pharmacological rescue of nonsense mutations … · · 2010-12-10pharmacological rescue of...
TRANSCRIPT
PHARMACOLOGICAL RESCUE OF NONSENSE
MUTATIONS IN RETT SYNDROME
by
Andreea Cristina Popescu
A thesis submitted in conformity with the requirements
for the degree of Master of Science
Graduate Department of Physiology
University of Toronto
© Copyright by Andreea C. Popescu (2009)
ii
Abstract
PHARMACOLOGICAL RESCUE OF NONSENSE MUTATIONS
IN RETT SYNDROME
Andreea Cristina Popescu
Master of Science, 2009
Department of Physiology
University of Toronto
Rett syndrome is a neurological condition that affects primarily girls. Approximately
40% of Rett syndrome cases arise from nonsense mutations. Several studies have shown that
certain aminoglycosides can suppress some types of nonsense mutations in a context
dependent manner, and allow the generation of a full length protein. It remains mostly
unclear whether different nonsense mutations of MECP2 will be responsive to
aminoglycoside treatment. In this study I tested whether some nonsense mutations of
MECP2 seen clinically in Rett syndrome girls can be partially suppressed by aminoglycoside
administration. My results show that aminoglycosides allow different mutant forms of
MECP2 to be overcome in transiently transfected HEK-293 cells, but with differing levels of
efficiency. Furthermore, I also show that aminoglycosides increased the prevalence of full
length MeCP2 protein in a lymphocyte cell line derived from a Rett girl with R255X
mutation. This study establishes the “proof of principle” that some nonsense mutations
causing Rett syndrome can be suppressed by drμg treatment.
iii
Acknowledgements
I am thankful to many individuals who have provided advice, support and encouragement.
First, I would like to thank my supervisor Dr. James Eubanks for his supervision and for
giving me the opportunity to work on this interesting research project. His patience,
knowledge, encouragement and support he has provided during the last two years are greatly
appreciated. He has helped me tremendously in these years and definitely made a great
impact in my life.
I would also like to thank Dr. Philippe Monnier and Dr. Jan Jongstra for being in my
advisory committee and offering their time, expertise and advice on my master thesis. Their
comments on my thesis were very helpful.
I would like to acknowledge my lab mates Guangming, Richard, Ewelina, Lidia, Jennifer,
Elena, Tea and Natalie for their help and advice on many occasions and for creating such a
pleasant environment in the lab.
I am also very grateful to my parents and my family for always being there for me when I
needed them and for their encouragement and confidence in me. I am also very thankful to
my friends and Nick for being so patient, supportive and understanding.
Also, I would like to acknowledge the Ontario Rett Syndrome Association for giving us the
opportunity to meet some Rett syndrome girls-they inspired and made me realize how
important this research is to them. I would like to dedicate this thesis to Abby Congram (a
girl with Rett syndrome who has R294X mutation) and to all the Rett syndrome girls.
iv
Table of contents
Abstract..............................................................................................ii
Acknowledgements...........................................................................iii
Table of contents...............................................................................iv
List of Tables...................................................................................viii
List of Figures...................................................................................ix
List of Abbreviations........................................................................xi
1 Introduction...............................................................................1
1.1 Concept of epigenetics and the role of Methyl-CpG-binding proteins........................1
1.2 Rett Syndrome.............................................................................................................5
1.2.1 Pathology.........................................................................................................5
1.2.2 Mutations in MECP2 are the predominant cause of Rett syndrome................6
1.2.3 The structure and function of MeCP2..............................................................8
1.2.4 BDNF is one gene regulated by MeCP2.........................................................11
1.2.5 MeCP2 is post-translationally regulated.........................................................11
1.2.6 There are two isoforms of MECP2 with distinct N-termini............................14
1.2.7 Mutations that occur in Rett syndrome...........................................................15
1.2.8 Nonsense mutations and NMD pathway........................................................18
1.2.9 Genotype/Phenotype analysis in Rett syndrome............................................19
1.2.10 Therapeutic approaches for Rett syndrome....................................................21
1.3 The molecular mechanism of premature stop mutations............................................24
v
1.4 Aminoglycosides........................................................................................................25
1.4.1 What are aminoglycosides?............................................................................25
1.4.2 Toxicity of aminoglycosides..........................................................................28
1.4.3 Megalin receptor is important in the uptake of aminoglycosides in cells......29
1.4.4 Potential of aminoglycosides to treat genetic diseases with nonsense
mutations........................................................................................................30
1.4.5 Proposed mechanism of aminoglycoside mediated read-through..................31
1.4.6 Do aminoglycosides facilitate read-through at normal stop codons?.............38
1.5 Aims of my thesis and hypothesis...............................................................................41
2 Methods........................................................................................43
2.1 Molecular Biological Techniques...............................................................................43
2.1.1 Construction of mutant forms of MECP2......................................................43
2.1.2 DNA transformation......................................................................................45
2.1.3 DNA purification...........................................................................................48
2.1.4 Preparation of cell lysates..............................................................................49
2.1.5 Nuclear extraction..........................................................................................49
2.1.6 Western blot analysis......................................................................................50
2.1.7 Immunocytochemistry....................................................................................51
2.2 Statistical analysis.......................................................................................................52
2.3 Aminoglycosides used in my study............................................................................52
2.4 Cell culture..................................................................................................................53
2.4.1 HEK-293 cell culture and transfection...........................................................53
2.4.2 Lymphocyte culture and drug treatment.........................................................54
vi
3 Results......................................................................................55
3.1 In vitro.......................................................................................................................55
3.1.1 Nonsense mutations generating truncated forms of MECP2 are expressed in
transiently transfected HEK-293 cells..........................................................55
3.1.2 The aminoglycosides gentamicin and geneticin facilitate read-through of the
R294X Rett syndrome causing mutation.......................................................60
3.1.3 Amikacin and paromomycin are not effective in inducing read through of
R294X mutation........................................................................................... .63
3.1.4 Aminoglycoside treatment induces read-through of Q170X mutation..........66
3.1.5 Aminoglycosides induce read-through of Y141X mutation with different
efficiencies.....................................................................................................69
3.1.6 Aminoglycosides are not effective in inducing read-through of E205X
mutation.........................................................................................................72
3.2 In vivo........................................................................................................................75
3.2.1 Acute aminoglycoside treatment increases the prevalence of full length
MeCP2 in a R255X lymphocyte cell line......................................................75
3.2.2 Long-term treatment of R255X lymphocyte cells at clinically-relevant
concentrations of aminoglycosides fails to increase the prevalence of full
length MeCP2................................................................................................83
3.3 Summary of results....................................................................................................86
4 Discussion.................................................................................88
4.1 Principal findings of my study...................................................................................88
4.2 Wild-type and mutant forms of MECP2 migrate at higher sizes than expected........89
4.3 Different Rett syndrome causing mutations respond differently to aminoglycoside
treatment.....................................................................................................................89
4.4 Different aminoglycosides suppress nonsense mutations with different efficiencies
in transfected HEK-293 cells......................................................................................91
4.5 Possible reasons of the context dependence effects of aminoglycosides...................93
vii
4.6 NMD pathway and aminoglycoside mediated read-through.....................................94
4.7 Aminoglycoside treatment in a lymphocyte cell line having R255X mutation
(CGA A >TGA A).....................................................................................................97
4.8 Possible reasons for the difference in aminoglycoside mediated read-through
in lymphocytes vs. transfected HEK-293 cells..........................................................99
4.9 Related study...........................................................................................................101
4.10 Aminoglycosides may be able to facilitate read-through at premature stop codons
and not at normal stop codons.................................................................................102
4.11 Future directions and potential clinical implications...............................................104
5 Summary................................................................................113
6 References..............................................................................116
viii
List of Tables
1. Percentage of girls with mutations in MECP2 that retain functional ability.....................20
2. Cycling Parameters for the Site-Directed Mutagenesis Method.......................................44
3. Effect of 48 hours treatment of aminoglycosides on HEK-293 cells transfected with
the mutant forms of MeCP2..............................................................................................86
4. Effect of 4 days aminoglycoside treatment on a lymphocyte cell line..............................87
5. Effect of 12 days aminoglycoside treatment on a lymphocyte cell line............................87
ix
List of Figures
Introduction
Figure 1: Structure of MBD proteins and Kaiso......................................................................4
Figure 2: Structure and function of MeCP2...........................................................................13
Figure 3: The two isoforms of MeCP2 and the type and frequency of mutations that
occur on MECP2 in Rett syndrome.......................................................................17
Figure 4: The structures of aminoglycosides used in my study.............................................27
Figure 5: The mechanism of aminoglycoside interaction with ribosomal protein
synthesis..................................................................................................................34
Figure 6: The structures of ribosomal decoding sites of prokaryotes and eukaryotes..........37
Figure 7: The molecular mechanism of the aminoglycoside mediated read-through……...40
Methods
Figure 8: The truncated forms of MeCP2 that I used in my study.......................................47
Results
Figure 9: The mutant forms of MeCP2 are expressed in transiently transfected HEK-293
cells.........................................................................................................................57
Figure 10: Transfection efficiency in HEK-293 cells determined by immunocytochemistry.59
Figure 11: Gentamicin and geneticin induce read-through of the R294X mutation in a dose
response manner.....................................................................................................62
Figure 12: Amikacin and paromomycin do not facilitate read-through of the R294X
mutation.................................................................................................................65
Figure 13: Aminoglycoside treatment induces read-through of Q170X mutation.................68
x
Figure 14: Gentamicin and geneticin induce read-through of Y141X mutation with different
efficiencies..............................................................................................................71
Figure 15: Aminoglycosides fail to increase the prevalence of full length MeCP2 from
E205X mutation.....................................................................................................74
Figure 16: Geneticin induces the prevalence of full length MeCP2 protein in a dose response
manner in the lymphocyte cell line with R255X mutation....................................78
Figure 17: Gentamicin induces the prevalence of full length MeCP2 protein in a dose
response manner in the lymphocyte cell line with R255X mutation.....................80
Figure 18: Amikacin is effective in restoring the full length MeCP2 protein at a high
concentration in the lymphocyte cell line with R255X mutation..........................82
Figure 19: Long term culture of R255X lymphocytes in clinically-relevant concentrations
of aminoglycosides does not induce a significant increase in full length MeCP2
protein....................................................................................................................85
Discussion
Figure 20: The chemical structures of PTC124 and NB54...................................................112
Figure 21: Model of aminoglycoside mediated read-through...............................................115
xi
List of Abbreviations
A: Adenine
AMPA: α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor
AT: Ataxia-Telangiectasia
AVPR2: V2 vasopressin receptor
BDNF: Brain-derived neurotrophic factor
BSA: Bovine serum albumin
C: Cytosine
C-terminus: Carboxy-terminus
CDKL5: Cyclin-dependent kinase like 5
CF: Cystic Fibrosis
CFTR: Cystic fibrosis transmembrane receptor protein
CHX inhibitor: Cycloheximide inhibitor
CNS: Central nervous system
CO2: Carbon dioxide
CREB1: CAMP responsive element binding protein 1
DAPI: 4,6-Diamidino-2-phenylindole dihydrochloride
DHCR7: 7-Dehydrocholesterol reductase
DMD: Duchenne Muscular Dystrophy
DMEM: Dulbecco’s Modified Eagle’s Medium
DNA: Deoxyribonucleic acid
dNTP: Deoxyribonucleotides triphosphate
2 – DOS: 2-Deoxystreptamine
Dpn: Diplococcus pneumonia
dsDNA: double stranded DNA
DTT: Dithiothreitol
xii
E: Glutamate or Glutamic acid
EB: Elution buffer
EDTA: Ethylenediaminetetraacetic acid
eRF1: Eukaryotic release factor 1
eRF3: Eukaryotic release factor 3
FBS: Fetal bovine serum
FoxG1: Forkhead box protein G1
G: Guanine
H1: Histone 1
H2: Histone 2
HA: Hemagglutinin
HDAC: Histone deacetylase
HEK: Human Embryonic Kidney cells
HEPES: (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)
HS: Hurler Syndrome
ID: Interdomain region
IDUA: Iduronidase Alpha-L
IRSF: International Rett Syndrome Foundation
KCl: Potassium chloride
KdA: Kilodalton
LB: Luria-Bertaini
LTD: Long term depression
LTP-: Long term potentiation
MBD: Methyl-CpG binding domain
MeCP2: Methyl CpG binding protein 2
MeCP2_e1: Methyl CpG binding protein 2 isoform 1
MeCP2_e2: Methyl CpG binding protein 2 isoform 2
xiii
MECP2: gene encoding methyl CpG binding protein 2 in humans
MECP2_e1: gene encoding methyl CpG binding protein 2 in humans isoform 1
MECP2_e2: gene encoding methyl CpG binding protein 2 in humans isoform 2
Mecp2: gene encoding methyl CpG binding protein 2 in mouse
mg: Milligram
MgCl2: Magnesium Chloride
mM: Millimolar
mRNA: Messenger ribonucleic acid
N-terminus: Amino terminus
NaCl: Sodium chloride
NaOH: Sodium hydroxide
NLS: Nuclear Localization Signal
NMD: Nonsense-mediated mRNA decay
NMDA: N-methyl-D-aspartate
NuRD: Nucleosome remodelling and histone deacetylase activity
OD: Optical densitometry
PBS: Phosphate buffered saline
PCDH15: Protocadherin 15
PCR : Polymerase chain reaction
PTC: Premature termination codon
PTC124: (3-[5-(2-fluorophenyl)-1,2,4-oxadiazol-3-yl]benzoic acid)
Q: Glutamine
R: Arginine
rRNA – ribosomal ribonucleic acid
RT-PCR: Real time polymerase chain reaction
RTT-Rett syndrome
S: serine
xiv
SDS: Sodium dodecyl-sulphate
SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis
SEM: Standard error of the mean
Sin3A: SIN3 homolog A, transcriptional regulator
siRNA: small interfering RNA
SMN: Survival Motor Neuron
T: Thymine
TRD: Transcriptional repressor domain
TRIS: Tris(hydroxymethyl)aminomethane
tRNA: Transfer ribonucleic acid
U: Uracil
μg: microgram
USH1: Usher Syndrome
UTR: Untranslated region
V: volt
W: Tryptophan
WT: Wild-type
WW: Two tryptophan residues
Y: Tyrosine
YB-1: Y box-binding protein 1
1
1 Introduction
1.1 Concept of epigenetics and the role of Methyl-CpG-binding proteins
One of the most important epigenetic modification in mammalian genomes is the
addition of methyl groups to position five of cytosine bases. The major target site for DNA
methylation is on the cytosine residues in CpG dinucleotides. Most CpG sites are methylated
at a frequency of 60%-90% (Bird, 1980). However, distinct regions with a very high CpG
content called CpG islands, which are found in promoters of highly expressed genes are not
methylated (Cross and Bird, 1995). Proper DNA methylation is important for normal
development in mammals (Okano et al., 1999; Bird, 2002). The primary effect of DNA
methylation is to repress transcription; active genes are generally non-methylated, whereas
non-transcribed genes are heavily methylated (Bestor and Tycko, 1996).
DNA methylation-mediated transcriptional repression is achieved through a
mechanism in which a protein containing a methyl-CpG binding domain (MBD) binds to
methylated CpG nucleotides to repress transcription. Currently, five family members have
been described: MeCP2, MBD1, MBD2, MBD3, and MBD4 (Hendrich and Bird, 1998).
The MECP2 gene is X-linked (Amir et al., 1999), whereas the other MBD proteins map to
autosomal loci (Hendrich et al., 1999 a). The MBD sequence is well conserved between
these family members (Figure 1) having between 45%-75% overall amino acid identity
(Hendrich and Bird, 1998). Among them, MeCP2, MBD1, and MBD2 are able to bind
methylated DNA and are involved in transcriptional repression (Hendrich and Bird, 1998).
Kaiso is a protein that uses zinc fingers to bind both methylated and non-methylated DNA
2
(Prokhortchouk et al., 2001; Filion et al., 2006). During deamination, methylated cytosines
become converted to thymines (Bestor and Tycko, 1996). MBD4 is a thymine glycosylase
which binds G-T (guanine-thymine) mismatches at methylated CpG sites to prevent such
mutations thus MBD4 is a mismatched repair protein (Hendrich et al., 1999 b). MBD2 and
MBD3 are more closely related to each other than to the other MBD proteins having 75%
similarity (Hendrich and Bird, 1998). MBD2 is present in the MeCP1 complex and is
associated with histone deacetylases (HDAC) to repress transcription. Despite the sequence
similarity, MBD3 is different from MBD2 because it does not bind methylated DNA
(Hendrich and Bird, 1998) since it has a mutation in the MBD domain (Bogdanovic and
Veenstra, 2009). MBD3 is an integral component of the NuRD (Nucleosome remodelling
and histone deacetylase activity) co-repressor complex that contains histone deacetylases
which are implicated in silencing genes as well (Wade et al., 1999; Zhang et al., 1999). Loss
of MBD3 in mice is associated with embryonic lethality; thus, MBD3 is important for
development (Hendrich et al., 2001). MeCP2 is the most extensively studied of the MBD
proteins since mutations in this gene are responsible for a majority (up to 90%) of Rett
syndrome cases (Smeets et al., 2009; Neul et al., 2008).
3
Figure 1. Structure of MBD proteins and Kaiso. MBD proteins display homology within
their MBD domains. The transcriptional repression domains (TRD) in MeCP2, MBD1 and
MBD2 are non-homologous and are important for interaction with various co-repressor
complexes. Other motifs shown are cysteine-rich regions (CxC) in MBD1 and the
glycosylase domain of MBD4. Kaiso is in a different family than MBD proteins, but also
binds methylated DNA through its zinc finger (zf) domains.
(Figure modified from the review paper by Bogdanovic and Veenstra, 2009).
4
Figure 1
5
1.2 Rett syndrome
1.2.1 Pathology
Rett syndrome, initially described by Andreas Rett in 1966, is an X-linked
progressive, neurodevelopmental disorder that affects almost exclusively girls. The
prevalence of this disease is 1/10,000 to 1/15,000 girls worldwide, making it one of the most
common genetic cause of severe mental retardation in girls (Hagberg and Hagberg, 1997).
Rett syndrome is characterized by normal development for the first 6 to 18 months of age,
followed by a period of regression in which the girls lose language and motor skills (Dunn
and MacLeod, 2001). Purposeful hand use is replaced by repetitive stereotyped hand
movements. Decelerating head growth and autistic features such as diminished eye contact
and emotional withdrawal also occur. Additional characteristics include anxiety, respiratory
dysfunctions, impairment of sleeping patterns, cardiac abnormalities, seizures, loss of
locomotion and bone density deficits. Furthermore, girls with Rett syndrome tend to be
growth retarded, and have a reduced life span. There is some stabilization of the disease at 4
to 7 years of age and girls may recover some of the skills (Hagberg et al., 1985).
Rett syndrome is believed to be a disease of arrested neuronal development, rather
than neurodegeneration, as there is no evidence of neuronal loss (Armstrong, 2001 a). The
brain is the organ most affected in Rett Syndrome and is typically underweight. The average
size of a mature Rett brain is approximately the same as a 12-month child (Johnston et al.,
2001; Glaze, 2005). Neurons within the Rett brain display significant decreases in dendritic
branching and somal size and elevated neuronal packing density (Belichenko et al., 1994).
6
Also, Blue et al (1999 a, b) have demonstrated abnormalities in receptor densities: AMPA
and NMDA receptors are increased in the young Rett brain (<8 years old) compared to
controls, while in older Rett brain these receptors are dramatically reduced. This suggests
that disturbances in excitatory neurotransmitter levels might be found in Rett syndrome girls
(Blue et al., 1999 a, b). A study conducted by our group has demonstrated that NMDA-
receptor-dependent long term potentiation (LTP) and long term depression (LTD) in the
hippocampus from symptomatic Mecp2-null mice are significantly reduced compared to
controls of the same age (Asaka et al., 2006). Thus, Rett syndrome is believed to be a
disorder that results from an impairment in synaptic plasticity (Johnston, 2004).
1.2.2 Mutations in MECP2 are the predominant cause of Rett syndrome.
Rett Syndrome is an X-linked neurological disorder. The genetic defect was mapped
to Xq28 (Sirianni et al., 1998) and 90% of mutations were identified in the gene MECP2
which encodes the transcriptional regulator MeCP2 (methyl CpG-binding protein 2) (Amir et
al, 1999; Smeets et al., 2009; Neul et al., 2008). A small number of Rett Syndrome cases are
caused by mutations in cyclin-dependent kinase like 5 (CDKL5), an X-linked gene (Weaving
et al., 2004; Bertani et al., 2006; Tao et al., 2004), which is a kinase for MeCP2 and may
play a role in regulation and phosphorylation of MeCP2 (Mari et al., 2005). Furthermore
some Rett syndrome cases arise from mutations in FoxG1 gene, which encodes a brain-
specific transcriptional repressor which is important for early development of the brain
(Ariani et al., 2008).
7
In 99.5% of all cases, Rett syndrome is sporadic and due to de novo mutations in the
MECP2 gene. Since affected females have a reproductive disadvantage, familial cases of
Rett syndrome are rare and are due to inheritance from a carrier mother (mother that has a
MECP2 mutation but does not express the disease due to skewed X inactivation) (Trappe et
al., 2001; Orrico et al., 2000). The majority of MECP2 mutations are due to cytosine-to-
thymine transitions in CpG dinucleotides (Dragich et al., 2000). This is most likely due to
deamination of methylated cytosine to thymine, which is not easily recognized by DNA
repair processes. DNA in sperm is much more highly methylated than the same sequences in
oocytes due to the need for greater nuclear compaction (Morgan et al., 2004) therefore the
DNA in sperm is more susceptible to mutations in a CG rich gene such as MECP2 (LaSalle,
2004). Thus, de novo mutations in Rett syndrome occur predominantly on the paternal X-
chromosome, which is inherited only by the female offspring, and this is the most probable
cause of high female: male ratio observed in patients with Rett syndrome (Girard et al.,
2001; Trappe et al., 2001).
