The

fecal suspension was further puri�ed to produce an endotoxin-free virus preparation using cellu�ne sulfate

(JNC Corporation, Tokyo, Japan) as the binding substrate for column puri�cation and elution into PBS. The

genomic equivalent (GE) titer of the �nal viral stock was determined by HEV-speci�c quantitative qRT- PCR with

a GE titer of ~4.5 x 106 per mL of fecal suspension. Experimental infection of wild-type and JH (-/-) knockout

gnotobiotic piglets with a genotype 3 strain of human HEV. The experimental design for the HEV infection of

gnotobiotic pigs is detailed in Table 1. The gnotobiotic piglets were housed in the sterile isolators for 7 days

before virus inoculation. On day 8, a total of 6 JH (-/-) knockout gnotobiotic piglets were intravenously

inoculated with approximately 9 x 106 GE titer of US-2 HEV infectious stock, and 5 other JH (-/-) knockout

piglets were similarly mock-inoculated with PBS (Table 1). As controls, a total of 5 wild-type gnotobiotic pigs

were intravenously inoculated with approximately 9 x 106 GE titer of US-2 HEV infectious stock, and another 4

wild-type gnotobiotic pigs were similarly inoculated with PBS buffer. After inoculation, the gnotobiotic piglets

were monitored daily for a total of 4 weeks post- infection (wpi). Blood

samples were collected from each pig weekly, and fecal samples were collected

three times per week. At 4 wpi, all gnotobiotic piglets were humanely euthanized and necropsied. Blood

samples were collected for serum and PBMC isolation prior to euthanasia. The total body and liver weights

were measured. During necropsy, tissue samples including spinal cord, brain, lung, liver, kidney, spleen,

duodenum, jejunum, ileum, large intestine, and mesenteric lymph node were collected from each pig. A portion

of the tissue samples

were �xed in 10% formalin to process for routine histological examination

of pathological lesions, and another portion of the tissues samples were immediately frozen on dry ice and

further stored at -80ºC for detection and quanti�cation of HEV RNA by qRT-PCR (Table 5). Additionally,

samples of bile and intestinal content were also collected and stored at -80ºC for the detection and

quanti�cation of HEV RNA by RT-PCR and qRT-PCR (Figure 3B). Furthermore, sections of spleen and

mesenteric lymph node were sterilely collected in RPMI-1640 medium and stored on wet ice for immediate

isolation of MNCs. Histological examination of liver lesions. Evaluation of gross and histological lesion were

conducted by a board-certi�ed veterinary pathologist in a blinded fashion. The formalin-�xed tissues were

trimmed, and routinely processed for histological examination. The lesion scoring criteria were previously

described as follows (33): score 0, no in�ammation; score 1, 1-2 focal lymphoplasmacytic in�ltrates per 10

hepatic lobules; score 2, 2-5 focal in�ltrates/10 hepatic lobules; score 3, 6-10 focal in�ltrates/10 lobules; score

4, >10 focal in�ltrates/10 hepatic lobules (Fig. 5A). Detection of HEV RNA by a nested RT-PCR. To detect HEV

RNA in weekly fecal samples, total RNAs were extracted with TRIzol LS Reagent (Invitrogen) from 200µL of

each 10% fecal suspension. The total RNAs were resuspended in 30µL of DNase-, RNase-, and proteinase-free

water (Eppendorf Inc.). Synthesis of cDNA and



�rst-round PCR ampli�cation were performed using Superscript III one-step reverse transcriptase

PCR kit (Invitrogen)

with primers speci�c for the US-2 strain of HEV: forward primer US202:1198F22 (5’-

ATCGCCCTGACACTGTTCAATC-3’), reverse primer US202:2064R25 (5’- AGGAATTAATTAAGACTCCCGGGTT-3’).

The cDNA synthesis was carried out at 55°C for 30 minutes followed by PCR ampli�cation with an initial

denaturing incubation

at 94°C for 2 minutes and 40 cycles of denaturation at 94°C for 15 second, annealing at 55 °C for

30 seconds, and extension at 68°C for

1 minute, with a �nal incubation at 68 °C for 5 minutes. The second round nested RT -PCR

was completed using

Hi-�delity Taq polymerase (Invitrogen) using 5µL of �rst round PCR product as the template and the same

primers US202:1198F22 and US202:2064R25 in a reaction as described previously (25, 47, 64). The ampli�ed

PCR products were visualized by gel electrophoresis on 1% agarose in Tris-acetate-EDTA buffer (TAE, Thermo

Fisher Scienti�c). An expected PCR product band of 895 bp was extracted and puri�ed from the gel using QG

buffer (Qiagen), and sequenced to verify the authenticity of the ampli�ed product at the Genomic Sequencing

Center at the Biocomplexity Institute of Virginia Tech. Quanti�cation of HEV RNA by qRT-PCR. The amounts of

viral RNAs in weekly serum and fecal swab samples as well as in a panel of tissue samples collected at

necropsy were quanti�ed by qRT-PCR using HEV-speci�c primers and probe. Brie�y, fecal swab materials and

intestinal content were suspended in 10% sterile PBS (w/v). Serum and bile samples were diluted in 10% sterile

PBS (v/v). One gram of tissue samples (liver, spleen, jejunum, and lymph node) were homogenized in 1mL of

TRIzol LS Reagent (Invitrogen) to prepare a 10% tissue suspension. Brie�y, each one-gram sample was placed

in 1mL of TRIzol for 5 min at room temperature, homogenized using individual sterile gentleMACS dissociator

tubes (Miltenyi Biotec), and centrifuged at 4°C for 5 min. Samples were separated into 1.5 mL microcentrifuge

tubes for the addition of 200 µL chloroform per 1mL

sample. Samples were incubated at room temperature for 10 minutes, centrifuged at 12,000 rpm for 15

min at 4°C

for phase separation and supernatants added to an equivalent amount of 70% ethanol. Total RNAs were

extracted using the RNeasy micro-kit columns (Qiagen) from 10% serum, bile, fecal swab materials, intestinal

contents, and tissue suspension in 70% ethanol using a standard Qiagen protocol. The amounts of HEV RNA

were quanti�ed using the SensiFAST Probe No-ROX One-Step kit (Bioline, USA, Inc.) with the forward primer

(JVHEVF, 5’GGTGGTTTCTGGGGTGAC-3’), reverse primer (JVHEVR, 5’- AGGGGTTGGTTGGATGAA-3’), and

hybridization probe (JVHEVP, 5’- TGATTCTCAGCCCTTCGC -3’) following the



protocol as described previously (65). The qRT- PCR assays were performed in a CFX96 real-time (RT) PCR

machine (Bio-Rad Laboratories). The standard curve was produced with puri�ed HEV genomic RNAs, and the

thermal cycling conditions were as follows: 45°C for 10 min (reverse transcription), 95°C for 2 min (initial

denaturation), followed by 95

°C for 5 s (denaturation), and 60°C for 20 s (PCR ampli�cation) for

40 cycles. The detection limit of the qRT-PCR assay was reported earlier as 10 viral genomic copies, which

corresponds to approximately 400 copies of viral RNA per 1 mL sample or per gram tissue (65, 66). Samples

with GE titers below the detection limit were considered negative. ELISA to detect IgG anti-HEV in pigs. Weekly

serum

samples were tested for IgG anti -HEV antibodies by an enzyme-linked immunosorbent assay

(ELISA)

as described previously (14, 34, 47). Brie�y, a truncated recombinant HEV capsid protein containing the

immunodominant region of HEV ORF2 (amino acids 452-617) was used as the antigen (GenWay Biotech Inc.,

San Diego, CA), and plated at 6 µg/10mL carbonate coating buffer to each well. The serum samples were

tested at 1:100 dilution in blocking buffer. Pre-immune

and hyperimmune anti-HEV positive pig sera were included as the negative and positive controls,

respectively.

Horse-radish peroxidase (HRP)-conjugated goat anti-swine IgG (Sigma) was used as the secondary antibody at

1:2,000 in blocking buffer. The plate was developed using ABTS substrate and absorbance was measured at

405 nm on a Promega GloMax Discover plate reader. Determination of serum levels of liver enzymes in pigs. A

panel of liver enzymes including

aspartate aminotransferase (AST), gamma-glutamyl transferase (GGT), alkaline phosphatase, and total

bilirubin were

measured in weekly serum samples using established protocols and standard values from

the Veterinary Diagnostic Lab at Iowa State University College of Veterinary Medicine (Ames,

IA). Isolation of PBMCs from peripheral blood and MNCs from spleen and lymph node tissues. Blood was

collected from each pig for PBMC isolation prior to euthanasia and isolated using

density-gradient centrifugation with Ficoll-Paque PREMIUM (GE Healthcare).

Buffy coats were resuspended in RPMI 1640 medium (Gibco) supplemented with 10% fetal bovine serum (FBS)

and 1% penicillin/streptomycin. Viability counts of PBMCs were conducted with 1:1 Trypan blue as the stain

and a Cellometer (Nexelom). Cells were stored at a density of 1x107/mL in FBS with 5% DMSO at -80ºC



overnight before moving to liquid nitrogen for storage prior to staining. Samples of spleen and MLN tissues

were collected in RPMI-1640 medium supplemented with gentamicin, ampicillin, and HEPES on the day of

euthanasia and processed for the isolation of MNCs as described previously (67, 68). Brie�y, the spleen tissues

were minced and transferred through a 40 µm cell strainer and pelleted by centrifugation. A density-gradient

isolation procedure was followed using Percoll in order to collect the interface containing MNCs. The isolated

cells were resuspended in enriched RPMI-1640 medium supplemented with

8% FBS, gentamicin, ampicillin,

2 mM L-Glutamine, 100 µM non-essential amino acids, 1 mM

sodium pyruvate, and 1:1000 2-mercaptoethanol. For the mesenteric lymph node (MLN), the tissue samples

were incubated for 30 minutes at 37°C on a horizontal shaker in RPMI medium supplemented with 8% FBS,

gentamicin, ampicillin, HEPES, collagenase D (1mg/mL), and DNase I (100U/mL), prior to transferring the

suspension to a cell strainer and collection by centrifugation. Cells were counted with 1:1 Trypan blue using

Cellometer and stored as described above. Intracellular cytokine staining and �ow cytometry analyses. Splenic

and mesenteric lymph node MNCs and blood PBMCs were thawed at room temperature, resuspended in RPMI-

1640 medium with 10% FBS, ampicillin, and gentamicin, and plated at a concentration of 2x106

cells/100µL/well of a 96-well V-bottom tissue-culture plate. Two wells were prepared for each sample and 3

separate plates for each of the 3 staining protocols. An unstimulated preparation of RPMI-1640 medium with

10% FBS, ampicillin, gentamicin, and 0.2 µg anti-human CD49 costimulatory mAb was applied to one well for

each sample per plate at 100 µL per well. A stimulation preparation of RPMI-1640 medium with 10% FBS,

ampicillin, gentamicin, 0.2 µg CD49 mAb, and 1µL JPT Pepmix (puri�ed recombinant HEV ORF2 antigen) was

applied to one well for each sample per plate at 100 µL per well. A cell stimulation mixture (eBioscience, Inc.)

was used as a positive stimulation control. Cells were stimulated for 12 hr at 37°C. Brefeldin A (GolgiPlug, BD

Biosciences) was added to each well at 0.2

µL/well and further incubated at 37°C for 5 hr. Plates were

stored overnight and protected from light at 4°C prior to antibody staining. PBMCs and MNCs were washed

with PBS once, resuspended in cold PBS with 3% FBS (FACS buffer), and stained with one of the following three

panels of �uorochrome-conjugated antibodies according to manufacturer’s recommendations and procedures

described previously (45, 48, 49). In panel one, PBMCs (2x106 cells per well) were sequentially stained with the

following mAb sets diluted in cold PBS with 3% FBS at 4°C for 15 min per incubation period: Spectral Red-

conjugated mouse (IgG1) anti-pig CD3e (clone PPT3; Southern Biotech) and phycoerythrin (PE)- conjugated

mouse (IgG1) anti-pig CD16 (AbDSerotec) followed by permeabilization with BD Cyto�x/Cytoperm buffer (BD

Pharmigen) at 4°C for 15 min and washing thrice with BD Perm/Wash buffer (BD Pharmigen). Intracellular

markers were stained with mouse IgG2b anti- human CD79a (Clone 11D10, Vector Laboratories), followed by

PE-Cy7



-goat anti-mouse IgG2b (Southern Biotech) and FITC-conjugated rat anti-mouse (IgG2b)

(BioLegend) at 4°C for 15 min. Appropriate isotype-matched control antibodies were included as background

staining controls (Southern Biotech, BD Biosciences, eBioscience, and Affymetrix ebioscience). The

frequencies of CD16+ and CD79a+ cells were expressed as percentages of parental CD3gated cells. In panel

two, in vitro HEV-speci�c antigen-stimulated PBMCs and splenic and mesenteric lymph node MNCs were

stained with antibodies to determine the frequencies of CD3+CD4+Foxp3+ Treg cells, CD25+ activation status,

and the expression of regulatory cytokines IL-10 and TGF-b in these cells (45, 48). PBMCs, spleen-derived

MNCs, and mesenteric lymph node-derived MNCs (2x106 cells/well) were stained at 4°C for 15 min with FITC-

conjugated mouse (IgG2b) anti-pig CD4a, SPRD-conjugated mouse (IgG2a) anti-pig CD3, and mouse (IgG1)

anti-pig CD25 (IgG1, clone K231.3B2; AbD Serotec), followed by APC-conjugated rat (IgG1) anti-mouse (clone

X56, BD Pharmingen). After staining for the extracellular markers, the cells were permeabilized with 146 the

Foxp3-staining buffer set (eBioscience) at 4°C for 15 min. Intracellular staining was completed with PE-Cy7-

conjugated rat (IgG2) anti-mouse/rat Foxp3 (cloneFJK-16s; eBioscience), Biotin mouse (IgG1) anti-pig IL-10

(clone 945a; Cell Sciences), and PE- conjugated mouse (IgG1) anti- human TGF-b1 (clone 9016; R&D system)

at 4°C for 15 min. The appropriated isotype-matched control antibodies and PE-conjugated

mouse (IgG1) isotype control (clone P3.6.2.8.

