ribosomal protein s12 and aminoglycoside antibiotics modulate a

Ribosomal Protein S12 and Aminoglycoside AntibioticsModulate A-site mRNA Cleavage and Transfer-MessengerRNA Activity in Escherichia coli*

Received for publication, September 3, 2009, and in revised form, September 21, 2009 Published, JBC Papers in Press, September 23, 2009, DOI 10.1074/jbc.M109.062745

Laura E. Holberger‡ and Christopher S. Hayes‡§1

From the ‡Department of Molecular, Cellular, and Developmental Biology and the §Biomolecular Science and EngineeringProgram, University of California, Santa Barbara, California 93106-9610

Translational pausing in Escherichia coli can lead to mRNAcleavage within the ribosomal A-site. A-site mRNA cleavage isthought to facilitate transfer-messenger RNA (tmRNA)�SmpB-mediated recycling of stalled ribosome complexes. Here, wedemonstrate that the aminoglycosides paromomycin and strep-tomycin inhibitA-site cleavage of stop codons during inefficienttranslation termination. Aminoglycosides also induced stopcodon read-through, suggesting that these antibiotics alleviateribosome pausing during termination. Streptomycin did notinhibit A-site cleavage in rpsL mutants, which express strepto-mycin-resistant variants of ribosomal protein S12. However,rpsL strains exhibited reducedA-sitemRNAcleavage comparedwith rpsL� cells. Additionally, tmRNA�SmpB-mediated SsrApeptide tagging was significantly reduced in several rpsL strainsbut could be fully restored in a subset of mutants when treatedwith streptomycin. The streptomycin-dependent rpsL(P90K)mutant also showed significantly lower levels of A-site cleavageand tmRNA�SmpB activity. Mutations in rpsD (encoding ribo-somal protein S4), which suppressed streptomycin dependence,were able to partially restore A-site cleavage to rpsL(P90K) cellsbut failed to increase tmRNA�SmpB activity. Taken together,these results show that perturbations to A-site structure andfunction modulate A-site mRNA cleavage and tmRNA�SmpBactivity. We propose that tmRNA�SmpB binds to streptomycin-resistant rpsL ribosomes less efficiently, leading to a partial lossof ribosome rescue function in these mutants.

Translational pausing in Escherichia coli elicits a uniqueRNase activity that cleaves theA-site codonwithin paused ribo-somes (1, 2). A-sitemRNA cleavage results in a ribosome that isarrested at the 3� end of a truncated transcript. In eubacteria,these stalled ribosomes are “rescued” by the tmRNA�SmpB2quality control system. tmRNA is a specialized RNA that func-tions as both a transfer RNA and a messenger RNA to removestalled ribosomes from truncatedmessages. tmRNAacts first asa tRNA to bind the ribosomal A-site and add its charged Alaresidue to the nascent peptide chain (3, 4). The truncated mes-sage is then released, and the ribosome resumes translationusing a small open reading frame within tmRNA to add the

SsrA peptide tag to the nascent chain (3, 4). SmpB is atmRNA-binding protein that is required for both the delivery oftmRNA to the ribosome and translation of the SsrA peptide tag(5, 6). The tmRNA system performs at least three distinct qual-ity control functions. First, the SsrA peptide tag targets proteinsfor rapid degradation byClpXP and other ATP-dependent pro-teases (7–9), ensuring that incomplete polypeptides do notaccumulate in the cell. Second, tmRNA�SmpB mediates therecycling of stalled ribosomes into 50 and 30 S subunits, whichare then able to reinitiate protein synthesis on other messages.Finally, tmRNA�SmpB facilitates truncated mRNA turnover bydelivering RNase R to the released transcripts during ribosomerescue (10). Because tmRNA�SmpB is not recruited to ribo-somes that are paused on full-lengthmRNAs (11), A-site cleav-age is thought to produce the truncated transcripts required fortmRNA�SmpB-mediated ribosome rescue (1, 2). In this man-ner, A-site mRNA cleavage and tmRNA�SmpB are proposed tocollaborate in the rescue of distressed ribosomes.A-sitemRNA cleavage was first identified as an in vitro activ-

ity of the E. coli RelE protein (12). Subsequently, translationalpauses were found to induce A-site cleavage in cells that lackRelE and all of its known homologs and paralogs (1, 2, 13, 14).We have recently discovered that RelE-independent A-sitecleavage requires at least two distinct RNase activities. RNase IIfirst degrades mRNA to the leading edge of the paused ribo-some, allowing for subsequent cleavage in the A-site codon(14). This ribosome border degradation is presumably requiredfor subsequent A-site nuclease activity, because A-site cleavagedoes not occur in �RNase II cells (14). None of the knownE. coli RNases cleave the A-site codon during translationalpausing, and the ribosome itself has been proposed to play acatalytic role (1, 2, 14). The 30 S ribosome subunit binds theA-site codon and is therefore appropriately positioned tocatalyze A-site cleavage. However, the A-site is dynamic andcould recruit an unknown RNase in the same manner inwhich it binds translation factors. Regardless of the catalyticscenario, the 30 S A-site defines the mRNA substrate, andthe ribosome must, at a minimum, act as a scaffold for theA-site nuclease.TheA-site codon is held within the decoding center of the 30

S subunit, where base-pairing interactions between the codonand the incoming tRNA are monitored (15, 16). Three 16 SrRNA residues, G530, A1492, and A1493 (Fig. 1), make direct con-tact with the A-site codon. A1492 and A1493 bind in the minorgroove of the codon-anticodon helix, ensuring that only

* This work was supported by National Institutes of Health Grant GM078634.1 To whom correspondence should be addressed: Life Sciences Technology

Bldg., Rm. 3105, University of California, Santa Barbara, CA 93106-9610.Tel.: 805-893-2028; Fax: 805-893-4724; E-mail: [email protected].

2 The abbreviation used is: tmRNA, transfer-messenger RNA.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 284, NO. 46, pp. 32188 –32200, November 13, 2009© 2009 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

32188 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 46 • NOVEMBER 13, 2009

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Watson-Crick base pairs are allowed at the first two positions(15, 16). Although 16 S rRNA is critical for the differentiation ofcognate from near cognate tRNA, ribosomal proteins S12, S4,and S5 also play important roles in decoding. The ram (ribo-some ambiguity) mutations in rpsD and rpsE (encoding S4 andS5, respectively) are thought to stabilize a closed A-site confor-mation characterized by high affinity for aminoacyl-tRNA (16–18). The ram conformation stabilizes the binding of near cog-nate tRNA and thereby increases the frequency of decodingerrors. The aminoglycoside antibiotic streptomycin binds tothe 30 SA-site (Fig. 1) and induces decoding errors, presumablyby stabilizing the ram conformation (16, 19). Streptomycinresistance is conferred by a variety of mutations in rpsL, whichencodes ribosomal protein S12. Streptomycin-resistant S12variants are predicted to stabilize an open A-site conformationand thereby counteract the closed conformation induced bystreptomycin binding (16, 18). In general, streptomycin-resis-tant rpsL alleles also confer an “error-restrictive” phenotypecharacterized by reduced A-site affinity for near cognate tRNAand hyperaccurate decoding (20). Neamine-containing amin-oglycosides, such as paromomycin, also stabilize the closedA-site conformation but have ribosome binding sites that aredistinct from that of streptomycin (Fig. 1) (18, 19).In this report, we ask whether structural perturbations to

the ribosomal A-site influence A-site mRNA cleavage andtmRNA�SmpB activities. We show that two aminoglycosideantibiotics, streptomycin and paromomycin, inhibit A-sitecleavage of stop codons during inefficient translation termina-tion. Aminoglycosides also induced stop codon read-through,suggesting that these antibiotics reduce A-site cleavage by alle-viating the underlying translational pause. A-site cleavage andtmRNA�SmpB-mediated SsrA peptide tagging activities weresignificantly reduced in several streptomycin-resistant rpsLmutants. In general, SsrA peptide tagging was reduced in cellscontaining error-restrictive ribosomes. However, streptomycinwas able to fully restore peptide tagging activity in a subset ofrpsL strains, without significantly affecting error restriction in

these mutants. It appears that tmRNA may be more sensitivethan tRNA to structural changes in the A-site, perhaps reflect-ing the unique manner in which tmRNA�SmpB binds the ribo-some. Based on these results, we propose that rpsL mutationsspecifically interfere with the recruitment of tmRNA�SmpB tothe ribosome.