Males with classic Rett syndrome have been described in a few familial cases. Male
patients fall into two categories: boys with classic Rett syndrome and boys with a severe
neonatal encephalopathy that leads to death within the first year of life (Hoffbuhr et al.,
2001). The boys with Rett Syndrome carry the same mutations in MECP2 gene as those that
cause Rett syndrome in girls. In some cases the boys are mosaics and have a mixed cellular
population of mutated and wild-type MECP2 (Clayton-Smith et al., 2000; Armstrong et al.,
2001 b; Topcu et al., 2002). In other cases, the males have a 46, XXY karyotype associated
with Kleinfelter’s syndrome. Since they have an extra X chromosome (and thus one normal
8
copy of MECP2), they reproduce the Rett phenotype (Leonard et al., 2001; Schwartzman et
al., 2001). Several studies have found boys with classic Rett syndrome with mutations in
MECP2 but no evidence of Kleinfelter’s syndrome or mosaicism (Budden et al., 2005; Dayer
et al., 2007; Masuyama et al., 2005; Ravn et al, 2003). This suggests that additional genetic
factors may influence the clinical features of Rett syndrome in boys.
1.2.3 The structure and function of MeCP2
MeCP2 is a 53 kDa nuclear protein which is part of a family of methyl-CpG-binding
domain proteins (MBD) (Lewis et al., 1992). It has four exons, and its protein sequence has
six domains: MBD, transcriptional repressor domain (TRD), nuclear localization signal
(NLS), interdomain region (ID), Carboxy-terminal domain (CTD) and N-terminal domain
(NTD) (Figure 2 a) (Kumar et al., 2008). MeCP2 is a highly disordered protein (Ghosh et al.,
2008). The distinct domains of MeCP2 are organized into a tertiary structure that is 60%
unstructured and has coil-like properties (Adams et al., 2007). The MBD is 85 amino acids in
length encoded within exons 3 and 4 and is essential for binding of MeCP2 to methylated
DNA (Lewis et al., 1992; Nan et al., 1993). When this domain binds methylated DNA, it
blocks other transcription factors from associating. The TRD encoded within exon 4
(residues 207 – 310) recruits histone deacetylases and Sin3A transcriptional co-repressor to
repress transcription (Figure 2 b). HDAC1 and HDAC2 are histone deacetylases that
combine with transcriptional repressor Sin3A to form a co-repressor system. Interaction
between TRD and the transcriptional co-repressor complex results in deacetylation of
9
histones H3 and H4 by histone deacetylases leading to compaction of the chromatin, making
it inaccessible for the components of the transcriptional machinery to bind, thus repressing
transcription (Nan et al., 1998; Jones et al., 1998). NLS is important for targeting the protein
to the nucleus. One NLS is embedded within the ID region (residues 174-190) and a second
NLS is found between residues 255 and 271 in TRD region of MeCP2 (Nan et al, 1996;
Kumar et al., 2008) (Figure 2 a). Carboxy-terminus may be involved in RNA-mediating
functions as it has been shown to interact with WW domain splicing factors (Buschdorf and
Stratling, 2004) and with the RNA-binding protein YB-1 (Y box-binding protein 1) (Young
et al., 2005). It has also been shown that Carboxy-terminus may be involved in facilitating
the binding of MeCP2 to the nucleosome core (Chandler et al., 1999). Furthermore,
interdomain region has been shown to be important in stabilizing the interactions of MBD
(Kumar et al., 2008). It is not yet known what the function of N-terminus is.
MeCP2 also binds to non-methylated DNA, but with lower affinity (Koch and
Stratling, 2004). MeCP2 has been shown to bind to chromatin fibers and compact them. The
genes used in these studies were non-methylated, suggesting a potential role for MeCP2 in
modulating chromatin structure independent of methylation status (Georgel et al., 2003;
Nikitina et al., 2007 a, b). Thus, MeCP2 influences chromatin structure and inappropriately
regulated chromatin structure is proposed to be a mechanism for the development of the
pathophysiology of Rett syndrome.
Until recently, it was believed that MeCP2 can only act as a transcriptional inhibitor.
However, Ben-Shachar and his group (2009) have found that MeCP2 can also act as a
transcriptional activator by associating with the CREB1 transcriptional factor at an activated
10
promoter (Figure 2 b) (Ben-Shachar et al., 2009). Moreover, a study by Yasui et al., (2007)
has shown that the majority of MeCP2 bound promoters are on highly expressed genes.
These results suggest that MeCP2 is a key transcriptional regulator that has dual functions on
gene expression. However, it is not known whether Rett syndrome is due to MeCP2 loss of
transcriptional activation, repression, or both.
MECP2 is expressed in many tissues of the body, however it is expressed at higher
levels in the brain (Shahbazian et al., 2002 a). Within the brain, MECP2 is expressed at high
levels in mature neurons (Kishi and Macklis, 2004). The timing of MECP2 expression in
mouse and human correlates with the maturation of the central nervous system (LaSalle et
al., 2001). The initial period of normal development in Rett syndrome suggests that MECP2
expression is not essential in the developing brain, but becomes critical in mature brain.
Kishi and Macklis (2004) demonstrated that MeCP2 maintains the mature neuronal state,
rather than play a role in cell fate decisions. In agreement with this idea, a study by
Giacometti et al., (2007) has demonstrated that expression of a Mecp2 transgene in
postmitotic neurons of Mecp2-null mice reversed some symptoms of the mutant mice. Also,
Chen and his group (2001) have shown that deletion of Mecp2 gene specifically in neurons
leads to a Rett-like phenotype in mice. These data suggest that Rett syndrome may be caused
by a deficiency of MeCP2 in central nervous system.
MeCP2 is believed to be important in the maturation of neurons and synapses. There
is a reduced neuronal size and dendrites are underdeveloped in patients with Rett syndrome
(LaSalle et al., 2001; Shahbazian et al., 2002 a). Furthermore, over-expressing MeCP2 in
transgenic mice results in enhanced synaptic plasticity as observed by an increase in LTP
11
(Collins et al., 2004). A study by our group has shown that in cortical neurons over-
expressing MeCP2, there is an increased dendritic complexity and axonal length (Jugloff et
al., 2005). These results indicate that MeCP2 may play an important role in regulating
synaptic function and plasticity.
1.2.4 BDNF is one gene regulated by MeCP2.
One gene that is regulated by MeCP2 is the brain-derived neurotrophic factor
(BDNF) (Chen et al., 2003). This gene encodes a neurotrophic factor important for neuronal
survival (Bonni et al., 1999), differentiation (Ghosh et al., 1994) and synaptic plasticity
(Kuczewski et al., 2009; Poo, 2001). Several studies have shown that BDNF protein is
reduced in MeCP2 mutant mice but is increased in transgenic mice that over-express MeCP2
(Chahrour et al., 2008; Chang et al., 2006). Also, Chang et al., (2006) have shown that
BDNF mutant mice displayed many features of a Rett syndrome mouse model and
introducing BDNF in MeCP2 mutant brain extended the lifespan, and reversed some
electrophysiological deficits observed in MeCP2 mutant mice. This suggests that the
pathophysiology of Rett Syndrome may be due to altered BDNF levels.
1.2.5 MeCP2 is post-translationally regulated.
Using mass spectrometry analysis, a study by Zhou et al., (2006) has shown that there
are three major sites of phosphorylation on MeCP2: serine 80 (S80), serine 229 (S229) and
12
Figure 2. Structure and function of MeCP2. A) Structure of MeCP2_e2 (Abbreviations:
NLS-nuclear localization factor, S-serine, MBD-methyl-CpG-binding domain, TRD-
transcriptional repressor domain, N-amino terminus domain, C-carboxy terminus domain).
Phosphorylation sites exist at S80, S229 and S421.
B) MeCP2 acts as a transcriptional repressor by binding methylated DNA and through the
Sin3A co-repressor recruits histone deacetylases (HDAC), leading to deacetylation of
histones and thus compacted chromatin. MeCP2 also acts as a transcriptional activator by
associating with CREB1 transcriptional factor.
(Figure 2 A-modified from IRSF database, Australia - http://mecp2.chw.edu.au/mecp2)
13
Figure 2
A
B
14
serine 421 (S421) (Figure 2 a). This study showed that neuronal depolarization triggers the
phosphorylation of MeCP2 at the amino acid residue S421 in the nervous system and
mutation of MECP2 at this site blocks the ability of MeCP2 to allow proper dendritic
maturation and activation of BDNF. These results suggest that phosphorylation of MeCP2 at
S421 mediates dendritic patterning, dendritic spine development and activation of BDNF.
However, phosphorylation at this site exhibits reduced binding to methylated DNA, raising
the possibility that it might inactivate the repressor function of MeCP2 (Chen et al., 2003).
Furthermore, a study by Tao et al., (2009) has shown that phosphorylation of MeCP2 at S80
is negatively regulated by neuronal activity. The opposing regulation of S421 and S80
phosphorylation by neuronal activity may suggest that S80 phosphorylation is associated
with MeCP2 function in resting neurons, however, S421 phosphorylation might be
associated with a role of MeCP2 in depolarized neurons. The disruption of this process in
individuals with mutations in MECP2 may underlie the pathology of Rett syndrome (Tao et
al., 2009).
1.2.6 There are two isoforms of MECP2 with distinct N-termini.
There are two isoforms of MECP2, which differ in their N-terminus domains. The
more recently identified MECP2e1 isoform has a longer and more acidic N-terminus
compared with the MECP2e2 isoform. MECP2e2 has a translation start site in exon 2,
whereas the start site for MECP2e1 is in exon 1 (Figure 3 A) (Mnatzakanian et al., 2004).
The functional distinction for the two protein isoforms is not known. The MECP2e2 is more
15
abundant than MECP2e1 in most tissues with the exception of the mature brain. In the adult
brain, the expression of MECP2e1 is approximately 10 times higher than MECP2e2
(Mnatzakanian et al., 2004). The two isoforms are nuclear and colocalize with
heterochromatin, thus it was suggested that the functions of the two isoforms may overlap
significantly (Kriaucionis and Bird, 2004; Kumar et al., 2008).
1.2.7 Mutations that occur in Rett syndrome.
About 67% of all MECP2 mutations are caused by cytosine to thymine transitions in
CpG dinucleotides and are located in the third and fourth exon of MECP2 (Figure 3 B)
(Dragich et al., 2000). Missense mutations (single amino acid substitutions) cluster in the
MBD, whereas frameshift mutations (deletions or insertions) occur in the C-terminal domain
(Weaving et al., 2003). Nonsense mutations (single nucleotide substitutions that introduce a
premature stop codon) generate truncated MeCP2 proteins and account for approximately
40% of Rett syndrome cases. Most nonsense mutations are located on the interdomain and
TRD (Percy et al., 2007; Weaving et al., 2003). Very few nonsense mutations are found in
the MBD. One of the nonsense mutations found in MBD is Y141X (IRSF database,
http://mecp2.chw.edu.au/mecp2). To date, no mutations in exon 2 have been identified in
individuals with Rett syndrome. It is possible that mutations in exon 2 do not cause Rett
syndrome as a result of compensation of MeCP2_e1 isoform which is much more abundant
in central nervous system compared to MeCP2_e2. However, a few mutations have been
16
Figure 3. The isoforms of MeCP2 and the mutations that occur on MECP2 in Rett
syndrome.
A) MeCP2_e1 and MeCP2_e2 isoforms.
(Figure modified from a review paper by Chahrour and Zoghbi, 2007).
B) The type and frequency of mutations that occur on MECP2 in Rett syndrome.
(Figure modified from IRSF database, Australia - http://mecp2.chw.edu.au/mecp2).
17
Figure 3
A
B
18
reported in exon 1 of MECP2e1 (Figure 3 B) (Mnatzakanian et al., 2004; Fichou et al.,
2009).
1.2.8 Nonsense mutations and NMD pathway.
Nonsense mediated decay pathway (NMD) is a mechanism by which eukaryotic cells
eliminate mRNA that contains a premature stop codon arising from nonsense or frameshift
mutations in order to prevent the synthesis of truncated proteins that might be non-functional
or deleterious (Mendell and Dietz, 2001; Holbrook et al., 2004; Amrani et al., 2006). The
current understanding of NMD is not completely understood. Not all transcripts containing
premature termination codons (PTCs) are targeted by NMD pathway (Holbrook et al., 2004;
Linde et al., 2007) and it is not known why some transcripts escape NMD pathway while
others are degraded. It has been proposed that this pathway might vary depending where on
the gene the mutation is found (Holbrook et al., 2004). Mutations near the 3`end of the open
reading frame usually escape nonsense-mediated mRNA decay (Kerr et al., 2001) while
nonsense mutations found more upstream in the open reading frame of mRNA are usually
degraded by NMD (Holbrook et al., 2004). To date no studies have determined whether
truncated proteins are detected in Rett cell lines, thus it is not known whether the nonsense
transcripts that cause Rett syndrome are degraded by NMD. If NMD degrades these
nonsense transcripts, then they may act as loss-of-function alleles, giving a very severe
phenotype.
19
1.2.9 Genotype/Phenotype analysis in Rett syndrome.
The severity of Rett syndrome varies from mild to more severe phenotypes. This may
depend on the type and location of mutations in the MECP2 gene (Table 1). Several studies
have found that truncating mutations are more severe than missense mutations with early
truncations being more severe than late truncations (Cheadle et al., 2000, Monros et al.,
2001, Huppke et al., 2002; Neul et al., 2008; Bebbington et al., 2008). Also, mutations
affecting nuclear localization factor (NLS) are more severe than mutations that preserve NLS
(Huppke et al., 2002). For example, individuals with R133C missense mutation are less
severely affected than those with the nonsense mutation R168X (Neul et al., 2008). The
R133C genotype causes very mild Rett syndrome. No breathing irregularities or other signs
of autonomic dysfunction were observed in girls with this mutation. These individuals did
not experience any seizures and they preserve some hand use and speech ability (Smeets et
al., 2009). The missense mutation R306C adversely affects only language (Neul et al., 2008).
Individuals with this mutation seldom develop epilepsy (Smeets et al., 2009). Individuals
with T158M missense mutation usually preserve ambulation. They all have epilepsy in some
period of their lives and/or breathing irregularities (Smeets et al., 2009). Individuals with the
R168X nonsense mutation are more severely affected than those with R294X and late C-
terminal truncating mutations. Girls with R168X mutation have the greatest severity score
and are less likely to walk, speak and retain hand use (Horska et al., 2009; Neul et al., 2008).
However, individuals with C-terminal truncations are the least severe and are more likely to
walk and use words (Neul et al., 2008; Huppke et al., 2002). A study by Bebbington et al.,
(2008) has shown that the nonsense mutations R270X and R255X which lose the NLS, are
20
Table 1: Percentage of girls with mutations in MECP2 that retain functional ability
Mutation N Walks alone (%) Uses hands (%) Uses words (%)
R106W 9 33 56 33
R133C 12 75 92 50
T158M 30 60 50 27
R168X 29 28 38 3
R255X 32 38 59 28
R270X 18 44 67 22
R294X 14 86 86 50
R306C 21 67 52 10
C-terminal truncations 17 82 88 71
Large deletions 17 41 53 12
Neul et al., 2008
21
more severe than R133C and R294X. Thus, specific mutations in MECP2 confer different
severity in Rett syndrome patients.
Furthermore, the phenotypic variability may also be the result of distinct patterns of
X-chromosome inactivation. Although normal females inherit two copies of the X-
chromosome, one copy is randomly silenced during early embryogenesis (Lyon, 1989).
Since MECP2 is located on the X-chromosome, it is subjected to X-chromosome
inactivation. Normally, X-inactivation is random, with approximately half of the cells
expressing the normal MECP2 and half expressing the defective MECP2 gene. If this
process is non-random (skewed), then the X-chromosome with either the defective or the
normal MECP2 gene may be preferentially active in most cells of the body. This non-random
X-inactivation can influence phenotype, resulting in a variety of clinical severity ranging
from the absence of phenotype if normal MECP2 gene is active to a more severe Rett
syndrome case when the mutated MECP2 gene is active (Archer et al., 2007). Rett
syndrome girls usually show a random pattern of X-inactivation; however, a few studies have
shown skewed patterns of X-inactivation (Archer et al., 2007; Amir et al., 2000). The
skewing is toward the normal X-chromosome and is correlated with less severe phenotypes
(Archer et al., 2007).
1.2.10 Therapeutic approaches for Rett syndrome.
Currently, there is no cure for Rett syndrome. At the moment, treatments of Rett
syndrome focus on the management of symptoms. Genetic manipulations of mouse models
22
have been useful in determining whether Rett syndrome can be reversed when the function of
MeCP2 is restored. However, the techniques used so far cannot be used in a clinical setting.
Mouse models of Rett syndrome have been generated using gene-targeting
approaches. They recapitulate several of the clinical features of Rett syndrome: a period of
normal development followed by a severe neurological dysfunction that includes tremors,
hypoactivity, irregular breathing, abnormal gait and movements, social impairment, seizures,
anxiety-like behaviour, learning and memory deficits. They also demonstrate impaired
synaptic plasticity, and males usually die by 8-12 weeks of age (Chen et al., 2001; Guy et al.,
2001; Shahbazian et al., 2002 b; Moretti et al., 2005; Asaka et al., 2005; Moretti et al.,
2006).
Initially it was believed that Rett syndrome is an irremediable condition, and that
MeCP2 is essential for neuronal development during a critical time window when synapses
start to form. However, Guy et al., (2007) have created a mouse model in which endogenous
Mecp2 was silenced but could be conditionally activated by its promoter. This study has
demonstrated that re-activation of Mecp2 expression led to reversal of Rett phenotype in
symptomatic mice. Also, Giacometti and his group (2007) have shown that reactivation of
Mecp2 in Mecp2 knockout mice improved life-span and rescued some Rett-like symptoms of
mutant mice. The Rett-like behaviour of Mecp2-deficient female mice was improved by re-
introduction of a Mecp2 transgene in the forebrain of these mice (Jugloff et al., 2008). These
results strongly suggest that the absence of MeCP2 does not irreversibly damage neurons and
thus, the neurological defects seen in Rett syndrome can be reversible by restoring MeCP2
function.
23
However, MeCP2 levels have to be tightly regulated. A few studies have shown that
transgenic mice with moderate over-expression of MeCP2 have neurological impairments
(Collins et al., 2004; Luikenhuis et al., 2004). This suggests that even mild over-expression
of this protein is deleterious and any therapies directed at increasing the levels of MeCP2 in
patients must be carefully considered to avoid any further neurological dysfunctions.
Furthermore, a study by Samaco et al., (2008) has shown that reducing MeCP2 levels by
50% results in a broad spectrum of phenotypic abnormalities such as learning and motor
deficits, altered social behaviour and breathing irregularities. However, in contrast with
Mecp2-null mice that die between 8 and 12 weeks of life, these mice have normal lifespan.
Thus, even a 50% decrease in MeCP2 levels might still cause a disease. Collectively, these
results suggest that the central nervous system is sensitive to MeCP2 expression levels and
the protein`s levels and function must be critically maintained.
The finding that over-expression of MeCP2 is as deleterious as its loss of expression
complicate the treatment of Rett syndrome. Using a therapy such as gene replacement
therapy would not necessary be beneficial since in addition to adding function to the cells
expressing the mutant MECP2 allele, it would also increase the level of MECP2 in cells
expressing the functional MECP2 allele. Thus, this procedure will introduce more MeCP2
protein than needed. Therefore, a therapeutic option would be to enhance endogenous
MeCP2 levels selectively in cells expressing the mutant allele.
24
1.3 The molecular mechanism of premature stop mutations.
Protein translation occurs in the cytoplasm where the ribosomes are located.
Eukaryotic ribosomes are made of a small subunit (40S) and a large subunit (60S) which
form the 80S ribosomal complex. The small subunit (40S) also contains 18S subunit. In
prokaryotes, the small ribosomal subunit is 30S which contains the 16S subunit, and the large
subunit is 50S (Rodnina and Wintermeyer, 2009). In eukaryotes, the ribosomal complex has
two sites: the A site (also called decoding site) within the 18S of rRNA which contains the
bases A1492 and A1493 which are important in facilitating the pairing of the anticodon of
aminoacyl tRNA with the complementary codon on mRNA, and a P site where the peptide
bond is formed. Termination of the protein synthesis happens when a termination codon
(UAA, UAG or UGA) on mRNA enters the A site of rRNA. At this stage, the translation
stops since there is no tRNA with an anticodon complementary to any of the stop codons.
This causes the release factors to bind to the stop codon (Kerem, 2004). In eukaryotes, the
release factor eRF1 recognizes all three stop codons in the ribosomal A site and facilitates
polypeptide chain release; another release factor eRF3 modulates the function of eRF1
(Zhouravleva et al., 1995). Nonsense mutations introduce a premature stop codon, which
lead to premature binding of the eRF1 to this premature termination codon, and thus a
truncated and non-functional protein is produced (Kerem, 2004).
25
1.4 Aminoglycosides
1.4.1 What are aminoglycosides?
Aminoglycosides are a class of structurally related antibiotics that are used in the
treatment of bacterial infections (Wilhelm et al., 1978). They are hydrophilic sugars that
contain several amino and hydroxyl groups. The amine groups are protonated in biological
media (Botto and Coxon, 1983); thus, they have a high binding affinity for nucleic acids.
Furthermore, due to their charged properties, they have poor permeability across the plasma
membrane (Kondo and Hotta, 1999). Their antibacterial action results from an
aminoglycoside binding to the decoding site (A site) on bacterial rRNA disrupting the
translational process and thus inhibiting protein synthesis. Accumulation of erroneous
proteins that are incorrectly folded and truncated accumulate in bacterial membrane leading
to bacterial cell death (Magnet and Blanchard, 2005).