2; eBioscience) were used as background staining controls. The frequencies of CD4+Foxp3+, CD25+, IL-10+,

and TGF-b+ cells were expressed as percentages of parental CD3 gated cells. In panel three, in vitro HEV-

speci�c antigen-stimulated PBMCs and spleen-derived and mesenteric lymph node-derived MNCs were

stained with antibodies to determine CD3+ CD4+ cells expressing IL-4 and IFN-g regulatory cytokines. PBMCs

and MNCs were stained at 4°C for 15 min with FITC-conjugated mouse (IgG2b) anti-pig CD4a (clone 74-12-4;

BD Pharmingen) and SPRD-conjugated (IgG1) anti-pig CD3e followed by permeabilization with BD

Cyto�x/Cytoperm buffer (BD Pharmingen) at 4°C for 15 min. PBMCs and MNCs were washed three times with

BD Perm/Wash buffer (BD Pharmingen) and subsequently stained with PE-conjugated mouse (IgG1) anti-pig

IFN-g (clone P2G10; BD Pharmingen) and

Brilliant Violet 421 anti-human IL-4 antibody (IgG1 clone MP4-25D2; BioLegend).

The appropriate isotype-matched control antibodies were used as background staining controls (BioLegend,

BD Biosciences, and Southern Biotech). For all three staining panels, at least 100,000 events

were acquired on FACS Calibur �ow cytometer (BD Biosciences) and the data were analyzed using

FloJo V10 software (Tree Star).

The absolute number of B, Treg, and NK-cells were based on the frequencies of cells in each sample,

respectively. Statistical analyses. All data was statistically analyzed using GraphPad Prism 7.0 (GraphPad

Software Inc.). The differences between the mean values of two treatment groups were analyzed with two-way



ANOVA or two-tailed unpaired student’s t-test and Tukey multiple comparison tools. The presence or absence

of hepatic in�ltrates was analyzed by Fisher’s exact test.

A p-value of <0.05 was considered statistically signi�cant for all

analyses. All graphs were reported as the mean +/- SEM. ACKNOWLEDGMENTS This study

is supported by grants from the National Institutes of Health (R01 AI074667, and R01 AI050611). Danielle M.

Yugo is supported by a

Ruth L. Kirschstein National Research Service Award Institutional Research Training Grant (T32OD010430). We

thank Ms. Melissa Makris for her technical assistance in �ow cytometry, Karen Hall, Kimberly Allen, Peter

Jobst, and the Teaching and Research Animal Care Support Staff (TRACCS) for their support in the animal

study, and Dr. Lijuan Yuan’s laboratory for their support in the animal study. REFERENCES 1. Yugo DM, Meng

XJ. 2013. Hepatitis E virus: foodborne, waterborne and zoonotic transmission. Int J Environ Res Public Health

10:4507-33. 2. 3. Emerson S, Purcell R.

2003. Hepatitis E virus. Reviews in medical virology 13:145-154.

Dalton H, Bendall R, Ijaz S, Banks M. 2008. Hepatitis E: an emerging infection in developed countries. The

Lancet infectious diseases 8:698-709. 4. Meng X-J. 2011. From barnyard to food table: the omnipresence of

hepatitis E virus and risk for zoonotic infection and food safety. Virus Res 161:23-30. 5. Meng X-J. 2013.

Zoonotic and foodborne transmission of hepatitis E virus. Semin Liv Dis 33:41-49. 6. Navaneethan U. 2009.

Seroprevalence of hepatitis E infection in pregnancy - more questions than answers. Indian J Med Res

130:677-9. 7. Navaneethan U, Al Mohajer M, Shata MT. 2008. Hepatitis E and pregnancy: understanding the

pathogenesis. Liver Int 28:1190-1199. 8. Haagsma EB, van den Berg AP, Porte RJ, Benne CA, Vennema H,

Reimerink JH, Koopmans MP.

2008. Chronic hepatitis E virus infection in liver transplant recipients. Liver Transpl 14:547-53.

9. Dalton HR, Bendall RP, Keane FE, Tedder RS, Ijaz S. 2009. Persistent carriage of hepatitis E virus in patients

with HIV infection. N Engl J Med 361:1025-7. 10. Kamar N, Garrouste C, Haagsma EB, Garrigue V, Pischke S,

Chauvet C, Dumortier J, Cannesson A, Cassuto-Viguier E, Thervet E, Conti F, Lebray P, Dalton HR, Santella R,

Kanaan N, Essig M, Mousson C, Radenne S, Roque-Afonso AM, Izopet J, Rostaing L. 2011. Factors associated

with chronic hepatitis in patients with hepatitis E virus infection who have received solid organ transplants.

Gastroenterology 140:1481-9. 11. Singh A, Seth R, Gupta A, Shalimar, Nayak B, Acharya SK, Das P. 2016.

Chronic hepatitis E - an emerging disease in an immunocompromised host. Gastroenterol Rep (Oxf)

doi:10.1093/gastro/gow024. 12.

Purdy MA, Harrison TJ, Jameel S, Meng XJ, Okamoto H, Van der Poel WHM, Smith DB, Ictv

Report C. 2017. ICTV Virus Taxonomy Pro�le: Hepeviridae. J Gen Virol 98:2645-2646. 13.



Meng XJ. 2010. Hepatitis E virus: animal reservoirs and zoonotic risk. Vet Microbiol

140:256-265. 14.


Emerson S. 1997. A novel virus in swine is closely related to the human hepatitis E virus. Proc Natl Acad Sci

U S A 94:9860-9865. 15. Sonoda H, Abe M, Sugimoto T, Sato Y, Bando M, Fukui E, Mizuo H, Takahashi M,

Nishizawa T, Okamoto H. 2004. Prevalence of hepatitis E virus (HEV) Infection in wild boars and deer and

genetic identi�cation of a genotype 3 HEV from a boar in Japan. J Clin Microbiol 42:5371-4. 16. Izopet J,

Dubois M, Bertagnoli S, Lhomme S, Marchandeau S, Boucher S, Kamar N, Abravanel F, Guerin JL. 2012.


Emerg Infect Dis 18:1274-1281. 17. Zhao C, Ma Z, Harrison TJ, Feng R, Zhang C, Qiao Z, Fan J, Ma H, Li M, Song

A, Wang Y. 2009. A novel genotype of hepatitis E virus prevalent among farmed rabbits in China. J Med Virol

81:1371-1379. 18. de Deus N, Peralta B, Pina S, Allepuz A, Mateu E, Vidal D, Ruiz-Fons F, Martín M, Gortázar C,

Segalés J. 2008. Epidemiological study of hepatitis E virus infection in European wild boars (Sus scrofa) in

Spain. Veterinary microbiology 129:163-170. 19. 20. Sridhar S, Teng JLL, Chiu TH, Lau SKP, Woo PCY. 2017.

Hepatitis E Virus Genotypes and Evolution: Emergence of Camel Hepatitis E Variants. Int J Mol Sci 18.

Lee GH, Tan BH, Teo EC, Lim SG, Dan YY, Wee A, Aw PP, Zhu Y, Hibberd ML, Tan CK,

Purdy MA, Teo CG. 2016. Chronic Infection With Camelid Hepatitis E Virus in a Liver Transplant Recipient Who

Regularly Consumes Camel Meat and Milk. Gastroenterology 150:355-7 e3. 21. Payne CJ, Ellis TM, Plant SL,

Gregory AR, Wilcox GE. 1999. Sequence data suggests big liver and spleen disease virus (BLSV) is genetically

related to hepatitis E virus. Vet Microbiol 68:119-125. 22. Billam P, Huang F, Sun Z, Pierson F, Duncan R, Elvinger

F, Guenette D, Toth T, Meng XJ. 2005. Systematic pathogenesis and replication of avian hepatitis E virus in

speci�c- pathogen-free adult chickens. J Virol 79:3429-3437. 23. Sun ZF, Larsen CT, Huang FF, Billam P, Pierson

FW, Toth TE, Meng XJ. 2004. Generation and infectivity titration of an infectious stock of avian hepatitis E virus

(HEV) in chickens and cross-species infection of turkeys with avian HEV. J Clin Microbiol 42:2658-2662. 24.

Johne R, Heckel G, Plenge-Bönig A, Kindler E, Maresch C, Reetz J, Schielke A, Ulrich R. 2011. Novel hepatitis E

virus genotype in Norway rats, Germany. Emerg Infect Dis 16:1452-1455. 25.

Johne R, Plenge-Bönig A, Hess M, Ulrich R, Reetz J, Schielke A. 2010. Detection of a novel hepatitis E-

like virus in faeces of wild rats using a nested broad-spectrum RT-PCR.

The Journal of general virology 91:750-758. 26. Drexler J, Seelen A, Corman V, Fumie Tateno A, Cottontail V,

Melim Zerbinati R, Gloza-Rausch F, Klose S, Adu-Sarkodie Y, Oppong S, Kalko E, Osterman A, Rasche A, Adam A,

Müller M, Ulrich R, Leroy E, Lukashev A, Drosten C. 2012. Bats worldwide carry hepatitis E virus-related viruses

that form a putative novel genus within the family Hepeviridae. J Virol 86:9134-9147. 27. Batts W, Yun S,

Hedrick R, Winton J. 2011. A novel member of the family Hepeviridae from cutthroat trout (Oncorhynchus



clarkii). Virus Res 158:116-123. 28. Kasorndorkbua C, Guenette D, Huang F, Thomas P, Meng XJ, Halbur P. 2004.

Routes of transmission of swine hepatitis E virus in pigs. J Clin Microbiol 42:5047-5052. 29. Cao D, Huang Y-W,

Meng X-J. 2010. The nucleotides on the stem-loop RNA structure in the junction region of the hepatitis E virus

genome are critical for virus replication. Journal of virology 84:13040-13044. 30.

Yugo DM, Cossaboom CM, Meng XJ. 2014. Naturally occurring animal models of human hepatitis E virus

infection. ILAR J

55:187-99. 31. Williams TP, Kasorndorkbua C, Halbur PG, Haqshenas G, Guenette DK, Toth TE, Meng XJ. 2001.

Evidence of extrahepatic sites of replication of the hepatitis E virus in a swine model. J Clin Microbiol 39:3040-

6. 32. Purcell RE, S.U. 2001. Hepatitis E Virus, 4th ed, p 3051-3061. Lippincott: Williams and Wilkins,

Philadelphia, PA.

33. Halbur PG, Kasorndorkbua C, Gilbert C, Guenette D, Potters MB, Purcell RH, Emerson SU, Toth TE, Meng XJ.

2001. Comparative pathogenesis of infection of pigs with hepatitis E viruses recovered from a pig and a human.

J Clin Microbiol

39:918-923. 34. Meng XJ, Halbur P, Shapiro M,

Govindarajan S, Bruna J, Mushahwar I, Purcell R, Emerson S. 1998. Genetic and experimental evidence for

cross-species infection by swine hepatitis E virus. J Virol 72:9714-9721. 35.

Billam P, Pierson F, Li W, LeRoith T, Duncan R, Meng X. 2008. Development and validation of a negative-strand-

speci�c reverse transcription-PCR assay for detection of a chicken strain of hepatitis E virus: identi�cation of

nonliver replication sites. Journal of clinical microbiology 46:2630-2634. 36. Emerson S, Purcell R. 2007.

Hepatitis E. The Pediatric infectious disease journal 26:1147-1148. 37. Tsarev SA, Emerson SU, Tsareva TS,

Yarbough PO, Lewis M, Govindarajan S, Reyes GR, Shapiro M, Purcell RH. 1993. Variation in course of hepatitis

E in experimentally infected cynomolgus monkeys. J Infect Dis 167:1302-1306. 38. Tsarev SA, Tsareva TS,

Emerson SU, Rippy MK, Zack P, Shapiro M, Purcell RH. 1995. Experimental hepatitis E in pregnant rhesus

monkeys: failure to transmit hepatitis E virus (HEV) to offspring and evidence of naturally acquired antibodies

to HEV. J Infect Dis 172:31-37. 39. Billam P, LeRoith T, Pudupakam RS, Pierson FW, Duncan RB, Meng XJ. 2009.

Comparative pathogenesis in speci�c-pathogen-free chickens of two strains of avian hepatitis E virus

recovered from a chicken with Hepatitis-Splenomegaly syndrome and from a clinically healthy chicken. Vet

Microbiol 139:253-261. 40. Lei S, Ryu J, Wen K, Twitchell E, Bui T, Ramesh A, Weiss M, Li G, Samuel H, Clark-

Deener S, Jiang X, Lee K, Yuan L. 2016.

Increased and prolonged human norovirus infection in RAG2/IL2RG de�cient gnotobiotic pigs with severe

combined immunode�ciency.

Sci Rep 6:25222. 41. 42. Ryu J, Lee K. 2017. CRISPR/Cas9-Mediated Gene Targeting during Embryogenesis in

Swine. Methods Mol Biol 1605:231-244. Kang JT, Cho B, Ryu J, Ray C, Lee EJ, Yun YJ, Ahn S, Lee J, Ji DY, Jue N,



Clark- Deener S, Lee K, Park KW. 2016.

Biallelic modi�cation of IL2RG leads to severe combined immunode�ciency in pigs.

Reprod Biol Endocrinol 14:74. 43.

44. Dalton H, Bendall, RP, Rashid, M, et al. 2011. Host risk factors and autochthonous hepatitis e

infection. Eur J Gastroenterol Hepatol

23:1200-5. Dalton HR, Fellows HJ, Stableforth W, Joseph M, Thurairajah PH, Warshow U, Hazeldine S,

Remnarace R, Ijaz S, Hussaini SH, Bendall RP. 2007. The role of hepatitis E virus testing in drug-induced liver

injury. Aliment Pharmacol Ther 26:1429-1435. 45.

Cao D, Cao QM, Subramaniam S, Yugo DM, Heffron CL, Rogers AJ,

Kenney SP, Tian D, Matzinger SR, Overend C, Catanzaro N, LeRoith T, Wang H, Pineyro P, Lindstrom N, Clark-

Deener S, Yuan L, Meng XJ. 2017.

Pig model mimicking chronic hepatitis E virus infection in immunocompromised patients to assess immune

correlates during chronicity. Proc Natl Acad Sci U S A

114:6914-6923. 46. Sanford BJ, Dryman BA, Huang YW, Feagins AR, Leroith T, Meng XJ. 2011. Prior infection of

pigs with a genotype 3 swine hepatitis E virus (HEV) protects against subsequent challenges with homologous

and heterologous genotypes 3 and 4 human HEV. Virus Res 159:17-22.

47. Meng X, Halbur P, Haynes J, Tsareva T, Bruna J, Royer R, Purcell R, Emerson S. 1998. Experimental

infection of pigs with the newly identi�ed swine hepatitis E virus (swine HEV), but not with human strains of HEV.

Archives of virology

143:1405-1415. 48.

Wen K, Li G, Yang X, Bui T, Bai M, Liu F, Kocher J, Yuan L. 2012. CD4+ CD25- FoxP3+ regulatory cells are the

predominant responding regulatory T cells after human rotavirus infection or vaccination in gnotobiotic pigs.

Immunology 137:160-

71. 49.