EXPERIMENTAL PROCEDURES

Bacterial Strains and Plasmids—Table 1 lists the bacterialstrains and plasmids used in this study. All bacterial strainswere derivatives of E. coli strain X90. Streptomycin-resistantalleles of rpsL (encoding ribosomal protein S12)were generatedby phage � Red-mediated recombination using random oligo-nucleotide libraries as described previously (21). The codonsfor S12 residues Lys42 and Pro90 weremutagenized using oligo-nucleotides rpsL-K42X, (5�-CAT ACT TTA CGC AGC GCGGAG TTC GGT TTN NNA GGA GTG GTA GTA TAT ACACGA GTA CAT) and rpsL-P90X (5�-GCA CCA CGT ACGGTG TGG TAA CGA ACA CCN NNG AGG TCT TTA ACACGA CCG CCA CGG ATC), respectively, and streptomycin-resistant mutants were selected as described (21). The rpsLgene was amplified from streptomycin-resistant mutants usingoligonucleotides rpsL-Nco (5�-ACC CAT GGT TAA GCACCC CAG CC) and rpsL-Bam, (5�-TTC GGA TCCGGCAGAATT TTA CGC) and sequenced using rpsL-seq (5�-CTC CTCGAG TTT AGT TTG ACA TTT AAG TTA AAA CG). Strep-tomycin-independent suppressor mutations were obtained byplating rpsL(P90K) streptomycin-dependent cells on antibiot-ic-free plates and selecting for streptomycin-independentmutants. The rpsD and rpsE genes (encoding ribosomal pro-teins S4 and S5, respectively) were amplified from streptomy-cin-independent cells using oligonucleotides, rpsD-for(5�-GCTCTGAACGCCGCAGGTTTCCGC), rpsD-rev (5�-TTG CTC GAT ATC AAC CAG GCG CGG), rpsE-for (5�-CGT TCCGGGTTCCAATATCATGGTCG), and rpsE-rev(5�-CAA GCA GCG TTG CCT TGT GTT TCG G). The rpsDand rpsE PCR products were sequenced using oligonucleotidesrpsD-seq (5�-GAT CCC TCA TAA CGG TTG TCG TCC) andrpsE-seq (5�-GGCAGATGCTGCCCGTGAAGCTGGCC).The details of all strain constructions are available uponrequest.Plasmids pKW1, pKW11, pKW23, pPW500, pCH201, and

pAD8 have been described previously (8, 22–24). DNA frag-ments encoding the trcpromoter and theN-terminal domain ofphage � cI repressor (�N) were PCR-amplified from plasmidpPW500 using oligonucleotide primers containing restrictionsites (underlined bases). The �N-flag-His6(PP) construct wasgenerated with oligonucleotides lacI-HpaI (5�-TAT CCC GCCGTT AAC TAG TAT CAA ACA GGA TTT TCG C) andHis6(PP)-SacI (5�-AATGAGCTCAATTAGGGCGGATGATGG TGA TGA TGG TGC). The �N-flag-His6(LA) fragmentwas generated with oligonucleotides His6(LA)-SacI (5�-ACCGAG CTC AAT TAT GCC AGA TGA TGG TGA TGA TGG)and lacI-HpaI. The resulting PCR fragments were digestedwithHpaI and SacI and ligated to plasmid pTrc99A (GEHealthcare).The FLAG-�N expression constructs were generated by PCRusing oligonucleotide �N-NdeI (5�-CAATTTCACACAGGAAAC AGC ATA TGG GCA CAA AAA AGA AAC C) in con-

FIGURE 1. Aminoglycoside binding sites in the ribosomal A-site. Thedecoding center of the 30 S subunit is depicted with helix 44 (h44) of 16 SrRNA and ribosomal protein S12. 16 S rRNA residues G530, A1492, and A1493 areindicated along with the ribosome binding sites of streptomycin (red) andparomomycin (green). Mutations that change S12 residues Lys42 and Pro90 areable to confer both streptomycin-resistant and streptomycin-dependentphenotypes. These data were taken from PDB accession number 1FJG (19)and rendered with PyMol.

Ribosomal Protein S12 and SsrA Peptide Tagging

NOVEMBER 13, 2009 • VOLUME 284 • NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 32189


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

junction with �N(PP)-SacI (5�-GCG GAG CTC TCG AATTAG GGC GGA GAC ATG CTA ACC GCT TCA TAC),�N(LA)-SacI (5�-TTG AGC TCT CGA ATT ATG CCA GAGACA TGC TAA CC), and �N(PPQ)-SacI (5�-GCG GAG CTCTCG AAT TGG GGC GGA GAC ATG CTA ACC GCT TCATAC). The resulting PCR products were digested with NdeIand SacI and ligated to plasmid pFG501. Plasmid pFG501 is amodified version of pTrc99A (GE Healthcare) encoding theFLAG epitope between NcoI and NdeI restriction sites, facili-tating the construction of N-terminal FLAG fusion proteins(25).mRNA Expression and Analysis—E. coli strains were grown

overnight at 37 °C in LBmedium supplementedwith the appro-priate antibiotics (150 �g/ml ampicillin, 25 �g/ml tetracycline,or 50 �M streptomycin). The following day, cells were resus-pended at anA600 of 0.05 in 15ml of freshmediumand grown at37 °C with aeration. Once cultures reached A600 of �0.5,mRNA expression was induced with 2 mM isopropyl �-D-thio-galactopyranoside, and simultaneously treated with paromo-mycin or streptomycin at the indicated concentrations. Afterfurther incubation for 15min, the cultures were poured into 15ml of ice-cold methanol and collected by centrifugation, andcell pellets were frozen at �80 °C. Total RNA was extractedfrom cell pellets using 1.0 ml of a solution containing 0.6 M

ammonium isothiocyanate, 2 M guanidinium isothiocyanate,0.1 M sodium acetate (pH 4.0), 5% glycerol, 40% phenol. Thedisrupted cell suspension was extracted with 0.2 ml of chloro-

form, and the aqueous phase was removed and added to anequal volume of isopropyl alcohol to precipitate total RNA.RNA pellets were washed once with ice-cold 75% ethanol anddissolved in 10 mM sodium acetate (pH 5.2), 1 mM EDTA.Northern blot and S1 nuclease protection analyses of all

mRNAswere performed as described (1). Oligonucleotide Trc-RBS (5�-CAT GGT CTG TTT CCT GTG TGA AAT TG) was5�-end-labeled with [�-32P]ATP and used as a probe for North-ern blot hybridizations. Oligonucleotides cI(PP) S1 (5�-GCAGGT CGA CTC TAG AGG ATC CCC GGG TAC CGA GCTCGA GTT AGG GCG GAG ACA TGC TAA CCG CTT CATACA TCT CGT AG) and cI-His6(PP) S1 (5�-GGT CGA CTCTAG AGG ATC CCC GGG TAC CGA GCT CAA TTA GGGCGG ATG ATG GTG ATG ATG GTG CTT GTC ATC GTCGTC CTT GT) were 3�-end-labeled with [�-32P]dideoxy-ATPand used as probes for nuclease S1 protection assays. Northernblots were visualized by phosphorimaging, and A-site mRNAcleavage was quantified using Quantity One software (Bio-Rad). A-site cleavage efficiency was determined as a percentageof total transcripts, defined as full-length transcripts plusA-site-truncated transcripts.Protein Expression and Western Blot Analysis—Strains were

cultured as described above for RNAanalysis. Total proteinwasextracted from frozen cells in 8 M urea, 10 mM Tris-HCl (pH8.0), 150 mM NaCl, and His6-tagged proteins purified by Ni2�-nitrilotriacetic acid affinity chromatography as described pre-viously (23). SsrA(His6)-tagged protein was further purified

TABLE 1Bacterial strains and plasmids

Strain or plasmid Genotype or descriptiona Ref.