The majority of aminoglycosides contain a common non-sugar ring, called 2-
deoxystreptamine (2-DOS) that carries sugar substituents at positions 4, 5, and 6. The 2-
DOS ring is also called ring II, and represents the central ring. The sugar ring bound at
position 4 of 2-DOS is ring I and the sugar ring bound either at position 5 or at position 6 of
2-DOS is ring III. The most important classes of aminoglycoside antibiotics are 4,5- and 4,6-
disubstituted 2-DOS derivatives. Paromomycin is an example of 4,5 disubstituted 2-DOS and
gentamicin, geneticin and amikacin are part of 4,6 disubstituted 2-DOS (Figure 4). In
addition to having a distinct linkage between 2-DOS and ring III, the 4, 5- disubstituted class
26
Figure 4. Structures of aminoglycosides used in my study.
(All structures were copied from the following web-sites).
Gentamicin: http://upload.wikimedia.org/wikipedia/commons/thumb/8/8f/Gentamicin_C2b.svg/539px
Gentamicin_C2b.svg.png
Geneticin: http://upload.wikimedia.org/wikipedia/commons/thumb/a/af/Geneticin.svg/501px-
Geneticin.svg.png
Amikacin: http://www.rsc.org/ej/NP/2000/a902202c/a902202c-u6.gif
Paromomycin: http://upload.wikimedia.org/wikipedia/commons/thumb/f/f6/Paromomycin_structure.svg/522
Px-Paromomycin_structure.svg.png
The structures of aminoglycosides could also be found in the review article by Hainrichson et al.,
2008.
27
Figure 4
Gentamicin Geneticin
Amikacin Paromomycin
28
of aminoglycosides consist of four (or more) rings rather than the three rings found in 4, 6 -
disubstituted class members (Hermann, 2007).
1.4.2 Toxicity of aminoglycosides.
One of the major disadvantages in using aminoglycosides for long term is their
toxicity through kidney (nephrotoxicity) and ear (ototoxicity) illnesses. A large amount of
the intravenously administered dose of aminoglycosides is accumulated in the kidney (about
10% of dose) and in the inner ear, whereas little distribution is seen in other tissues (Nagai
and Takano, 2004). The mechanism of aminoglycoside-induced toxicity involves a series of
steps. Since aminoglycosides are positively charged in neutral environment, they are able to
interact electrostatically with the negatively charged cell membranes. Upon entering the
cells, aminoglycosides interact with acidic phospholipids in the lysosomal membranes
(Nagai and Takano, 2004). This interaction generates free radical species which eventually
leads to tissue damage (Keeling and Bedwell, 2005). Also, aminoglycosides inhibit
phospholipases (enzymes that break down phospholipids) and this is another factor that
contributes to toxicity of aminoglycosides in inner ear and kidneys (Forge and Schacht,
2000; Nagai and Takano, 2004).
There is a structure-toxicity relationship of aminoglycosides. A decrease in the
number of amino groups results in diminished toxicity; however, a decrease in the number of
hydroxyl groups results in elevated toxicity. The reduced toxicity due to a decrease in the
number of charged amino groups could be explained by a decrease in nonspecific
29
interactions with many cell components and reduced formation of free radicals. The rank
order of the binding affinity with cell components resulting in nephrotoxic and ear toxicity is:
geneticin > gentamicin~paromomycin>amikacin (Humes et al., 1982; Williams et al., 1987).
Currently, the aminoglycosides that are used in clinical use as antibiotics for administration
in humans are amikacin, gentamicin and paromomycin amongst others (Figure 4). Due to its
high toxicity, geneticin is not used for clinical practices (Hainrichson et al., 2008) (Figure 4).
1.4.3 Megalin receptor is important in the uptake of aminoglycosides in cells.
Megalin is an anionic, endocytic receptor (Moestrup et al., 1995). Since
aminoglycosides are cationic at physiological pH, they can easily bind to megalin and are
taken up in the cells via receptor-mediated endocytosis (Moestrup et al., 1995). Megalin is
expressed on the membranes of most cells and organs of the body; however, it is most
abundantly expressed in the renal proximal tubule of kidney and inner ear (Christensen et al.,
1998). Thus, the nephrotoxicity and ototoxicity arise due to too much accumulation of
aminoglycosides in kidney and inner ear. The role of megalin in aminoglycoside
accumulation in kidney is supported by a study showing that a mouse model carrying a
knockout of the megalin gene does not accumulate aminoglycosides in kidney (Schmitz et
al., 2002). Furthermore, a study by Watanabe et al., (2004) has shown that administration of
agonists that compete with aminoglycoside binding to megalin results in a decrease of
aminoglycoside accumulation and toxicity. These studies indicate that one way
aminoglycosides might get into cells is through megalin receptor.
30
1.4.4 Potential of aminoglycosides to treat genetic diseases with nonsense mutations
A large number of human genetic diseases arise from nonsense mutations, single
point alterations in DNA that give rise to UAA, UAG, or UGA premature stop codons in
mRNA coding regions, leading to premature termination of protein synthesis and eventually
to truncated and non-functional proteins (Kerem, 2004). One approach to treat these diseases
is to reduce the efficiency of translation termination, so production of some full-length and
functional protein is restored. This mechanism is termed “termination suppression” or “read-
through”. Through mechanisms not completely understood, in the past few years, several
studies have shown that besides their use as antibiotics, aminoglycosides could have a
therapeutic benefit in the treatment of genetic diseases caused by premature stop codons by
inducing the ribosome to read-through these premature stop codons generating a full length
protein (Howard et al., 1996; Bedwell et al., 1997; Barton-Davis et al., 1999; Rebibo-Sabbah
et al., 2007; Lai et al., 2004; Pinotti et al., 2006).
The fact that aminoglycosides could suppress premature stop codons in mammalian
cells was first demonstrated in 1985 by Burke and Mogg. They have shown that geneticin
and paromomycin can suppress the TAG premature stop codon and restore the activity of a
mutant gene to approximately 20% of wild type levels when it was transfected in COS-7
cells. Furthermore, they also mentioned the therapeutic potential of these drugs in the
treatment of genetic diseases. Cystic Fibrosis (CF) was the first genetic disease studied and
several experiments have shown that nonsense mutations in the CFTR gene (which encodes
for cystic fibrosis transmembrane receptor protein) could be suppressed by geneticin and
gentamicin as seen by the appearance of full length, functional CFTR protein in transfection
31
assays and in a bronchial epithelial cell line (Howard et al., 1996; Bedwell et al., 1997).
Other genetic disorders where aminoglycosides were tested on are Duchenne Muscular
Dystrophy (DMD) (Barton-Davis et al., 1999; Howard et al., 2004), Hurler Syndrome
(Keeling et al., 2001), Usher Syndrome (Rebibo-Sabbah et al., 2007), Ataxia-Telangiectasia
(Lai et al., 2004), Factor VII deficiency (Pinotti et al., 2006) and Nephropathic cystinosis
(Helip-Wooley et al., 2002). The production of full length and functional proteins in these
studies were demonstrated with efficiencies varying from 1% to 30%, depending on the
sequence of the stop codon, the sequence context surrounding it and the aminoglycoside
tested.
Several studies have shown that the premature stop codon TGA shows a greater
translational read-through than TAG, and TAA stop codon is the most resistant to read-
through. The nucleotide after the stop codon also plays an important role in determining the
efficiency of aminoglycoside mediated read-through, but its effect is highly influenced by the
stop codon present and sequence around it (Manuvakhova et al., 2000; Bidou et al., 2004;
Keeling and Bedwell, 2002). Thus, it remains unclear whether the different nonsense
mutations responsible for Rett syndrome would be responsive to aminoglycoside treatment.
1.4.5 Proposed mechanisms of aminoglycoside mediated read-through.
It is believed that the potential of aminoglycosides in the treatment of disorders with
premature termination codons results from their ability to suppress nonsense mutations by
inducing the ribosomes to “read-through” the premature stop codons generating full length
32
proteins by insertion of an amino acid by the near-cognate tRNA (Hainrichson et al., 2008).
It has been suggested that in general tryptophan is inserted at TGA premature stop codon and
glutamine is inserted at TAG and TAA premature stop codons (Nilsson and Ryden-Aulin,
2003). A proposed mechanism of how aminoglycosides may induce read-through is by their
ability to bind to the decoding site (A site) of rRNA inducing conformational changes that
stabilize the interaction between the stop codon of mRNA and the near-cognate aminoacyl
tRNA (aminoacyl-tRNA that has an anticodon complementary to two of the three nucleotides
of the stop codon). When this occurs, the release factor proteins do not bind, thus the
elongation of the polypeptide chain in the correct reading frame continues and a full length
protein is produced (Recht et al., 1996) (Figure 5).
It has been shown that there are several important structures that allow
aminoglycosides to bind to the decoding site of rRNA. The bases G1408, A1492 and A1493
in the rRNA decoding site are necessary for high affinity binding to ring I of the
aminoglycosides (Vicens and Westhof, 2003). A possible reason is that these nucleotides are
unpaired and they create a suitable site for the aminoglycosides to bind and interact with
nucleic acids and anionic phosphate groups. It has been shown that this cavity in the rRNA is
necessary to allow binding of aminoglycosides (Figure 6) (Vicens and Westhof, 2003).
Furthermore, it has been proposed that the central ring (2-DOS or ring II) of aminoglycosides
is required for the precise anchoring of the aminoglycosides to the decoding site of rRNA
(Vicens and Westhof, 2003; Hermann, 2005).
33
Figure 5. The mechanism of aminoglycoside interaction with ribosomal protein
synthesis.
A) As an example, in the normal case, tRNA carrying the anticodon (CUU) of glutamic acid
(E) matches the codon on mRNA (GAA). This match results in the conformational alignment
of A1492 and A1493 in the decoding site of 18S rRNA leading to polypeptide chain
elongation.
B) When a nonsense mutation occurs, in this example the codon for glutamic acid changes
to a premature stop codon (UAA) in mRNA. This mutation prevents the codon-anticodon
pairing since A1492 and A1493 in the ribosomal decoding site are not properly aligned and
this causes translation to end and thus a truncated protein is produced.
C) Aminoglycosides bind to the decoding site of 18S rRNA and induce a conformational
alignment of A1492 and A1493 in the ribosomal decoding site. When this occurs, the
interaction between the premature stop codon of mRNA and the near-cognate aminoacyl
tRNA is stabilized, leading to incorporation of an amino acid (in this example, glutamine or
Q) and promoting chain elongation.
(Image modified from a review article by Zingman et al., 2007)
34
Figure 5
A B
C
35
A study by Recht et al., (1999) has shown that aminoglycosides bind with a higher
affinity to the rRNA of prokaryotes than to that of eukaryotes. Prokaryotic rRNA contains
A1408 in the decoding site; however, eukaryotic rRNA contains G1408 base pair (Figure 6)
(Recht et al., 1999). Crystal structure analysis of aminoglycoside complexes have shown that
key hydrogen bonds occur at A1408 of the ribosomal decoding site of bacteria (Francois et
al., 2005). Since eukaryotic rRNA decoding site has a G at this position, it is not capable of
forming these critical hydrogen interactions with aminoglycosides. Thus, this single
nucleotide change allows binding of aminoglycosides to bacterial rRNA decoding site with a
much higher affinity than to eukaryotic rRNA. The antibacterial mode of these compounds
is due to this single nucleotide change (Recht et al., 1999).
The precise mechanism(s) through which aminoglycoside mediated read-through is
achieved remains unclear. During decoding, the aminoacyl-tRNA forms a minihelix between
the codon of the mRNA and the anti-codon of aminoacyl-tRNA. During this process, the
conformation of the A site is changed from an “off” state where the conserved adenines
A1492 and A1493 are folded back within helix, to an “on” conformation, where the adenines
are flipped out from the A-site, allowing the interaction between the cognate codon-
anticodon to occur. This conformation is a molecular switch that determines the continuation
of translation. It is believed that aminoglycosides facilitate read-through of nonsense
mutations by binding to the A-site of rRNA and changing the conformation equilibrium of
the two conserved adenines A1492 and A1493 to the “on” state (Figure 7). In the “on” state
conformation the two adenines are able to create hydrogen bonds with the bases formed by
near-cognate tRNA anticodon and the mRNA premature stop codon leading to continuation
36
Figure 6. The structures of ribosomal decoding sites of prokaryotes and eukaryotes. The
A base (prokaryotes) and G base (eukaryotes) are indicated by arrows. The cavity formed by
the unpaired nucleotides A1408 or G1408, A1492 and A1493 allows aminoglycosides to
bind. (Abbreviations: A-adenine, G-guanine).
(Figure modified from a review article by Hainrichson et al., 2008)
37
Figure 6
Prokaryotic (16S) decoding site Eukaryotic (18S) decoding site
38
of translation (Hainrichson et al., 2008; Keeling and Bedwell, 2005) (Figure 7). It has been
shown that different aminoglycosides bind to decoding site of rRNA with different affinities.
This might depend on the hydrogen bonds and electrostatic interactions between decoding
site of rRNA and the rings of aminoglycosides (Vicens and Westhof, 2003; Carter et al.,
2000; Yoshizawa et al., 1998; Vicens and Westhof, 2001).
Although it is not completely clear, several studies have proposed that another
mechanism of how aminoglycosides might be able to induce read-through is by suppressing
the nonsense mediated mRNA decay (NMD) pathway (Bedwell et al., 1997; Correa-Cerro et
al., 2005; Buck et al., 2009). Approaches that inhibit NMD pathway increase the amount of
mutated mRNA available for translation. This may greatly enhance the levels of protein
produced by suppression therapy (Correa-Cero et al., 2005).
1.4.6 Do aminoglycosides facilitate read-through at normal stop codons?
Although not completely known, it is believed that aminoglycosides can only
facilitate read through at premature stop codons, and not at normal stop codons. In a review
article, Kerem (2004) has proposed that naturally occurring stop codons are found within a
context that promotes efficient translation termination compared to premature stop codons.
Furthermore, multiple stop codons are found at the end of an open reading frame of mRNA.
The presence of many stop codons may reduce the ability of aminoglycosides to induce read-
through at normal termination signals (Major et al., 2002). Also, the normal stop codons are
located in proximity to the poly(A) tail and this may contribute to translational termination
39
Figure 7. The molecular mechanism of the aminoglycoside mediated read-through.
At the ribosomal decoding site, A1492 and A1493 are in the “off” state conformation.
When aminoglycosides bind to the decoding site, they change the conformation equilibrium
of the two conserved adenines to the “on” state. In the “on” state conformation, A1492 and
A1493 are able to create hydrogen bonds with the bases formed by near-cognate tRNA
anticodon and the mRNA premature stop codon leading to continuation of translation.
(Figure modified from a review article by Hainrichson et al., 2008)
40
Figure 7
41
(Amrani et al., 2004). In addition, specific mRNA decay mechanisms are activated when
translation extends into the 3`-untranslated region (UTR); thus, even if aminoglycosides
would facilitate read through at normal stop codons, the proteins would not be produced
(Hoof et al., 2002). Collectively, these factors have led to the hypothesis that
aminoglycosides may be able to induce read through only at premature stop codons.
1.5 Aims of my thesis
Approximately 40% of mutations that cause Rett syndrome are of the nonsense
mutation class (Percy et al., 2007). Several studies have shown that certain aminoglycosides
facilitate premature termination stop codon read-through and allow the generation of a full-
length and functional protein product (Bedwell et al., 1997; Howard et al., 1996). However,
the aminoglycoside mediated read-through is highly dependent on the sequence of the stop
codon, and nucleotides surrounding the stop codon. It remains unclear whether the
different nonsense mutations of MECP2 that cause Rett syndrome will be responsive to
aminoglycoside treatment.
Specifically, the aims of my thesis were:
To generate epitope tagged cDNAs containing some nonsense mutations seen
clinically in Rett syndrome girls.
To transiently transfect HEK-293 cells with the mutant cDNAs in the presence and
absence of different concentrations of aminoglycosides, and determine whether the
42
prevalence of full length MeCP2 protein is increased in the presence of
aminoglycosides using western blot analysis.
To determine whether the prevalence of full length MeCP2 protein is increased in
lymphocyte cells derived from a Rett syndrome girl with R255X mutation when they
were treated for four days with different concentrations of aminoglycosides.
To determine whether the prevalence of full length MeCP2 protein is increased in the
lymphocyte cells derived from a Rett Syndrome girl with R255X mutation when they
were treated for 12 days with aminoglycosides at clinically relevant doses.
MY OVERALL HYPOTHESIS is that the premature terminating mutations of
MECP2 that cause Rett syndrome can be partially suppressed by aminoglycoside
administration allowing a full length MeCP2 protein to be generated.
43
2 Methods
2.1 Molecular biological techniques
2.1.1 Construction of mutant forms of MECP2
Nonsense mutations corresponding to specific mutations seen clinically in Rett girls were
generated by PCR-based site-directed mutagenesis using a myc or hemagglutinin-tagged
(HA) full-length mouse Mecp2 cDNA (exon 2 form) as a template for generating the Y141X,
Q170X, and E205X mutant forms, and a human MECP2 cDNA (exon 1 form) for generating
the R294X mutant. The following primers were used for these reactions:
Mecp2-Y141X (C-G substitution):
Sense: 5`-GTAGAATTGATTGCATAGTTTGAAAAGGTGGGAGACACCTCC-3`,
Antisense: 5’-GGAGGTGTCTCCCACCTTTTCAAACTATGCAATCAATTCTAC;
Mecp2-Q170X (C-T substitution):
Sense: 5`-CCCTCCAGGAGAGAGTAGAAACCACCTAAG-3`,
Antisense 5`-CTTAGGTGGTTTCTACTCTCTCCTGGAGGG-3`;
Mecp2-E205X (G-T substitution):
Sense: 5`-GGCAGCAGCATCATAAGGTGTTCAGGTG - `3,
Antisense: 5`- CACCTGAACACCTTATGATGCTGCTGCC -`3;
MECP2-R294X (C-T substitution):
Sense: 5`-GTGAAGGAGTCTTCTATCTGATCTGTGCAGGAGACC -3`,
Antisense: 5`-GGTCTCCTGCACAGATCAGATAGAAGACTCCTTCAC-3`.
44
The bolded and underlined nucleotide indicates the site targeted to generate the mutant form
of MECP2.
In order to generate the mutant forms of MECP2, the site directed mutagenesis kit
(STRATAGENE) was used. The PCR reaction mix was made by adding reaction buffer to
1X, 50 ng of wild type MECP2 cDNA (having HA or Myc epitope tags in a modified
pTRACER-CMV2 expression vector in which cDNA encoding the green fluorescent protein
had been excised), 125 ng of sense primer, 125 ng of antisense primer, 1 ul of dNTP mix and
water to a final volume of 50 ul. After mixing the reaction, 1 ul of PfuUltra HF DNA
polymerase (2.5 U/ul) was added. The reaction was added in a thermocycler with the
conditions as illustrated in Table 2.
Table 2. Cycling Parameters for the Site-Directed Mutagenesis Method.
Segment Cycles Temperature Time
1 1 95C 30 seconds
2 15 95C 30 seconds
55C 1 minute
68C 1.5 minutes
Following the temperature cycling, the reaction was placed on ice for two minutes to cool to
less than 37oC. Approximately 1 ul of Dpn I restriction enzyme (10 U/ul) was added directly
to each amplification reaction, after which the reaction was mixed and incubated in 37oC
water bath for two hours to digest the parental dsDNA (non-mutated DNA). The DNA was
then transformed in SURE 2 Supercompetent E.coli cells (STRATAGENE), purified and
45
each mutant was verified by DNA sequencing of both strands (ACGT Inc, Toronto, Ontario).
The generated truncated forms of MeCP2 are shown in Figure 8.
2.1.2 DNA transformation
All cDNA constructs were transformed in SURE 2 Supercompetent E. coli cells
(STRATAGENE). The bacterial cells (100 ul cells) were allowed to thaw on ice. After
thawing, 2 ul of Beta-mercaptoethanol was added on cells to increase transformation
efficiency. The cells were then incubated on ice for 10 minutes, swirling gently every 2
minutes. Approximately 50 ng of each mutant cDNA was added to 100 ul bacterial cells,
after which they were left on ice for 45 minutes. Then, the cells were heat-pulsed by placing
them in a 42oC water bath for 30 seconds, and then incubated on ice for 2 minutes.
Following this, 900 ul of preheated NZY+ (1% NZ amine, 0.5% yeast extract, 0.5% NaCl,
pH 7.5) was added on bacterial cells, and the tubes were incubated at 37oC for 1-2 hours with
shaking at 225-250 rpm in an incubator shaker (Series 25, New Brunswick Scientific CO.,
Inc).
Approximately 50-100 ul of the transformation mixture was plated on Luria-Bertaini (LB)
agar plates (1% NaCl, 1% tryptone, 0.5% yeast extract, 1.5% agar, 1% ampicillin) and
incubated at 37oC for 12-16 hours. Next day, a single colony from a plate was inoculated in
approximately 3 mL LB medium (1% NaCl, 1% tryptone, and 0.5% yeast extract) and
incubated for 12-16 hours at 37oC with shaking at 300 rpm.
46
Figure 8. The truncated forms of MeCP2 that I used in my study. On the right side of the
figure, the induced premature stop codon, the nucleotide downstream of stop codon, and their
expected migration sizes in kilodaltons (kDa) are shown.
47
Figure 8
48
2.1.3 DNA purification
For DNA purification, the QIAprep Spin Miniprep Kit (QIAGEN) was used. Approximately
3 mL of bacteria were pelleted at 13,200 rpm (16,300 x g; 851 IEC MicroMax) in a tabletop
microfuge for 1 minute, after which the pellet was re-suspended in 250 ul buffer P1 (50 mM
glucose, 25 mM Tris.Cl pH 8, 10 mM EDTA pH 8, RNAse). The bacteria were re-
suspended in this buffer until no cell clumps were visible. Then, 250 ul of buffer P2 (0.2 M
NaOH, 1% SDS) was added to lyse the cells, and the tube was inverted slowly six times until
the solution became slightly clear. The lysis reaction was allowed to proceed for 5 minutes.
To neutralize the reaction, 350 ul buffer N3 (3 M potassium acetate, 11.5 % glacial acetic
acid) was further added and the solution was mixed several times until it became cloudy.