Yuan L, Wen K, Azevedo MS, Gonzalez AM, Zhang W, Saif LJ. 2008. Virus-speci�c intestinal IFN- gamma

producing T cell responses induced by human rotavirus infection and vaccines are correlated with protection

against rotavirus diarrhea in gnotobiotic pigs. Vaccine 26:3322-

31. 50.

Emerson SU, Purcell RH. 2007. Hepatitis E. Pediatr Infect Dis J



26:1147-8. 51.

Rogers CS, Hao Y, Rokhlina T, Samuel M, Stoltz DA, Li Y, Petroff E, Vermeer DW, Kabel AC, Yan Z, Spate L, Wax

D, Murphy CN, Rieke A, Whitworth K, Linville ML, Korte SW, Engelhardt JF, Welsh MJ, Prather RS. 2008.

Production of CFTR-null and CFTR-DeltaF508 heterozygous pigs by adeno-associated virus-mediated gene

targeting and somatic cell nuclear transfer. J Clin Invest 118:1571-

7. 52. 53. Purcell R, Emerson S. 2008.

Hepatitis E: an emerging awareness of an old disease. Journal of hepatology

48:494-503. Aggarwal R, Kamili S, Spelbring J, Krawczynski K. 2001. Experimental studies on subclinical

hepatitis E virus infection in cynomolgus macaques. J Infect Dis 184:1380- 1385. 54. 55. 56. 57. Krawczynski

K, Meng X-J, Rybczynska J. 2011. Pathogenetic elements of hepatitis E and animal models of HEV infection.

Virus Res 161:78-83. Butterworth PJ. 1983.

Alkaline phosphatase. Biochemistry of mammalian alkaline phosphatases. Cell Biochem Funct

1:66-70. Kim YB. 1975. Developmental immunity in the piglet. Birth Defects Orig Artic Ser 11:549-57.

Saif LJ, Ward LA, Yuan L, Rosen BI, To TL. 1996. The gnotobiotic piglet as a model for studies of disease

pathogenesis and immunity to human rotaviruses. Arch Virol Suppl 12:153-

61. 58. 59.

Wack A, Openshaw P, O'Garra A. 2011. Contribution of cytokines to pathology and protection in virus infection.

Curr Opin Virol 1:184-95. Boer MC, Joosten SA, Ottenhoff TH. 2015. Regulatory T-Cells at the Interface between

Human Host and Pathogens in Infectious Diseases and Vaccination. Front Immunol 6:217. 60. 61. 62. Ndure J,

Flanagan KL. 2014. Targeting regulatory T cells to improve vaccine immunogenicity in early life. Front Microbiol

5:477.

Yoshioka K, Suzuki C, Tanaka A, Anas IM, Iwamura S. 2002. Birth of piglets derived from porcine zygotes

cultured in a chemically de�ned medium. Biol Reprod 66:112-

9.

Lee K, Redel BK, Spate L, Teson J, Brown AN, Park KW, Walters E, Samuel M, Murphy CN, Prather RS. 2013.

Piglets produced from cloned blastocysts cultured in vitro with GM-CSF. Mol Reprod Dev

80:145-54. 63. Erker JC, Desai SM, Schlauder GG, Dawson GJ, Mushahwar IK. 1999. A hepatitis E virus variant

from the United States: molecular characterization and transmission in cynomolgus macaques. J Gen Virol 80

( Pt 3):681-90. 64. Meng XJ, Halbur PG, Shapiro MS, Govindarajan S, Bruna JD, Mushahwar IK, Purcell RH,



Emerson SU. 1998. Genetic and experimental evidence for cross-species infection by swine hepatitis E virus. J

Virol 72:9714-21. 65. Jothikumar N, Cromeans TL, Robertson BH, Meng XJ, Hill VR.

2006. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus.

J Virol Methods 131:65-71.

66. Mokhtari C, Marchadier E, Haim-Boukobza S, Jeblaoui A, Tesse S, Savary J, Roque- Afonso AM. 2013.

Comparison of real-time RT-PCR assays for hepatitis E virus RNA detection. J Clin Virol 58:36-40. 67.

Subramaniam S, Pineyro P, Tian D, Overend C, Yugo DM, Matzinger SR, Rogers AJ, Haac ME, Cao Q, Heffron CL,

Catanzaro N, Kenney SP, Huang YW, Opriessnig T, Meng XJ. 2014. In vivo targeting of porcine reproductive and

respiratory syndrome virus antigen through porcine DC-SIGN to dendritic cells elicits antigen-speci�c CD4T cell

immunity in pigs. Vaccine 32:6768-75. 68.

Yuan L, Ward LA, Rosen BI, To TL, Saif LJ. 1996. Systematic and intestinal antibody- secreting cell

responses and correlates of protective immunity to human rotavirus in a gnotobiotic pig model of disease. J Virol

70:3075-

83. TABLES TABLE 1. Experimental infection of wild-type and immunoglobulin JH (-/-) knockout gnotobiotic

piglets with a genotype 3 human strain (US2) of hepatitis E virus Group Number of Pigletsa Phenotype of

Piglets Inoculab Necropsy at 4 wpi 1 5 JH Knock-out PBS 5 2 6 JH Knock-out G3 (US2) HEV 6 3 4 Wild-type

PBS 4 4 5 Wild-type G3 (US2) HEV 6 aPiglets were retrieved by hysterectomy at 111-113 days of gestation and

maintained germ-free in sterile isolators for the duration of the study. Variation in piglet numbers per groups

was due to the e�ciency in retrieval of live piglets following embryo transfer. bPiglets were inoculated with

US2 strain of HEV or mock (PBS) at 8 days of age via ear-vein injection. TABLE 2. E�cacy of CRISPR/Cas9 to

introduce targeted modi�cations in Ig heavy chain locus during embryogenesis Gene Total # injected % of

blastocysts on day 7 # of genotyped Homozygous Biallelic Genotypes a Mosaic Hetero WT Ig heavy chain 132

24 (18.2%) 15 3 12 0 0 0 aSingle embryos at blastocyst stage were used for genotyping. No wild-type allele

was found. TABLE 3. Phenotyping of Ig heavy-chain modi�ed piglets produced using CRISPR/Cas9 technology

and retrieved by hysterectomy Number of Surrogate embryos Stage of Number of ID Modi�cation transferred

into a embryo Pregnancy pigletsa surrogate 308 Ig Heavy chain 82 Day 6 Y 3 piglets and 1 mummy 68-8 Ig

Heavy chain 74 Day6 Y 5 piglets 61-12 Ig Heavy chain 89 Day5 Y 4 piglets 29-1 Ig Heavy chain 81 Day6 Y 3

piglets 61-13 Ig Heavy chain 80 Day 6 Y 4 piglets Y465 WT 83 Day 6 Y 8 piglets and 3 mummy 70-3 WT 89 Day

5,6 Y 8 piglets 55-09 WT 68 Day 6,7 Y 2 piglets 70-04 WT 105 Day 5 Y 2 piglets aA total of 21 piglets were

delivered from 5 surrogate gilts carrying the immunoglobulin heavy chain knockout JH (-/-) phenotype. The

piglets were maintained in gnotobiotic status in sterile isolators for the duration of the experimental period.

TABLE 4. Genotyping the Ig heavy chain modi�ed piglets Pig ID Mutation Genotype a

GCACACCCCCCAGGTTTTTGTGGGGCGAGCCTGGAGATTGCACCACT WT N/A

GTGATTACTATGCTATGGATCTCTGGGGCCCAGGCGTTGAAGTCGTC GTGTCCTCAGGTAAGAACGGCCC 308-1

Homozygous GCACACCCCCCAGGTTTTTAGTGGGGCGAGCCT (1bp) 308-2 Biallelic mutation



GCACACCCCCCAGGTTTTTTGTGGGGCGAGCCTGGAG (1bp) GCACACCCCCCAGGT------GGGGCGAGCCTGGAG

(6bp) 308-3 Homozygous GCACACCCCCCAGGT-------GTGGGGCGAGCCTGGAG (4bp) 68-8-1 Biallelic mutation

GCACACCCCCCAGGT----GTGGGGCGAGCCTGGAG (4bp) GCACACCCCCCAGGTT---- (282bp) 68-8-2

Homozygous GCACACCCCCCAGGT----GTGGGGCGAGCCTGGAG (4bp) 68-8-3 Biallelic mutation

GCACACCCCCCAGGTTTTTTTTGTGGGGCGAGCCTGGAG (3bp)

GCACACCCCCCAGGTTTTTTGTGGGGCGAGCCTGGAG (1bp) 68-8-4 Biallelic mutation GCACACCCCCCAGG-----

GTGGGGCGAGCCTGGAG (5bp) GCACACCCCCCAGGTTTTTTGTGGGGCGAGCCTGGAG (1bp) 68-8-5 Biallelic

mutation GCACACCCCCCAGGTTTTTTGTGGGGCGAGCCTGGAG (1bp) GCACACCCCCCAGG------

GGCGAGCCTGGAGATTGCAC (9bp) 61-12-1 Homozygous

GCACACCCCCCAGGCCACACTCACCCCTCCAGGGGCGAGCCTGGAG (14bp) 61-12-2 Homozygous

TCCCAGCCCTGCGGCCGAGGG------GTGGGGCGAGCCTGGAG (59bp) GCACACCCCCCAGG------

GGGGGCGAGCCTGGAG 61-12-3 Homozygous (6bp,1bp) Biallelic

GCACACCCCCCAGGTTTTTTGTGGGGCGAGCCTGGAG (1bp) 61-12-4 mutation GGGAAGTCAGGAGGGAGC------

AGATTGCACCAC (107bp) 29-1-1 Homozygous GCACACCCCCCAGGT----GTGGGGCGAGCCT (4bp) 29-1-2

Homozygous GCACACCCCCCA------GGGGCGAGCCT (9bp) Biallelic GCACACCCCCCA------GGGGCGAGCCT (9bp)

29-1-3 mutation GCACACCCCCCAGGTTTTTGTGGGGGCGAGCCT (1bp) GCACACCCCCCAGGTTTTT------

CTCAGGT (80bp) Biallelic GCACACCCCCCAG------GTGGGGCGAGCCTGGAGATTGCACCAT 61-13-1 mutation

GTGATTACTATGCTATGGGATCTCTGGGGCCCAGGCGTTGAAGTCGC TCGTGTCCT—GTAAGAACGGCCC (9bp,

2bp, 2bp) GCACACCCCCCAGGTTTT-------TCGTGTCCTCAGGTAAGAA Biallelic 61-13-2 CGGCCC (74bp) mutation

GCACACCCCC------CAGGTAAGAACGGCCC (91bp) GCACACCCCCCAGGTTTTTGT------CGTGTCCTCAGGT 61-13-3

Homozygous (72 bp) 61-13-4 Homozygous GCACACCCCCCAGGTTTTT------CTCAGGT (80bp) aGenotype of

each knock-out piglet with mutations on each allele individually or on both alleles. Number of base pairs for

each indicated in parentheses. Underline indicates targeting sequence. Bold letters indicate insertion or

change in nucleotides, and ‘-’ indicates deletion of a nucleotide. All piglets carried mutation on Ig heavy chain

TABLE 5. Detection of HEV RNA in the serum (fecal) samples of wild-type and Ig JH (-/-) knockout gnotobiotic

piglets experimentally infected with the US2 strain of human HEV Group Inoculum Piglet phenotype No. of

positive samples/no. tested on DPI a: 0 7 14 21 28 1 PBS 2 HEV 3 PBS 4 HEV Knock-out Knock-out Wild-type

Wild-type 0/5 (0/5) 0/5 (0/5) 0/5 (0/5) 0/5 (0/5) 0/5 (0/5) 0/6 (0/6) 4/6 (6/6) 5/6 (6/6) 4/6 (6/6) 5/6 (6/6) 0/4

(0/4) 0/4 (0/4) 0/4 (0/4) 0/4 (0/4) 0/4 (0/4) 0/6 (0/6) 1/6 (3/6) 4/6 (6/6) 3/6 (6/6) 3/6 (6/6) aDPI: days post-

inoculation. HEV RNA was detected via strain-speci�c nested RT-PCR and qPCR. The ampli�ed PCR-positive

products were sequenced to con�rm the identity as the US2 strain of HEV. TABLE 6. Primers and double-

stranded DNA (dsDNA) used for the development of Ig heavy-chain knockout piglets Name Sequence (5’-3’) Ig

Heavy chain G-block 1 (dsDNA) Ig Heavy chain G-block 2 (dsDNA) Ig Heavy chain G-block 3 (dsDNA) Ig Heavy

chain G-block 4 (dsDNA) T7_Ig Heavy chain 1F TTAATACGACTCACTATAGGCGTTGAAGTCGTCGTGTC

GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTG

CTTTTTTGTTTTAGA TTAATACGACTCACTATAGGACACCCCCCAGGTTTTTG

TGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT



GCTTTTTTGTTTTAGA TTAATACGACTCACTATAGGAGATTGCACCACTGTGAT

GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTG

CTTTTTTGTTTTAGA TTAATACGACTCACTATAGGGTTGAAGTCGTCGTGTCC

TCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT

GCTTTTTTGTTTTAGA TTAATACGACTCACTATAGGCGTTGAAGTCGTCGTGTC T7_Ig Heavy chain 2F T7_Ig

Heavy chain 3F TTAATACGACTCACTATAGGACACCCCCCAGGTTTTTG TG

TTAATACGACTCACTATAGGAGATTGCACCACTGTGAT T7_Ig Heavy chain 4F

TTAATACGACTCACTATAGGGTTGAAGTCGTCGTGTCC TC T7_sgRNA R AAAAGCACCGACTCGGTGCC Cas9 F

TAATACGACTCACTATAGGGAGAATGGACTATAAGGA CCACGAC Cas9 R GCGAGCTCTAGGAATTCTTAC

Genomic Primer F GACACTTTGGAGGTCAGGAACGGGAG Genomic Primer R

CTTCTCTCTCCGACATGGCTCTTTCAGAC FIGURES Fig. 1 A Ig Heavy B chain 2 3 1 4 Wild type sgRNA Targeting

sequence 1 CCAGGCGTTGAAGTCGTCGTGTC 2 ACACCCCCCAGGTTTTTGTGGGG 3

CCTGGAGATTGCACCACTGTGAT 4 GTTGAAGTCGTCGTGTCCTCAGG Homozygous C

C C C C A Wild type G G T T T T T G T G G G G C mEmutbartiyoon#1 C C C C

A Homozygous mutation (308-3)