Bacterial strainsX90 F� lacIq lac�pro�/ara ��lac-pro� nalA argE�am� rif thi-1CH22 X90 ssrA::cat, CmR Ref. 22CH165 X90 �ssrA Ref. 1CH3676 CH165 rpsL(K42R), StrR This studyCH3522 CH165 rpsL(K42N), StrR This studyCH3666 CH165 rpsL(K42T), StrR This studyCH3662 CH22 rpsL(K42A), CmR, StrR This studyCH3664 CH165 rpsL(K42C), StrR This studyCH3665 CH165 rpsL(K42S), StrR This studyCH3667 CH165 rpsL(K42V), StrR This studyCH3668 CH165 rpsL(K42Y), StrR This studyCH3656 CH165 rpsL(P90F), StrR This studyCH3659 CH165 rpsL(P90Y), StrR This studyCH3683 CH165 rpsL(P90H), StrR This studyCH3658 CH165 rpsL(P90N), StrR This studyCH3700 CH165 rpsL(P90Q), StrP This studyCH3911 CH165 rpsL(P90R), StrD This studyCH3874 CH22 rpsL(P90K), CmR, StrD This studyCH4850 CH22 rpsL(P90K) rpsD-1(Q53K), CmR, StrS This studyCH4851 CH22 rpsL(P90K) rpsD-2(N85Y), CmR, StrS This studyCH4852 CH22 rpsL(P90K) rpsD-3(Y203amb), CmR, StrS This studyCH4853 CH22 rpsL(P90K) rpsD-4(A192-TLTNT), CmR, StrS This study

PlasmidspTrc99A Isopropyl 1-thio-�-D-galactopyranoside-inducible expression vector, AmpR GE HealthcarepFG501 FLAG-encoding derivative of pTrc99A, AmpR Ref. 25pFLAG-�N(PP) pFG501 derivative for inducible expression of FLAG-�N(PP), AmpR This studypFLAG-�N(LA) pFG501 derivative for inducible expression of FLAG-�N(LA), AmpR This studypPW500 Expresses �N-FLAG-His6 from trp leader terminated nonstop mRNA, AmpR Ref. 8p�N-FLAG-His6(PP) pTrc99A derivative expressing �N-FLAG-His6(PP), AmpR This studyp�N-FLAG-His6(LA) pTrc99A derivative expressing �N-FLAG-His6(LA), AmpR This studypKW1 pACYC184 derived plasmid, TetR Ref. 22pKW11 pKW1-derived plasmid expressing wild-type tmRNA, TetR Ref. 22pKW23 pKW1-derived plasmid expressing tmRNA(DD), TetR Ref. 22pCH201 pKW1-derived plasmid expressing tmRNA(His6), TetR Ref. 23pAD8 Encodes Renilla-firefly luciferase fusion interrupted by UGA stop codon, AmpR Ref. 24

a AmpR, ampicillin resistant; CmR, chloramphenicol-resistant; StrR, streptomycin-resistant; StrD, streptomycin-dependent; StrP, streptomycin-pseudodependent; StrS, strep-tomycin-sensitive; TetR, tetracycline-resistant.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

by reverse-phase high pressure liquid chromatography asdescribed (26), for electrospray ionization mass spectrometryanalysis. Ni2�-nitrilotriacetic acid-purified proteins wereresolved on SDS-polyacrylamide gels, followed by staining withCoomassie Blue. Stained gels were scanned using the LI-COR�Odyssey infrared imaging system, and the percentage ofSsrA(DD)-tagged chains was quantified as described (13).Reported tagging efficiencies are the means � S.E. for threeindependent experiments. Western blot analysis was per-formed using the LI-COR� Odyssey infrared imaging systemaccording to the manufacturer’s instructions with minormodifications. Briefly, 10 �g of total urea-soluble proteinwas resolved by SDS-PAGE, followed by electrotransfer tonitrocellulose membranes. Membranes were blocked with2% (w/v) bovine serum albumin in phosphate-buffered saline(2.7 mM KCl, 1.8 mM KH2PO4, 137 mM NaCl, 10.1 mM

Na2HPO4 (pH 7.4)), followed by incubation overnight withanti-SsrA(DD) polyclonal and anti-FLAG M2 monoclonalantibodies (Sigma). IRDyeTM 800-conjugated anti-mouse(Rockland Immunochemicals) and Alexafluor 680-conju-gated anti-rabbit (Invitrogen) secondary antibodies wereused for fluorescence detection.Dual-Luciferase Assay—E. coli strains carrying plasmid

pAD8 (24) were grown overnight in LBmedium supplementedwith 150�g/ml ampicillin. The following day, cells were diluted1:200 into fresh LB containing 150 �g/ml ampicillin and 50 �M

streptomycin as indicated. Cultures were grown at 37 °C tomidlogarithmic phase, collected by centrifugation, and resus-pended in 200 �l of lysis buffer (1 mg/ml lysozyme, 10 mM

Tris-HCl (pH 8.0), 1 mM EDTA). Cell suspensions were incu-bated on ice for 10 min and then frozen in a dry ice/ethanolbath. Samples were then thawed on ice, and 5 �l of each lysatewas assayed for firefly and Renilla luciferase activities using theDual-Luciferase reporter assay system (Promega). For eachreaction, luminescence (expressed as counts/s) was collectedover a 10-s interval using a model 1420 Victor3 V plate readerwith injectors (PerkinElmer Life Sciences). Each lysate wasassayed in triplicate, and all rpsL mutants were independentlytested at least three times.

RESULTS

Aminoglycoside Antibiotics Inhibit A-site mRNA Cleavage—We examined the effect of streptomycin on A-site mRNAcleavage using a plasmid-borne construct that expresses theN-terminal domain of � phage cI repressor containing a C-ter-minal Pro-Pro sequence (Fig. 2A). The C-terminal Pro-Promotif interferes with normal translation termination and is suf-ficient to elicit A-site cleavage at stop codons (1, 27). This con-struct also encodes an N-terminal FLAG epitope to facilitatetracking of the reporter protein by Western blot (Fig. 2A).Expression of FLAG-�N(PP) resulted in the accumulation of

FIGURE 2. Streptomycin inhibits A-site mRNA cleavage during inefficienttranslation termination. A, FLAG-�N expression constructs. The generalizedflag-�N transcript is shown schematically along with the Northern probe-binding site. The 3�-coding sequences of the flag-�N(PP), flag-�N(LA), andflag-�N(UAA3Gln) transcripts are shown. The UAA3Gln mutation changesthe UAA stop codon to a glutamine codon, mimicking stop codon read-through. The boxed P and A indicate the positions of the ribosomal P- andA-sites during translation termination. B, Northern blot analysis of flag-�N(PP)mRNA. The flag-�N(PP) transcript was expressed in tmRNA� and �tmRNAcells as indicated. �tmRNA cells were treated with increasing concentrationsof streptomycin for 15 min, total RNA was isolated, and the effects on A-sitecleavage were assessed by Northern blot. The 3�-end of the truncated tran-script was mapped to the stop codon by S1 nuclease protection analysis (datanot shown). The positions of full-length and A-site-truncated transcripts are indi-cated. C, Western blot analysis of protein synthesis in streptomycin-treated

cells. Expression of FLAG-�N(PP) was induced in �tmRNA cells concomitantlywith the addition of 7.5 �M streptomycin, and samples were taken at theindicated times for Western blot using FLAG-specific antibodies. Streptomy-cin induced the production of an alternative translation product that co-mi-grated with protein expressed from flag-�N(UAA3Gln), consistent with stopcodon read-through. Streptomycin did not induce stop codon read-throughduring FLAG-�N(LA) synthesis.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

truncatedmRNA in cells lacking tmRNA (�tmRNA) but not intmRNA� cells (Fig. 2B). A-site-cleaved transcripts do not typ-ically accumulate in tmRNA� cells, presumably becausetmRNA�SmpB releases the truncated messages from stalledribosomes, thereby facilitating their rapid degradation (1, 10,28). S1 nuclease protection analysis confirmed that these tran-scripts were truncated in the stop codon (data not shown), con-sistent with A-site mRNA cleavage during inefficient transla-tion termination (1, 2). Truncated mRNA was not detected incells expressing �N with a C-terminal Leu-Ala sequence (Figs.1A) (data not shown), in agreement with previous studiesshowing that this C-terminal peptide sequence does not induceribosome pausing during translation termination (14, 27).Treatment of �tmRNA cells with streptomycin led to a dose-dependent decrease in A-site truncated mRNA without affect-ing the levels of full-length transcript (Fig. 2B). These resultssuggest that streptomycin inhibits A-site mRNA cleavage dur-ing inefficient translation termination.Translation initiation and ribosome recycling after termina-