The reaction was then centrifuged for 10 minutes at 13,000 rpm. The supernatant was
applied to the QIAprep spin column and centrifuged for 1 minute. The flow-through was
discarded and the DNA in the QIAprep spin column was washed with 500 ul buffer PB
(guanidine hydrochloride, isopropanol) to remove trace nuclease activity. The column was
centrifuged again for 1 minute, the flow-through was discarded, and the DNA was washed by
adding 750 ul buffer PE (70% ethanol). The QIAprep spin column was centrifuged for 1
minute to remove the wash buffer. The column with the DNA was placed in a clean 1.5
microcentrifuge tube and 50 ul buffer EB (10 mM Tris-Cl ph 8.5) was added to the center of
spin column. The tube was left on the bench for 1 minute and then centrifuged again for 1
minute at 13,000 rpm to elute the DNA. DNA concentration was measured using Nanodrop.
49
2.1.4 Preparation of cell lysates
Treated and non-treated transfected HEK-293 cells plated in 6-well plates were washed once
with cold PBS and lysed on ice with 100 ul Mammalian Protein Extraction Reagent (M-PER-
PIERCE) lysis buffer supplemented with proteinase inhibitors per well for 5 minutes.
Lysates were then centrifuged at 13,200 rpm (16,300 x g) for 10 minutes in a tabletop
microfuge (851 IEC MicroMax). The supernatant fractions were collected, aliquoted and
stored at -20oC until use.
2.1.5 Nuclear extraction
Treated and untreated lymphocytes were washed 3X with PBS at 4oC by sequential
centrifugation at 2000 rpm (688 x g) (model #3840, Omnifuge). The washed cell pellet was
re-suspended in 4X the pellet volume (roughly 800 ul) of hypotonic solution (10 mM HEPES
pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, protease inhibitors) and incubated on ice
for 10 minutes to allow the cells to swell. The swollen cells were then centrifuged for 15
minutes at 2000 rpm (688 x g) at 4oC. The pellet was re-suspended in 2X the pellet volume
(roughly 400 ul) in hypotonic solution, and disrupted by manual homogenization (40 strokes)
in a round bottom Dounce tube fitted with a pestle. The nuclei were then collected by
centrifugation at 2000 rpm (688 x g) for 15 minutes at 4oC as above. The pellet was
collected, re-suspended in 300 ul ice cold lysis buffer (20 mM HEPES pH 7.9, 25% glycerol,
0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, protease inhibitors), and
homogenized 40X as above in the Dounce homogenization tube. Nuclear proteins were
extracted from this homogenate by incubation on a rotating platform for 30 minutes at 4oC,
50
and then cleared by centrifugation for 30 minutes at 14,500 rpm (26,000 x g) (SW-41T1
Beckman rotor). The nuclear extract was aliquoted into cryovials, and snap-frozen by
submerging in liquid nitrogen. The extracts were stored at -80oC until use.
2.1.6 Western blot analysis
The protein concentrations of individual samples were determined using the Bradford protein
assay (Invitrogen, Carlsbad CA) at 595 wavelength using the spectrophotometer (Beckman
model DU640). For nuclear extractions 3 ug proteins were loaded on each well. For total
extractions, 15 ug proteins were loaded on each well. Samples were prepared for gel
electrophoresis by addition of loading buffer (50 mM Tris-HCl, pH 6.8, 2% SDS, 10%
glycerol, 1% Beta-mercaptoethanol, 12.5 mM EDTA and 0.02% bromophenol blue) and
heating to 95oC for five minutes to denature the proteins. The samples were then resolved by
electrophoresis on a 5% acrylamide stacking gel and 12.5% resolving acrylamide gel in Tris-
glycine Laemlli running buffer (25 mM Tris, 192 mM glycine and 0.1% SDS) at a constant
voltage of 100 V for 2 hours. After electrophoresis, the proteins were transferred onto a
nitrocellulose membrane overnight in transfer buffer (25 mM Tris, 192 mM glycine, 20%
methanol) at a constant voltage of 23V at 4oC. The membranes were then incubated for two
hours at room temperature with a blocking solution containing TBST washing buffer (10
mM Tris, 150 mM NaCl, 0.05% Tween 20) and 5% non-fat dry skim milk to diminish non-
specific binding, and then incubated overnight with specific primary antibodies diluted in
blocking solution at 4oC. The primary antibodies used were a chicken anti-human MeCP2
C-terminus antibody at a dilution of 1:15,000 (a gift from Dr. Janine LaSalle, University of
51
California, Davis) and monoclonal antibodies raised in mouse towards the HA (COVANCE,
dilution 1:1000) and Myc (Cell Signaling Technology, dilution 1:1000) epitope tags.
Following primary incubation, the blots were washed extensively in TBST washing buffer,
and then incubated for two hours with secondary horseradish peroxidase-conjugated species-
specific antibodies diluted in blocking solution. The antibodies were used at concentrations
recommended by the manufacturer (anti-chicken 1:10,000 and anti-mouse 1:5,000). Reaction
products were visualized using enhanced chemiluminescence (GE Healthcare, Amersham
ECL Western Blotting Detection Reagents). Molecular weights were determined with pre-
stained markers. To control for the amount of loaded protein in lymphocytes, the membranes
were stripped by incubation at 55o
C for 30 minutes in stripping buffer (10% SDS, 1 M Tris
pH 6.7, Beta-mercaptoethanol) followed by washing in TBST (3 X 10 minutes per wash) and
blocking for 2 hours at room temperature in blocking solution. The blots were re-probed with
an antibody against MBD2 (Sigma) at a dilution of 1:10,000.
2.1.7 Immunocytochemistry
Transfected HEK-293 cells grown on glass coverslips were washed twice with PBS and
fixed in cold PBS containing 4% paraformaldehyde for 20 minutes. The cells were washed
with PBS (5 minutes 3X), and permeabilized with 0.25% Triton X-100 (Sigma), followed by
washing with PBS (5 minutes 3X). The cells were incubated overnight at 4oC with blocking
solution containing 4% BSA, 4% goat serum and 0.5% non-fat dry skim milk to eliminate
nonspecific antibody binding. The following day, the cells were incubated overnight at 4oC
with primary antibodies diluted in the blocking solution (Anti HA 1:500; Anti Myc 1:500).
52
The cells were washed with PBS (5 minutes 3X) after which they were incubated with
secondary antibody conjugated with fluorochromes for 1 hour at room temperature. The cells
were washed again with PBS (5 minutes 3X) and stained with DAPI, which fluorescently
labels nuclei for 20 minutes. Cells were viewed using a Zeiss Axioplan with Deconvolution
Imaging microscope.
2.2 Statistical analysis
The read-through in transfected HEK-293 cells was determined by dividing the full length
MeCP2 protein by the total amount of MeCP2 protein (full length + truncated form) after
subtracting film background, to determine the percent recovery using densitometry (MCID
Elite 6.0 Program). In lymphocytes, the read through was determined by dividing the full
length MeCP2 protein by the control load (MBD2) and then divide the ratio of treated cells
by the ratio of untreated cells using densitometry. Data are expressed as means +/- standard
error of the mean (SEM). Statistical analysis was performed by one way analysis of variance
and student t-test. Statistical significance was accepted at p<0.05 following a post hoc
Bonferroni correction for multiple comparisons.
2.3 Aminoglycosides used in my study
All aminoglycosides used (amikacin, paromomycin, gentamicin and geneticin) (Figure 4)
were purchased from SIGMA in powder form. A stock solution of 50 mg/mL in distilled
water was made and stored at 4oC.
53
2.4 Cell culture
2.4.1 HEK-293 cell culture and transfection
HEK-293 cells were grown as monolayer cultures in Dulbecco’s Modified Eagle Medium
(DMEM) with 1,000 mg/L of D-glucose, L-glutamine, pyridoxine hydrochloride, and 110
mg/L of sodium pyruvate supplemented with 10% fetal bovine serum (FBS) and 50 units/ml
penicillin, and 50 ug/mL streptomycin in 10-cm dishes. The cells were incubated at 37oC at
an atmosphere of 5% CO2. Twenty four hours before transfection, the cells were split in 6-
well plates. Next day, at approximately 80% confluency, the cells were transiently
transfected with the purified plasmids using Lipofectamine 2000 (Invitrogen). Cells were
transfected with a total amount of 4 ug of DNA/well and 10 ul of Lipofectamine/well (for
immunoblotting) and 0.8 ug of DNA/well and 2 ul of Lipofectamine/well (for
immunocytochemistry). The purpose of immunocytochemistry was to determine the
transfection efficiency in HEK-293 cells. The transfection efficiency was determined by
dividing the number of transfected cells by the total cell number (DAPI staining). Four hours
later, the transfection medium was removed and replaced with fresh medium containing
aminoglycosides diluted at the indicated concentrations (without streptomycin and
penicillin). The cells were treated for 48 hours. Fresh aminoglycoside-containing media was
replaced every 24 hours.
54
2.4.2 Lymphocyte culture and drug treatment
Lymphocyte cells derived from a Rett girl expressing an R255X nonsense mutation of
MECP2 (Corriell Cell Repository, Stock Number 16497) were grown in RPMI medium
(SIGMA) with 15% FBS, 1% glutamine and 1% penicillin/streptomycin at 37oC and 5%
CO2. The cells were treated with aminoglycosides at the indicated doses for four days (acute
treatment) and twelve days (long term treatment). Fresh media containing aminoglycosides
was replaced every 48 hours. Nuclear extractions were done at the fifth day (acute
treatment) and thirteenth day (long term treatment) after the aminoglycosides were added.
55
3 Results
3.1 In vitro
3.1.1 Nonsense mutations generating truncated forms of MeCP2 are expressed in
transiently transfected HEK-293 cells.
Although nonsense mediated decay is primarily seen in in vivo settings, I first
confirmed that each of the nonsense mutant forms of MeCP2 to be used in my study were
successfully expressed in human embryonic kidney cells. As shown in Figure 9, expression
cassettes containing the Y141X, Q170X, E205X and R294X mutations each generated a
truncated MeCP2 protein in transient transfection assays. I chose these mutations because
they generate all three premature stop codons in different surrounding contexts. While this
does not rule out the possibility of nonsense mediated mRNA decay affecting any or all of
these nonsense mutations in vivo, these results do establish that the mutant forms are
generated from their respective transcripts in the assay conditions used for this study.
Using immunocytochemistry, the transfection efficiency in HEK-293 cells was
determined to be approximately 10% (32 transfected cells out of 300 cells) (Figure 10).
56
Figure 9. The mutant forms of MeCP2 are expressed in transiently transfected HEK-
293 cells. Western blot analysis of protein samples extracted from HEK-293 cells transfected
with epitope tagged wild type MECP2 or tagged Y141X, Q170X, E205X and R294X mutant
forms of MECP2. Immunoreactivity was detected using monoclonal antibodies: anti-Myc for
R294X and anti-HA for Y141X, Q170X and E205X, which detect the N-terminal part of
MeCP2 protein. Because of the basic nature of MeCP2, its electrophoretic mobility is slower
than its predicted mass. The 60 kDa product is a non-specific product seen in all of the
transfected HEK-293 cells with the Myc antibody.
57
Figure 9
58
Figure 10. Transfection efficiency in HEK-293 cells is about 10%. I have transiently
transfected HEK-293 cells with MECP2-R294X mutation. Forty eight hours after
transfection, immunocytochemistry was done to determine the transfection efficiency. Panel
A shows the total cell number (DAPI staining). Panel B shows the transfected cells (using
Texas Red anti-Myc antibody) and Panel C shows the emerged cells.
59
Figure 10
A B
C
60
3.1.2 The aminoglycosides gentamicin and geneticin facilitate read-through of the
R294X Rett syndrome causing nonsense mutation.
The first part of my study was to test whether the administration of different doses of
specific aminoglycosides would promote read-through of specific nonsense mutant forms of
MECP2. I have transiently transfected HEK-293 cells with the mutant forms of MECP2 in
the presence and absence of different concentrations of aminoglycosides for 48 hours. In the
absence of aminoglycosides, no full length MeCP2 protein was detected for any of the
mutant forms tested.
However, administration of the aminoglycosides geneticin, or gentamicin, partially
suppressed the R294X nonsense mutation (TGA T) and facilitated the generation of a full
length MeCP2 protein in a dose-dependent manner. A statistically significant effect for these
aminoglycosides started to be observed at a concentration of 0.6 mg/mL. Analysis of
densitometric levels revealed that at this concentration gentamicin induced the full length
MeCP2 protein by 8 +/- 1.5% while geneticin induced the full length MeCP2 protein by 11
+/- 1.8% (Figure 11 C). The maximal levels of stop codon read-through for these
aminoglycosides were detected at 2 mg/ml. The relative efficiency of read-through for
geneticin at 2 mg/ml was 30 +/- 1.7%, while the efficiency for gentamicin was 22% +/- 1.8%
(Figure 11 C).
61
Figure 11. Gentamicin and geneticin induce read-through of the R294X mutation in a
dose response manner.
Western blot analysis of protein samples extracted from treated and non-treated HEK cells
transfected with R294X mutation (TGA T) (A and B). The negative control represents
protein samples extracted from non-transfected HEK-293 cells and the positive control
represents protein samples extracted from HEK-293 cells transfected with wild type Myc-
MECP2 cDNA. Immunoreactivity was detected with anti-Myc antibody which detects the
N-terminal part of MeCP2 protein. The 60 kDa protein is a non-specific product detected by
the Myc antibody in all of the transfected HEK-293 cells used in this study. Panel C shows
the mean and standard errors from 4 independent experiments for each aminoglycoside, each
performed in duplicate. Percent read-through was determined by dividing the full length
MeCP2 by the total amount of protein (full length + truncated form). Astericks * and #
represent statistical significance compared to non-treated cells for geneticin and gentamicin,
respectively, at p<0.05, following a post-hoc Bonferroni correction for multiple comparisons.
62
Figure 11
A
B
C
63
3.1.3 Amikacin and paromomycin are not effective in inducing read-through of R294X
mutation.
I then tested the read through potential of two additional aminoglycosides on the
R294X mutation that are used clinically with less toxicity than gentamicin: namely amikacin
and paromomycin. I have transiently transfected HEK-293 cells with R294X mutation in the
presence and absence of different concentrations of amikacin or paromomycin for 48 hours.
Amikacin produced a small increase in the full length MeCP2 protein (in 2 out of 3 assays)
only at the highest concentrations used, however this did not reach statistical significance
(Figure 12 A, C). Paromomycin did not induce full length MeCP2 protein at any of the
concentrations tested (Figure 12 B, C).
64
Figure 12. Amikacin and paromomycin do not facilitate read-through of the R294X
mutation.
Western blot analysis of protein samples extracted from non-treated, amikacin-treated
(A) and paromomycin-treated (B) HEK-293 cells transfected with R294X mutation. The
negative control represents protein samples extracted from non-transfected HEK-293 cells
and the positive control represents protein samples extracted from HEK-293 cells transfected
with wild type MECP2 cDNA. Immunoreactivity was detected with an anti-Myc antibody
which detects the epitope tag at the N-terminal part of MeCP2 protein. The 60 kDa protein is
a non-specific product detected by the Myc antibody in all of the transfected HEK-293 cells
used in this study. Panel C shows the mean and SEM from 3 independent experiments with
each aminoglycoside, each performed in duplicate. The percent read-through was
determined by dividing the full length MeCP2 by the total amount of protein (full length +
truncated form). Statistical significance was accepted at p<0.05 following a post-hoc
Bonferroni correction for multiple comparisons. Amikacin and paromomycin did not
significantly induce full length MeCP2 protein.
65
Figure 12
A
B
C
66
3.1.4 Aminoglycoside treatment induces read-through of Q170X mutation.
In addition to the nonsense mutations involving arginine codons, another mutation
seen in Rett syndrome girls is glutamine (Q170X). This mutation induces the stop sequence
TAG A. I have transiently transfected HEK-293 cells with Q170X mutation in the presence
and absence of different concentrations of gentamicin or geneticin for 48 hours. Gentamicin
induced the read-through of Q170X mutation at a concentration of 2 mg/mL, where it
increased the prevalence of full length MeCP2 protein by approximately 9 +/- 2%. Lower
concentrations were not effective in restoring the full length MeCP2 protein (Figure 13 A,
C). Furthermore, geneticin suppressed this tetranucleotide termination signal in a dose
response manner (Figure 13 B, C). A statistical significant effect started to be detected at a
concentration of 0.6 mg/mL where geneticin induced full length MeCP2 protein from this
mutation by 7 +/- 1.2%. The highest read-through occurred at a dose of 2 mg/mL where
geneticin suppressed this premature stop codon by 11+/- 1.7% (Figure 13 C).
67
Figure 13. Aminoglycoside treatment induces read-through of Q170X mutation.
Western blot analysis of protein samples extracted from non-treated, gentamicin-treated (A)
and geneticin-treated (B) HEK-293 cells transfected with Q170X (TAG A) mutation. The
negative control represents protein samples extracted from non-transfected HEK-293 cells
and the positive control represents protein samples extracted from HEK-293 cells transfected
with wild type Mecp2 cDNA. An anti-HA antibody was used to detect the epitope tag
located at the N-terminal part of the recombinant MeCP2 proteins. Panel C shows the
cumulative densitometric results (mean and SEM) from 3 independent experiments for each
aminoglycoside, each performed in duplicate. Percent read-through was determined by
dividing the full length MeCP2 by the total amount of protein (full length + truncated form).
* and # denote statistical significance compared to non-treated cells for geneticin and
gentamicin, respectively, at p<0.05 following a post-hoc Bonferroni correction for multiple
comparisons.
68
Figure 13
A
B
C
69
3.1.5 Aminoglycosides induce read-through of Y141X mutation with different
efficiencies.
The nonsense mutation Y141X induces the premature termination codon TAG T. I
have transiently transfected HEK-293 cells with this mutation in the presence and absence of
different concentrations of gentamicin or geneticin for 48 hours. Western blot analysis
shows that gentamicin did not induce the prevalence of full length MeCP2 protein from this
mutation at any concentrations tested (Figure 14 A). However, geneticin suppressed this
mutation only at a concentration of 2 mg/mL where it induced the full length MeCP2 protein
by approximately 10 +/- 0.67% (Figure 14 B, C). Thus, at the concentrations tested, geneticin
is more efficient in suppressing this type of mutation than gentamicin.
70
Figure 14. Gentamicin and geneticin induce read-through of Y141X mutation with
different efficiencies.
Western blot analysis of protein samples extracted from non-treated, gentamicin-treated (A)
and geneticin-treated (B) HEK-293 cells transfected with Y141X (TAG T) mutation. The
negative control represents protein samples extracted from non-transfected HEK-293 cells
and the positive control represents protein samples extracted from HEK-293 cells transfected
with wild type Mecp2 cDNA. An anti-HA antibody was used to detect the epitope tag
located at the N-terminal part of the recombinant MeCP2 proteins. Panel C shows the
cumulative densitometric results (mean and SEM) from 3 independent experiments for each
aminoglycoside, each performed in duplicate. Percent read-through was determined by
dividing the full length MeCP2 by the total amount of protein (full length + truncated form).
* denotes statistical significance compared to non-treated cells for geneticin at p<0.05
following a post-hoc Bonferroni correction for multiple comparisons.
71
Figure 14
A
B
C
72
3.1.6 Aminoglycosides are not effective in inducing read-through of E205X mutation.
Another nonsense mutation seen in Rett girls is E205X. This mutation introduces the
premature stop codon TAA G. I have transiently transfected HEK-293 cells with E205X
mutation in the presence and absence of different concentrations of gentamicin or geneticin
for 48 hours. Western blot analysis shows that the aminoglycosides gentamicin and
geneticin had no effect on this type of mutation, as full length MeCP2 protein was not
detected at any concentrations tested (Figure 15). These results illustrate that the identity of
the stop codon plays an important role in determining the efficiency of aminoglycoside-
mediated read-through.
73
Figure 15. Aminoglycosides fail to increase the prevalence of full length MeCP2 from
E205X mutation.
Western blot analysis of protein samples extracted from non-treated, gentamicin-treated (A)
and geneticin-treated (B) HEK-293 cells transfected with E205X (TAA G) mutation. The
negative control represents protein samples extracted from non-transfected HEK-293 cells
and the positive control represents protein samples extracted from HEK-293 cells transfected
with wild type Mecp2 cDNA. An anti-HA antibody was used to detect the epitope tag
located at the N-terminal part of the recombinant MeCP2 proteins. Panel C shows the
cumulative mean data from 3 independent experiments for each aminoglycoside, each
performed in duplicate. Gentamicin and geneticin did not increase full length MeCP2 protein
from E205X mutation at any concentrations tested.
74
Figure 15
A
B
C
75
3.2 In vivo
3.2.1 Acute aminoglycoside treatment increases the prevalence of full length MeCP2
protein in a lymphocyte cell line with R255X mutation.
Next, I tested whether aminoglycoside treatment would be effective at increasing full-
length MeCP2 levels in a lymphocyte cell line derived from a Rett girl with an R255X
nonsense mutation. Although this nonsense mutation is an R-X conversion, in this case the
nucleotide after stop codon differs from the R294X mutation tested above in the transient
transfection assays. The mutation R255X induces the premature stop codon TGA A while the
mutation R294X induces the premature stop mutation TGA T. Cultured lymphocyte cells
were treated for four days with different concentrations of gentamicin, geneticin or amikacin,
and then harvested for nuclear protein extraction. Since MeCP2 is a nuclear protein, nuclear
extractions were done to minimize the unspecific binding of the antibody to the proteins from
the cytoplasm.
Western blot analysis of these nuclear extracts revealed that all three aminoglycosides
induced full length MeCP2 protein in a dose-dependent manner. These cells are
heterozygous for MeCP2: it is expected that half of the cells express the full length copy of
MeCP2 and half of the cells express the truncated form. For geneticin, the highest read-
through occurred at 0.1 mg/mL, where a 35 +/- 8% increase in the prevalence of full length
MeCP2 protein was observed (Figure 16). Higher doses than 0.1 mg/mL were associated
with poor cell growth and some cell death. Gentamicin increased the prevalence of full
length MeCP2 protein in a dose response manner starting at a concentration of 0.05 mg/mL.