G G T G T G G G G C G A G C

Biallelic mutation Embryo #2 C C C C A Biallelic mutation (308-2) G

G T G T T G T T G A G G C T G A G G C G

Fig. 1. Ig heavy chain targeting CRISPR sequences and representative types of Ig heavy chain mutations in this

study. (A) Disruption of Ig heavy chain in pigs by CRISPR/Cas9 with a total of 4 target sites designed using a

web-based program. Bold letters indicate PAM sequence of target sites. Black arrows indicate primers used to

amplify the target region. (B) Types of genetic mutations of the Ig heavy chain in single blastocyst. The

sequencing results indicated either homozygous or biallelic mutation of Ig heavy chain in single embryos with

no wild-type alleles observed. (C) Representative genotype of Ig heavy chain knock-out pigs. Arrows indicate

sites of mutations. Fig. 2 A B 5×10-1 5×10-1 4×10-1 *** CD79a+ B-cells Frequency of parent 4×10-1 *** 3×10-1

2×10-1 CD79a+ B-cells 3×10-1 2×10-1 1×10-1 Frequency of parent 1×10-1 0 0 knock-out wild-type knock-out

wild-type Fig. 2. B-lymphocyte cell counts in peripheral blood samples of wild-type and immunoglobulin JH

knockout gnotobiotic piglets experimentally-infected with HEV. PBMCs were collected from each piglet at 28

days post-inoculation (dpi) at necropsy. Cells were gated based on CD3 and quanti�ed for the intracellular

marker CD79a+ as a measure of the total B-cell population in the peripheral blood. Asterisks indicate statistical

signi�cance between designated groups determined by Tukey’s t-test with a p value <0.001. Fig. 3 A B 6×107 *

4×107 Fecal viral RNA copies per 1mL 10% suspension 2×107 4×106 3×106 2×106 1×106 0 0 2 4 7 9 1 1 1 4 1

6 1 8 2 1 Days post-infection K/O HEV infected W/T HEV infected 2 3 2 5 2 8 C 1×109 1×108 log10 per 1mL

10% suspension 1×107 Fecal viral RNA 1×106 1×105 1×104 1×103 1×102 1×101 * D 0 2 4 7 9 11 14 16 18 21



23 25 28 Days post-infection K/O HEV infected W/T HEV infected 6×107 5×107 4×107 3×107 Viral RNA (per mL

10% suspension) 2×107 1×107 2×105 1×105 0 8×103 7×103 6×103 Serum viral RNA copies per 1mL 5×103

4×103 3×103 2×103 1×103 0 * Intestinal Content Bile K/O HEV infected W/T HEV infected 0 7 1 4 1 8 Days

post-infection 2 2 K/O HEV infected W/T HEV infected Fig. 3. Quanti�cation of HEV RNA loads in serum, fecal,

and bile samples of wild-type and JH knockout gnotobiotic piglets experimentally-infected with HEV. Viral

RNAs were extracted from (A) fecal samples three times weekly, (B) intestinal contents and bile at 28 days

post-inoculation (dpi), (C) as a scatterplot of fecal viral RNA, with each symbol indicating the value for an

individual piglet, and (D) serum samples at 0, 7, 14, 21, and 28 dpi for the quanti�cation of HEV RNA copy

numbers by qRT-PCR. Data are expressed as mean +/- SEM. The detection limit is 10 viral genomic copies,

which corresponds to 400 copies per 1mL sample or per gram of tissue. Titers below the reported detection

limit were considered negative. Asterisks indicate statistical signi�cance between designated groups as

determined by two-way ANOVA and p-value <0.05. Fig. 4 A 300 200 AST (IU/L) 100 0 C 2000 1500 Alk. phos.

(IU/L) 1000 500 0 0 1 2 3 4 Weeks post-infection K/O PBS K/O HEV W/T PBS W/T HEV 0 1 2 3 4 Weeks post-

infection K/O PBS K/O HEV W/T PBS W/T HEV B 2.0 Total Bilirubin mg/dL 1.5 1.0 0.5 0.0 0 1 2 3 4 Weeks post-

infection K/O PBS K/O HEV W/T PBS W/T HEV D 250 200 * GGT (IU/L) 150 100 50 0 0 1 Weeks post-infection

2 3 4 K/O PBS K/O HEV W/T PBS W/T HEV Fig. 4. Circulating levels of liver enzymes in serum samples

collected weekly from HEV- infected wild-type and HEV-infected JH (-/-) knockout gnotobiotic piglets. Serum

was collected weekly from each piglet beginning with 0-week post-inoculation (wpi) and continuing until

necropsy at 4 wpi. Liver enzymes including (A) aspartate aminotransferase (AST), (B) total bilirubin, (C) alkaline

phosphatase, and (D) gamma-glutamyl transferase (GGT) were measured at the Iowa State University

Veterinary Diagnostic Lab. Normal limits were provided with the analysis based on the laboratory’s standards

for each speci�c test, which are indicated on each scatterplot graph as a dotted line. Each sample indicates an

individual piglet for each time point and are expressed as the mean +/- SEM. Analysis was completed using

two-way ANOVA. *p<0.05. Fig. 5 A B ns 5 ** ** 0.04 ns 4 ns ** * Histopathological lesions * 0.03 3 ns Score ** 2

ns ns 1 0 Liver weight ratio of overall BW 0.02 0.01 -1 Lymphoplasmacytic Hepatocellular 0.00 hepatitis

Necrosis K/O PBS K/O HEV W/T PBS W/T HEV inoculated infected inoculated infected K/O PBS K/O HEV W/T

PBS W/T HEV Fig. 5. Histopathological lesions in wild-type and JH knockout gnotobiotic piglets

experimentally-infected with HEV. (A) Histopathological lesions in the liver including lymphoplasmacytic

hepatitis and hepatocellular necrosis. Lymphoplasmacytic hepatitis was scored as follows:

0, no in�ammation; 1, 1- 2 focal lymphoplasmacytic in�ltrates/ 10 hepatic lobules; 2, 3- 5 focal

in�ltrates/ 10 hepatic lobules; 3, 6- 10 focal in�ltrates /10

hepatic lobules; and 4, >10 focal in�ltrates/10 hepatic lobules. Hepatocellular necrosis was characterized by

the presence of individual hepatocytes with an eosinophilic cytoplasm with or without fragmented or absent

nuclei. (B) Liver/body weight ratio: The liver weights were evaluated as a ratio of overall body weight. Asterisks

indicate statistical signi�cance as determined by two-way ANOVA.

*p<0.05, **p<0.01, ***p<0.001. Fig. 6 A



Mean frequencies of IFNg expressing 1.0 CD4+ T cells among CD3+ cells 0.8 0.6 0.4 0.2 0.0 blood K/O PBS

spleen K/O HEV mesenteric lymph node W/T PBS W/T HEV B 1.0 Mean frequencies of IL-4 expressing CD4+ T

-cells among CD3+ cells 0.8 0.6 0.4 0.2 0.0 blood K/O PBS spleen K/O HEV mesenteric lymph node W/T PBS

W/T HEV C Mean frequencies of CD3

+CD4+ T cells 1.0 0.8 0.6 0.4 0.2

0.0 blood K/O PBS ** ** spleen K/O HEV *** ** mesenteric lymph node W/T PBS W/T HEV Fig. 6. Frequencies

of IFN-g and IL-4 intracellular cytokines in mononuclear cells isolated from spleen and mesenteric lymph node

tissues and PBMCs from peripheral blood of wild- type and JH knockout piglets experimentally-infected with

HEV. PBMCs and MNCs were collected from each piglet at 28 days post-inoculation (dpi) at necropsy. Cells

were gated on CD3 and stained for extracellular and intracellular markers CD4+ and IFN-g and IL-4,

respectively, after stimulation with HEV-speci�c capsid protein. The mean frequencies of (A) IFN-g, (B) IL-4, (C)

CD4+, are indicated and expressed as mean +/- SEM. All frequencies were determined by �ow cytometry with

100,000 events per sample. *p<0.05. Fig. 7 A 0.4 Mean frequencies of CD3+CD4+ 0.3 CD25+Foxp3 0.2 0.1 0.0

blood K/O PBS spleen K/O HEV mesenteric lymph node W/T PBS W/T HEV B 1.0 Mean frequencies of

CD3+CD4+ 0.8 CD25-Foxp3 0.6 0.4 0.2 0.0 blood K/O PBS spleen K/O HEV mesenteric lymph node W/T PBS

W/T HEV C 1.0 Mean frequencies of TGF-B+CD4+ 0.8 CD25+ Treg cells 0.6 0.4 0.2 0.0 bood K/O PBS spleen

K/O HEV mesenteric lymph node W/T PBS W/T HEV D 0.4 Mean frequencies of IL-10+CD4+ CD25+ Treg cells

0.3 0.2 0.1 0.0 blood K/O PBS spleen K/O HEV mesenteric lymph node W/T PBS W/T HEV Fig. 7. Frequencies

of TGF-b and IL-10 intracellular cytokines in mononuclear cells isolated from spleen and mesenteric lymph

node tissues and PBMCs from peripheral blood of wild- type and JH knockout piglets experimentally-infected

with HEV. PBMCs and MNCs were collected from each piglet at 28 days post-inoculation (dpi) at necropsy.

Cells were gated on CD3 and stained for extracellular and intracellular markers CD4+, CD25+, Foxp3, and TGF-b

and IL- 10 respectively after stimulation with HEV-speci�c capsid protein. The mean frequencies of (A) CD25+

Foxp3+, (B) CD25- Foxp3+, (C) TGF-b, and (D) IL-10 are indicated and expressed as mean +/- SEM. All

frequencies were determined by �ow cytometry with 100,000 events per sample. Chapter V: Evidence for an

Unknown Agent Antigenically Related to the Hepatitis E Virus in Dairy Cows in the United States Danielle M.

Yugo1, Caitlin M. Cossaboom1†, C. Lynn Heffron1, Yao-Wei Huang1‡, Scott P. Kenney1§, Amelia R. Woolums2,

David J. Hurley3, Tanja Opriessnig4, Linlin Li5, Eric Delwart5, Isis Kanevsky6¶, and Xiang-Jin Meng1#

1Department of


Polytechnic Institute and State University, Blacksburg, VA;

2Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State

University, Mississippi State, MS; 3Department of Large Animal Medicine,

College of Veterinary Medicine, University of Georgia, Athens, GA; 4Division of Infection and Immunity,

The



Roslin Institute, University of Edinburgh, Midlothian, Scotland; 5Department of Laboratory Medicine, Blood

Systems Research Institute, San Francisco, CA; 6Department of Dairy Sciences, Virginia Polytechnic Institute

and State University, Blacksburg, VA; †Present address: National Center for Emerging and Zoonotic Infectious

Diseases, Center for Disease Control and Prevention, Atlanta, GA; ‡Present address: College of Animal

Sciences, Zhejiang University, Hangzhou, Zhejiang, China; §Present address:

Department of Veterinary Preventive Medicine, Food Animal Health Research Program, The Ohio

State University, Wooster, OH; ¶Present address: P�zer Inc, New York City, NY Journal of Medical Virology.

201;8 Oct; DOI: 10.1002/jmv.25339 Modi�ed and reprinted with permission. ABSTRACT Genotypes 3 and 4

hepatitis E virus (HEV) strains within the species Orthohepevirus A in the family Hepeviridae are zoonotic.

Recently, a genotype 4 HEV was reportedly detected in fecal samples of cows; although, independent

con�rmation is lacking. In this study, we �rst tested serum samples from 983 cows in different regions in the

United States for the presence of IgG anti-HEV and found that 20.4% of cows were seropositive. The highest

seroprevalence rate (68.4%) was from a herd in Georgia. In an attempt to genetically identify HEV from cattle, a

prospective study was conducted in a known seropositive dairy herd by monitoring 10 newborn calves from

birth to 6 months of age for evidence of HEV infection. At least three of the 10 calves seroconverted to IgG

anti-HEV, and importantly, the antibodies present neutralized genotype 3 human HEV, thus indicating the

speci�city of IgG anti-HEV in cattle. However, our extensive attempts using broad- spectrum RT-PCR assays

and MiSeq deep-sequencing technology to genetically identify HEV- related sequences in cattle failed. The

results suggest the existence of an agent antigenically-related to HEV in cattle; although, contrary to published

reports, we showed that the IgG recognizing HEV in cattle was not caused by HEV infection. Key words:

Hepatitis E virus (HEV); Cattle; Bovine; Zoonotic transmission; Neutralizing antibodies; Seroprevalence 1.

INTRODUCTION Hepatitis E virus (HEV), the causative agent of hepatitis E, is transmitted via fecal-oral route

through contaminated water and food.1 Hepatitis E is a global disease with large waterborne outbreaks

occurring in developing countries due to poor sanitation conditions. In industrialized countries, sporadic and

cluster cases of hepatitis E due to the ingestion of contaminated animal meats and shell�sh or direct contact

with infected animals have also been reported.2 The overall mortality rate associated with HEV infection

ranges from 0.5%-4% in immunocompetent individuals; however, concurrent pregnancy accounts for increases

in mortality up to 28%.3 4 Immunocompromised individuals infected with HEV, such as organ transplant

recipients,5 lymphoma and leukemia patients,6; 7 or patients with HIV infection,8 tend to progress into

chronicity.9 HEV is a recognized zoonotic agent with numerous known animal reservoirs.10 Among the well-

characterized animal strains of HEV are the genotypes 3 and 4 swine HEV within species Orthohepevirus A in

domestic and wild pigs,11; 12 and the genotypes 1-4 avian HEV within species Orthohepevirus C in

chickens.13; 14 The recent identi�cation of genetically-diversi�ed strains of HEV across a wide range of animal

species including bat,15 �sh, 16 rat,17 ferret,18 rabbit,19 wild boar,12 moose,20 mongoose,21 deer,22 and

camel23 greatly expanded the host range and diversity of the virus. Ruminant species including deer,22

goats,24 sheep, and cattle25 have been implicated as potential reservoir as either IgG anti-HEV or viral RNA



have been detected in these species. In 2016, genotype 4 HEV RNA was reportedly detected in cows in China,

and raw milk was shown to be contaminated with infectious HEV.26 Surprisingly, the HEV sequence from cows

were more than 99% identical across the entire genome to the HEV sequences from humans and pigs in

China.26 Unfortunately, independent con�rmation of this �nding is lacking. Likewise, Yan et al. reported 8 of

254 yellow cattle in Shandong, China with detectable genotype 4 strain HEV RNA from serum.27 However, two

more recent and independent studies failed to identify HEV RNA in milk and fecal samples from >10% of cows

in Belgium28 or from bulk milk samples from dairy herds in Germany29.