tion are both inhibited at high aminoglycoside concentrations(29, 30). Ribosomesmust translate to the stop codon in order toelicit A-site cleavage in our system; therefore, it is possible thatstreptomycin reduced A-site cleavage indirectly by shuttingdown protein synthesis. To test whether streptomycin inhib-ited protein synthesis under these conditions, wemeasured theaccumulation of FLAG-�N(PP) as a function of time in theabsence and presence of streptomycin (Fig. 2C). FLAG-�N(PP)synthesis was not inhibited by 7.5 �M streptomycin during thefirst 20 min of treatment and continued over the entire timecourse (Fig. 2C). Streptomycin significantly inhibited proteinsynthesis after 40min of treatment (data not shown). However,we note that A-site cleavage was assessed after 15 min of strep-tomycin treatment, a point at which there was no decrease inreporter protein synthesis. Although protein synthesis was notinhibited, a prominent FLAG-reactive alternative translationproduct was observed in cells treated with streptomycin (Fig.2C). Streptomycin increases the frequency ofmiscoding events,including stop codon read-through (31, 32), which couldaccount for this product. To ascertain whether streptomycininduced read-through, we mutated the flag-�N(PP) stop codonto a Gln codon to mimic the read-though product and foundthat the resulting protein co-migrated with the streptomy-cin-induced product on SDS-polyacrylamide gels (Fig. 1, Aand C). Moreover, the alternative product was not detectedin streptomycin-treated cells expressing the control FLAG-�N(LA) protein (Fig. 2C). Taken together, these results sug-gest that streptomycin-induced miscoding occurs specifi-cally when ribosomes pause during translation termination.To determinewhether neamine-containing aminoglycosides

also influence A-site mRNA cleavage, we examined the effectsof paromomycin using an additional �N reporter construct.The �N-flag-His6(PP) construct is derived from the previouslycharacterized pPW500 plasmid (8), which encodes internalFLAG and His6 peptide epitopes that allow for immunodetec-tion and affinity purification (Fig. 3A). Like the flag-�N(PP)construct described above, the �N-flag-His6(PP) message alsoundergoes A-site cleavage in �tmRNA cells (Fig. 3B) (data notshown). A-site mRNA cleavage was significantly inhibited in

FIGURE 3. Paromomycin inhibits A-site mRNA cleavage during inefficienttranslation termination. A, �N-FLAG-His6 expression constructs. The gener-alized �N-flag-His6 transcript is shown schematically along with the Northernprobe-binding site. The 3�-coding sequences of �N-flag-His6(PP) and �N-flag-His6(LA) messages are shown. The boxed P and A indicate the positions of theribosomal P- and A-sites during translation termination. B, Northern blot anal-ysis of �N-flag-His6(PP) mRNA. The �N-flag-His6(PP) message was expressed intmRNA� and �tmRNA cells as indicated. �tmRNA cells were treated withincreasing concentrations of paromomycin, and the effects on A-site cleav-age were assessed by Northern blot. The 3�-end of the truncated transcriptwas mapped to the stop codon by S1 nuclease protection analysis (data notshown). The positions of full-length and A-site-truncated transcripts are indi-cated. C, Western blot analysis of protein synthesis in paromomycin-treatedcells. Expression of �N-FLAG-His6(PP) was induced in �tmRNA cells concom-itantly with the addition of paromomycin at various concentrations. Cellswere collected after 20 min, and total urea-soluble protein was isolated andsubjected to Western blot analysis using FLAG-specific antibodies. The rate of�N-FLAG-His6(PP) synthesis in �tmRNA cells treated with 20 �M paromomy-cin was also compared with untreated cells. Finally, paromomycin inducedstop codon read-through during the synthesis of �N-FLAG-His6(PP) but not�N-FLAG-His6(LA).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

�tmRNA cells treated with increasing concentrations of paro-momycin (Fig. 3B). Western blot analysis showed that�N-FLAG-His6(PP) synthesis was not dramatically reduced in�tmRNAcells treatedwith up to 30�Mparomomycin (Fig. 3C).Moreover, time course analysis showed that �N-FLAG-His6(PP) accumulated at similar rates in either the absence orpresence of 20 �M paromomycin (Fig. 3C). Although �N-FLAG-His6(PP) synthesis was not inhibited, paromomycin induced sig-nificant stop codon read-through (Fig. 3C). Similar to the findingswith streptomycin, paromomycin-induced read-through was notobserved during expression of the control �N-FLAG-His6(LA)protein, which undergoes efficient translation termination (Fig. 2,A and C). These results show that aminoglycosides inhibit A-sitemRNA cleavage at concentrations that still permit efficient pro-tein synthesis in �tmRNA cells. The accompanying increase instop codon read-through suggests that aminoglycosides mayinhibit A-site cleavage by relieving the underlying translationalpause during termination.Aminoglycosides and SsrA Peptide Tagging Activity—A-site

cleavage is thought to be required for tmRNA�SmpB recruit-ment to ribosomes during inefficient translation termination(1, 2). We reasoned that if aminoglycosides alleviate ribosomepausing via stop codon read-though, then they should alsoreduce the attendant SsrA peptide tagging activity. We firstconfirmed peptide tagging at the C terminus of FLAG-�N(PP)using tmRNA(His6), which encodes the protease-resistantSsrA(His6) tag (23, 33). FLAG-�N(PP) was expressed intmRNA(His6) cells, and SsrA(His6)-tagged proteins were puri-fied for mass spectrometry analysis. The major tagged producthad a mass of 13,365 Da, corresponding to SsrA(His6) tag addi-tion after the C-terminal proline residue of FLAG-�N(PP) (Fig.4A). We also used mass spectrometry to confirm C-terminaltagging of the �N-FLAG-His6(PP) reporter protein with thestable SsrA(DD) tag (data not shown). These results confirmprevious work showing that A-site cleavage at stop codons in�tmRNA cells is correlated with SsrA peptide tagging of full-length proteins in tmRNA� cells (1).

We next tested whether aminoglycosides inhibitedSsrA(DD) peptide tagging at the C terminus of the reporterproteins. We note that tmRNA� cells are more resistant tostreptomycin than �tmRNA cells (34), and therefore higherstreptomycin concentrations were used in these tagging exper-iments (comparedwith the data shown in Fig. 2B).Western blotanalysis showed that streptomycin and paromomycin bothinhibited SsrA(DD) peptide tagging and concomitantlyincreased stop codon read-through (Fig. 4B).However, total�Nreporter protein synthesis also appeared to be inhibited by theaminoglycosides, particularly in paromomycin-treated cells(Fig. 4B). The inhibition of �N expression in these experimentswas perplexing, because both aminoglycosides had little effecton protein synthesis in �tmRNA cells (see Figs. 1C and 2C). Todetermine whether SsrA(DD) peptide tagging was inhibited toa greater extent than�Nsynthesis, we quantified and comparedthe relative decreases in SsrA(DD)- and FLAG-dependent flu-orescence from Western blots. We found that streptomycininhibited SsrA(DD)-tagging to a greater extent than it inhibitedFLAG-�N(PP) synthesis (Fig. 4B) (data not shown). However,SsrA(DD) peptide tagging and �N-FLAG-His6(PP) synthesis

were inhibited to the sameextentbyparomomycin treatment (Fig.4B) (data not shown). Therefore, although these results suggestthat streptomycin inhibits SsrA tagging via stop codon read-through, tmRNA�SmpBactivitywas also inhibiteddue to a generaldecrease in protein synthesis in paromomycin-treated cells.In principle, it is possible that aminoglycosides directly

inhibit tmRNA�SmpB activity. Indeed, paromomycin has been

FIGURE 4. SsrA peptide tagging during aminoglycoside treatment.A, mass spectrometry of SsrA(His6)-tagged FLAG-�N(PP). FLAG-�N(PP) wasexpressed in tmRNA(His6) cells, and SsrA(His6)-tagged protein was purified byNi2� affinity chromatography for mass spectrometry. The major species had amass of 13,365 Da, corresponding to SsrA(His6) tag addition after the C-ter-minal Pro residue (calculated mass, 13,364.9 Da). B, Western blot analysis ofSsrA(DD) peptide tagging during aminoglycoside treatment. FLAG-�N(PP)and �N-FLAG-His6(PP) were expressed in tmRNA(DD) cells treated withincreasing concentrations of aminoglycosides for 20 min. Total urea-solubleprotein was analyzed by Western blot using antibodies specific for the FLAGand SsrA(DD) epitopes. Individual fluorescence channels and the merged sig-nals are presented.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