The highest read-through for this aminoglycoside was observed at a concentration of 0.3
76
mg/mL, where full-length MeCP2 levels were increased by 30 +/- 2.6% (Figure 17).
Similarly, amikacin increased the levels of full-length MeCP2 by 32 +/- 2.6% at a
concentration of 0.3 mg/ml. Lower concentrations were not effective in inducing read-
through (Figure 18).
77
Figure 16. Geneticin induces the prevalence of full length MeCP2 protein in a dose
response manner.
Representative western blot of nuclear proteins extracted from treated and non-treated
lymphocyte cell line having R255X mutation. The antibody used is an anti-human MeCP2
raised in chicken that detects the C-terminal part of MeCP2 protein. The cells were treated
for 4 days with the indicated concentrations of geneticin. Positive control represents nuclear
extracts from MBD2-null mouse brain. Following initial hybridization, the blots were
stripped and re-probed with an antibody against MBD2 to serve as a loading control. The
histogram shows the densitometric data (mean and SEM) from 5 independent experiments,
each performed in duplicate, normalized to MBD2. * denotes statistical significance
compared to non-treated cells at p<0.05 following a post-hoc Bonferroni correction for
multiple comparisons.
78
Figure 16
79
Figure 17. Gentamicin induces the prevalence of full length MeCP2 protein in a dose
response manner.
Representative western blot of nuclear proteins extracted from treated and non-treated
lymphocyte cell line having R255X mutation. The antibody used is an anti-human MeCP2
raised in chicken that detects the C-terminal part of MeCP2 protein. The cells were treated
for 4 days with the indicated concentrations of gentamicin. Positive control represents
nuclear extracts from MBD2-null mouse brain. Following initial hybridization, the blots
were stripped and re-probed with an antibody against MBD2 to serve as a loading control.
The histogram shows the densitometric data (mean and SEM) from 5 independent
experiments, each performed in duplicate, normalized to MBD2. * denotes statistical
significance compared to non-treated cells at p<0.05 following a post-hoc Bonferroni
correction for multiple comparisons.
80
Figure 17
81
Figure 18. Amikacin is effective in restoring the full length MeCP2 protein at a high
concentration.
Representative western blot of nuclear proteins extracted from treated and non-treated
lymphocyte cell line having R255X mutation. The antibody used is an anti-human MeCP2
raised in chicken that detects the C-terminal part of MeCP2 protein. The cells were treated
for 4 days with the indicated concentrations of amikacin. Positive control represents nuclear
extracts from MBD2-null mouse brain. Following initial hybridization, the blots were
stripped and re-probed with an antibody against MBD2 to serve as a loading control. The
histogram shows the densitometric data (mean and SEM) from 6 independent experiments,
each performed in duplicate, normalized to MBD2. * denotes statistical significance
compared to non-treated cells at p<0.05 following a post-hoc Bonferroni correction for
multiple comparisons.
82
Figure 18
83
3.2.2 Long-term treatment of R255X lymphocyte cells at clinically-relevant
concentrations of aminoglycosides fails to increase the prevalence of full length MeCP2.
The doses of aminoglycosides required to significantly elevate full-length MeCP2
protein in lymphocytes treated for four days exceeded clinically-tolerable levels. This led me
to test whether culturing the lymphocyte cells for twelve days in concentrations of amikacin
or gentamicin that are more appropriate for clinical use would be sufficient to increase full
length MeCP2 levels. The maximal clinical accepted dose for amikacin is approximately 100
ug/mL and for gentamicin is approximately 30 ug/mL (Du et al., 2006). Western blot
analysis shows that at these concentrations aminoglycosides did not significantly induce full
length MeCP2 protein (Figure 19).
84
Figure 19. Long-term culture of R255X lymphocytes at clinically-relevant
concentrations of aminoglycosides does not induce a significant increase in full-length
MeCP2 protein.
Western Blot analysis of nuclear proteins extracted from lymphocyte cell line having R255X
mutation treated with aminoglycosides for 12 days using the same anti-human C-terminus
antibody as above. The cells were treated with either gentamicin (0.03 mg/mL), or amikacin
(0.1 mg/mL) throughout the incubation period. The positive control represents nuclear
proteins extracted from MBD2 null mouse brain. Following initial hybridization, the blots
were stripped and re-probed with an antibody against MBD2 to serve as a loading control.
The histogram represents the cumulative data normalized to MBD2 (mean and SEM) from 3
independent experiments, each performed in duplicate. No significant increases in MeCP2
protein were detected under these conditions.
85
Figure 19
86
3.3 Summary of results
Table 3: Effect of 48 hours treatment of aminoglycosides on HEK-293 cells transfected
with the mutant forms of MeCP2
Mutation Stop codon Aminoglycoside Concentration Readthrough SEM
R294X TGA T Gentamicin 2 mg/mL 22% * +/- 1.8%
R294X TGA T Geneticin 2 mg/mL 30% * +/- 1.7%
R294X TGA T Amikacin 5 mg/mL 6% +/- 2.3%
R294X TGA T Paromomycin 4 mg/mL 0
Q170X TAG A Gentamicin 2 mg/mL 9% * +/- 2.4%
Q170X TAG A Geneticin 2 mg/mL 11% * +/- 1.7%
Y141X TAG T Gentamicin 2 mg/mL 1% +/- 1%
Y141X TAG T Geneticin 2 mg/mL 10% * +/- 0.7%
E205X TAA G Gentamicin 2 mg/mL 0
E205X TAA G Geneticin 2 mg/mL 1% +/- 0.9%
*denotes statistical significance compared to non-treated cells at p<0.05 following a post-hoc
Bonferroni correction for multiple comparisons.
87
Table 4: Effect of 4 days aminoglycoside treatment on a lymphocyte cell line
Mutation Stop codon Aminoglycoside Concentration Readthrough SEM
R255X TGA A Geneticin 0.1 mg/mL 35% * +/-8%
R255X TGA A Gentamicin 0.3 mg/mL 30% * +/-2.6%
R255X TGA A Amikacin 0.3 mg/mL 32% * +/-2.6%
Table 5: Effect of 12 days aminoglycoside treatment on a lymphocyte cell line
Mutation Stop codon Aminoglycoside Concentration Readthrough SEM
R255X TGA A Gentamicin 0.03 mg/mL 3% +/-3.2%
R255X TGA A Amikacin 0.1 mg/mL 8% +/-6.2%
*denotes statistical significance compared to non-treated cells at p<0.05 following a post-hoc
Bonferroni correction for multiple comparisons.
88
4 Discussion
4.1 Principal findings of my study
In this study, I tested the hypothesis that the premature terminating mutations of
MECP2 that cause Rett syndrome can be partially suppressed by aminoglycoside
administration, allowing a full length MeCP2 protein to be generated. My results partially
support this hypothesis, as aminoglycoside treatment facilitated full length MeCP2 protein in
both HEK-293 cells transiently expressing the R294X mutation, and in a lymphocyte cell
line expressing the R255X nonsense mutation of MECP2. Thus, the results of my study
show that nonsense mutations that generate a TGA premature stop codon are responsive to
this treatment. However, other nonsense mutations of MECP2 seen clinically in Rett girls
that have different premature stop codon sequences responded to aminoglycoside treatment
less efficiently. No full length MeCP2 protein was detected in transient transfection assays
with the induced TAA stop sequence, and only marginal increases were observed in assays
testing the induced TAG stop sequence. Furthermore, the ability of the aminoglycosides to
suppress premature stop mutations also depended on the sequence context surrounding the
stop codon and on the aminoglycoside tested.
89
4.2 Wild type and mutant forms of MeCP2 migrate at higher sizes than expected in
SDS-PAGE.
Wild type MeCP2 protein is 52 kDa, however it migrates at about 72 kDa in SDS-
PAGE. Furthermore, the truncated mutant forms of MeCP2 also migrate higher than
expected (compare Figure 8 for expected sizes with Figure 9 for actual sizes). Since MeCP2
is a highly basic protein (approximately one-fifth of all residues in MeCP2 are basic) (Kumar
et al., 2008) it does not bind SDS in a uniform manner. Thus, MeCP2 does not follow the
expected charge-to-mass ratio and migrates slower than expected.
4.3 Different Rett syndrome causing mutations responded differently to aminoglycoside
treatment.
I have transiently transfected HEK-293 cells with some mutant forms of MECP2 in
the presence and absence of different concentrations of aminoglycosides. I tested four
different types of nonsense mutations: arginine which produces TGA T premature stop
codon; glutamine which produces TAG A stop codon; tyrosine which produces TAG T stop
codon; and glutamate which produces TAA G premature stop codon. The mutations I chose
generate all three premature stop codons (TGA, TAG, and TAA) in different surrounding
contexts, thus, I was able to determine how aminoglycosides differ in their ability to induce
read-through based on the sequence of the stop codon and surrounding context. These
nonsense mutations are seen clinically in Rett girls. I chose to treat these cells for 48 hours
with aminoglycosides since several studies have shown that treatment with aminoglycosides
90
for 48 hours leads to higher levels of full length protein than treatment for a lower period of
time in transiently transfected cells (Azimov et al., 2008; Sangkuhl et al., 2004).
My results suggest that the aminoglycoside mediated read-through was highly
dependent on the sequence context of the stop codon. The pattern of suppression observed as
a function of stop codon was TGA > TAG> TAA with gentamicin and geneticin. These data
are consistent with other studies that have demonstrated that the sequence of the stop codon
plays an important role in determining the efficiency of aminoglycoside mediated read-
through (Howard et al., 2000; Bedwell and Keeling, 2002; Manuvakhova et al., 2000; Bidou
et al., 2004).
I have also shown that the context surrounding a stop codon can have a strong
influence on the aminoglycoside mediated read-through. My results show that gentamicin
induced full length MeCP2 protein from Q170X mutation (TAG A premature stop codon) by
9%; however, gentamicin had no effect on Y141X mutation (TAG T premature stop codon).
Thus, the order of read-through as a function of 3` nucleotide that I observed was TAG A >
TAG T with gentamicin. This pattern of suppression differs from a study by Keeling and
Bedwell (2002) who have shown that the order of susceptibility of gentamicin as a function
of 3` nucleotide after stop codon is TAG T > TAG G > TAG C> TAG A. Thus, in MECP2
the TAG A is more responsive to gentamicin treatment, distinguishing it from the series of
read-through reporter constructs that Keeling and Bedwell have used. It is likely that the
sequence context around the tetranucleotide termination signal accounts for these
differences. In agreement with this, Manuvakhova et al., (2000) have shown that the
sequence context beyond the tetranucleotide termination signal influences the level of read-
91
through induced by aminoglycosides. This study used an in vitro translation system to test
the ability of aminoglycosides to suppress termination in the presence of different contexts of
the tetranucleotide termination signal (Manuvakhova et al., 2000). Also, a study by Bidou et
al., (2004) using an in vitro translation system has demonstrated that the impact of the
nucleotide downstream of the stop codon on gentamicin mediated read-through is largely
dependent on the surrounding context. My study also showed that geneticin suppressed these
mutations with the same efficiency. Taken together, these findings suggest that each of these
aminoglycosides can suppress premature stop codons in a context-dependent manner in
MECP2.
4.4 Different aminoglycosides suppress nonsense mutations with different efficiencies in
transfected HEK-293 cells.
Different read-through efficiencies were obtained depending on the aminoglycoside
tested. Efficiency is determined as the amount of full length MeCP2 protein produced at
concentrations of aminoglycosides that will not kill the cells. At a concentration of 2 mg/mL
gentamicin and geneticin induced full length MeCP2 protein in HEK-293 cells transfected
with R294X mutation by 22% and 30%, respectively. Higher doses than 2 mg/mL geneticin
and 3 mg/mL gentamicin were associated with poor cell growth and toxicity in these cells.
Furthermore, amikacin at a concentration of 5 mg/mL induced very little read-through, and
paromomycin at 4 mg/mL had no effect on R294X mutation under these acute conditions (48
hours treatment) (Figure 12). First, I started treating HEK-293 cells transfected with R294X
mutation with lower concentrations of amikacin and paromomycin (up to 2 mg/mL);
92
however, since I saw no full length MeCP2 protein, I increased the concentrations. Higher
concentrations than 4 mg/mL paromomycin and 5 mg/mL amikacin were associated with
poor cell growth and signs of toxicity in HEK-293 cells. Since amikacin and paromomycin
were not effective in inducing read-through on the nonsense codon TGA, which is the most
susceptible mutation to read-through, I did not test the effect of these aminoglycosides on
HEK-293 cells transfected with the mutations that cause TAG and TAA premature stop
codons. Collectively, these results suggest that in these transfection assays, gentamicin and
geneticin suppress nonsense mutations of MECP2 with a higher efficiency than amikacin or
paromomycin.
My results in the transfection assays are consistent with other studies, which have
also demonstrated that another factor that can affect the response to read-through is the
chemical composition of aminoglycosides. A study by Manuvakhova et al., (2000) has
demonstrated that amikacin was not able to induce a significant level of read-through in a
reporter system using all three stop codons surrounded by different sequences using a rabbit
reticulocyte translation system. They also showed that paromomycin induced read-through
less efficiently than gentamicin, and geneticin showed the highest effect of read-through in
all the constructs tested (Manuvakhova et al., 2000). Also, a study by Sangkuhl et al., (2004)
has shown that geneticin was approximately 2-fold more efficient than paromomycin in
restoring the full length and function of AVPR2 protein containing TAG C stop codon in
transfected COS-7 cells. However, amikacin had no effect on this type of mutation
(Sangkuhl et al., 2004). Taken together, these results may suggest that in contrast to
gentamicin and geneticin, amikacin or paromomycin are not able to induce efficient
conformational changes on these type of mutations that would allow the premature stop
93
codon on mRNA to interact with a near cognate tRNA molecule. Thus, the ability of
aminoglycosides to suppress termination at premature stop codons is also largely affected by
the structure of aminoglycosides.
4.5 Possible reasons of the context dependence effects of aminoglycosides.
It is not yet clear how the composition of the nonsense mutation and its surrounding
sequence influence the efficiency of an aminoglycoside to suppress a premature stop codon.
A proposed mechanism of how aminoglycosides may induce read-through is through their
ability to bind to the decoding site of rRNA (A site) inducing conformational changes that
allow the near-cognate tRNA-mRNA complexes to occur (Figure 5 C) (Recht et al., 1996).
Although not completely understood, it was suggested that the mRNA context surrounding
the stop codon may affect the ability of aminoglycosides to bind to the A site directly, or it is
possible that mRNA context may limit the conformational change induced in the decoding
site by aminoglycosides (VanLoock et al., 1999). Furthermore, it was proposed that
aminoglycosides form hydrogen bonds with the mRNA molecule directly in the decoding
site (VanLoock et al., 1999). Thus, it is possible that the complexity of the context-
dependence observed in aminoglycoside mediated read-through may be due to the formation
of different hydrogen bonding between the different aminoglycosides, the mRNA and the
decoding site of rRNA, thus influencing conformational changes within the decoding site of
rRNA (VanLoock et al., 1999; Keeling and Bedwell, 2002).
When a termination codon enters the decoding site of rRNA, it is recognized by
release factors which cause the release of the polypeptide chain (Zhouravleva et al., 1995).
94
Interestingly, several studies have shown that the identity of the stop codon and the sequence
context around it influence termination efficiency. Termination is most efficient at TAA stop
codons, followed by the TAG, and TGA is the least efficient (McCaughan et al., 1995; Poole
et al, 1998). The release factor eRF1 and near-cognate aminoacyl-tRNAs normally compete
for A site binding when a termination stop codon within the mRNA reaches this site
(Zhouravleva et al., 1995). It was proposed that the aminoglycosides bound to the decoding
site of rRNA may reduce the efficiency of release factor recognition of the stop codon
(Keeling and Bedwell, 2005). Thus, the complexity of the context dependence seen in
aminoglycoside mediated read-through may also be due to differences in the ability of stop
codon to recognize the release factors.
4.6 NMD pathway and aminoglycoside mediated read-through.
In addition, it is possible that aminoglycosides induce full length MeCP2 protein by
suppressing the NMD pathway. Approaches that suppress NMD pathway increase amount of
mutated mRNA available for translation. This, in turn, may greatly enhance the levels of
protein produced by suppression therapy. A study by Bedwell et al., (1997) has
demonstrated that in a human bronchial respiratory epithelial cell line from a Cystic Fibrosis
patient having TGA A premature stop codon, the mutated mRNA levels were increased after
incubation with geneticin for 24 hours. Also, a 2 fold increase was observed in mRNA levels
derived from fibroblasts from a patient with Smith-Lemli-Opitz syndrome having a
premature termination codon in DHCR7 gene after treatment with geneticin for 48 hours
(Correa-Cerro et al., 2005). These results suggest that aminoglycosides might be able to
95
inhibit the NMD pathway. However, the mechanism(s) by which aminoglycosides may
suppress the NMD pathway is currently unknown.
In order to determine whether NMD is inhibited by aminoglycosides in my study,
mRNA levels could be assessed before and after treatment by quantitative RT-PCR. If
mRNA levels were increased after treatment with aminoglycosides, this would suggest that
aminoglycosides may be able to suppress the NMD pathway.
Furthermore, it was proposed that not all transcripts containing premature termination
codons (PTCs) are targeted by NMD (Holbrook et al., 2004), and this has been shown to
have a benefit in the response of aminoglycosides to read-through (Linde et al., 2007). Some
transcripts containing PTCs are markedly reduced by NMD, while others are not affected as
much (Linde et al., 2007; Kerr et al., 2001; Azimov et al., 2008). This pathway may vary
depending where on the gene the mutation is found. It has been proposed that the more
upstream a nonsense mutation is found in mRNA, the more likely it is to be degraded by
NMD pathway (Holbrook et al., 2004). Consistent with this idea, it has been shown that
mutations near the 3`end of the open reading frame usually escape nonsense-mediated
mRNA decay (Kerr et al., 2001). Another explanation why in my study the R294X mutation
is more susceptible to suppression by aminoglycosides might be because it is located further
downstream in the gene and it is not degraded by NMD as much as the other mutations. If
this is the case, then the level of R294X nonsense transcripts available for read-through
would be higher and read-through would be more effective. In order to determine whether
NMD acts differently on the different nonsense mutations of MECP2 used in my study,
96
mRNA levels of each mutant in transfection assays could be compared by quantitative RT-
PCR.
A possible role for NMD in regulating the response to aminoglycoside mediated read-
through came from a study by Linde et al., (2007) who has shown that there is no increase in
full length CFTR protein and no correction of the CFTR function with gentamicin in patients
with low levels of nonsense transcripts. However, full length CFTR protein and a significant
improvement in CFTR function with gentamicin treatment was achieved by increasing the
level of CFTR nonsense transcripts. In this study, Linde et al., (2007) have shown that CFTR
mRNA nonsense transcript levels with the same mutation (W1282X generating TGA A
premature stop codon) vary between patients. Following treatment of epithelial cell lines
from these patients with 50-200 ug/mL gentamicin for 18-24 hours, a dose-dependent
function of CFTR was detected in cells with higher levels of transcripts compared to lower
levels. Also, this study showed that inhibition of NMD pathway using the cycloheximide
(CHX) inhibitor, and downregulation of UPF proteins (proteins involved in regulating NMD
pathway) using siRNA oligonucleotides, in cells carrying low levels of CFTR transcripts led
to an increase in CFTR nonsense transcripts and enhanced CFTR function in response to
gentamicin treatment. Taken together, these results suggest that aminoglycosides may be
more effective on nonsense mutations that escape or are not degraded as much by NMD
pathway.
97
4.7 Aminoglycoside treatment in a lymphocyte cell line with R255X mutation (CGA
A>TGA A).
To test whether the suppression of premature stop mutations in Rett syndrome can be
extended to a more physiological, clinical setting, we turned to a lymphocyte cell line
derived from a Rett syndrome girl with R255X mutation. The mutation R255X (resulting in
TGA A premature stop codon) is one of the most common nonsense mutations seen in Rett
syndrome girls (Figure 3) and has the premature stop codon most susceptible to suppression.
These cells are heterozygous: it is expected that half of the cells express full length and
functional copy of MeCP2 and half of the cells express the truncated, non-functional form of
MeCP2. First, I have treated these cells for four days with aminoglycosides in different
concentrations, since a study by Lai et al., (2004) has shown that treatment for four days with
aminoglycosides induced the most read-through in lymphocytes from Ataxia Telangiectasia
(AT) patients at a concentration of 125 ug/mL. At the fifth day, nuclear extractions were
done to determine whether the prevalence of full length MeCP2 protein was elevated with
increasing concentrations of aminoglycosides. Since MeCP2 is a nuclear protein, nuclear
extractions were done to minimize the unspecific binding of the antibody to the proteins from
the cytoplasm.
The aminoglycosides (gentamicin, geneticin and amikacin) each elevated the relative
prevalence of full length MeCP2 protein in the lymphocyte cell line with the same efficiency.
However, they differed in the doses where they induced the most read through. For example,
geneticin induced the highest amount of full length MeCP2 protein at a concentration of 100
ug/mL, while gentamicin and amikacin induced approximately the same amount of full
98
length MeCP2 protein at a concentration of 300 ug/mL. These data are consistent with
previous studies that have shown that geneticin induces read-through at lower doses than
gentamicin (Yang et al., 2007) and amikacin (Heier and DiDonato, 2009). In lymphocytes
treated with geneticin for 4 days, I started noticing poor cell growth and obvious cell death
starting at a concentration of 200 ug/mL; illustrating the toxicity of this drug in more long-
term cultures. Consistent with my results, a study by Lai et al., (2004) has shown that
geneticin increased the full length ATM protein having a premature stop codon in
lymphocytes from Ataxia Telangiectasia (AT) patients treated for four days in a dose
response manner. This study demonstrated that the highest read through occurred at 125
ug/mL geneticin; higher concentrations were associated with poor cell growth and toxicity
(Lai et al., 2004). Consistent with my transfection assays and my in vivo results, it has been
shown that geneticin starts to be toxic at concentrations that are lower than gentamicin and
amikacin (Chernikov et al., 2003). Thus it is possible that it needs lower doses of geneticin to
bind effectively to the decoding site of rRNA and change its conformation in order to allow
read-through to occur. This may explain why geneticin induces read-through levels at lower
doses than gentamicin and amikacin.