Therefore, the main objective of this study was to determine if cattle in the

United States are infected with HEV. 2. MATERIALS AND METHODS 2.1. Bovine

serum samples A total of 1,168 serum samples were collected from

983 cows in different regions of the United States including 223 serum samples from a university dairy herd in

Virginia, 732 archived serum samples from feed lot cattle herds located in Texas, Oklahoma,

New Mexico, South Dakota, North Dakota, Montana, Wyoming, Iowa, and

Nebraska, and a longitudinal study including 213 serum samples from 38 cows in a cattle herd in Georgia

collected at different timepoints (Table 1). 2.2. A prospective �eld study to genetically identify HEV from calves

In an attempt to genetically identify HEV from cows, we conducted a prospective study in a known HEV IgG

seropositive university dairy herd in Virginia by following 10 newborn calves from birth to 6 months of age

when they were moved to pasture. Weekly blood and fecal samples were collected from each of the 10 calves.

Newborn calves were housed in individual hutches until 12 weeks of age, when they were moved to group barn

housing under the standard operating procedures at this farm. The weekly serum and fecal samples were

tested for the presence of HEV RNA by a nested universal RT-PCR assay that is capable of detecting genotypes

1-4 HEV strains (Table S1) and the weekly serum samples were also tested by a commercial ELISA kit (Wantai,

China) for the presence of IgG anti-HEV (Fig. 1). Additionally, the serum level of liver enzymes, including

gamma-glutamyl transferase (GGT), glutamate dehydrogenase (GLDH), and aspartate aminotransferase (AST),

were also measured (Fig. 2). 2.3. Collection of environmental samples from an HEV IgG positive dairy farm A

total of 100 environmental samples were collected from an HEV IgG seropositive dairy farm in Virginia and

stored at -80C until testing. These included composite fresh fecal samples from the milking parlor �oor,

pastures, �oors and bedding from cow and calf barns, run-off water and fecal samples from the waste

collection tanks of the associated barns, and standing pools of cleaning water. All environmental samples

were tested for the presence of HEV RNA by a broad-spectrum nested RT-PCR assay. 2.4. Enzyme-linked

immunosorbent assay (ELISA) to detect IgG anti-HEV in bovine sera The bovine serum samples were tested for

IgG anti-HEV using the commercial Wantai Double Antigen Sandwich ELISA kit (Beijing Wantai Biological

Pharmacy Enterprise CO; https://www.szabo-scandic.com/�leadmin/content/images/AAH/HEV/HEV-

IgG_CE_IFU_1_.pdf). This commercial assay has been shown to be superior to other assays in detecting HEV



antibodies in a previous study.30 10µL of each serum sample was diluted into 100µL of provided diluent,

tested in duplicate wells coated with recombinant HEV antigens to ORF2 (aa 394-606), and HEV antibodies

bound using horse-radish peroxidase (HRP-) conjugated rabbit anti-human IgG secondary antibody, according

to the manufacturer’s instructions. Substrate conversion absorbance was read using a Tecan Sapphire 2.0

instrument using Magellan software. Speci�c signal was collected using 405 nm with a light scatter reference

wavelength of 630 nm. The results for each serum sample were calculated by comparing each individual

sample’s optical density (S) to the cut-off value (C.O.) following the manufacturer’s instructions and quality

control criteria. Serum samples with S/C.O.>1.0 were considered positive for IgG binding HEV. Results were

declared borderline when S/C.O. between 0.9 and 1.1 was measured, and these samples were re-tested for

con�rmation. Samples with S/C.O.<1.0. were declared negative for IgG binding HEV. All sera from herds from

different states (Table 1), the Virginia dairy milking herd (Table 1), and the intensively studied calves and their

respective dams (Table 2) were tested for the presence of IgG binding HEV by ELISA (Fig. 1). 2.5. Serum level

of liver enzyme analyses All sera from the calves in the prospective study (ID #’s 5078, 5079, 5080, 5081, 5082,

5083, 5084, 5086, 5088, and 5091) were tested by the Cornell Animal Health Diagnostic Center (Ithaca, NY)

using standard methods for serum levels of liver enzymes including gamma-glutamyl transferase (GGT),

glutamate dehydrogenase (GLDH), and aspartate aminotransferase (AST). Reference intervals of each enzyme

speci�cally for bovine as determined by Cornell AHDC are as follows: AST 61-162 U/L, GLDH 11-83 u/L, and

GGT 9-50 U/L (Fig. 2). 2.6. Broad-spectrum nested RT-PCR assays to detect HEV RNA in bovine samples

Selected serum, fecal, and environmental

samples were tested for the presence of HEV using a broad-spectrum RT-PCR assay that

is known to detect RNA of multiple HEV genotypes as previously described.31 Additionally, degenerate primer

sets were also designed based on the alignment of known HEV strains (Table S1) and used for the detection of

HEV RNA in the same nested RT-PCR assay. Furthermore, published primers used successfully to identify novel

animal strains of HEV20; 32 were similarly used in the same RT-PCR assay. RNA was extracted from

approximately 100 µL of the 10% fecal suspension or 100 µL of serum samples using TriReagent (Molecular

Research Center, Cincinnati, OH, USA).

cDNA was prepared using Superscript II reverse transcriptase (Life Technologies;

Thermo Fisher, Waltham, MA). Multiple primer sets were utilized for both the �rst and second rounds of nested

RT-PCR (Table S1) using AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, CA). For the serum

samples from calves in the prospective study, an additional hemi-nested touchdown RT-PCR was utilized with

degenerate primers BatHEVF4228 and BatHEVR4598 (Table S1) according to the published protocol.15 The

second round of the nested RT-PCR was completed using 5µL of �rst round DNA product as the template and

degenerate primers BatHEVF4228 and Bat HEVR4565 (Table S1).15 2.7. In vitro neutralization assay for HEV A

subclone of the Huh7 human liver cell line, Huh7-S10-3,33 was utilized to propagate the genotype 3 human

HEV Kernow P6 strain.34 Human hepatocellular carcinoma cells HepG2/C3A (ATCC, Manassas, VA) were



maintained in Dulbecco's Modi�ed Eagle Medium (DMEM; ThermoFisher Scienti�c, Ontario, Canada) with 10%

FBS on collagen coated �asks and used for all in vitro infectivity assays as described previously35; 36 on

selected bovine sera that were tested positive by ELISA. Brie�y, the genotype 3 HEV Kernow P6 virus stock 37

was incubated in duplicate with PBS as the negative control, Chimp 1313 hyperimmune anti-HEV serum as the

positive control, or selected bovine serum samples at 1:10, 1:100, and 1:1000 dilutions. The mixture was then

added onto the HepG2/C3A liver cells and incubated for 2 hr at 37°C. Afterwards, the samples were removed,

cells washed with PBS, and fresh DMEM medium was added and incubated for 5-6 days. Cells were stained at

5-6 days post-infection by immuno�uorescence assay (IFA) with a rabbit antisera against a bacterially-derived

6x His capsid protein containing a 111 N-terminal amino acid truncation from the HEV Kernow-C1-P6 strain34;

38 as the primary antibody and AlexaFluor 488 goat anti-rabbit IgG (H&L) (Molecular Probes, Life Technologies,

Carlsbad, CA, USA) as the secondary antibody. The number of positive cells were counted and recorded as the

number of �uorescein focus units (FFU). Serum samples were compared to the negative control (PBS) to

generate a value for overall percent decrease in HEV infectivity, which represented the ability of the bovine

serum to neutralize genotype 3 human HEV. Sera were scored as effective if there was greater than 50%

reduction in infectivity and further titered at 1:2 to 1:8192 serial dilutions using the same procedure (Table 3).

2.8. Deep sequencing of serum and fecal samples attempting to genetically identify HEV sequences from

bovine samples Selected serum samples from calves in the prospective study were deep-sequenced using

MiSeq at the Biocomplexity Institute of Virginia Tech, Blacksburg VA, and the Blood Systems Research Institute

at the University of California, San Francisco, CA. Serum samples from calf numbers 5082 and 5091 were

selected for deep-sequencing by MiSeq techniques over the time course of collection. Additionally, serum

samples from all calves (5078, 5079, 5080, 5081, 5082, 5083, 5084, 5086, 5088, and 5091) were pooled and

deep-sequenced via MiSeq for the presence of HEV- related sequences across the trial as well. Furthermore,

100 serum samples representing all of the different geographic regions collected were randomly selected, and

5 µL from each serum was used to assemble a single pool that was subsequently deep-sequenced. Selected

fecal samples from calves in the prospective study including calves #s 5082 and 509, were deep-sequenced

using MiSeq at Columbia University, New York, NY. Library preparation and deep-sequencing analysis was

performed as described previously.39-41 3. RESULTS 3.1. Prevalence of IgG binding HEV antigen in bovine

herds in the United States Serum samples from a total of 983 individual cows including feedlot cows from 9

different States, a dairy herd in Virginia, and a herd in Georgia were tested for IgG that bound HEV antigen

using a commercial ELISA assay. The overall seroprevalence rate across all herds was 20.4% with a range of

16.1% to 68.4% as associated with the geographic locations of the herds (Table 1). The herd from Georgia was

unique in that sequential serum samples were collected from each of the 38 cows over the course of 9

months. The seroprevalence rate across all 213 serum samples from the 38 cows within the Georgia herd was

24.4%. However, this corresponded to 68.4% of individual cows being seropositive at least once during the

study. Of the 223 individual cows from the Virginia Dairy herd, 10 serum samples were from the dams of the

calves participating in the prospective study. Dam numbers 4682, 4810, and 4700, the mothers of calf numbers

5086, 5091, and 5088, were positive for IgG anti-HEV within 2 weeks of calving. In contrast, dam numbers



4832, 4855, 4517, 4854, 4852, 5686, and 4344 were not positive for IgG recognizing HEV (Table 2). 3.2.

Seroconversion to IgG binding HEV antigen in serum of calves from a prospective study in a Virginia Dairy herd

For the prospective study in a dairy herd, the 10 female calves were born from both seropositive dams (#’s

4682, 4810, and 4700) and seronegative dams (#’s 4832, 4855, 4517, 4854, 4852, 4686, and 4344) (Table 2).

Calf numbers. 5079, 5080, 5081, 5084, and 5088 did not seroconvert to HEV at any time point during the study,

and were considered negative (Fig. 1a). Calf numbers 5078, 5082 and 5091 had varying levels of

seroconversion. Calf #5078 brie�y seroconverted by producing IgG recognizing HEV at 31 days of age for 1

week, and again at the age of 71 days for 2 weeks with a relatively low level of antibody (Fig. 1b). Calf #5082

brie�y seroconverted at 28 days of age for 1 week, and again at 78 days of age with a high level of IgG

recognizing HEV observed and lasting 9 weeks. Calf #5091 seroconverted at 106 days of age, with a high level

of HEV IgG observed for 3 weeks. The remaining two calves 5083 and 5086 both had only transient

seroconversion with very low levels of antibodies (Fig. 1b). The prospective study ended with the movement of

calves to pasture at 6 months of age. None of the 10 calves were positive for maternal IgG anti-HEV at the time

of birth or within the �rst 3 weeks after birth (Table 2). Dam numbers 4682, 4700, 4810, corresponding to calf

numbers 5086, 5088, and 5091, had HEV IgG within 2 weeks prior to calving. No correlation between the

seropositive dames and the seroconversion of calves was observed in this study (Table 2). 3.3. Elevation of

serum level of glutamate dehydrogenase (GLDH) liver enzyme in calves that seroconverted to IgG anti-HEV

Since at least three calves in the prospective study seroconverted to HEV, we measured the serum levels of the

liver enzymes; AST, GLDH, and GGT in all serum samples from each of the ten calves on a bi-monthly basis in

(Fig. 2). The results showed that the AST values remained within normal limits (62-162U/L) for all calves

throughout the study. The GGT values were initially elevated on the day of birth, and during the �rst two weeks

of life in calf numbers 5088 and 5091. This is expected in neonates. However, all subsequent samples

remained within normal limits for all calves (11-83 u/L). There appears to be a correlation between peaks in

serum levels of GLDH and the levels of IgG recognizing HEV among the calves that seroconverted in this

prospective study (Fig. 3). Calf numbers 5078, 5082, and 5091, which had relatively high levels of IgG

recognizing HEV, also had high serum levels of GLDH at the same time points (Fig. 3). 3.4. Failure to detect

HEV-related sequences in calves from the prospective study by broad- spectrum nested RT-PCR assays In an

attempt to detect HEV RNA from calves in the prospective study, we utilized broad-spectrum nested RT-PCR

assays with different sets of primers to test selected fecal and serum samples from all calves. PCR primers

targeting the sequences from known HEV strains in the conserved regions of ORF1 (RNA-dependent RNA

polymerase region), ORF2 (capsid gene region), and ORF3 were used for the RT-PCR assays. Furthermore,

published RT-PCR primers and protocols utilized for recent detection of bat,15 rat,31 and rabbit HEV32 strains,

and degenerate pan-primers used for detection of multiple HEV genotypes were also used in our repeated

attempts to amplify HEV RNA (Table S1). Serum and fecal samples used for these RT-PCR assays included

three calves (ID no. 5078, 5082, and 5091) that had seroconverted to HEV (Fig. 1b). Additional samples

collected from many time points from the remaining calves were assayed as well. Despite repeated testing

with different sets of primers and protocols, none of the bovine serum or fecal samples in the prospective



study were positive for HEV RNA. A serum sample containing rabbit HEV was used as the positive control and

was positive in all RT-PCR reactions. Similarly, environmental samples from the dairy herd including water run-

off, surface fecal samples, and combined samples from the sick cow area, calf hutches, calving pen, and free-

stall barns all tested negative using these RT-PCR assays. 3.5. MiSeq deep-sequencing of various bovine

serum and fecal samples did not reveal the

presence of HEV- related sequence The failure to detect HEV RNA

by broad-spectrum RT-PCR assays from serum and fecal samples of calves that apparently seroconverted to

HEV prompted us to employ a deep-sequencing strategy. First, we deep-sequenced pooled sera from the

calves that seroconverted to HEV including samples collected at the week of seroconversion, three time points

prior to seroconversion, and the week following seroconversion. However, analysis of the deep sequence reads

did not identify any HEV-related sequences from the samples. Therefore, we performed additional MiSeq deep

sequencing on combined serum samples collected from calves 5082 and 5091 at all time points from the date

of birth to the end of the prospective study. Again, HEV- related sequences were not identi�ed. Additionally, we

performed MiSeq deep sequencing on fecal samples from calves 5082 and 5091 at all time points, but did not

identify any HEV-related sequence. Sequences from numerous other viruses were identi�ed in the serum and

fecal samples of both calves (data not shown),41 indicating that the MiSeq deep-sequencing technique was

successfully applied. Furthermore, MiSeq deep sequencing was performed on a pooled serum sample from all

time points of all ten calves in the prospective study, again with HEV-related sequence was not detected.