reported to interfere with distinctstages of the tmRNA�SmpB activitycycle (35, 36). To determinewhether aminoglycosides inhibitSsrA peptide tagging independentof stop codon read-through, weexamined tmRNA�SmpB activitywith ribosomes stalled on nonstopmRNA. Nonstop messages lack in-frame stop codons. Therefore, ribo-somes translate to the 3�-end ofthese “truncated” transcripts, wherethey stall with no codon in theA-site (Fig. 5A). In tmRNA� cells,these stalled ribosomes are rapidlyrescued by tmRNA�SmpB, and alarge proportion of the proteinchains are SsrA-tagged (3, 22). In�tmRNA cells, the untagged nas-cent chains are released from thestalled ribosome by an uncharac-terized process (Fig. 5A). Thus,tmRNA�SmpB activity can be as-sessed by measuring the ratio oftagged to untagged protein synthe-sized from nonstop mRNA (Fig.5A). Expression of �N-FLAG-His6from nonstop mRNA in �tmRNAcells resulted in the accumulation ofuntagged protein, whereas almostall of the �N-FLAG-His6 chainswere tagged in tmRNA(DD) cells(Fig. 5B). When tmRNA(DD) cellswere treated with increasing con-centrations of streptomycin orparomomycin, we again saw thatreporter protein synthesis wassomewhat inhibited (Fig. 5B). How-ever, aminoglycoside treatment didnot increase the proportion ofuntagged �N-FLAG-His6 chains(Fig. 5B). These results indicate thatunder these experimental condi-tions, aminoglycosides do not spe-cifically inhibit the tmRNA�SmpBsystem.A-site mRNACleavage in Strepto-

mycin-resistant rpsL Mutants—Inaddition to their well describedeffects on the ribosome, aminogly-cosides also bind and modulate theactivity of other catalytic RNAs (37–39). To determine whether amino-glycosides influence A-site cleavagedue to their effects on translation,we examined streptomycin-resist-ant rpsL mutants. The ribosomesfrom rpsL mutants are altered in

FIGURE 5. tmRNA�SmpB-mediated ribosome rescue from nonstop mRNA during aminoglycoside treat-ment. A, schematic of tmRNA-mediated and tmRNA-independent ribosome recycling. The �N-flag-His6(trpL) non-stop message is depicted, and the positions of the encoded flag and His6 peptide epitopes are indicated. The�N-flag-His6 open reading frame was fused to the intrinsic transcription terminator from the E. coli trp leader tocreate a transcript lacking in-frame stop codons. Ribosomes arrested on nonstop messages are efficiently rescuedby the tmRNA�SmpB system. In �tmRNA cells, the nascent chains are released from these stalled ribosomes by anuncharacterized pathway, and untagged protein accumulates. B, Western blot analysis of SsrA(DD) peptide taggingduring nonstop mRNA expression. The �N-flag-His6(trpL) transcript was expressed in �tmRNA and tmRNA(DD) cellsas indicated. tmRNA(DD) cells were treated with increasing concentrations of streptomycin and paromomycin for20 min. Total urea-soluble protein was analyzed by Western blot using antibodies specific for the FLAG and SsrA(DD)epitopes. Individual fluorescence channels and the merged signals are presented.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

ribosomal protein S12 and typically have much lower affinityfor streptomycin (40–42). To generate a variety of rpsLmuta-tions, we used phage �Red-mediated recombination and oligo-nucleotide libraries to randomize codons corresponding to S12residues Lys42 and Pro90 (see Fig. 1) and then selected themutagenized cells for streptomycin-resistant mutants. Wefocused on Lys42 and Pro90 because changes in these residuesare most commonly associated with streptomycin resistance(20, 43). We sequenced the rpsL gene from 100 streptomycin-resistant mutants and identified 16 different missense muta-tions: nine Lys42 alleles and seven Pro90 alleles (Table 2).Because oligonucleotide recombineering allows the routineisolation of unusual missense mutations (21), many of thesemutations have not been previously identified in E. coli. Exam-ination of rpsL mutant growth rates in the presence andabsence of streptomycin led to the identification of twostreptomycin-dependent mutants, rpsL(P90K) and rpsL(P90R),and one streptomycin pseudodependent mutant, rpsL(P90Q),which grew almost 2-fold faster in the presence of streptomycin(Table 2).Initially, we examined A-site mRNA cleavage in three previ-

ously characterized mutants: rpsL(K42T), rpsL(K42R), andrpsL(K42A). The rpsL(K42T)mutation is a classical streptomy-cin resistance allele that produces error-restrictive ribosomes.In contrast, rpsL(K42R) is unique among known streptomycinresistance alleles in that its phenotype is non-restrictive (20).Green and co-workers (44) recently described the rpsL(K42A)mutation, reporting that it conferred a streptomycin-pseudodependent phenotype. However, we observed nochange in the growth rate of rpsL(K42A) cells when cultured inmedium containing streptomycin (Table 2). A-site mRNAcleavage was reduced in all three of these mutants comparedwith rpsL� cells (Fig. 6). Growth in the presence of 50�M strep-tomycin had little effect on A-site mRNA cleavage inrpsL(K42A) and rpsL(K42T) cells but decreased cleavage effi-

FIGURE 6. Northern analysis of A-site mRNA cleavage in streptomycin-resistant rspL mutants. The flag-�N(PP) transcript was expressed in �tmRNAcells containing rpsL mutations that encode the indicated streptomycin-re-sistant S12 variants. Total RNA was isolated from cells grown in the absenceand presence of streptomycin (50 �M) as indicated. Samples from tmRNA�

and �tmRNA cells containing wild-type S12 (rpsL�) were included in eachblot as a reference control for A-site cleavage. The rpsL(P90K) and rpsL(P90R)mutants are streptomycin-dependent and therefore were not tested in theabsence of streptomycin. Similarly, the rpsD mutations confer streptomycinsensitivity to the parental rpsL(P90K) strain, and therefore these mutants werenot tested with streptomycin. The positions of full-length and A-site-trun-cated transcripts are indicated. The percentage of A-site-truncated tran-scripts, with respect to total transcript (full-length � truncated), was deter-mined from phosphorimaging data as described under “ExperimentalProcedures.”

TABLE 2Selection of streptomycin-resistance rpsL mutationsStreptomycin-resistant mutants were produced by targeted mutagenesis of thechromosomal rpsL gene as described under “Experimental Procedures.”

Mutagenizedposition

Aminoacid

changePhenotypea Isolation

frequency

Doublingtime

Nostreptomycin

50 �Mstreptomycin

minWild type StrS 27 NDb

Lys42 Ala StrR 1/43 35 34Arg StrR 21/43 29 34Asn StrR 1/43 46 37Cys StrR 5/43 30 33Ile StrR 1/43 44 45Ser StrR 6/43 48 38Thr StrR 2/43 31 37Tyr StrR 1/43 43 44Val StrR 5/43 40 35

Pro90 Arg StrD 1/57 ND 66Asn StrR 6/57 36 37Gln StrP 7/57 76 40His StrR 2/57 36 36Lys StrD 1/57 ND 48Phe StrR 34/57 50 45Tyr StrR 6/57 46 50

a StrS, streptomycin-sensitive; StrR, streptomycin-resistant; StrD, streptomycin-dependent; StrP, streptomycin-pseudodependent.

b ND, not determined. These strains would not grow in either the presence orabsence of streptomycin.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

ciency in the rpsL(K42R)mutant (Fig. 6).We also examined thenovel rpsL(P90F)mutant, which was the most frequently iden-tified mutation in the selection (Table 2). A-site mRNA cleav-age was reduced in rpsL(P90F) cells but could be restored whenthe mutant was grown with streptomycin (Fig. 6). Takentogether, these results strongly suggest that streptomycinmod-ulates A-site cleavage by virtue of its effects on the ribosomeand translation.We also examined the two streptomycin-dependent

rpsL(P90R) and rpsL(P90K) alleles. Because streptomycin ispresumably bound to streptomycin-dependent ribosomes, weused these mutants to examine whether ribosome-bound ami-noglycoside influences A-site mRNA cleavage. Both strepto-mycin-dependent mutants exhibited lower A-site cleavage lev-els compared with rpsL� cells (Fig. 6). We next asked whethermutations that suppress streptomycin dependence couldrestore A-site cleavage to rpsL(P90K) cells. These suppressormutations typically occur in the rpsD and rpsE genes, whichencode ribosomal proteins S4 and S5, respectively (20). Weisolated and identified four rpsD mutations that allowedrpsL(P90K) cells to grow in the absence of streptomycin. TherpsD-1, rpsD-2, and rpsD-3 alleles encode Q53K, N85Y, andY203amber missense mutations, respectively (Table 1). TherpsD-4 mutation is a single-nucleotide deletion in codon 193,resulting in a frameshift that replaces the C-terminal Asp193–Lys205 residues of S4 with the TLTNT pentapeptide (Table 1).Each of the rpsD mutants was streptomycin-sensitive but stillcontained the original rpsL(P90K)mutation. In addition to con-