The concentration of aminoglycosides required to significantly elevate full-length
MeCP2 protein in lymphocytes treated for four days exceeded clinically-tolerable levels.
This led me to test whether culturing the lymphocyte cells for twelve days in concentrations
of amikacin or gentamicin that are more appropriate for clinical use would be sufficient to
increase full length MeCP2 levels. The maximal clinical accepted dose for gentamicin is
approximately 30 ug/mL and for amikacin is approximately 100 ug/mL (Du et al., 2006).
However, the results of these long-term culture experiments did not reveal any significant
99
increase in full length MeCP2 protein. It is possible that these low doses of aminoglycosides
are not enough to bind effectively to the decoding site of rRNA and change its conformation
in order to allow the suppression of premature stop codon to occur. These results are
consistent with the transient assays where I have shown that treatment with gentamicin for 48
hours did not induce read through of R294X mutation (TGA T) or Q170X (TAG A) at low
concentrations. Furthermore, treatment of lymphocytes for 4 days with 100 ug/mL amikacin
did not induce a significant amount of full length MeCP2 protein; by treating these cells for 4
days with 50 ug/mL gentamicin, a 14% increase in the prevalence of full length MeCP2
protein was detected. Since I saw only a 14% increase in full length MeCP2 protein at a
concentration of 50 ug/mL gentamicin, I have not tested lower concentrations of this drug.
Thus, it can be concluded that while nonsense mutation read-through of the R255X MECP2
mutation is feasible, the concentration of aminoglycoside required to elicit an effect exceeds
what could be tolerated clinically for prolonged use.
4.8 Possible reasons for the difference in aminoglycoside mediated read-through in
lymphocytes vs. transfected HEK-293 cells.
Amikacin did not significantly induce full length MeCP2 protein in the transfected
HEK-293 cells with MECP2-R294X mutation; however in Rett lymphocyte cell line carrying
MECP2-R255X mutation at a concentration of 300 ug/mL, amikacin induced full length
MeCP2 protein by approximately 32 +/- 2.6%. A possible reason for this difference might be
because the sequence context around the stop codon is different. The mutation R294X has
ATC TGA TCT sequence while R255X mutation has GGC TGA AAG sequence. Consistent
100
with this idea, a study by Keeling and Bedwell (2002) has shown that amikacin produced
higher levels of read-through than gentamicin at certain contexts, demonstrating a unique
pattern of context dependence. Furthermore, it is possible that lymphocytes are more
sensitive to aminoglycoside treatment than HEK-293 cells. Consistent with my results, a
study by Heier and DiDonato, (2009) has shown that amikacin was only capable of inducing
read-through of the SMN premature stop codon (TAG A) in primary fibroblasts; not in
transfected HEK-293 cells. This suggests that there might be differences in translational
machinery between different types of cells. Another possible explanation is that the
transfected HEK-293 cells were treated with amikacin only for 48 hours; however, the
lymphocytes were treated for 4 days. Thus, duration might be an important factor
determining how amikacin influences the read-through of these mutations. It is possible that
longer than 48 hours treatment may be needed to be able to see a significant read-through
effect in R294X mutation treated with amikacin. However, it was not possible to treat the
cells for a longer period of time since the plasmid in transiently transfected HEK-293 cells
after 48 hours might lose its expression. For this, we would need stable cell lines where the
plasmid is incorporated in the cell’s genome. These are all possibilities that may explain why
amikacin was able to induce read through in lymphocytes, but not in transfected HEK-293
cells.
Furthermore, both gentamicin and geneticin induced higher levels of read through at
lower concentrations in lymphocytes carrying R255X mutation than in HEK-293 cells
transfected with R294X, even though they produce the same premature stop codon: TGA. A
possible reason for this is that the context sequence of the gene surrounding the stop codon is
different. Consistent with this, the study by Keeling and Bedwell (2002) has demonstrated
101
that the absolute levels of aminoglycoside-induced suppression at the same tetranucleotide
termination signals can differ among different contexts. Also, the duration of treatment (4
days in lymphocytes and 48 hours in transfected HEK-293 cells), and different cell types
might account for these differences. Geneticin started to be toxic as seen by the poor cell
growth and death in lymphocytes, at a concentration of 200 ug/mL; however, in transfected
HEK-293 cells, geneticin started to be toxic at concentrations higher than 2 mg/mL at 48
hours. This suggests that lymphocytes might be more sensitive than HEK cells to
aminoglycoside treatment, or it is possible that treatment for longer time at a lower dose
causes toxicity. Collectively, these are possible explanations which may account for the
difference in the doses where gentamicin and geneticin had the highest read-through effect in
lymphocytes vs. transfected HEK-293 cells.
4.9 Related study
While my study was in progress, Brendel et al., (2009) reported that gentamicin
effectively induced read-through of different TGA mutations associated with the most
common R-X nonsense mutations seen clinically in Rett girls. The efficiencies in their
report ranged between 10% and 22%, with the highest effect being observed for the R294X
mutation. My results are consistent with this study, as I also showed a read-through
efficiency of 22% for gentamicin in transfected HEK-293 cells employing this same R294X
mutation. However, the study by Brendel et al., (2009) tested only one type of mutation -
arginine which produces TGA stop codon. Furthermore, in their study Brendel et al., only
discussed one aminoglycoside - gentamicin. My study is different because in addition to
102
gentamicin I tested three other aminoglycosides: geneticin, amikacin and paromomycin.
Furthermore, I have tested more mutations that are known to cause Rett syndrome: tyrosine,
glutamine, glutamic acid and arginine. In addition, my study extends from the study of
Brendel et al., (2009) by testing whether acute and chronic aminoglycoside treatment affects
full-length MeCP2 levels in a lymphocyte cell line derived from a girl with Rett syndrome
who has an R255X nonsense mutation.
4.10 Aminoglycosides may be able to facilitate read-through at premature stop codons
and not at normal stop codons.
Although not completely known, it is believed that aminoglycosides can only
facilitate read-through at premature stop codons, and not at normal stop codons. A few
reasons have been suggested for the apparent lack of read-through at normal stop codons. In
a review article, Kerem (2004) has proposed that naturally occurring stop codons are found
within a context that promotes efficient translation termination compared to premature stop
codons. Consistent with this, a study by McCaughan et al., (1995) has shown that in
mammalian genes certain signals such as UAAG are overrepresented and some are not used
as much (such as UGAC, UGAT). Furthermore, multiple stop codons are frequently found
at the end of an open reading frame. The presence of many stop codons may reduce the
ability of aminoglycosides to induce read-through at normal termination signals (Major et al.,
2002). Furthermore, the termination complex formed at premature stop codons appears to
differ from the complex at normal stop codons (Amrani et al., 2004). This suggests that the
ribosome might terminate translation at the normal stop codon more efficiently than at
103
premature stop codons. Also, it has been shown that when the normal stop codons are located
in proximity to the poly(A) tail, termination is more efficient and this might contribute to
translational termination (Amrani, et al., 2004). All these factors have led to the hypothesis
that aminoglycosides may be able to facilitate read-through only at premature stop codons.
My results also suggest that aminoglycosides only induce read-through at premature
stop mutations in MECP2. There are four in frame normal stop codons in MECP2 sequence:
TGA, TGA, TGA and TAA. The first normal stop codon is followed by 78 bases before the
next one; thus, if aminoglycosides would read-through this normal stop codon, in addition to
MeCP2 which is 72 kDa, an extra product of approximately 75 kDa with aminoglycoside
treatment should be detected in SDS-PAGE. However, only one clear product of
approximately 72 kDa in HEK-293 cells transfected with the mutant forms of MeCP2 in the
presence of aminoglycosides is detected, which is the same size as the wild-type MeCP2.
As a control, I have treated HEK-293 cells transfected with wild type MECP2 cDNA with
aminoglycosides; however, SDS-PAGE showed no difference in migration of protein lysates
from aminoglycoside-treated and non-treated transfected HEK-293 cells (data not shown). If
aminoglycosides would read-through the normal stop codon of MECP2, then we would
expect the protein lysates from aminoglycoside treated transfected cells to have an extra
product with a higher migration size than the protein lysates from non-treated wild-type
transfected cells; however, this was not the case. Consistently, the protein extracts from
aminoglycoside treated lymphocytes were not different than the positive control or non-
treated cells, as they did not show an extra product at a higher mass. Collectively, these
results suggest that aminoglycosides are only able to facilitate read-through at premature stop
codons in MECP2.
104
4.11 Future directions and potential clinical implications
There are currently no effective treatments for Rett syndrome. However, transgenic
studies in mouse models of Rett syndrome have revealed that re-introducing or re-activating
functional MeCP2 into specific regions of the brain in pre-symptomatic mice, or throughout
the brain in mice displaying Rett-like behaviour, improves at least some of their behavioral
deficits (Luikenhuis et al., 2004; Collins et al., 2004; Guy et al., 2007; Jugloff et al., 2008).
The fact that the loss of MeCP2 function during embryonic and prenatal brain development
does not cause an irremediable condition is encouraging for prospective treatments.
Furthermore, the finding that over-expression of MeCP2 is also deleterious (Collins et al.,
2004; Luikenhuis et al., 2004) complicate the treatment of Rett syndrome. Using a therapy
such as gene replacement therapy would not be beneficial since in addition to adding
function to the cells expressing the mutant MECP2 allele, it would also increase the level of
MECP2 in cells expressing the functional MECP2 allele. Thus, this procedure will introduce
more MeCP2 protein than needed. Therefore, a therapeutic option would be to enhance
endogenous MeCP2 levels selectively in cells expressing the mutant allele. The
pharmacological approach is attractive for Rett syndrome since it circumvents these
problems.
Roughly 40% of the mutations that cause Rett syndrome are nonsense mutations
(Percy et al., 2007) and of these the most common involve R-X transformations which
produce TGA premature stop codons (Dragich et al., 2000; IRSF database). As my results
show, aminoglycosides are effective in partially suppressing some of these nonsense
mutations of MECP2.
105
However, aminoglycosides are able to suppress nonsense mutations by inducing the
ribosomes to “read-through” the premature stop codons generating full length proteins by
insertion of an amino acid by the near-cognate tRNA in place of the premature stop codon. It
has been proposed that tryptophan is usually inserted at TGA stop codon and glutamine is
inserted at TAG and TAA premature stop codons (Nilsson and Ryden-Aulin, 2003).
Following this hypothesis, it is possible that the read-through of MECP2 TGA premature
stop codon would lead to the replacement of the normal arginine by a tryptophan. MeCP2 is
a highly disordered protein (Adams et al., 2007) and this amino acid might impair the proper
folding of the MeCP2 protein. It is possible that read-through might also insert other amino
acids to generate a range of missense-mutated proteins. Thus, the random nature of amino
acid incorporation at the premature stop codon leads to production of full length MeCP2
protein that may or may not be functional. However, database analysis shows no arginine
missense mutations involving the key R sites associated with nonsense mutations (IRSF
database). While not conclusive, the lack of any Rett girls with R-missense mutations
suggests that some tolerance may exist for these R sites. First, it is important to determine
the exact amino acid which is inserted in the full length MeCP2 protein by mass
spectrometry.
If the amino acid that is introduced is not the wild-type, then functional studies in
cells would be required to determine whether the functional capacity of MeCP2 is restored.
Most nonsense mutations are located in transcriptional repressor domain (TRD) and
interdomain (Figure 3), so the TRD and the Carboxy-terminus in these mutants are disrupted.
Since the TRD domain of MeCP2 recruits Sin3A and histone deacetylases to repress
transcription (Nan et al., 1998; Jones et al., 1998), it is important to determine whether these
106
mutant forms of MeCP2 in the presence of aminoglycosides can bind Sin3A and histone
deacetylases in transfected HEK-293 cells (since they do not express endogenous MeCP2)
using western blot analysis and immunoprecipitation. If successful, this would provide proof
that aminoglycosides may be able to restore the function of MeCP2 protein.
If the above functional studies show an improvement in MeCP2 function with
aminoglycoside treatment, the next step would be to determine whether the
aminoglyocosides ameliorate the symptoms of Rett syndrome in transgenic mice containing
nonsense mutations. If successful, this would provide more evidence that aminoglycosides
restore MeCP2 function and thus this would suggest that pharmacological treatment might be
a therapeutic approach for a subset of Rett syndrome patients with nonsense mutations. A
mouse model is useful to test the efficiency of this pharmacological approach before more
expensive clinical trials are undertaken. A mouse model containing R168X nonsense
mutation exists (Lawson-Yuen et al., 2007). This mutation introduces TGA premature stop
codon, which is the most susceptible to suppression. Furthermore, this is one of the most
severe (Neul et al., 2008) and common nonsense mutation seen in Rett syndrome girls
(Figure 3). The mice containing this mutation show features similar to Rett syndrome,
including breathing irregularities, hypoactivity, forelimb stereotypies, and social impairment
(Lawson-Yuen et al., 2007). These mice could be treated with aminoglycosides in order to
determine whether these Rett-like features are reduced. However, toxicity remains an issue,
and it is not known whether aminoglycosides can effectively cross the blood brain barrier. If
the aminoglycosides do not get into the brain, then they will not be effective in reducing
some symptoms associated with Rett syndrome with the exception of bone deficits. A mouse
model is useful to test some of these possibilities.
107
It is also possible that the truncated proteins generated by nonsense mutations might
have a dominant negative effect and compete for the binding with the wild-type or the full
length MeCP2 protein generated by aminoglycoside mediated read-through. If
aminoglycosides suppress the NMD pathway and if there is a dominant negative effect of the
truncated proteins, then this may suggest that aminoglycosides would not be beneficial to
Rett syndrome. Furthermore, it may also be possible that the full length proteins generated by
aminoglycoside mediated read-through may (if the amino acid introduced is not the wild
type) have a dominant negative effect. These are possibilities that we do not yet know.
Shahbazian et al., (2002) have developed a mouse model where they replaced the wild-type
Mecp2 allele with one encoding a truncated protein after amino acid 308 (MeCP2 308/y
).
These mice appeared normal for first 6 weeks, but then developed a neurological disease that
includes many features of Rett syndrome: abnormal motor function, abnormal social
interaction, seizures, tremors and stereotypic forelimb motions (Shahbazian et al., 2002).
Alvarez-Saavedra et al., (2007) have expressed a transgene of functional Mecp2 in mice with
a background of the endogenous truncated MeCP2 and have shown that the expression of
transgenic Mecp2 did not result in the prevention of the development of some symptoms
associated with Rett syndrome. This could be due to a dominant negative effect of Mecp2 308
allele which competes with the functional Mecp2 transgene for DNA binding, since Mecp2
308/y mice make a truncated protein that also binds DNA (Shahbazian et al., 2002). However,
in order to test this possibility, Alvarez-Saavedra and his group, (2008) also introduced the
functional Mecp2 transgene in Mecp2-null mice background, in which no MeCP2 mRNA or
protein was observed (Guy et al., 2001). They again have shown that with the exception of
locomotion, the Rett-like behaviour was not improved and there was no increase in lifespan.
108
These results contrast with other studies that have shown an increase in lifespan upon re-
activation or re-introduction of functional MeCP2 in Mecp2-null mice (Giacometti et al.,
2007; Luikenhuis et al., 2004). Although not completely clear, these results do not support
the possibility of a dominant negative effect of truncated MeCP2 proteins.
However, it is also possible that truncated proteins might have residual function, and
if aminoglycosides suppress the NMD pathway, they may partially restore the function of
MeCP2 by just stabilizing the truncated form. The fact that individuals with R294X
mutations and late C-terminal truncating mutations are less severely affected suggests that
these mutants may still have some partial function of MeCP2. Most nonsense mutations
occur on TRD and interdomain of MeCP2, thus they still have the MBD intact. Thus, it is
possible that aminoglycosides by stabilizing truncated proteins might have a benefit since
most of these proteins have the MBD intact and are able to bind methylated DNA.
It is not exactly known how much functional MeCP2 protein is required to confer a
therapeutic improvement in Rett syndrome patients. Samaco et al., (2008) generated a mouse
model that contains a conditional hypomorphic allele of Mecp2 which expresses 50% of the
wild-type level of Mecp2 (they called this mouse Mecp2 Flox-y
). In this study, they have
shown that a 50% reduction of MeCP2 levels results in a variety of abnormalities such as
altered social behaviour, learning and motor deficits, movement abnormalities, and breathing
irregularities (Samaco et al., 2008). However, in contrast with Mecp2-null mice that die
between 8 and 12 weeks of life (Chen et al., 2001; Guy et al., 2001), these mice have a
normal lifespan. Furthermore, Mecp2 Flox-y
mice do not show some overt abnormalities
observed in Mecp2-null mice such as body tremor or hindlimb clasping. They also show
109
decreased anxiety (Samaco et al., 2008). These results suggest that a 50% decrease in
MeCP2 levels might still cause a disease, however, it is not as severe as Rett syndrome.
Taken together, these data suggest that it is possible that restoring low levels of MeCP2 may
ameliorate some symptoms associated with Rett syndrome.
Although some nonsense mutations that cause Rett syndrome can be suppressed by
aminoglycoside administration allowing a full length MeCP2 protein to be produced, the
dose of aminoglycosides required to see a significant effect exceed the clinical accepted
range. Thus, my data suggests that aminoglycosides may not be effective for treating Rett
syndrome patients. However, this study is important because it establishes the “proof of
principle” that a subset of nonsense mutations that cause Rett syndrome can be suppressed by
drug treatment. My results suggest that if aminoglycosides also restore the function of
MeCP2 protein (as determined by functional studies and transgenic mice containing
nonsense mutations), then screening for other drugs with improved termination suppression
activity and lower toxicity may have a great potential for reducing the symptoms in a subset
of Rett syndrome patients with TGA mutations.
Drugs such as PTC124 and NB54 have been recently indentified (Figure 20). NB54
is a newly-derived aminoglycoside specifically tailored for nonsense mutation suppression
which exhibits several fold greater suppression activity than gentamicin. The superior read-
through efficiency compared to gentamicin was demonstrated in vitro in PCDH15, CFTR,
Dystrophin, and IDUA genes carrying nonsense mutations and representing the genetic
causes for Usher Syndrome (USH1), Cystic Fibrosis (CF), Duchenne Muscular Dystrophy
(DMD) and Hurler Syndrome (HS), respectively and in transfected COS-7 culture cell line.
110
Importantly, NB54 also displays far less toxicity than either gentamicin or amikacin
(Nudelman et al., 2009), increasing its potential for chronic therapeutic use. Furthermore,
like aminoglycosides, the read-through of this compound is highly dependent on the context
of the gene and the composition of nonsense mutation, with TGA having higher read-through
than TAG and TAA (Nudelman et al., 2009). PTC124 is a new orally, bio-available drug,
developed from screening as one potential lead to treat genetic diseases with nonsense
mutations. It has read-through ability without the side effects associated with
aminoglycosides. This compound has no structural similarities with aminoglycosides (Figure
20). Furthermore, it displays significantly higher read-through ability at TGA nonsense
codons than aminoglycosides, and is effective at concentrations that are clinically tolerated
(Welch et al., 2007). Encouraging results have been obtained in a clinical trial in which
PTC124 was administered to Cystic Fibrosis patients (Kerem et al., 2008), but to date its
effects on central nervous system disorders have not been investigated and we do not know if
it crosses the blood brain barrier. It will clearly be of interest to determine whether either of
these new drugs will facilitate effective read-through of nonsense mutations of MECP2.
111
Figure 20. The chemical structures of PTC124 and NB54
NB54: structure modified from the research article by Nudelman et al., 2009.
PTC124: structure copied from:
http://upload.wikimedia.org/wikipedia/commons/thumb/5/5b/PTC124.svg/732px-PTC124.svg.png
The structure of PTC124 can also be found in the research article by Auld et al., 2009.
112
Figure 20
NB54
PTC124
113
5 Summary
To summarize, my project focused on investigating whether the nonsense mutations
of MECP2 that cause Rett syndrome can be suppressed by aminoglycosides. With the help of
my lab members, I have generated four mutant forms of MeCP2 seen clinically in Rett
patients and using these constructs, I first tested the efficiency of read-through in transfection
assays. I have shown that aminoglycoside treatment facilitated full length MeCP2 protein in
a dose response manner from the premature stop codon TGA. However, other mutations that
cause the TAG termination codon were less efficiently suppressed, and no full length MeCP2
protein was detected when the premature stop codon was TAA. Furthermore, the ability of
aminoglycosides to suppress nonsense mutations also depended on the sequence context
surrounding the stop codon and the aminoglycoside tested (Figure 21). Since full length
MeCP2 protein was detected in transiently transfected cells, my final aim was to test whether
and with what efficiency the restoration of full length MeCP2 protein can be achieved in a
lymphocyte cell line from a Rett girl having TGA premature stop codon. Exposure of these
lymphocyte cells acutely (4 days) to high concentrations of aminoglycosides increased the
overall prevalence of full-length MeCP2 protein, indicating that the read-through effects
observed in the transfection assays are recapitulated in cells with stable genomic nonsense
mutations. Taken together, my results help to establish the “proof of principle” that a subset
of nonsense mutations that cause Rett syndrome can be suppressed by drug treatment.
114
Figure 21. Model of aminoglycoside mediated read-through.
A) My data suggest that the R294X Rett syndrome mutation is the most amenable to read-
through. Gentamicin and geneticin are the most effective of the drugs tested. These
aminoglycosides bind to the decoding site of rRNA through hydrogen (H) bonds and
electrostatic interaction (red dashes). This stabilizes the interaction of the third base of stop
codon (Adenine or A) to pair with the cytosine (C) of a tryptophan (W) t-RNA anticodon.
My results indicate that this context allows approximately 30% of the total MeCP2 protein
generated in cells to be full length rather than truncated.