Finally, we performed MiSeq deep sequencing on a combined serum sample from a total of 100 cattle

randomly selected from 9 different states, and again HEV-related sequence was not identi�ed. 3.6. IgG

antibody recognizing HEV antigen present in calves are capable of neutralizing genotype 3 human HEV A virus

neutralization assay was performed to further validate the ELISA results. We found that serum samples with

individual ELISA S/C.O. values ranging from 0.145-0.957 (1.0 is considered seropositive) were unable to

neutralize genotype 3 human HEV in HepG2/C3 cells (data not shown). However, three selected serum

samples from the Virginia dairy herd with individual S/C.O. values of 2.270, 20.851, and 2.658 (Table 3),

respectively, consistently reduced the infection of genotype 3 human HEV by >50% (Table 3). Reductions of

~50% corresponded with virus neutralization titers of 1:16 for calves no. 5078 and 5082 (S/C.O. values 2.658

and 2.270, respectively). 4. DISCUSSION HEV has been genetically identi�ed from more than a dozen animal

species.2 Genotypes 3 and 4 HEV strains within the species Orthohepevirus A infect across species barriers

and are zoonotic. Swine represent the primary natural reservoir for genotypes 3 and 4 HEV,10 and chronic and

neurologic cases of hepatitis E in humans are almost exclusively caused by the zoonotic genotype 3 HEV of

likely animal origins.5; 42 Since the discovery of swine HEV from pigs in the United States in 1997,11

genotypes 3 and 4 HEV have been detected worldwide from both wild and domestic swine.43 The ubiquitous

nature of swine HEV in pigs worldwide has led to contamination of pork products including the United

States,44 the Netherlands,45 the United Kingdom,46 and Japan.47 Food-borne transmission of swine HEV has

been de�nitively



linked to the consumption of raw or undercooked pork products.45 The known host range of HEV

is rapidly expanding with the genetic identi�cation of novel HEV strains from a wide range of species. HEV IgG

has also been identi�ed in several other species including cats, dogs, cattle, horses,25; 48 and goats,24

although the sources of virus inducing seroconversion in these species are unclear. Recently, a genotype 4 HEV

was reportedly detected from fecal samples of cows, and surprisingly the infected cows reportedly excreted

virus into milk.26 This report, although still lacking independent con�rmation, raises serious concerns

regarding milk and beef safety. On the contrary, reports from Germany29 and Belgium28 failed to identify the

presence of HEV in milk samples and dairies. Therefore, it is imperative to de�nitely determine the nature and

extent of HEV infection in cattle. In this study, �rst we utilized a commercial ELISA assay to determine the

seroprevalence of IgG recognizing HEV antigen in cattle in the United States. Serum samples from a total of

983 individual cows from 9 different states were tested, and the results showed that the overall seroprevalence

rate was 20.4% with herd seroprevalence rates ranging from 16.1% to 68.4% depending upon the geographic

locations. The seroprevalence in cattle was similar to those reported in other animal species.43; 48 We also

tested 213 sequential serum samples collected from 38 cows in Georgia over a period of 9 months, and found

that 68.4% of the cows were seropositive at least once during that period, which is similar to the levels

observed in some swine herds.49; 50 The results suggest that there is an HEV-related agent in the bovine

population. In our attempt to identify HEV from cattle, we conducted a prospective study in a known HEV-

seropositive dairy herd by monitoring 10 newborn calves from the time of birth to 6 months of age for evidence

of HEV infection. We showed that at least three of the 10 calves temporarily seroconverted to IgG against HEV

at different time points during the course of the prospective study, suggesting that a HEV-related agent is

present in these calves. Importantly, we demonstrated that the IgG anti-HEV present in the seropositive calves

show some neutralizing activity against the genotype 3 human HEV. This indicates that HEV IgG present in the

cattle can target antigenic epitopes found on HEV. Interestingly, the serum level of liver enzyme GLDH appears

to correlate with the seroconversion to HEV IgG in the calves. This is suggestive of potential liver damage

associated with infection by the HEV-related agent. Our repeated and extensive attempts to genetically identify

the source of seropositivity in the cattle were unsuccessful. Both HEV-speci�c and broad-spectrum degenerate

primers that are known to amplify sequences from multiple HEV genotypes with the species Orthohepevirus

A31 as well as published RT-PCR primers that were successfully used to identify other novel animal strains of

HEV from moose,20 rabbit,32 and bat15 all failed to amplify HEV RNA from serum or fecal samples collected

from the three calves that had seroconverted to HEV and the seven seronegative calves. Similarly, broad-

spectrum RT-PCR assays also failed to amplify HEV RNA from the environmental samples collected in the

seropositive Virginia dairy herd. Detection of viral RNA from ruminant species, especially from fecal samples,

present hurdles when utilizing RT-PCR due to the presence of potential inhibitors.51; 52 While serum samples,

which typically do not have PCR inhibitors, were also used for RT-PCR detection in the study, viremia is

transient during HEV infection and thus it is possible that the window of HEV RNA detection may have been

missed. It is also possible that the HEV responsible for the seropositivity in cattle is genetically highly

divergent, and therefore these broad-spectrum RT- PCR assays still may not be able to detect the virus. For



example, the avian HEV in chickens shares only approximately 50% nucleotide sequence identity with

mammalian HEVs.53; 54 The HEV from cutthroat trout shares <27% identity16 with mammalian HEVs, and the

moose HEV shares only approximately 37-63% identity with other known HEV strains.20 Therefore, deep

sequencing of the bovine samples was also performed to identify all viral sequences present in cattle. MiSeq

deep sequencing was performed on serum samples from the calves that had seroconverted to HEV in the

prospective study including calf numbers 5082 and 5091 at all time points, fecal samples from calves 5082

and 5091, and on pooled serum samples from 100 cows in different geographic regions of the United States.

Despite repeated attempts, no HEV-related sequence was identi�ed from the deep sequencing reads, even

though speci�c sequences from other bovine viruses were successfully identi�ed in the samples, indicating

that the MiSeq deep sequencing procedures worked well. In conclusion, we demonstrate serological evidence

for the existence of an HEV-related agent in cattle, as documented by the relatively high seroprevalence rate of

IgG recognizing HEV in cattle. Further, seroconversion to HEV in newborn calves born seronegative over the

course of their calf-hood, and the ability of that antibody to neutralize genotype 3 human HEV in cell culture

strongly indicate an antigenic relationship with an agent related to HEV. The failure of our repeated attempts to

genetically identify HEV from cows and calves using broad-spectrum RT-PCR assays and MiSeq deep

sequencing technology suggests an important limitation in the interpretation of HEV serological data reported

in a large number of animal species including cattle. It is possible that the seroconversion in cattle is caused

by antigenic cross-reaction with a related, but as yet unknown agent or alternatively is due to antigenic cross-

reactivity with unknown host protein(s). Unless HEV can be de�nitively and reproducibly identi�ed from cattle,

we must be very cautious in speculating the role of cattle, if any, in HEV transmission and potential zoonotic

disease. ACKNOWLEDGEMENTS This study is supported by grants from the National Institutes of Health

(R01AI074667, and R01AI050611). Danielle M. Yugo is supported by a Ruth L. Kirschstein National Research

Service Award Institutional Research Training Grant (T32OD010430). We thank Drs. Suzanne U. Emerson and

Robert H. Purcell at NIAID, NIH, Bethesda, MD for kindly providing us with the human HEV genotype 3 Kernow

P6 strain, Huh7-S10-3 cells, and anti-HEV hyperimmune chimpanzee 1313 antiserum. We also thank Dr. Amit

Kapoor of Columbia University, NY, and Dr. Saikumar Karyala and Dr. Bob Settlage of Biocomplexity Institute of

Virginia Tech for their expert assistance in MiSeq deep sequencing of the bovine samples. Con�icts of interest:

The authors declare that they have no competing interests.

Disclaimers: This paper has not been published elsewhere in part or in entirety, and is not under consideration

for publication by another journal. REFERENCES 1 Purcell RH, S.U. Hepatitis E Virus. In: Knipe D, Howley P,

Gri�n D, Lamb R, Martin M, Roizman B, al. e, editors. Fields Virology 4th ed. Philadelphia, PA: Lippincott:

Williams and Wilkins. 2001. p 3051-3061. 2 Meng XJ. Expanding Host Range and Cross-Species Infection of

Hepatitis E Virus. PLoS Pathog 2016; 12(8):e1005695. 3 Navaneethan U. Seroprevalence of hepatitis E

infection in pregnancy - more questions than answers. Indian J Med Res 2009; 130(6):677-679. 4 Navaneethan

U, Al Mohajer M, Shata MT. Hepatitis E and pregnancy: understanding the pathogenesis. Liver Int 2008;

28(9):1190-1199. 5 Kamar N, Izopet J, Dalton HR. Chronic hepatitis e virus infection and treatment. J Clin Exp



Hepatol 2013; 3(2):134-140. 6 le Coutre P, Meisel H, Hofmann J, Röcken C, Vuong G, Neuburger S, Hemmati P,

Dörken B, Arnold R.

Reactivation of hepatitis E infection in a patient with acute lymphoblastic leukaemia after allogeneic stem cell

transplantation. Gut 2009; 58(5):699- 702.

7 Ollier L, Bigaillon C, Tieulie N, Tesse S, Heudier P, Sanderson F, Giordanengo V, Nicand E, Fuzibet J-G.

[Hepatitis E initially serologically silent with prolonged evolution in a patient treated for a lymphoma]. Presse

Med 2009; 38(11):1700-1704. 8 Dalton HR, Bendall RP, Keane FE, Tedder RS, Ijaz S. Persistent carriage of

hepatitis E virus in patients with HIV infection. N Engl J Med 2009; 361(10):1025-1027. 9

Teshale EH, Hu DJ, Holmberg SD. The two faces of hepatitis E virus. Clin Infect Dis 2010; 51(

3):328-334. 10

Pavio N, Meng X-J, Renou C. Zoonotic hepatitis E: animal reservoirs and emerging risks. Vet Res

2010; 41(6):46. 11 Meng XJ, Purcell R, Halbur P, Lehman J, Webb D, Tsareva T, Haynes J, Thacker B, Emerson S.

A novel virus in swine is closely related to the human hepatitis E virus. Proc Natl Acad Sci U S A 1997; 94(

18):9860-9865. 12 de Deus N, Peralta B, Pina S, Allepuz A, Mateu E, Vidal D, Ruiz-Fons F, Martín M, Gortázar C,

Segalés J. Epidemiological study of hepatitis E virus infection in European wild boars (Sus scrofa) in Spain. Vet

Microbiol 2008; 129(1-2):163-170. 13 Payne CJ, Ellis TM, Plant SL, Gregory AR, Wilcox GE. Sequence data

suggests big liver and spleen disease virus (BLSV) is genetically related to hepatitis E virus. Vet Microbiol

1999; 68(1-2):119-125. 14 Zhang X, Bilic I, Troxler S, Hess M. Evidence of genotypes 1 and 3 of avian hepatitis

E virus in wild birds. Virus Res 2017; 228:75-78. Drexler J, Seelen A, Corman V, Fumie Tateno A, Cottontail V,

Melim Zerbinati R, Gloza-Rausch F, Klose S, Adu-Sarkodie Y, Oppong S, Kalko E, Osterman A, Rasche A, Adam A,

Müller M, Ulrich R, Leroy E, Lukashev A, Drosten C. Bats worldwide carry hepatitis E virus-related viruses that

form a putative novel genus within the family Hepeviridae. J Virol 2012; 86(17):9134-9147. 16 17 Batts W, Yun

S, Hedrick R, Winton J. A novel member of the family Hepeviridae from cutthroat trout (Oncorhynchus clarkii).

Virus Res 2011; 158(1-2):116-123.

Johne R, Heckel G, Plenge-Bönig A, Kindler E, Maresch C, Reetz J, Schielke A, Ulrich R. Novel hepatitis E

virus genotype in Norway rats, Germany. Emerg Infect Dis 2010; 16(9):1452-1455.

18 19 Raj V, Smits S, Pas S, Provacia L, Moorman-Roest H, Osterhaus A, Haagmans B. Novel hepatitis E virus in

ferrets, the Netherlands. Emerg Infect Dis 2012; 18(8):1369-1370. Zhao C, Ma Z, Harrison TJ, Feng R, Zhang C,

Qiao Z, Fan J, Ma H, Li M, Song A, Wang Y. A novel genotype of hepatitis E virus prevalent among farmed

rabbits in China. J Med Virol 2009; 81(8):1371-1379. 20 21 Lin J, Norder H, Uhlhorn H, Belak S, Widen F. Novel

hepatitis E like virus found in Swedish moose. J Gen Virol 2014; 95(Pt 3):557-570.

Nakamura M, Takahashi K, Taira K, Taira M, Ohno A, Sakugawa H,



Arai M, Mishiro S.

Hepatitis E virus infection in wild mongooses of Okinawa, Japan: Demonstration of anti- HEV antibodies and a

full-genome nucleotide sequence. Hepatol Res 2006; 34(

3):137- 140. 22

Matsuura Y, Suzuki M, Yoshimatsu K, Arikawa J, Takashima I, Yokoyama M, Igota H, Yamauchi K, Ishida S,

Fukui D, Bando G, Kosuge M, Tsunemitsu H, Koshimoto C, Sakae K, Chikahira M, Ogawa S, Miyamura T, Takeda N,

Li TC. Prevalence of antibody to hepatitis E virus among wild sika deer, Cervus nippon, in Japan. Arch Virol

2007; 152(7):1375-1381. 23 24 Sridhar S, Teng JLL, Chiu TH, Lau SKP, Woo PCY. Hepatitis E Virus Genotypes

and Evolution: Emergence of Camel Hepatitis E Variants. Int J Mol Sci 2017; 18(4):869. Sanford BJ, Emerson

SU, Purcell RH, Engle RE, Dryman BA, Cecere TE, Buechner- Maxwell V, Sponenberg DP, Meng XJ. Serological

Evidence for a Hepatitis E Virus- Related Agent in Goats in the United States. Transbound Emerg Dis 2012;

60(6):538- 545. 25 Arankalle V, Joshi M, Kulkarni A, Gandhe S, Chobe L, Rautmare S, Mishra A, Padbidri V.

Prevalence of anti-hepatitis E virus antibodies in different Indian animal species. J Viral Hepat 2001; 8(3):223-

227.

26 Huang F, Li Y, Yu W, Jing S, Wang J, Long F, He Z, Yang C, Bi Y, Cao W, Liu C, Hua X, Pan Q. Excretion of

infectious hepatitis E virus into milk in cows imposes high risks of zoonosis. Hepatology 2016; 64(2):350-359.

Yan B, Zhang L, Gong L, Lv J, Feng Y, Liu J, Song L, Xu Q, Jiang M, Xu A.

Hepatitis E Virus in Yellow Cattle, Shandong, Eastern China.