ferring streptomycin sensitivity, therpsD mutations also appeared torestore some A-site cleavage activ-ity compared with the parentalrpsL(P90K) strain (Fig. 6). Theseresults demonstrate that structuralperturbations to the A-site can sig-nificantly modulate A-site cleavageactivity.SsrA Peptide Tagging Activity

in Streptomycin-resistant rpsLMutants—Given the effects of rpsLmutations on A-site cleavage, wenext asked whether these allelesalso influence tmRNA�SmpB ac-tivity. We expressed �N-FLAG-His6(PP) in rpsL mutants contain-ing tmRNA(DD) and then purifiedthe reporter protein by Ni2� affin-ity chromatography to determinethe percentage of SsrA(DD)-tagged chains. SsrA(DD) taggingwas largely unaffected in most ofthe rpsL(K42) mutants, althoughrpsL(K42V) cells showed signifi-cantly less tagging (28 � 1.2%tagged) than rpsL� cells (43 � 0.6%tagged) (Fig. 7). In contrast, most ofthe rpsL(P90) mutants displayedsignificant SsrA(DD) peptide tag-

ging defects. The greatest effect was observed in rpsL(P90Q)cells, in which only 19� 1.1% of the �N-FLAG-His6(PP) chainswere tagged (Fig. 7). Notably, SsrA(DD) tagging was increasedwhen the rpsL(P90N), rpsL(P90Y), rpsL(P90F), and rpsL(P90Q)mutants were grown in 50 �M streptomycin (Fig. 7). Surpris-ingly, there was little correlation between SsrA tagging effi-ciency and A-site mRNA cleavage in the rpsL mutants. Forexample, the rpsL(K42A) mutation had no effect on peptidetagging activity in streptomycin-treated tmRNA(DD) cells (Fig.7) yet reducedA-site cleavage in the�tmRNAbackground (Fig.6). A similar disparity between A-site cleavage and peptide tag-ging was observed with the rpsL(P90R) streptomycin-depend-ent mutation.SsrA tagging of full-length�N-FLAG-His6(PP) chains results

from inefficient translation termination. Therefore, tagging isinversely related to the efficiency of stop codon decoding byrelease factors (23, 27). To assess tmRNA�SmpB activity with-out competition from release factors, we examined SsrA(DD)tagging of �N-FLAG-His6 expressed from nonstop mRNA. Asoutlined above, decreased tmRNA�SmpB activity leads to theaccumulation of untagged products, which are readily distin-guished from tagged protein by gel electrophoresis.We focusedon the rpsL(P90)mutants because these cells exhibited themostpronounced decrease in SsrA(DD) tagging during inefficienttermination (Fig. 7). In addition, the previously characterizedrpsL(K42R), rpsL(K42T), and rpsL(K42A) mutants were alsoanalyzed. All of the examined strains had significant taggingdefects, except for the rpsL(K42R) and rpsL(P90R) mutants, in

FIGURE 7. Quantification of SsrA(DD) peptide tagging in streptomycin-resistant rpsL mutants. The effi-ciency of SsrA(DD) peptide tagging during inefficient translation termination was determined using �N-FLAG-His6(PP) as the reporter protein. �N-FLAG-His6(PP) was synthesized in rpsL mutants expressing tmRNA(DD) inthe absence or presence of streptomycin (50 �M) as indicated. Total �N-FLAG-His6(PP) protein was purified byNi2� affinity chromatography, and the SsrA(DD)-tagged and -untagged chains were resolved by SDS-PAGEand quantified using LI-COR� Odyssey software. The percentage of tagged chains in each background isreported as the average � S.E. from three independently conducted experiments.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

which SsrA(DD) tagging was actually more efficient than inrpsL� cells (Fig. 8). Streptomycin treatment increasedtmRNA�SmpB activity in all of the non-dependent rpsL(P90)mutants. In fact, the rpsL(P90H), rpsL(P90F), and rpsL(P90Y)mutants regained wild-type tagging efficiency or better whentreated with streptomycin (Fig. 8). In contrast, the rpsL(K42A)and rpsL(K42T)mutants showed no change in peptide taggingin response to streptomycin (Fig. 8). We also examined theeffects of the four rpsDmutations and found that the rpsD-1, -2,and -4 alleles decreased SsrA(DD) tagging efficiency comparedwith the parental rpsL(P90K) strain (Fig. 8).The results shown in Fig. 8 suggest that SsrA tagging in rpsL

mutants may be related to the error-restrictive phenotype. Forexample, the restrictive rpsL(K42T) mutation decreased SsrAtagging, whereas the non-restrictive rpsL(K42R) mutationallowed efficient tagging (Fig. 8). Additionally, streptomycincounteracts the restrictive phenotype (20), which could con-ceivably lead to more efficient tagging in the streptomycin-treated rpsL(P90) mutants. Therefore, we assessed miscodingin several of the rpsLmutants to determine whether a correla-tion exists between error restriction and reduced tmRNA�

SmpB activity. Stop codon read-through was measured using aRenilla luciferase-firefly luciferase fusion construct, in whichthe firefly luc gene contains an in-frame UGA stop codon atposition 417 (24). This construct only produces firefly lucifer-ase activity when the UGA codon is inappropriately decoded asa sense codon. In the absence of streptomycin, most of the rpsLmutants had lower firefly luciferase/Renilla luciferase activityratios than rpsL� cells, indicative of reduced read-through andthe error-restrictive phenotype (Fig. 9). As expected, therpsL(K42R) mutant was non-restrictive but surprisinglybecamemore restrictive when grown inmedium supplementedwith streptomycin (Fig. 9). Streptomycin slightly increasedread-through in the rpsL(K42T) and rpsL(P90Q) mutants, butfirefly luciferase/Renilla luciferase ratios were unaffected bystreptomycin in the other mutants (Fig. 9). Streptomycin-de-pendent rpsL(P90R) cells were moderately restrictive,whereas the rpsL(P90K)mutant was more restrictive, similarto the other rpsL mutants we examined (Fig. 9). The rpsDmutations had little effect on miscoding in the rpsL(P90K)background, although we note that it was necessary to testthese strains under different conditions due to their respec-tive streptomycin-dependent and streptomycin-sensitivephenotypes (Fig. 9). Taken together, we found no direct cor-relation between error restriction and efficiency of SsrA pep-tide tagging (compare Figs. 7 and 8). These results indicatethat some other property of rpsL ribosomes influencestmRNA�SmpB activity.

DISCUSSION

The results presented here show that alterations in ribo-somal A-site structure and function have significant effectson A-site mRNA cleavage and tmRNA�SmpB activity. Strep-tomycin and paromomycin both inhibited A-site cleavageduring inefficient translation termination. A-site cleavageduring translational pauses is a complex process thatrequires at least two RNase activities. RNase II processivelydegrades downstream mRNA in a 3� 3 5� direction until itencounters the leading edge of the paused ribosome, and thisactivity appears to be required for subsequent cleavage in theA-site codon by another RNase (14). The A-site nuclease hasyet to be identified and could be an activity of the ribosomeitself. Because streptomycin and paromomycin bind very nearthe A-site codon and dramatically alter A-site structure andfunction (15, 16, 19, 20, 45, 46), these aminoglycosides coulddirectly inhibit A-site nuclease activity. However, aminoglyco-sides induced stop codon read-through, which occurred con-comitantly with the decrease in A-site mRNA cleavage.Although correlative, this finding suggests that aminoglyco-side-induced miscoding alleviates the translational pauserequired for A-site cleavage. Other indirect evidence also sug-gests that aminoglycosides influence ribosome pausing in thissystem (31, 32, 47). When A-site cleavage is inhibited, down-stream mRNA is still degraded to the ribosome border, result-ing in a slightly larger truncated transcript that indicates the“toeprint” of the paused ribosome (14, 25). The lack of A-siteand ribosome border-truncated transcripts in aminoglycoside-treated cells suggests that ribosomes no longer pause duringtranslation termination. We note that paromomycin has the

FIGURE 8. Ribosome rescue activity in streptomycin-resistant rpsLmutants. The efficiency of tmRNA�SmpB-mediated ribosome rescue fromnonstop mRNA was assessed by SsrA(DD) peptide tagging. �N-FLAG-His6 wassynthesized from a nonstop message (shown in Fig. 5A) in tmRNA(DD) cellscontaining the indicated rpsL mutations. Cells were grown in the absence orpresence of streptomycin (50 �M) as indicated. Total �N-FLAG-His6(PP) pro-tein was purified by Ni2� affinity chromatography, and the SsrA(DD)-taggedand untagged chains were resolved by SDS-PAGE, followed by CoomassieBlue staining.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

potential to actually increaseA-site cleavage during translationtermination, because it inhibits release factor binding to A-sitestop codons (48). However, paromomycin also stabilizes nearcognate tRNA in the A-site (19), providing an outlet forarrested ribosomes via stop codon read-through. Takentogether, it appears that aminoglycoside-induced miscodingaccounts for the observed decrease in A-site mRNA cleavage.