B) In contrast, my data show that amikacin and paromomycin are not as effective in inducing
read-through at this same premature termination codon. This could be due to weaker binding
of these specific aminoglycosides to ribosomal decoding site (red dashes), thereby not
allowing the codon-anticodon stabilization to occur as efficiently as with geneticin and
gentamicin.
C and D) In the TAG or TAA context, gentamicin and geneticin still facilitate some read-
through, but with lower efficiencies. This may relate to the first base of the codon-anticodon
pairing being mis-matched with TAG and TAA stop codons compared to the third base being
mis-matched with TGA.
115
Figure 21
A B
C D
116
References
Adams HV, McBryant SJ, Wade AP, Woodcock CL and Hansen CJ (2007) Intrinsic disorder
and autonomous domain function in the multifunctional nuclear protein, MeCP2. J Biol
Chem., 282: 15057-15064.
Alvarez-Saavedra M, Sáez MA, Kang D, Zoghbi HY and Young JI (2007) Cell-specific
expression of wild-type MeCP2 in mouse models of Rett syndrome yields insight about
pathogenesis. Hum Mol Genet., 16: 2315-2325.
Amir RE, Van den Veyver IB, Wan M, Tran CQ, Francke U and Zoghbi HY (1999) Rett
Syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding
protein 2. Nature, 23: 185-188.
Amir RE, Van den Veyver IB, Schultz R, Malicki DM, Tran CQ, Dahle EJ, Philippi A,
Timar L, Percy AK, Motil KJ, Lichtarge O, Smith EO, Glaze DG and Zoghbi HY (2000)
Influence of mutation type and X chromosome inactivation on Rett syndrome phenotypes.
Ann Neurol., 47: 670-679.
Amrani N, Ganesan R, Kervestin S, Mangus DA, Ghosh S and Jacobson A (2004) A faux 3`-
UTR promotes aberrant termination and triggers nonsense-mediated mRNA decay. Nature,
432: 112-118.
Amrani N, Sachs MS and Jacobson A (2006) Early nonsense: mRNA decay solves a
translational problem. Nat Rev Mol Cell Biol., 7: 415-425.
Archer H, Evans J, Leonard H, Colvin L, Ravine D, Christodoulou J, Williamson S,
Charman T, Bailey ME, Sampson J, de Klerk N and Clarke A (2007) Correlation between
clinical severity in patients with Rett syndrome with a p.R168X or p.T158M MECP2
mutation, and the direction and degree of skewing of X-chromosome inactivation. J Med
Genet., 44: 148-152.
Ariani F, Hayek G, Rondinella D, Artuso R, Mencarelli MA, Spanhol-Rosseto A, Pollazzon
M, Buoni S, Spiga O, Ricciardi S, Meloni I, Longo I, Mari F, Broccoli V, Zappella M and
Renieri A (2008) FOXG1 is responsible for the congenital variant of Rett syndrome. Am J
Hum Genet., 83: 89-93.
Armstrong DD (2001 a) Rett syndrome neuropathology review 2000. Brain Dev., 23 (Suppl.
1): S72-S76.
Armstrong J, Pineda M, Aibar E, Gean E and Monros E (2001 b) Classic Rett Syndrome in a
boy as a result of somatic mosaicism for a MECP2 mutation. Ann Neurol., 50: 692.
117
Archer H, Evans J, Leonard H, Colvin L, Ravine D, Christodoulou J, Williamson S,
Charman T, Bailey ME, Sampson J, de Klerk N and Clarke A (2007) Correlation between
clinical severity in patients with Rett syndrome with a p.R168X or p.T158M MECP2
mutation, and the direction and degree of skewing of X-chromosome inactivation. J Med
Genet., 44: 148-152.
Asaka Y, Jugloff GM, Zhang L, Eubanks JH and Fitzsimonds MR (2006) Hippocampal
synaptic plasticity is impaired in the MeCP2-null mouse model of Rett Syndrome. Neurobiol
Dis., 21: 217-227.
Auld DS, Thorne N, Maguire FW and Inglese J (2009) Mechanism of PTC124 activity in
cell-based luciferase assays of nonsense codon suppression. PNAS, 106: 3585-3590.
Azimov R, Abuladze N, Sassani P, Newman D, Kao L, Liu W, Orozco N, Ruchala P,
Pushkin A and Kurtz I (2008) G418-mediated ribosomal read-through of a nonsense
mutation causing autosomal recessive proximal renal tubular acidosis. Am J Physiol Renal
Physiol., 295: 633-641.
Barton-Davis ER, Cordier L, Shoturma DI, Leland SE and Sweeney HL (1999)
Aminoglycoside antibiotics restore dystrophin function to skeletal muscles of mdx mice. J
Clin Invest., 104: 375-381.
Bebbington A, Anderson A, Ravine D, Fyfe S, Pineda M, de Klerk N, Ben-Zeev B, Yatawara
N, Percy A, Kaufmann WE and Leonard H (2008) Investigating genotype-phenotype
relationships in Rett syndrome using an international data set. Neurology, 70: 868-875.
Bedwell DM, Kaenjak A, Benos DJ, Bebok Z, Bubien JK, Hong J, Tousson A, Clancy JP
and Sorscher EJ (1997) Suppression of a CFTR premature stop mutation in a bronchial
epithelial cell line. Nature, 3: 1280-1284.
Belgrader P, Cheng J and Maquat LE (1993) Evidence to iplicate translation by ribosomes in
the mechanism byh which nonsense codons reduce the nuclear level of human
triosephosphate isomerise mRNA. PNAS, 90: 482-486.
Belichenko PV, Oldfors A, Hagberg B and Dahlström A (1994) Rett syndrome: 3-D
confocal microscopy of cortical pyramidal dendrites and afferents. Neuro Report, 5: 1509-
1513.
Ben-Shachar S, Chahrour M, Thaller C, Shaw CA and Zoghbi HY (2009) Mouse models of
MeCP2 disorders share gene expression changes in cerebellum and hypothalamus. Hum Mol
Genet., 18: 2431-2442.
Bertani I, Rusconi L, Bolognese F, Forlani G, Conca B, De Monte L, Badaracco G,
Landsberger N and Kilstrup-Nielsen C (2006) Functional consequences of mutations in
118
CDKL5, an X-linked gene involved in infantile spasms and mental retardation. J Biol
Chem., 281: 32048-32056.
Bestor TH and Tycko B (1996) Creation of genomic methylation patterns. Nat Genet., 12:
363-367.
Bidou L, Hatin I, Perez N, Allamand V, Panthier JJ and Rousset JP (2004) Premature stop
codons involved in muscular dystrophies show a broad spectrum of readthrouh efficiencies in
response to gentamicin treatment. Gene Ther., 11: 619-627.
Bird AP (1980) DNA methylation and the frequency of CpG in animal DNA. Nucleic Acids
Res., 8: 1499-1504.
Bird A (2002) DNA methylation patterns and epigenetic memory. Genes Dev., 16: 6-21.
Blue ME, Naidu S and Johnston MV (1999 a) Altered development of glutamate and GABA
receptors in the basal ganglia of girls with Rett syndrome. Exp Neurol., 156: 345-352.
Blue ME, Naidu S and Johnston MV (1999 b) Development of amino acid receptors in
frontal cortex from girls with Rett Syndrome. Ann Neurol., 45: 541-545.
Bogdanovic O and Veenstra JC (2009) DNA methylation and methyl-CpG binding proteins:
developmental requirements and function. Chromosoma.
Bonni A, Brunet A, West AE, Datta SR, Takasu MA and Greenberg ME (1999) Cell survival
promoted by the Ras-MAPK signalling pathway by transcription-dependent and independent
mechanisms. Science, 286: 1358-1362.
Botto RE and Coxon B (1983) Nitrogen-15 nuclear magnetic resonance spectroscopy of
neomycin B and related aminoglycosides. J Am Chem Soc., 105: 1021-1028.
Brendel C, Klahold E, Gartner J and Huppke P (2009) Suppression of nonsense mutations in
Rett Syndrome by aminoglycoside antibiotics. Pediatr Res., 65: 520-523.
Buck NE, Wood L, Hu R, Peters HL (2009) Stop codon read-through of a Methylmalonic
aciduria mutation. Mol Genet and Metab., 97: 244-249.
Buckingham RH, Grentzmann G and Kisselev L (1997) Polypeptide chain release factors.
Mol Microbiol., 24: 449-456.
Budden SS, Dorsey HC and Steiner RD (2005) Clinical profile of a male with Rett
syndrome. Brain Dev., 27: (Suppl 1), S69-S71.
119
Burke JF and Mogg AE (1985) Suppression of a nonsense mutation in mammalian cells in
vivo by the aminoglycoside antibiotics G-418 and paromomycin. Nucleic Acids Res., 13:
6265-6272.
Buschdorf JP and Stratling WH (2004) A WW domain binding region in methyl-CpG-
binding protein MeCP2: impact on Rett syndrome. J Mol Med., 82: 135-143.
Buzina A and Shulman MJ (1999) Infrequent translation of a nonsense codon is sufficient to
decrease mRNA level. Mol Biol Cell, 10: 515-524.
Carter AP, Clemons MW, Brodersen DE, Warren RJ, Wimberly BT and Ramakrishnan V
(2000) Functional insights from the structure of the 30S ribosomal subunit and its
interactions with antibiotics. Nature, 407: 340-348.
Chahrour M, Jung SY, Shaw C, Zhou Z, Wong STC, Qin J and Zoghbi HY (2008) MeCP2, a
key contributor to neurological disease, activates and represses transcription. Science, 320:
1224-1229.
Chahrour M and Zoghbi HY (2007) The story of Rett syndrome: from clinic to neurobiology.
Neuron, 56: 422-437.
Chandler SP, Guschin D, Landsberger N and Wolffe AP (1999) The methyl-CpG binding
transcriptional repressor MeCP2 stably associates with nucleosomal DNA. Biochemistry,
38: 7008-7018.
Chang Q, Khare G, Dani V, Nelson S and Jaenisch R (2006) The disease progression of
MeCP2 mutant mice is affected by the level of BDNF expression. Neuron, 49: 341-348.
Cheadle JP, Gill H, Fleming N, Maynard J, Kerr A, Leonard H, Krawczak M, Cooper DN,
Lynch S, Thomas N, Hughes H, Hulten M, Ravine D, Sampson JR and Clarke A (2000)
Long-read sequence analysis of the MECP2 gene in Rett syndrome patients: correlation of
disease severity with mutation type and location. Hum Mol Genet., 9: 1119-1129.
Chen RZ, Akbarian S, Tudor M and Jaenisch R (2001) Deficiency of methyl-CpG binding
protein 2 in CNS neurons results in a Rett-like phenotype in mice. Nature, 27: 327-331.
Chen WG, Chang Q, Lin Y, Meissner A, West AE, Griffith EC, Jaenisch R and Greenberg
ME (2003) Derepression of BDNF transcription involves calcium-dependent
phosphorylation of MeCP2. Science, 302: 885-889.
Chernikov VG, Terekhov SM, Krokhina TB, Shishkin SS, Smirnova TD, Kalashnikova EA,
Adnoral NV, Rebrov LB, Denisov-Nikol'skii YI and Bykov VA (2003) Comparison of
cytotoxicity of aminoglycoside antibiotics using a panel cellular biotest system. Bull Exp
Biol Med., 135: 103-105.
120
Christensen EI, Birn H, Verroust P and Moestrup SK (1998) Membrane receptors for
endocytosis in the renal proximal tubule. Int Rev Cytol., 180: 237-284.
Clayton-Smith J, Watson P, Ramsden S and Black GC (2000) Somatic mutation in MeCP2
as a non-fatal neurodevelopmental disorder in males. Lancet., 356: 830-832.
Collins AL, Levenson JM, Vilaythong AP, Richman R, Armstrong DL, Noebels JL, David
Sweatt J and Zoghbi HY (2004) Mild overexpression of MeCP2 causes a progressive
neurological disorder in mice. Hum Mol Genet., 13: 2679-2689.
Correa-Cerro LS, Wassif CA, Waye JS, Krakowiak PA, Cozma D, Dobson NR, Levin SW,
Anadiotis G, Steiner RD, Krajewska-Walasek M, Nowaczyk MJ and Porter FD (2005)
DHCR7 nonsense mutations and characterisation of mRNA nonsense mediated decay in
Smith-Lemli-Opitz syndrome. J Med Genet., 42: 350-357.
Cross SH and Bird AP (1995) CpG islands and genes. Curr Opin Genet Dev., 5: 309-314.
Dayer AG, Bottani A, Bouchardy I, Fluss J, Antonarakis SE, Haenggeli CA and Morris MA
(2007) MECP2 mutant allele in a boy with Rett syndrome and his unaffected heterozygous
mother. Brain Dev., 29: 47-50.
Dragich J, Houwink-Manville I and Schanen C (2000) Rett Syndrome: A surprising result of
mutation in MECP2. Hum Mol Genet., 9: 2365-2375.
Du M, Keeling KM, Fan L, Liu X, Kovacs T, Sorscher E and Bedwell DM (2006) Clinical
doses of amikacin provide more effective suppression of the human CFTR-G542X stop
mutation than gentamicin in a transgenic mouse model. J Mol Med., 84: 573-582.
Du M, Liu X, Welch EM, Hirawat S, Peltz SW and Bedwell DM (2008) PTC124 is an orally
bioavailable compound that promotes suppression of the human CFTR-G542X nonsense
allele in a CF mouse model. PNAS., 105: 2064-2069.
Dunn HG and MacLeod PM (2001) Rett syndrome: review of biological abnormalities. Can
J Neurol Sci., 28: 16-29.
Fichou Y, Nectoux J, Bahi-Buisson N, Rosas-Vargas H, Girard B, Chelly J and Bienvenu T
(2009) The first missense mutation causing Rett syndrome specifically affecting the
MeCP2_e1 isoform. Neurogenetics, 10: 127-133.
Filion GJ, Zhenilo S, Salozhin S, Yamada D, Prokhortchouk E and Defossez PA (2006) A
family of human zinc finger proteins that bind methylated DNA and repress transcription.
Mol Cell Biol., 26: 169-181.
Forge A and Schacht J (2000) Aminoglycoside antibiotics. Audiol Neurootol., 5: 3-22.
121
François B, Russell RJ, Murray JB, Aboul-ela F, Masquida B, Vicens Q and Westhof E
(2005) Crystal structures of complexes between aminoglycosides and decoding A site
oligonucleotides: role of the number of rings and positive charges in the specific binding
leading to miscoding. Nucleic Acids Res., 33: 5677-5690.
Georgel PT, Horowitz-Scherer RA, Adkins N, Woodcock CL, Wade PA and Hansen JC
(2003) Chromatin compaction by human MeCP2. J Biol Chem., 278: 32181-32188.
Ghosh A, Carnahan J and Greenberg ME (1994) Requirement for BDNF in activity-
dependent survival of cortical neurons. Science, 263: 1618-1623.
Ghosh RP, Horowitz-Scherer AR, Nikitina T, Gierasch LM and Woodcock CL (2008) Rett
Syndrome-causing mutations in human MECP2 result in diverse structural changes that
impact folding and DNA interactions. J Biol Chem., 283: 20523-20534.
Giacometti E, Luikenhuis S, Beard C and Jaenisch R (2007) Partial rescue of MeCP2
deficiency by postnatal activation of MeCP2. PNAS, 104:1931-1936.
Girard M, Couvert P, Carrie A, Tardieu M, Chelly J, Beldjord C and Bienvenu T (2001)
Parental origin of de novo MECP2 mutations in Rett Syndrome. Eur J Hum Genet., 9: 231-
236.
Glaze DG (2005) Neurophysiology of Rett Syndrome. J Child Neurol., 20: 740-746.
Guy J, Gan J, Selfridge J, Cobb S and Bird A (2007) Reversal of neurological defects in a
mouse model of Rett syndrome. Science, 315: 1143-1147.
Guy J, Hendrich B, Holmes M, Martin EF and Bird A (2001) A mouse Mecp2-null mutation
causes neurological symptoms that mimic Rett syndrome. Nature, 27: 322-326.
Hagberg B and Hagberg G (1997) Rett syndrome: epidemiology and geographical
variability. Eur Child Adolesc Psychiatry, 6: 5-7.
Hagberg B, Goutières F, Hanefeld F, Rett A and Wilson J (1985) Rett syndrome: criteria for
inclusion and exclusion. Brain Dev., 7: 372-373.
Hainrichson M, Nudelman I and Baasov T (2008) Designer aminoglycosides: the race to
develop improved antibiotics and compounds for the treatment of human genetic diseases.
Org Biomol Chem., 6: 227-239.
Heier CR and DiDonato CJ (2009) Translational readthrough by the aminoglycoside
geneticin (G418) modulates SMN stability in vitro and improves motor function in SMA
mice in vivo. Hum Mol Genet., 18: 1310-1322.
122
Helip-Wooley A, Park MA, Lemons RM and Thoene JG (2002) Expression of CTNS alleles:
subcellular localization and aminoglycoside correction in vitro. Mol Genet Metab., 75: 128-
133.
Hendrich B, Abbott C, McQueen H, Chambers D, Cross S and Bird A (1999 a) Genomic
structure and chromosomal mapping of the murine and human Mbd1, Mbd2, Mbd3, and
Mbd4 genes. Mamm Genome., 10: 906-912.
Hendrich B, Hardeland U, Ng HH, Jiricny J and Bird A (1999 b) The thymine glycosylase
MBD4 can bind to the product of deamination at methylated CpG sites. Nature, 401: 301-
304.
Hendrich B and Bird A (1998) Identification and characterization of a family of mammalian
methyl-CpG binding proteins. Mol Cell Biol., 18: 6538-6547.
Hendrich B, Guy J, Ramsahoyce B, Wilson AV and Bird A (2001) Closely related proteins
MBD2 and MBD3 play distinctive but interacting roles in mouse development. Genes Dev.,
15: 710-723.
Hermann T (2005) Drugs targeting the ribosome. Curr Opin Struct Biol., 15: 355-366.
Hermann T (2007) Aminoglycoside antibiotics: old drugs and new therapeutic approaches.
Cell Mol Life Sci., 64: 1841-1852.
Hoffbuhr K, Devaney JM, LaFleur B, Sirianni N, Scacheri C, Giron J, Schuette J, Innis J,
Marino M, Philippart M, Narayanan V, Umansky R, Kronn D, Hoffman EP and Naidu S
(2001) MeCP2 mutations in children with and without the phenotype of Rett Syndrome.
Neurology, 56: 1486-1495.
Holbrook JA, Neu-Yilik G, Wentze MW and Kulozik AE (2004) Nonsense-mediated decay
approaches the clinic. Nat Genet., 36: 801-808.
Hoof VA, Frischmeyer AP, Dietz CH and Parker R (2002) Exosome-Mediated recognition
and degradation of mRNAs lacking a termination codon. Science, 295: 2262-2264.
Horská A, Farage L, Bibat G, Nagae LM, Kaufmann WE, Barker PB and Naidu S (2009)
Brain metabolism in Rett syndrome: age, clinical, and genotype correlations. Ann Neurol.,
65: 90-97.
Howard MT, Anderson CB, Fass U, Khatri S, Gesteland RF, Atkins JF and Flanigan KM
(2004) Readthrough of Dystrophin Stop Codon Mutations Induced by Aminoglycosides.
Ann Neurol., 55: 422-426.
Howard M, Frizzell RA and Bedwell DM (1996) Aminoglycoside antibiotics restore CFTR
function by overcoming premature stop mutations. Nat Med., 2: 467-469.
123
Humes HD, Weinberg JM and Knauss TC (1982) Clinical and pathophysiological aspects of
aminoglycoside nephrotoxicity. Am J Kidney Dis., 2: 5-29.
Huppke P, Held M, Hanefeld F, Engel W and Laccone F (2002) Influence of mutation type
and location on phenotype in 123 patients with Rett syndrome. Neuropediatrics, 33: 63-68.
IRSF database Australia (http://mecp2.chw.edu.au/mecp2).
Johnston MV, Oh J, Pevsner J, Blue ME and Naidu S (2001) Neurobiology of Rett
syndrome: a genetic disorder of synapse development. Brain Dev., 1: S206-S213.
Johnston MV (2004) Clinical disorders of brain plasticity. Brain Dev., 26: 73-80.
Jones PL, Veenstra GJ, Wade PA, Vermaak D, Kass SU, Landsberger N, Strouboulis J and
Wolffe AP (1998) Methylated DNA and MeCP2 recruit histone deacetylase to repress
transcription. Nat Genet., 19: 187-191.
Jugloff DG, Jung BP, Purushotham D, Logan R and Eubanks JH (2005) Increased dendritic
complexity and axonal length in cultured mouse cortical neurons overexpressing methyl-
CpG-binding protein MeCP2. Neurobiol Dis., 19: 18-27.
Keeling KM, Brooks DA, Hopwood JJ, Li P, Thompson JN and Bedwell DM (2001)
Gentamicin-mediated suppression of Hurler syndrome stop mutations restores a low level of
alpha-L-iduronidase activity and reduces lysosomal glycosaminoglycan accumulation. Hum
Mol Genet., 10: 291-299.
Keeling KM and Bedwell DM (2002) Clinically relevant aminoglycosides can suppress
disease-associated premature stop mutations in the IDUA and P53 cDNAs in a mammalian
translation system. J Mol Med., 80: 367-376.
Keeling KM and Bedwell DM (2005) Pharmacological Suppression of Premature stop
mutations that cause genetic diseases. Current Pharmacogenomics, 3: 1-11.
Kerem E (2004) Pharmacologic therapy for stop mutations: how much CFTR activity is
enough? Curr Opin Pulm Med., 10: 547-552.
Kerem E, Hirawat S, Armoni S, Yaakov Y, Shoseyov D, Cohen M, Nissim-Rafinia M, Blau
H, Rivlin J, Aviram M, Elfring GL, Northcutt VJ, Miller LL, Kerem B and Wilschanski M
(2008) Effectiveness of PTC124 treatment of cystic fibrosis caused by nonsense mutations: a
prospective phase II trial. Lancet, 372: 719-727.