Emerg Infect Dis 2016; 22(12):2211- 2212. 28 Vercouter AS, Sayed IM, Lipkens Z, De Bleecker K, De Vliegher S,

Colman R, Koppelman M, Supre K, Meuleman P. Absence of zoonotic hepatitis E virus infection in Flemish dairy

cows. Int J Food Microbiol 2018; 281:54-59. 29 Baechlein C, Becher P. No evidence for zoonotic hepatitis E

virus infection through dairy milk in Germany. Hepatology 2017; 65(1):394-395. 30 Norder H, Karlsson M,

Mellgren A, Konar J, Sandberg E, Lasson A, Castedal M, Magnius L, Lagging M. Diagnostic Performance of Five

Assays for Anti-Hepatitis E Virus IgG and IgM in a Large Cohort Study. J Clin Microbiol 2016; 54(3):549-555. 31

Johne R, Plenge-Bönig A, Hess M, Ulrich R, Reetz J, Schielke A. Detection of a novel hepatitis E-like virus

in faeces of wild rats using a nested broad-spectrum RT-PCR. J Gen Virol 2010; 91 (Pt 3):750-

758. 32 Cossaboom C, Cordoba L, Dryman B, Meng X-J. Hepatitis E virus in rabbits, Virginia, USA. Emerg Infect

Dis 2011; 17(11):2047-2049. 33 Emerson SU, Nguyen HT, Torian U, Burke D, Engle R, Purcell RH. Release of

genotype 1 hepatitis E virus from cultured hepatoma and polarized intestinal cells depends on open reading

frame 3 protein and requires an intact PXXP motif. J Virol 2010; 84(18):9059- 9069. 34

Shukla P, Nguyen HT, Torian U, Engle RE, Faulk K, Dalton HR, Bendall RP, Keane FE, Purcell RH, Emerson SU.

Cross-species infections of cultured cells by hepatitis E virus and discovery of an infectious virus-host



recombinant. Proc Natl Acad Sci U S A 2011; 108(6):2438-

2443. 35

Wang L, Cao D, Wei C, Meng XJ, Jiang X, Tan M.

A dual vaccine candidate against norovirus and hepatitis E virus. Vaccine 2014; 32(4):445-452. 36 Xia M, Wei C,

Wang L, Cao D, Meng XJ, Jiang X, Tan M.

A trivalent vaccine candidate against hepatitis E virus, norovirus, and astrovirus. Vaccine 2016; 34(7):905-913.

37 Cordoba L, Feagins AR, Opriessnig T, Cossaboom CM, Dryman BA, Huang YW, Meng XJ. Rescue of a

genotype 4 human hepatitis E virus from cloned cDNA and characterization of intergenotypic chimeric viruses

in cultured human liver cells and in pigs. J Gen Virol 2012; 93(Pt 10):2183-2194. 38 Kenney SP, Meng XJ. The

lysine residues within the human ribosomal protein S17 sequence naturally inserted into the viral nonstructural

protein of a unique strain of hepatitis E virus are important for enhanced virus replication. J Virol 2015;

89(7):3793- 3803. 39 Zhang Y, Gong W, Zeng H, Wang L. Genetic Evolution of Hepatitis E Virus. Adv Exp Med

Biol 2016; 948:73-88. Li L, Deng X, Mee ET, Collot-Teixeira S, Anderson R, Schepelmann S, Minor PD, Delwart E.

Comparing viral metagenomics methods using a highly multiplexed human viral pathogens reagent. J Virol

Methods 2015; 213:139-146. 41 Sadeghi M, Kapusinszky B, Yugo DM, Phan TG, Deng X, Kanevsky I, Opriessnig

T, Woolums AR, Hurley DJ, Meng XJ, Delwart E. Virome of US bovine calf serum. Biologicals 2017; 46:64-67. 42

43 44 McLean BN, Gulliver J, Dalton HR. Hepatitis E virus and neurological disorders. Pract Neurol 2017;

17(4):282-288. Yugo DM, Meng XJ. Hepatitis E virus: foodborne, waterborne and zoonotic transmission. Int J

Environ Res Public Health 2013; 10(10):4507-4533. Feagins A, Opriessnig T, Guenette D, Halbur P, Meng X.

Inactivation of infectious hepatitis E virus present in commercial pig livers sold in local grocery stores in the

United States. Int J Food Microbiol 2008; 123(1-2):32-37. 45 Colson P, Borentain P, Queyriaux B, Kaba M, Moal

V, Gallian P, Heyries L, Raoult D, Gerolami R. Pig liver sausage as a source of hepatitis E virus transmission to

humans. J Infect Dis 2010; 202(6):825-834. 46

Berto A, Backer JA, Mesquita JR, Nascimento MS, Banks M, Martelli F, Ostanello F, Angeloni G,

Di Bartolo I, Ruggeri FM, Vasickova P, Diez-Valcarce M, Hernandez M, Rodriguez-Lazaro D, van der Poel WH.

Prevalence and transmission of hepatitis E virus in domestic swine populations in different European countries.

BMC Res Notes 2012; 5:

190. 47 48 Takahashi M, Okamoto H. Features of hepatitis E virus infection in humans and animals in Japan.

Hepatol Res 2014; 44(1):43-58. Geng JB, Fu HW, Wang L, Wang XJ, Guan JM, Chang YB, Li LJ, Zhu YH, Zhuang

H, Liu QH, Peng XC.

[Hepatitis E virus (HEV) genotype and the prevalence of anti-HEV in

8 species of animals in the suburbs of Beijing].



Zhonghua Liu Xing Bing Xue Za Zhi 2010; 31(1):

47-50. 49

Blacksell SD, Myint KS, Khounsy S, Phruaravanh M, Mammen MP, Jr., Day NP, Newton PN. Prevalence of

hepatitis E virus antibodies in pigs: implications for human infections in village-based subsistence pig farming in

the Lao PDR. Trans R Soc Trop Med Hyg 2007;

101(3):305-307. 50

Seminati C, Mateu E, Peralta B, de Deus N, Martin M. Distribution of hepatitis E virus infection and its

prevalence in pigs on commercial farms in Spain. Vet J 2008; 175(1):130-132.

51 Thornton CG, Passen S. Inhibition of PCR ampli�cation by phytic acid, and treatment of bovine fecal

specimens with phytase to reduce inhibition. J Microbiol Methods 2004; 59(1):43-52.

Rapp D. DNA extraction from bovine faeces: current status and future trends. J Appl Microbiol 2010;

108(5):1485-1493.

53 Bilic I, Jaskulska B, Basic A, Morrow C, Hess M. Sequence analysis and comparison of avian hepatitis E

viruses from Australia and Europe indicate the existence of different genotypes. J Gen Virol 2009; 90(Pt 4):863-

873. 54 Billam P, Pierson F, Li W, LeRoith T, Duncan R, Meng X. Development and validation of a negative-

strand-speci�c reverse transcription-PCR assay for detection of a chicken strain of hepatitis E virus:

identi�cation of nonliver replication sites. J Clin Microbiol 2008; 46(8):2630-2634. TABLES Table 1. Prevalence

of IgG binding to HEV in cattle from different geographic regions of the United States Year Herd Locationa No

of cows samples collected sampled Percent (%) Range of positive for Individual IgG anti-HEV S/C.O. valuesb

TX, OK, NM SD, ND, MT, WY SD, IA, NE GA VA Dairy 2010 352 2010 250 2010 130 2009 38 2012 223 17.84 0.16-

21.5 19.60 0.15-26.5 22.30 0.15-14.4 68.4 0.18-24.8 16.1 0.07-7.56 aSamples listed by geographic locations as

follows:

Texas (TX), Oklahoma (OK), New Mexico (NM), South Dakota (SD),

North Dakota (ND), Montana (MT), Wyoming (WY), Iowa (IA), Nebraska (NE), Georgia (GA), and Virginia (VA).

bAll sera were tested by an established commercial ELISA assay (Wantai ELISA kit). Individual ELISA S/C.O.

value >1.0 is considered positive. Table 2. Serological evidence of HEV IgG in dams and their corresponding

calf from the prospective study in a university dairy herd Date of Dam S/C.O. Calf S/C.O. Dam ID sample anti-

HEV Calf ID anti-HEV collectionb valueb value at birthc Seroconversion of calf to IgG anti- HEVcd 4832 4855

4517 4682a 4810a 4854 4852 4686 4344 4700a 11/7/12 11/7/12 11/7/12 11/7/12 11/7/12 11/7/12 11/7/12

11/7/12 11/7/12 11/7/12 0.4879 0.3532 0.263 5.668a 2.5926a 0.3444 0.693 0.4826 0.5624 7.5513a 5078d

5082d 5083d 5086d 5091d 5079 5080 5081 5084 5088 0.2070 0.1925 0.1590 0.5790 0.2248 0.1850 0.2217

0.1632 0.2008 0.3733 Yes Yes Transient Transient Yes No No No No No a Dams and their individual S/C.O.

values considered positive for IgG recognizing HEV. bEach of the calves was born between November 4th and



November 25th, 2012 with the Dams sampled within 2 weeks of the expected calving dates. cIgG anti-HEV

ELISA O.D. (optical density) values reported as a ratio of the sample to the average of three negative controls

plus 0.12 as instructed by the commercial Wantai ELISA assay. Individual ELISA S/C.O. >1.0 is considered

positive. dCalves seroconverted to HEV by producing IgG during the course of the prospective study. Two

calves (no. 5083, and 5086) only transiently seroconverted for only 1 or 2 weeks. Table 3. Neutralizing

capability of selected bovine serum samples from calves on the infectivity of a genotype 3 human HEV

(Kernow P6 strain) in HepG2/C3A human liver cells Bovine Serum ID and controls Date of sample collection

ELISA O.D. value Individual % Decrease S/C.O. in HEV value infectivitya Sample neutralizing antibody titer PBS

Chimp 1313 5078 5082 5082 N/A N/A 1/14/13 12/5/12 1/10/13

N/A N/A N/A N/A 0. 411 2.658 0.

340 2.270 3.125 20.851 0 91.87 48.56 46.9 49.28 N/A N/A 1:16 1:4 1:16 aAll bovine sera were tested in

dilutions 1:10, 1:100 and 1:1000, and were also titered in serial dilutions from 1:2 to 1:8192 in a serum virus

neutralization assay. Chimp 1313 is a hyperimmune HEV antisera as a positive control with at least 105 IgG

ELISA titer against HEV from a chimpanzee experimentally-infected with HEV. Supplementary Table 1. Oligo

primers used for the detection of HEV RNA in fecal and serum samples by broad-spectrum nested RT-PCR

assays Primer IDa Sequence Tm Size (bp) Pan F1 Pan R1 Pan F2 Pan R2 USRAB DEG F1 USRAB DEG R1

USRAB DEG F2 USRAB DEG R2 ORF2 BOVF1 ORF2 BOVR1 ORF2 BOVF2 ORF2 BOVR2 ESP MOOSE F EAP

MOOSE R BATHEVF4228 BATHEVR4598 BATHEVR4565 5’-TCGCGCATCACMTTYTTCCARA-3’ 5’-

GCCATGTTCCAGACDGTRTTCCA-3’ 5’-TGTGCTCTGTTTGGCCNTGGTTYMG-3’ 5’-

CCAGGCTCACCRGARTGYTTCTTCCA-3’ 5’-GCMACACGKTTYATGAARGA-3’ 5’-ACYTTRGACCATCVAGRGARC-3’

5’-GCTGAYACRCTTCTYGGYG-3’ 5’-TGAMGGRGTRGGYGRTCYTG-3’ 5’-GGBCTNCCGACAGAATTRAT-3’ 5’-

TRCCHGCTTCCCAGRAGGAV-3’ 5’-CYGTYGTSTCRGCCAATGG-3’ 5’-GWGWAAASCCAMARMACATCA-3’ 5’-

CATGGTAAAGTGGGTCAGGGTAT-3’ 5’-AGGGTGCCGGGCTCGCCGGA-3’ 5’-ACYTTYTGTGCYYTITTT

GGTCCITGGTT-3’ 5’-GCCATGTTCCAGAYGGTGTTCCA-3’ 5’-CCGGGTTCRCCIGAGTGTTTCTTCCA-3’ 58.6 59.0

62.7 63.4 53.4 55.8 56.2 58.7 54.0 59.7 57.7 52.4 56.4 71.7 470 470 330 330 200 200 200 200 406 406 225

225 383 383 63.8 371/338 60.8 371 65.2 338 a F1, F2, R1, and R2 indicated �rst round forward, second round

forward, �rst round reverse, second round reverse, respectively. FIGURES Fig.1. Seroconversion to IgG anti-HEV

in calves in a closed university dairy herd in Virginia in a prospective study. Ten newborn calves born to both

IgG anti-HEV seropositive and seronegative dams were monitored for evidence of HEV infection from the day

of birth to 6 months of age. The weekly serum samples from all calves were tested by the commercial Wantai

ELISA assay for IgG anti-HEV. (A): Calves tested negative for IgG anti-HEV in the prospective study; (B): Calves

tested positive for IgG anti-HEV in the prospective study. The speci�c signal (individual ELISA O.D.) values were

collected and plotted as S/C.O.

(Y-axis) as a function of the ages of the



animals (days after birth) indicating when the samples were collected. The ELISA cut- off value indicating

seropositivity to IgG anti-HEV is indicated as a dotted line at 1.0 based on the commercial Wantai ELISA assay

standard. Fig. 2. Serum levels of liver enzymes over time in the prospective study in calves from the time of

birth to 6 months of age. Serum samples were collected weekly from each calf beginning with the day of birth

and continuing prospectively until approximately 6 months of age. Serum levels of liver enzymes including (A)

aspartate aminotransferase (AST), (B) glutamate dehydrogenase (GLDH), and (C) gamma-glutamyl transferase

(GGT) were measured in each serum samples at the Cornell University Animal Health Diagnostic Center.

Normal limits of each enzyme were provided with the analysis based on the diagnostic laboratory’s standards

for each speci�c test, which are indicated on each scatterplot graph as a dotted line. Each sample indicates an

individual calf serum sample for each time point and are expressed as the mean +/- SEM. Analysis was

completed using two-way ANOVA. Fig. 3. Correlation between seroconversion and serum levels of GLDH in

serum samples collected prospectively from calves from the time of birth to 6 months of age. Calves (A)

#5078, (B) 5082, (C) 5083, (D) 5086, and (E) 5091 seroconversion to IgG anti-HEV correlated with the

elevations in serum levels of GLDH. The speci�c signal (individual ELISA O.D.) values were plotted as S/C.O.