Aminoglycosides also inhibited the SsrA peptide taggingduring inefficient translation termination. In our system, thisinhibitory effect appears to be the result of increased stopcodon read-through and decreased protein synthesis. Aiba andco-workers (49) have previously shown that aminoglycosideinduced stop codon read-through can result in translationthrough the 3�-untranslated region to the end of the messageand thereby increase SsrApeptide tagging.Here, we see that thesame miscoding event can actually prevent peptide taggingassociated with inefficient translation termination. We notethat the constructs used in our study have additional in-framestop codons in the 3�-untranslated region, which prevent ribo-somes from reaching the 3�-end of the transcript. Paromomy-cin has also been reported to inhibit the aminoacylation oftmRNA and to shift the tmRNA reading frame into the �1frame in vitro (35, 36). In those studies, tmRNA aminoacylationwas inhibited at�225�Mparomomycin, and the�1 frameshifteffect became apparent at 55 �M paromomycin. We do notknow the intracellular concentration of aminoglycosides in ourexperiments, but therewas no evidence of�1 frame translationby Western blot analysis or mass spectrometry.3 Moreover,there was no indication that tmRNA aminoacylation was spe-cifically inhibited by either paromomycin or streptomycin. Alack of tmRNA aminoacylation would presumably be mani-fested as a �tmRNA phenotype, yet we observed no increase inuntagged chains during aminoglycoside treatment. Therefore,although aminoglycosides can clearly inhibit distinct stages ofthe tmRNA activity cycle, these effects appear to require higherconcentrations than those used in our study. It is still unclearwhy the synthesis of our reporter proteinswasmore sensitive toaminoglycoside treatment in tmRNA(DD) cells compared with�tmRNA cells, particularly because �tmRNA cells have beenshown to be more sensitive to aminoglycoside antibiotics (34).However, we note that protein synthesis was also inhibited in�tmRNA cells after about 40min of aminoglycoside treatment.Thus, it appears that the inhibition of protein synthesis ismerely delayed in�tmRNA cells, perhaps reflecting differencesin the rate of aminoglycoside uptake between the two geneticbackgrounds.A-site mRNA cleavage was significantly decreased in several

streptomycin-resistant rpsLmutants, yet there was no correla-tion between error restriction and A-site cleavage in thesestrains. The non-restrictive rpsL(K42R) mutation and theweakly restrictive rpsL(P90R) mutation both reduced A-sitecleavage to the same extent as restrictive rpsL alleles. Strepto-mycin-resistant ribosomes tend to suppress stop codon read-through, suggesting that translation termination may occurmore efficiently in these mutants. Of course, increased fidelityduring termination does not necessarily indicate more rapidstop codon decoding. Indeed, SsrA(DD) tagging of full-lengthFLAG-�N(PP) in the rpsL(K42A) and rpsL(P90R)mutants wasessentially identical to that of rpsL� cells, suggesting compara-ble translational pausing during termination in these back-grounds. It seemsmore likely that reduced read-through is dueto low A-site affinity for suppressor tRNA rather than an

3 L. E. Holberger and C. S. Hayes, unpublished results.

FIGURE 9. Decoding fidelity of streptomycin-resistant cells. The pAD8plasmid encoding a Renilla-firefly luciferase fusion interrupted by a UGA stopcodon at position 417 of firefly luciferase was introduced into �tmRNA cellscontaining the indicated rpsL mutations. Increased stop codon read-throughresults in a higher ratio of firefly to Renilla luciferase activity (F-Luc/R-Luc).Firefly luciferase/R-Luc ratios were determined from lysates of cells grown inthe absence and presence of streptomycin (50 �M) as indicated. Reportedvalues are the average � S.E. for at least three independently conductedexperiments.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

increase in the rate of termination (50–52). Alternatively,reduced A-site cleavage may result from processivity errors,which are characteristic of both streptomycin-resistant and-dependent ribosomes (45, 46, 53). Processivity errors occurwhen translating ribosomes fail to reach the stop codon andinstead produce truncated peptide chains. Most of these errorshave been proposed to be the result of “drop-off” (20), in whichpeptidyl-tRNA dissociates from the ribosome. Although therestrictive P-site has high affinity for peptidyl-tRNA, therestrictive A-site has a corresponding low affinity for peptidyl-tRNA, and drop-off is hypothesized to occur from the A/Phybrid state prior to translocation (17, 46). We did not detectincomplete FLAG-�N(PP) chains in rpsLmutants, but perhapsdrop-off occurred while ribosomes paused during termination.Non-canonical release of full-length nascent chains in rpsLmutants would be indistinguishable from normal terminationand therefore very difficult to study in vivo. We are currentlyexamining the kinetics of ribosome pausing in various rpsLmutants to determine whether pretermination ribosomes arerecycled more rapidly in these cells.Finally, our data show that ribosomal protein S12 plays an

important role in tmRNA�SmpB-mediated ribosome rescue.This effect was most apparent during ribosome arrest on non-stop mRNA, in which a significant proportion of chains werenot tagged in tmRNA(DD) cells. One possible explanation forthese findings is that rpsL ribosomes do not support efficienttmRNA�SmpB activity. In principle, a defect in any stage of thetmRNA activity cycle could produce the partial loss of functionobserved in thesemutants. But given thewell characterized roleof S12 in tRNA selection, a defect in the initial binding oftmRNA to the A-site seems most likely. A-site binding oftmRNA differs from that of canonical tRNAs in severalrespects. tmRNA lacks an anticodon and readily binds ribo-somes that contain no A-site codon. Additionally, SmpBappears tomimic themissingA-site codon-anticodon helix andhas recently been shown to make contacts with 16 S rRNAresidues G530, A1492, and A1493 in the decoding center (54–56).Perhaps these atypical interactions render tmRNA�SmpBmoresensitive to perturbations in the A-site. Although rpsL ribo-somes tend to have lower A-site affinity for canonical tRNA,this phenomenon cannot completely account for our data. SsrApeptide tagging was significantly reduced in several error-re-strictive rpsL(P90)mutants. However, streptomycinwas able tofully restore tagging in several of thesemutants while having noeffect on error restriction. These results suggest that the rpsLmutations have specific effects on tmRNA�SmpB recruit-ment, distinct from the effects on tRNA binding. Althoughwe favor a model in which rpsL mutations interfere withtmRNA�SmpB binding to the A-site, we recognize that thereis a tmRNA-independent pathway that releases nascentchains from nonstop-arrested ribosomes. It is possible thatrpsL mutations accelerate this tmRNA-independent ribo-some-recycling pathway, thereby giving the appearance ofdefective tmRNA�SmpB function. These two models can bedistinguished by measuring the rates of peptidyl-tRNA turn-over from nonstop mRNA-arrested ribosomes in tmRNA�

and �tmRNA cells. Peptidyl-tRNA accumulates on nonstop-stalled ribosomes in �tmRNA cells but not in tmRNA� cells,

presumably due to rapid ribosome rescue.4 If rpsLmutationsinterfere with tmRNA�SmpB recruitment to paused ribo-somes, then peptidyl-tRNA should be detectable in thesemutants. Alternatively, if the rpsL mutations facilitatetmRNA-independent ribosome recycling, then peptidyl-tRNA should turn over more rapidly in �tmRNA cells car-rying these mutations. We are currently measuring thekinetics of peptidyl-tRNA turnover in rpsL mutants touncover the basis of this ribosome rescue phenotype.

Acknowledgments—We thank Brian Janssen for helpful discussions,Kurt Fredrick for providing plasmid pAD8, and James Pavlovitch(Department of Chemistry and Biochemistry Mass SpectrometryFacility, University of California, Santa Barbara, CA) for assistancewith mass spectrometry.