Kerr TP, Sewry CA, Robb SA and Roberts RG (2001) Long mutant dystrophins and variable
phenotypes: evasion of nonsense-mediated decay? Hum Genet., 109: 402-407.
124
Kishi N and Macklis DJ (2004) MECP2 is progressively expressed in post-migratory neurons
and is involved in neuronal maturation rather than cell decisions. Mol Cell Neurosci., 27:
306-321.
Kisselev L, Ehrenberg M and Frolova L (2003) Termination of translation: Interplay of
mRNA, rRNAs and release factors? EMBO, 22: 175-182.
Koch C and Stratling WH (2004) DNA binding of methyl-CpG-binding protein MeCP2 in
human MCF7 cells. Biochemistry, 43: 5011-5021.
Kondo S and Hotta K (1999) Semisynthetic aminoglycoside antibiotics: Development and
enzymatic modifications. J Infect Chemother., 5: 1-9.
Kriaucionis S and Bird A (2004) The major form of MeCP2 has a novel N-terminus
generated by alternative splicing. Nucleic Acids Res., 32: 1818-1823.
Kuczewski N, Porcher C, Lessmann V, Medina I and Gaiarsa JL (2009) Activity-dependent
dendritic release of BDNF and biological consequences. Mol Neurobiol., 39: 37-49.
Kumar A, Kamboj S, Malone BM, Kudo S, Twiss JL, Czymmek KJ, LaSalle JM and
Schanen NC (2008) Analysis of protein domains and Rett syndrome mutations indicate that
multiple regions influence chromatin-binding dynamics of the chromatin-associated protein
MeCP2 in vivo. J Cell Sci., 121: 1128-1137.
Lai CH, Chun HH, Nahas SA, Mitui M, Gamo KM, Du L and Gatti RA (2004) Correction of
ATM gene function by aminoglycoside-induced read-through of premature termination
codons. PNAS., 101: 15676-15681.
LaSalle JM, Goldstine J, Balmer D and Greco CM (2001) Quantitative localization of
heterogeneous methyl-CpG-binding protein 2 (MeCP2) expression phenotypes in normal and
Rett syndrome brain by laser scanning cytometry. Hum Mol Genet., 10: 1729-1740.
LaSalle JM (2004) Paradoxical Role of Methyl-CpG-Binding protein 2 in Rett Syndrome.
Curr Top Dev Biol., 59: 61-86.
Lawson-Yuen A, Liu D, Han L, Jiang IZ, Tsai EG, Basu AC, Picker J, Feng J and Coyle JT
(2007) Ube3a mRNA and protein expression are not decreased in MeCP2-R168X mutant
mice. Brain Res., 1180: 1-6.
Leonard H, Silberstein J, Falk R, Houwink-Manville I, Ellaway C, Raffaele LS, Engerström
IW and Schanen C (2001) Occurrence of Rett syndrome in boys. J Child Neurol., 16: 333-
338.
125
Lewis JD, Meehan RR, Henzel WJ, Maurer-Fogy I, Jeppesen P, Klein F and Bird A (1992)
Purification, sequence, and cellular localization of a novel chromosomal protein that binds to
methylated DNA. Cell, 69: 905-914.
Linde L, Boelz S, Nissim-Rafinia M, Oren YS, Wilschanski M, Yaacov Y, Virgilis D, Neu-
Yilik G, Kulozik AE, Kerem E and Kerem B (2007) Nonsense-mediated mRNA decay
affects nonsense transcript levels and governs response of cystic fibrosis patients to
gentamicin. J Clin Invest., 17: 683-692.
Luikenhuis S, Giacometti E, Beard CF and Jaenisch R (2004) Expression of MeCP2 in
postmitotic neurons rescues Rett syndrome in mice. PNAS, 101: 6033-6038.
Lyon MF (1989) X-chromosome inactivation as a system of gene dosage compensation to
regulate gene expression. Prog Nucleic Acid Res Mol Biol., 36: 119-130.
Magnet S and Blanchard JS (2005) Molecular insights into aminoglycoside action and
resistance. Chem Rev., 105: 477-498.
Major LL, Edgar TD, Yee Yip P, Isaksson LA and Tate WP (2002) Tandem termination
signals: Myth or reality? FEBS Lett., 1: 84-89.
Manuvakhova M, Keeling K and Bedwell DM (2000) Aminoglycoside antibiotics mediate
context-dependent suppression of termination codons in a mammalian translation system.
RNA, 6: 1044-1055.
Mari F, Azimonti S, Bertani I, Bolognese F, Colombo E, Caselli R, Scala E, Longo I, Grosso
S, Pescucci C, Ariani F, Hayek G, Balestri P, Bergo A, Badaracco G, Zappella M, Broccoli
V, Renieri A, Kilstrup-Nielsen C and Landsberger N (2005) CDKL5 belongs to the same
molecular pathway of MeCP2 and it is responsible for early-onset seizure variant of Rett
Syndrome. Hum Mol Genet., 14: 1935-1946.
Masuyama T, Matsuo M, Jing JJ, Tabara Y, Kitsuki K, Yamagata H, Kan Y, Miki T, Ishii K
and Kondo I (2005) Classic Rett syndrome in a boy with R133C mutation of MECP2. Brain
Devl., 27: 439-442.
McCaughan KM, Brown CM, Dalphin EM, Berry JM and Tate PW (1995) Translational
termination efficiency in mammals is influenced by the base following the stop codon.
PNAS, 92: 5431-5435.
Mendell JT and Dietz CH (2001) When the Message Goes Awry: Disease-producing
mutations that influence mRNA content and performance. Cell, 107: 411-414.
Mnatzakanian GN, Lohi H, Munteanu I, Alfred SE, Yamada T, MacLeod PJ, Jones JR,
Scherer SW, Schanen NC, Friez MJ, Vincent JB and Minassian BA (2004) A previously
126
unidentified MECP2 open reading frame defines a new protein isoform relevant to Rett
syndrome. Nat Genet., 36: 339-341.
Moestrup SK, Cui S, Vorum H, Bregengård C, Bjørn SE, Norris K, Gliemann J and
Christensen EI (1995) Evidence that epithelial glycoprotein 330/megalin mediates uptake of
polybasic drugs. J Clin Invest., 96: 1404-1413.
Monrós E, Armstrong J, Aibar E, Poo P, Canós I and Pineda M (2001) Rett syndrome in
Spain: mutation analysis and clinical correlations. Brain Dev., 23 (Suppl 1): S251-253.
Moretti P, Bouwknecht JA, Teague R, Paylor R and Zoghbi HY (2005) Abnormalities of
social interactions and home-cage behavior in a mouse model of Rett syndrome. Hum Mol
Genet., 14: 205-220.
Moretti P, Levenson JM, Battaglia F, Atkinson R, Teague R, Antalffy B, Armstrong D,
Arancio O, Sweatt JD and Zoghbi HY (2006) Learning and memory and synaptic plasticity
are impaired in a mouse model of Rett syndrome. J Neurosci., 26: 319-327.
Morgan HD, Santos F, Green K, Dean W and Reik W (2005) Epigenetic reprogramming in
mammals. Hum Mol Genet., 14: R47-R58.
Nagai J and Takano M (2004) Molecular aspects of renal handling of aminoglycosides and
strategies for preventing the nephrotoxicity. Drug Metab Pharmacokinet., 19: 159-170.
Nan X, Meehan RR and Bird A (1993) Dissection of the methyl-CpG binding domain from
the chromosomal protein MeCP2. Nucleic Acids Res., 21: 4886-4892.
Nan X, Tate P, Li E and Bird A (1996) DNA methylation specifies chromosomal localization
of MeCP2. Molec Cell Biol., 16: 414-421.
Nan X, Campoy FJ and Bird A (1997) MeCP2 is a transcriptional repressor with abundant
binding sites in genomic chromatin. Cell, 88: 471-481.
Nan X, Ng HH, Johnson CA, Laherty CD, Turner BM, Eisenman RN and Bird A (1998)
Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone
deacetylase complex. Nature, 393: 386-389.
Neul JL, Fang P, Barrish J, Lane J, Caeg EB, Smith EO, Zoghbi H, Percy A and Glaze DG
(2008) Specific mutations in methyl-CpG-binding protein 2 confer different severity in Rett
syndrome. Neurology, 70: 1313-1321.
Ng HH, Zhang Y, Hendrich B, Johnson CA, Turner BM, Erdjument-Bromage H, Tempst P,
Reinberg D and Bird A (1999) MBD2 is a transcriptional repressor belonging to the MeCP1
histone deacetylase complex. Nat Genet., 23: 58-61.
127
Nikitina T, Ghosh RP, Horowitz-Scherer RA, Hansen JC, Grigoryev SA and Woodcock CL
(2007 a) MeCP2-chromatin interactions include the formation of chromatosome-like
structures and are altered in mutations causing Rett Syndrome. J Biol Chem., 282: 28237-
28245.
Nikitina T, Shi X, Ghosh RP, Horowitz-Scherer RA, Hansen JC and Woodcock CL (2007 b)
Multiple modes of interaction between the methylated DNA binding protein MeCP2 and
Chromatin. Mol Cell Biol., 27: 864-877.
Nilsson M and Ryden-Aulin M (2003) Glutamine is incorporated at the nonsense codons
UAG and UAA in a suppressor-free Escherichia coli strain. Biochim Biophys Acta., 1627: 1-
6.
Nudelman I, Rebibo-Sabbah A, Cherniavsky M, Belakhov V, Hainrichson M, Chen F,
Schacht J, Pilch DS, Ben-Yosef T and Baasov T (2009) Development of novel
aminoglycoside (NB54) with reduced toxicity and enhanced suppression of disease-causing
premature stop mutations. J Med Chem., 52: 2836-2845.
Okano M, Bell DW, Haber DA and Li E (1999) DNA methyltransferases Dnmt3a and
Dnmt3b are essential for the novo methylation and mammalian development. Cell, 99: 247-
257.
Ogle JM, Brodersen DE, Clemons WM Jr, Tarry MJ, Carter AP and Ramakrishnan V (2001)
Recognition of cognate transfer RNA by the 30S ribosomal subunit. Science, 292: 897-902.
Orrico A, Lam C, Galli L, Dotti MT, Hayek G, Tong SF, Poon PM, Zappella M, Federico A
and Sorrentino V (2000) MECP2 mutation in male patients with non-specific X-linked
mental retardation. FEBS Lett., 481: 285-288.
Percy AK, Lane JB, Childers J, Skinner S, Annese F, Barrish J, Caeg E, Glaze DG and
MacLeod P (2007) Rett syndrome: North American database. J Child Neurol., 22: 1338-
1341.
Pinotti M, Rizzotto L, Pinton P, Ferraresi P, Chuansumrit A, Charoenkwan P, Marchetti G,
Rizzuto R, Mariani G, Bernardi F and International Factor VII Deficiency Study Group
(2006) Intracellular readthrough of nonsense mutations by aminoglycosides in coagulation
factor VII. J Thromb Haemost., 4: 1308-1314.
Poo MM (2001) Neurotrophins as synaptic modulators. Nat Rev Neuroscience, 2: 24-32.
Poole ES, Major LL, Mannering SA and Tate WP (1998) Translational termination in
Escherichia coli: Three bases following the stop codon crosslink to release factor 2 and
affect the decoding efficiency of UGA-containing signals. Nucleic Acid Res., 26: 954-960.
128
Poole ES, Major LL, Mannering SA and Tate WP (1998) Translational termination in
Escherichia coli: three bases following the stop codon crosslink to release factor 2 and affect
the decoding efficiency of UGA-containing signals. Nucleic Acids Res., 26: 954-960.
Prokhortchouk A, Hendrich B, Jorgensen H, Ruzov A, Wilm M, Georgiev G, Bird A and
Prokhortchouk E (2001) The p120 catenin partner Kaiso is a DNA methylation-dependent
transcriptional repressor. Genes Dev., 15: 1613-1618.
Ravn K, Nielsen JB, Uldall P, Hansen FJ and Schwartz M (2003) No correlation between
phenotype and genotype in boys with a truncating MECP2 mutation. J Med Genet., 40: 1-5.
Rebibo-Sabbah A, Nudelman I, Ahmed MZ, Baasov T and Ben-Yosef T (2007) In vitro and
ex vivo suppression by aminoglycosides of PCDH15 nonsense mutations underlying type 1
Usher syndrome. Hum Genet., 122: 373-381.
Recht MI, Douthwaite S and Puglisi JD (1999) Basis for prokaryotic specificity of action of
aminoglycoside antibiotics. EMBO J., 18: 33133-3138.
Recht MI, Fourmy D, Blanchard SC, Dahlquist KD, Puglisi JD (1996) RNA sequence
determinants for aminoglycoside binding to an A site rRNA model oligonucleotide. J Mol
Biol., 262: 421-436.
Rodnina MV and Wintermeyer W (2009) Recent mechanistic insights into eukaryotic
ribosomes. Curr Opin Cell Biol., 21: 435-443.
Samaco CR, Fryer JD, Ren J, Fyffe S, Chao HT, Sun Y, Greer JJ, Zoghbi HY and Neul JL
(2008) A partial loss of function allele of Methyl-CpG-binding protein 2 predicts a human
neurodevelopmental syndrome. Hum Mol Genet., 17: 1718-1727.
Sangkuhl K, Schulz A, Römpler H, Yun J, Wess J and Schöneberg T (2004)
Aminoglycoside-mediated rescue of a disease-causing nonsense mutation in the V2
vasopressin receptor gene in vitro and in vivo. Hum Mol Genet., 13: 893-903.
Schmitz C, Hilpert J, Jacobsen C, Boensch C, Christensen EI, Luft FC and Willnow TE
(2002) Megalin deficiency offers protection from renal aminoglycoside accumulation. J Biol
Chem., 277: 618-622.
Schwartzman JS, Bernardino A, Nishimura A, Gomes RR and Zatz M (2001) Rett syndrome
in a boy with a 47,XXY karyotype confirmed by a rare mutation in the MECP2 gene.
Neuropediatrics, 32: 162-164.
Shahbazian MD, Antalffy B, Armstrong DL and Zoghbi HY (2002 a) Insight into Rett
syndrome: MeCP2 levels display tissue- and cell-specific differences and correlate with
neuronal maturation. Hum Molec Genet., 11: 115-124.
129
Shahbazian M, Young J, Yuva-Paylor L, Spencer C, Antalffy B, Noebels J, Armstrong D,
Paylor R and Zoghbi H (2002 b) Mice with truncated MeCP2 recapitulate many Rett
syndrome features and display hyperacetylation of histone H3. Neuron, 35: 243-254.
Sirianni N, Naidu S, Pereira J, Pillotto RF and Hoffman EP (1998) Rett syndrome:
confirmation of X-linked dominant inheritance, and localization of the gene to Xq28. Am J
Hum Genet., 63: 1552-1558.
Smeets EJ, Chenault M, Curfs LM, Connie TR and Frijns JP (2009) Rett Syndrome and
Long-Term Disorder Profile. Am J Med Genet A., 149A: 199-205.
Tao J, Van Esch H, Hagedorn-Greiwe M, Hoffmann K, Moser B, Raynaud M, Sperner J,
Fryns JP, Schwinger E, Gécz J, Ropers HH and Kalscheuer VM (2004) Mutations in the X-
linked cyclin-dependent kinase-like 5 (CDKL5/STK9) gene are associated with severe
neurodevelopmental retardation. Am J Hum Genet., 75: 1149-1154.
Tao J, Hu K, Chang Q, Wu H, Sherman NE, Martinowich K, Klose RJ, Schanen C, Jaenisch
R, Wang W and Sun YE (2009) Phosphorylation of MeCP2 at Serine 80 regulates its
chromatin association and neurological function. PNAS, 106: 4882-4887.
Topçu M, Akyerli C, Sayi A, Törüner GA, Koçoğlu SR, Cimbiş M and Ozçelik T (2002)
Somatic mosaicism for a MECP2 mutation associated with classic Rett syndrome in a boy.
Eur J Hum Genet., 10: 77-81.
Trappe R, Laccone F, Cobilanschi J, Meins M, Huppke P, Hanefeld F and Engel W (2001)
MECP2 mutations in sporadic cases of Rett syndrome are almost exclusively of paternal
origin. Am J Hum Genet., 68: 1093-1101.
VanLoock MS, Easterwood TR and Harvey SC (1999) Major groove binding of the
tRNA/mRNA complex to the 16 S ribosomal RNA decoding site. J Mol Biol., 285: 2069-
2078.
Vicens Q and Westhof E (2003) Crystal structure of geneticin bound to a bacterial 16 S
ribosomal RNA A site oligonucleotide. J Mol Biol., 326: 1175-1188.
Vicens and Westhof (2001) Crystal structure of paromomycin docked into the eubacterial
ribosomal decoding A site. Structure., 9: 647-658.
Wade PA, Gegonne A, Jones PL, Ballestar E, Aubry F and Wolffe AP (1999) Mi-2 complex
couples DNA methylation to chromatin remodelling and histone deacetylation. Nat Genet.,
23: 62-66.
Wakefield RI, Smith BO, Nan X, Free A, Soteriou A, Uhrin D, Bird AP and Barlow PN
(1999) The solution structure of the domain from MeCP2 that binds to methylated DNA. J
Mol Biol., 291: 1055-1065.
130
Wan M, Lee S, Zhang X, Houwink-Manville I, Song HR, Amir RE, Budden S, Naidu S,
Pereira JL, Lo IF, Zoghbi HY, Schanen NC and Francke U (1999) Rett syndrome and
beyond: recurrent spontaneous and familial MECP2 mutations at CpG hotspots. Am J Hum
Genet., 65: 1520-1529.
Watanabe A, Nagai J, Adachi Y, Katsube T, Kitahara Y, Murakami T and Takano M (2004)
Targeted prevention of renal accumulation and toxicity of gentamicin by aminoglycoside
binding receptor antagonists. J Control Release, 95: 423-433.
Weaving LS, Williamson SL, Bennetts B, Davis M, Ellaway CJ, Leonard H, Thong MK,
Delatycki M, Thompson EM, Laing N and Christodoulou J (2003) Effects of MECP2
mutation type, location and X-inactivation in modulating Rett syndrome phenotype. Am J
Med Genet A., 118A:103-114.
Weaving LS, Christodoulou J, Williamson SL, Friend KL, McKenzie OL, Archer H, Evans
J, Clarke A, Pelka GJ, Tam PP, Watson C, Lahooti H, Ellaway CJ, Bennetts B, Leonard H
and Gécz J (2004) Mutations of CDKL5 cause a severe neurodevelopmental disorder with
infantile spasms and mental retardation. Am J Hum Genet., 75: 1079-1093.
Welch EM, Barton ER, Zhuo J, Tomizawa Y, Friesen WJ, Trifillis P, Paushkin S, Patel M,
Trotta CR, Hwang S, Wilde RG, Karp G, Takasugi J, Chen G, Jones S, Ren H, Moon YC,
Corson D, Trupoff AA, Campbell JA, Conn MM, Khan A, Almstead NG, Hedrick J, Mollin
A, Risher N, Weetall M, Yeh S, Branstrom AA, Colacino JM, Babiak J, Ju WD, Hirawat S,
Northcutt VJ, Miller LL, Spatrick P, He F, Kawana M, Feng H, Jacobson A, Peltz SW and
Sweeney HL (2007) PTC124 targets genetic disorders caused by nonsense mutations.
Nature, 447: 87-93.
Wilhelm JM, Pettitt SE and Jessop JJ (1978) Aminoglycoside antibiotics and eukaryotic
protein synthesis: structure-function relationships in the stimulation of misreading with a
wheat embryo system. Biochemistry, 17: 1143-1149.
Williams PD, Hottendorf GH and Bennett DB (1987) Correlation between renal membrane
binding and nephrotoxicity of aminoglycosides. Antimicrob Agents Chemother., 31: 570-
574.
Yang C, Feng J, Song W, Wang J, Tsai B, Zhang Y, Scaringe WA, Hill KA, Margaritis P,
High KA and Sommer SS (2007) A mouse model for nonsense mutation bypass therapy
shows a dramatic multiday response to geneticin. PNAS, 104: 15394-15399.
Yasui DH, Peddada S, Bieda MC, Vallero RO, Hogart A, Nagarajan RP, Thatcher KN,
Farnham PJ and Lasalle JM (2007) Integrated epigenomic analyses of neuronal MeCP2
reveal a role for long-range interaction with active genes. PNAS, 104: 19416-19421.
131
Yoshizawa S, Fourmy D and Puglisi J (1998) Structural origins of gentamicin antibiotic
action. Hum Mol Genet., 17: 6437-6448.
Young JI, Hong EP, Castle JC, Crespo-Barreto J, Bowman AB, Rose MF, Kang D, Richman
R, Johnson JM, Berget S and Zoghbi HY (2005) Regulation of RNA splicing by the
methylation-dependent transcriptional repressor methyl-CpG binding protein 2. PNAS, 102:
17551-17558.
Zhang Y, Ng HH, Erdjument-Bromage H, Tempst P, Bird A and Reinberg D (1999) Analysis
of the NuRD subunits reveals a histone deacetylase core complex and a connection with
DNA methylation. Genes Dev., 13: 1924-1935.
Zhou Z, Hong EJ, Cohen S, Zhao WN, Ho HY, Schmidt L, Chen WG, Lin Y, Savner E,
Griffith EC, Hu L, Steen JA, Weitz CJ and Greenberg ME (2006) Brain-specific
phosphorylation of MeCP2 regulates activity-dependent Bdnf transcription, dendritic growth,
and spine maturation. Neuron, 52: 255-269.
Zhouravleva G, Frolova L, Le Goff X, Le Guellec R, Inge-Vechtomov S, Kisselev L and
Philippe M (1995) Termination of translation in eukaryotes is governed by two interacting
polypeptide chain release factors, eRF1 and eRF3. EMBO J., 14: 4065-4072.
Zingman LV, Park S, Olson TM, Alekseev AE and Terzic A (2007) Aminoglycoside-
induced translational read-through in disease: overcoming nonsense mutations by
pharmacogenetic therapy. Clin Pharmacol Ther., 81: 99-103.