(left


animal (days after birth). The ELISA cut-off value indicating seropositivity to IgG anti-HEV is indicated as a

dotted line at 1.0 based on the commercial Wantai ELISA assay standard. The serum levels of GLDH were

plotted (right


animal (days after birth). The upper normal limit was provided with the analysis based on the diagnostic

laboratory’s standard for GLDH in bovine species and indicated as the dotted line at 83 u/L. Chapter VI

GENERAL DISCUSSION As discussed throughout the dissertation research, many underlying mechanisms of

HEV infection including pathogenesis of disease, immune dynamics during the acute stage, transmission and

reservoir species, and the host factors and virus determinants leading to progressive disease, are not well

understood. The zoonotic risk of HEV is well established (1-3); however, the ever- expanding host range and

identi�cation of new animal reservoir species pose a signi�cant public health concern. Additionally, current

animal models for HEV research do not adequately replicate the course of infection seen in infections in

humans (4), nor do they develop the level of pathogenicity and progression of disease seen in

immunocompromised (5, 6) and pregnant populations (7). The �rst objective of the dissertation research was

to establish an immunoglobulin (Ig) heavy chain JH (-/-) knockout gnotobiotic pigs using CRISPR/Cas9

technology. This model aimed to deplete the B-lymphocyte population resulting in an inability to elicit a

humoral response. The resultant gnotobiotic piglets with challenged with a genotype 3 human strain of HEV

(US-2). The dynamics of acute HEV infection were then systematically determined in this unique and novel

gnotobiotic pig model in an attempt to better mimic the course of acute HEV infections observed in humans.



As the natural host for genotypes 3 and 4 (2, 8, 9) HEV infections in humans, the outbred conventional piglet

model has long been used in HEV research to study HEV biology and cross-species infection (2, 10, 11).

However, infection with HEV in conventional pigs is clinically asymptomatic with only mild to moderate hepatic

lesions (12, 13). Compared to the wild-type gnotobiotic piglets, the frequencies of B-lymphocytes in Ig heavy

chain JH (-/-) knockout pigs were signi�cantly lower despite retaining normal levels of other innate and

adaptive T-lymphocyte cell populations. After infection with HEV, the wild-type gnotobiotic piglets had higher

viral RNA loads in feces and sera when compared with the JH (-/-) knockout piglets, which suggests that the Ig

heavy chain JH (-/-) knockout pigs decreased the level of HEV replication within the host. Both the HEV-

infected wild-type and JH (-/-) knockout gnotobiotic piglets induced more pronounced lymphoplasmacytic

hepatitis and hepatocellular necrosis lesions in the liver with discernible difference when compared with a

conventional pig model. The HEV-infected JH (-/-) knockout pigs had signi�cantly enlarged livers both grossly

and as a ratio of liver/body weight when compared with the PBS mock-infected groups. Additionally, the serum

level of the liver enzyme GGT was signi�cantly elevated in the HEV-infected JH (-/-) knockout pigs and may

indicate liver damage, since the predominant source of GGT is the biliary epithelium. Therefore, the novel

gnotobiotic piglet model is a valuable tool to aid in future studies into HEV pathogenicity, an aspect which has

been di�cult to reproduce in the available animal model systems, thus far. HEV has been genetically identi�ed

from more than one dozen animal species (14). Swine serve as the primary animal reservoir for zoonotic

genotypes 3 and 4 within the species Orthohepevirus A (15, 16) and are

de�nitively linked to human infections through zoonotic and foodborne transmission of HEV (17, 18). Recently

reported identi�cation of genotype 4 HEV in fecal samples of cows and excretion of virus into cow milk (19,

20) raises concerns regarding milk and beef safety. Contradictory reports from Europe (21, 22) failed to identify

evidence of HEV infection in dairy cows. Therefore, in the second project of the dissertation, the main objective

was to determine if cattle in the United States are infected with a bovine strain of HEV. We demonstrated

evidence of an HEV-related agent in cattle with a high overall level of seroprevalence at 20.4% and herd

seroprevalence rates ranging from 16.1-68.4% depending on geographic location. In a prospective animal

study, three of the 10 calves seroconverted to IgG against HEV and this antibody was capable of neutralizing

genotype 3 human HEV. Interestingly, the elevated serum levels of GLDH appeared to correlate with the peak of

seroconversion, which is suggestive of potential liver damage. The failure to provide de�nitive evidence of

virus in cattle using broad-spectrum RT-PCR assays and MiSeq deep sequencing technology suggests a

limitation in the interpretation of HEV serological data in species such as cattle. Additionally, without de�nitive

genetic identi�cation of virus in cattle, we must be cautious in speculating the role of cattle, if any, in HEV

transmission and potential zoonotic infection. In summary, much knowledge related to HEV infection,

pathogenesis, and progression of disease is currently lacking. A challenge in �lling these knowledge gaps lies

in the extensive genetic diversity of animal strains of HEV and the unresolved determination of all potential

reservoirs capable of transmitting virus to the human population. Additionally, the lack of an adequate cell

culture model for in vitro work and limited availability of commercial diagnostic assays for all strains of HEV



makes understanding the course of infection di�cult. As this dissertation research has presented, the

identi�cation of better animal models for research and the identi�cation of all animal reservoirs are key in fully

understanding HEV and its impacts on public health. All projects included in this dissertation provided many

unforeseen complications and identi�ed numerous limitations in this �eld. While some portions of this

dissertation work carried a negative result connotation, the projects provided groundwork for follow-up studies

in the areas of novel strain identi�cation and transmission, immune responses of HEV, and novel animal model

development. Future directions of this work lead directly to the use of the gnotobiotic piglet model in a

prolonged experimental period study

in order to ascertain an understanding of the full course of infection.

This research will provide an understanding of the immune dynamics during the acute and chronic stages of

infection. With the ability to develop classical liver lesions seen in humans, the gnotobiotic piglet will �ll much-

needed knowledge gaps in HEV research. Additionally, the lack of a bovine strain of HEV identi�ed during the

course of this work, points to the need to develop better diagnostic assays with consistent analysis for HEV.

Prior con�icting studies from several countries around the world, lead the scienti�c community to consider

bovine as a potential reservoir for HEV. However, this study de�nitively determines that cattle herds in the

United States do not carry a bovine strain of HEV. Overall, the projects in this dissertation answer important

questions for the scienti�c community and will be directly linked to HEV studies carried out in our laboratory.

REFERENCES 1. Meng X-J. 2011. From barnyard to food table: the omnipresence of hepatitis E virus and risk

for zoonotic infection and food safety. Virus Res 161:23-30. 2. Meng XJ. 2010. Hepatitis E virus: animal

reservoirs and zoonotic risk. Vet Microbiol 140:256-265. 3. Kasorndorkbua C, Guenette D, Huang F, Thomas P,

Meng XJ, Halbur P. 2004. Routes of transmission of swine hepatitis E virus in pigs. J Clin Microbiol 42:5047-

5052. 4. Yugo DM, Cossaboom CM, Meng XJ. 2014. Naturally occurring animal models of human hepatitis E

virus infection. ILAR J 55:187-199. 5. Singh A, Seth R, Gupta A, Shalimar, Nayak B, Acharya SK, Das P. 2016.

Chronic hepatitis E - an emerging disease in an immunocompromised host. Gastroenterol Rep (Oxf)

doi:10.1093/gastro/gow024. 6. Haagsma EB, van den Berg AP, Porte RJ, Benne CA, Vennema H, Reimerink JH,

Koopmans MP. 2008. Chronic hepatitis E virus infection in liver transplant recipients. Liver Transpl 14:547-553.

7. Navaneethan U, Al Mohajer M, Shata MT. 2008. Hepatitis E and pregnancy: understanding the pathogenesis.

Liver Int 28:1190-1199. 8. Meng XJ, Halbur P, Shapiro M, Govindarajan S, Bruna J, Mushahwar I, Purcell R,

Emerson S. 1998. Genetic and experimental evidence for cross-species infection by swine hepatitis E virus. J

Virol 72:9714-9721. 9. Sanford BJ, Dryman BA, Huang YW, Feagins AR, Leroith T, Meng XJ. 2011. Prior infection

of pigs with a genotype 3 swine hepatitis E virus (HEV) protects against subsequent challenges with

homologous and heterologous genotypes 3 and 4 human HEV. Virus Res 159:17-22. 10. Cao D, Huang Y-W,

Meng X-J. 2010. The nucleotides on the stem-loop RNA structure in the junction region of the hepatitis E virus

genome are critical for virus replication. J Virol 84:13040-13044. 11. Cao D, Cao QM, Subramaniam S, Yugo

DM, Heffron CL, Rogers AJ, Kenney SP, Tian D, Matzinger SR, Overend C, Catanzaro N, LeRoith T, Wang H,

Pineyro P, Lindstrom N, Clark-Deener S, Yuan L, Meng XJ. 2017. Pig model mimicking chronic hepatitis E virus



infection in immunocompromised patients to assess immune correlates during chronicity. Proc Natl Acad Sci

U S A 114:6914-6923. 12. Williams TP, Kasorndorkbua C, Halbur PG, Haqshenas G, Guenette DK, Toth TE, Meng

XJ. 2001. Evidence of extrahepatic sites of replication of the hepatitis E virus in a swine model. J Clin Microbiol

39:3040-6. 13. Emerson S, Purcell R. 2003. Hepatitis E virus. Rev Med Virol 13:145-154. 14. Meng XJ. 2016.

Expanding Host Range and Cross-Species Infection of Hepatitis E Virus. PLoS Pathog 12:e1005695. 15. Pavio

N, Meng X-J, Renou C. 2010. Zoonotic hepatitis E: animal reservoirs and emerging risks. Vet Res 41:46. 16.

Takahashi M, Nishizawa T, Miyajima H, Gotanda Y, Iita T, Tsuda F, Okamoto H. 2003. Swine hepatitis E virus

strains in Japan form four phylogenetic clusters comparable with those of Japanese isolates of human

hepatitis E virus. The Journal of general virology 84:851-862. 17. Feagins AR, Opriessnig T, Guenette DK, Halbur

PG, Meng XJ. 2007. Detection and characterization of infectious Hepatitis E virus from commercial pig livers

sold in local grocery stores in the USA. J Gen Virol 88:912-7. 18. Colson P, Borentain P, Queyriaux B, Kaba M,

Moal V, Gallian P, Heyries L, Raoult D, Gerolami R. 2010. Pig liver sausage as a source of hepatitis E virus

transmission to humans. J Infect Dis 202:825-834. 19. Huang F, Li Y, Yu W, Jing S, Wang J, Long F, He Z, Yang C,

Bi Y, Cao W, Liu C, Hua X, Pan Q. 2016. Excretion of infectious hepatitis E virus into milk in cows imposes high

risks of zoonosis. Hepatology 64:350-359. 20. Yan B, Zhang L, Gong L, Lv J, Feng Y, Liu J, Song L, Xu Q, Jiang

M, Xu A. 2016. Hepatitis E Virus in Yellow Cattle, Shandong, Eastern China. Emerg Infect Dis 22:2211- 2212. 21.

Vercouter AS, Sayed IM, Lipkens Z, De Bleecker K, De Vliegher S, Colman R, Koppelman M, Supre K, Meuleman

P. 2018. Absence of zoonotic hepatitis E virus infection in Flemish dairy cows. Int J Food Microbiol 281:54-59.

22. Baechlein C, Becher P. 2017. No evidence for zoonotic hepatitis E virus infection through dairy milk in

Germany. Hepatology 65:394-395. 23. Halbur PG, Kasorndorkbua C, Gilbert C, Guenette D, Potters MB, Purcell

RH, Emerson SU, Toth TE, Meng XJ. 2001. Comparative pathogenesis of infection of pigs with hepatitis E

viruses recovered from a pig and a human. J Clin Microbiol 39:918-923. 24. Meng XJ, Purcell R, Halbur P,

Lehman J, Webb D, Tsareva T, Haynes J, Thacker B, Emerson S. 1997. A novel virus in swine is closely related

to the human hepatitis E virus. Proc Natl Acad Sci U S A 94:9860-9865. 25. Feagins A, Opriessnig T, Huang Y,

Halbur P, Meng XJ. 2008. Cross-species infection of speci�c-pathogen-free pigs by a genotype 4 strain of

human hepatitis E virus. J Med Virol 80:1379-1386. 26. Feagins AR, Cordoba L, Sanford BJ, Dryman BA, Huang

YW, LeRoith T, Emerson SU, Meng XJ. 2011. Intergenotypic chimeric hepatitis E viruses (HEVs) with the

genotype 4 human HEV capsid gene in the backbone of genotype 3 swine HEV are infectious in pigs. Virus Res

156:141-146. 27. Shukla P, Nguyen HT, Faulk K, Mather K, Torian U, Engle RE, Emerson SU. 2012. Adaptation of

a genotype 3 hepatitis E virus to e�cient growth in cell culture depends on an inserted human gene segment

acquired by recombination. J Virol 86:5697-5707. 28. Shukla P, Nguyen HT, Torian U, Engle RE, Faulk K, Dalton

HR, Bendall RP, Keane FE, Purcell RH, Emerson SU. 2011. Cross-species infections of cultured cells by hepatitis

E virus and discovery of an infectious virus-host recombinant. Proc Natl Acad Sci U S A 108:2438-2443. 29.

Nguyen HT, Torian U, Faulk K, Mather K, Engle RE, Thompson E, Bonkovsky HL, Emerson SU. 2012. A naturally

occurring human/hepatitis E recombinant virus predominates in serum but not in faeces of a chronic hepatitis

E patient and has a growth advantage in cell culture. J Gen Virol 93:526-530. 30. Meng X, Halbur P, Haynes J,

Tsareva T, Bruna J, Royer R, Purcell R, Emerson S. 1998. Experimental infection of pigs with the newly identi�ed



swine hepatitis E virus (swine HEV), but not with human strains of HEV. Arch Virol 143:1405-1415. 31. Meng

XJ, Halbur PG, Shapiro MS, Govindarajan S, Bruna JD, Mushahwar IK, Purcell RH, Emerson SU. 1998. Genetic

and experimental evidence for cross-species infection by swine hepatitis E virus. J Virol 72:9714-9721. 32.

Huang YW, Haqshenas G, Kasorndorkbua C, Halbur PG, Emerson SU, Meng XJ. 2005. Capped RNA transcripts

of full-length cDNA clones of swine hepatitis E virus are replication competent when transfected into Huh7

cells and infectious when intrahepatically inoculated into pigs. J Virol 79:1552-1558. 16. 29. 41. 56. 69. 81. 93.

15 27 40 52 1 2 4 6 7 8 10 11 12 13 14 15 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45

46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80

81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111

112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136

137 138 139 140 141 142 143 144 145 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162

163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187

188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204

similarity index 13% - virginia tech..."new norovirus study findings have been reported by...

Documents