REFERENCES1. Hayes, C. S., and Sauer, R. T. (2003)Mol. Cell 12, 903–9112. Sunohara, T., Jojima, K., Yamamoto, Y., Inada, T., and Aiba, H. (2004)

RNA 10, 378–3863. Keiler, K. C., Waller, P. R., and Sauer, R. T. (1996) Science 271, 990–9934. Moore, S. D., and Sauer, R. T. (2007) Annu. Rev. Biochem. 76, 101–1245. Karzai, A. W., Susskind, M. M., and Sauer, R. T. (1999) EMBO J. 18,

3793–37996. Sundermeier, T. R., Dulebohn, D. P., Cho, H. J., and Karzai, A. W. (2005)

Proc. Natl. Acad. Sci. U.S.A. 102, 2316–23217. Choy, J. S., Aung, L. L., and Karzai, A. W. (2007) J. Bacteriol. 189,

6564–65718. Gottesman, S., Roche, E., Zhou, Y., and Sauer, R. T. (1998)Genes Dev. 12,

1338–13479. Herman, C., Thevenet, D., Bouloc, P., Walker, G. C., and D’Ari, R. (1998)

Genes Dev. 12, 1348–135510. Richards, J., Mehta, P., and Karzai, A. W. (2006) Mol. Microbiol. 62,

1700–171211. Ivanova, N., Pavlov, M. Y., Felden, B., and Ehrenberg, M. (2004) J. Mol.

Biol. 338, 33–4112. Pedersen, K., Zavialov, A. V., Pavlov, M. Y., Elf, J., Gerdes, K., and Ehren-

berg, M. (2003) Cell 112, 131–14013. Garza-Sanchez, F., Gin, J. G., and Hayes, C. S. (2008) J. Mol. Biol. 378,

505–51914. Garza-Sanchez, F., Shoji, S., Fredrick, K., and Hayes, C. S. (2009) Mol.

Microbiol. 73, 882–89715. Ogle, J.M., Brodersen, D. E., Clemons,W.M., Jr., Tarry,M. J., Carter, A. P.,

and Ramakrishnan, V. (2001) Science 292, 897–90216. Ogle, J. M., Carter, A. P., and Ramakrishnan, V. (2003) Trends Biochem.

Sci. 28, 259–26617. Karimi, R., and Ehrenberg, M. (1994) Eur. J. Biochem. 226, 355–36018. Ogle, J. M., Murphy, F. V., Tarry, M. J., and Ramakrishnan, V. (2002) Cell

111, 721–73219. Carter, A. P., Clemons, W. M., Brodersen, D. E., Morgan-Warren, R. J.,

Wimberly, B. T., and Ramakrishnan, V. (2000) Nature 407, 340–34820. Kurland, C. G., Hughes, D., and Ehrenberg, M. (1996) in Escherichia

coli and Salmonella: Cellular and Molecular Biology (Neidhardt, F. C.,and Curtiss, R., eds) pp. 979–1004, American Society for MicrobiologyPress, Washington, DC

21. Diner, E. J., and Hayes, C. S. (2009) J. Mol. Biol. 386, 300–31522. Roche, E. D., and Sauer, R. T. (1999) EMBO J. 18, 4579–458923. Hayes, C. S., Bose, B., and Sauer, R. T. (2002) Proc. Natl. Acad. Sci. U.S.A.

99, 3440–344524. Devaraj, A., Shoji, S., Holbrook, E. D., and Fredrick, K. (2009) RNA 15,

255–26525. Garza-Sanchez, F., Janssen, B. D., and Hayes, C. S. (2006) J. Biol. Chem.

4 Janssen, B. D., and Hayes, C. S. (2009) J. Mol. Biol., in press




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

281, 34258–3426826. Hayes, C. S., and Setlow, P. (1998) J. Biol. Chem. 273, 17326–1733227. Hayes, C. S., Bose, B., and Sauer, R. T. (2002) J. Biol. Chem. 277,

33825–3383228. Yamamoto, Y., Sunohara, T., Jojima, K., Inada, T., and Aiba, H. (2003)

RNA 9, 408–41829. Modolell, J., and Davis, B. D. (1970) Proc. Natl. Acad. Sci. U.S.A. 67,

1148–115530. Borovinskaya, M. A., Pai, R. D., Zhang, W., Schuwirth, B. S., Holton, J. M.,

Hirokawa, G., Kaji, H., Kaji, A., andCate, J. H. (2007)Nat. Struct.Mol. Biol.14, 727–732

31. Benzer, S., and Champe, S. P. (1962) Proc. Natl. Acad. Sci. U.S.A. 48,1114–1121

32. Davies, J., Gilbert, W., and Gorini, L. (1964) Proc. Natl. Acad. Sci. U.S.A.51, 883–890

33. Roche, E. D., and Sauer, R. T. (2001) J. Biol. Chem. 276, 28509–2851534. Luidalepp, H., Hallier, M., Felden, B., and Tenson, T. (2005) RNA Biol. 2,

70–7435. Corvaisier, S., Bordeau, V., and Felden, B. (2003) J. Biol. Chem. 278,

14788–1479736. Takahashi, T., Konno, T., Muto, A., and Himeno, H. (2003) J. Biol. Chem.

278, 27672–2768037. Mikkelsen, N. E., Brannvall, M., Virtanen, A., and Kirsebom, L. A. (1999)

Proc. Natl. Acad. Sci. U.S.A. 96, 6155–616038. Schroeder, R., Waldsich, C., and Wank, H. (2000) EMBO J. 19, 1–939. von Ahsen, U., Davies, J., and Schroeder, R. (1991) Nature 353, 368–37040. Biswas, D. K., and Gorini, L. (1972) Proc. Natl. Acad. Sci. U.S.A. 69,

2141–2144

41. Chang, F. N., and Flaks, J. G. (1972) Antimicrob. Agents Chemother. 2,294–307

42. Garvin, R. T., Biswas, D. K., and Gorini, L. (1974) Proc. Natl. Acad. Sci.U.S.A. 71, 3814–3818

43. Timms, A. R., Steingrimsdottir, H., Lehmann, A. R., and Bridges, B. A.(1992)Mol. Gen. Genet. 232, 89–96

44. Sharma, D., Cukras, A. R., Rogers, E. J., Southworth, D. R., and Green, R.(2007) J. Mol. Biol. 374, 1065–1076

45. Jørgensen, F., and Kurland, C. G. (1990) J. Mol. Biol. 215, 511–52146. Karimi, R., and Ehrenberg, M. (1996) EMBO J. 15, 1149–115447. Orias, E., and Gartner, T. K. (1966) J. Bacteriol. 91, 2210–221548. Youngman, E. M., He, S. L., Nikstad, L. J., and Green, R. (2007)Mol. Cell

28, 533–54349. Abo, T., Ueda, K., Sunohara, T.,Ogawa, K., andAiba,H. (2002)GenesCells

7, 629–63850. Bilgin, N., Claesens, F., Pahverk, H., and Ehrenberg, M. (1992) J. Mol. Biol.

224, 1011–112751. Ruusala, T., Andersson, D., Ehrenberg, M., and Kurland, C. G. (1984)

EMBO J. 3, 2575–258052. Timms, A. R., Dewan, K. K., and Bridges, B. A. (1995) Mutagenesis 10,

463–46653. Dong, H., and Kurland, C. G. (1995) J. Mol. Biol. 248, 551–56154. Ivanova, N., Pavlov, M. Y., Bouakaz, E., Ehrenberg, M., and Schiavone,

L. H. (2005) Nucleic Acids Res. 33, 3529–353955. Kurita, D., Sasaki, R., Muto, A., and Himeno, H. (2007) Nucleic Acids Res.

35, 7248–725556. Nonin-Lecomte, S., Germain-Amiot, N., Gillet, R., Hallier, M., Ponchon,

L., Dardel, F., and Felden, B. (2009) EMBO Rep. 10, 160–165




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Laura E. Holberger and Christopher S. HayesCleavage and Transfer-Messenger RNA Activity in Escherichia coli

Ribosomal Protein S12 and Aminoglycoside Antibiotics Modulate A-site mRNA

doi: 10.1074/jbc.M109.062745 originally published online September 23, 20092009, 284:32188-32200.J. Biol. Chem.

10.1074/jbc.M109.062745Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/284/46/32188.full.html#ref-list-1

This article cites 55 references, 27 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M109.062745

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;284/46/32188&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/284/46/32188

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=284/46/32188&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/284/46/32188

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/284/46/32188.full.html#ref-list-1

http://www.jbc.org/

ribosomal protein s12 and aminoglycoside antibiotics modulate a

Documents