regulation of mitochondrial translation and …
TRANSCRIPT
![Page 1: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/1.jpg)
The Pennsylvania State University
The Graduate School
Eberly College of Science
REGULATION OF MITOCHONDRIAL TRANSLATION AND OXIDATIVE
PHOSPHORYLATION THROUGH REVERSIBLE ACETYLATION
A Dissertation in
Biochemistry, Microbiology and Molecular Biology
by
Hüseyin Çimen
2012 Hüseyin Çimen
Submitted in Partial Fulfillment of the Requirements
for the Degree of
Doctor of Philosophy
August 2012
![Page 2: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/2.jpg)
The Dissertation of Hüseyin Çimen was reviewed and approved* by the following:
Emine C. Koc Assistant Professor of Biochemistry and Molecular Biology Dissertation Co-adviser Co-chair of Committee
Hasan Koc Assistant Professor of Natural Sciences Dissertation Co-adviser Co-chair of Committee
Craig E. Cameron Paul Berg Professor of Biochemistry and Molecular Biology Associate Department Head for Research and Graduate Education
Joseph C. Reese Professor of Biochemistry and Molecular Biology
Teh-hui Kao Professor of Biochemistry and Molecular Biology
Tae-Hee Lee Assistant Professor of Chemistry and the Huck Institute of the Life Sciences
Craig E. Cameron Paul Berg Professor of Biochemistry and Molecular Biology Associate Department Head of the Department of Biochemistry and Molecular Biology
![Page 3: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/3.jpg)
iii
ABSTRACT
In a eukaryotic cell, mitochondria provide energy in the form of ATP through
oxidative phosphorylation (OXPHOS), which consists of five electron transport chain
complexes embedded in the inner membrane of mitochondria. Human mitochondria have
their own genome and transcription/translation system to synthesize mitochondrially
encoded thirteen proteins of respiratory chain complexes. We investigated how
acetylation of ribosomal proteins regulates translation and energy production in
mitochondria since reversible acetylation of mitochondrial proteins was found to be
critical for maintaining energy homeostasis. We identified mitochondrial ribosomal
protein L10 (MRPL10) as the major acetylated ribosomal protein in mammalian
mitochondria with two-dimensional gel electrophoresis followed by tandem mass
spectrometry and immunoblotting analyses. In addition, we discovered that SIRT3, which
is the main NAD+-dependent deacetylase localized into mitochondria, interacts with the
ribosome and is responsible for the deacetylation of MRPL10. MRPL10 is a member of
L7/L12 stalk, which is essential for translation since this stalk region stimulates the
activity of translation factors. We employed SIRT3 knock-out mice in order to study the
mechanism of reversible acetylation of MRPL10. The acetylation of MRPL10 resulted in
increased MRPL12 binding to the L7/L12 stalk accompanied by enhanced protein
synthesis in our in vitro translation assays. Moreover, HIB1B, a brown adipocyte tissue
cell line stably overexpressing SIRT3, demonstrated reduction in the acetylation of
MRPL10 and decreased MRPL12 binding to the L7/L12 stalk. By using [35S]-methionine
pulse-labeling assays, we revealed that the mitochondrial protein synthesis was
![Page 4: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/4.jpg)
iv
suppressed in these cells overexpressing SIRT3. Diminished synthesis of mitochondrial-
encoded protein subunits of respiratory chain complexes resulted in reduced activities of
Complex I and IV and total ATP production. Overall, these findings define a possible
mechanism by which SIRT3-dependent reversible acetylation of MRPL10 and binding of
MRPL12 to the ribosome regulates the mitochondrial protein synthesis and, therefore,
modulates the OXPHOS and ATP production. In the next chapter, the discovery of
another novel SIRT3 substrate, the flavoprotein (SdhA) subunit of Complex II, succinate
dehydrogenase, was demonstrated. We identified and assessed the acetylation of the
SdhA subunit, which resulted in reduced activity of Complex II in SIRT3 knock-out
mice. Due to their location in the enzyme, the acetylated lysine residues may induce
conformational changes to the active site of the enzyme in order to regulate its activity.
Next, the advancement in the available expressed sequence tag (ESTs) databases from
different organisms and the improved sensitivity of mass spectrometry-based proteomic
studies encouraged us to reevaluate the protein components of the mammalian
mitochondrial ribosome. In our analyses, we identified three additional members of the
mitochondrial ribosome; CHCHD1, AURKAIP1, and CRIF1. We found that siRNA
mediated knockdown of the newly identified ribosomal proteins to impair mitochondrial
protein synthesis as determined by [35S]-methionine pulse-labeling assays.
Overall, these biochemical and proteomic studies identified novel acetylated
targets, MRPL10 and SdhA, for SIRT3. Given that the components of mitochondrial
translation are crucial in the synthesis of respiratory chain subunits, the newly identified
ribosomal proteins in addition to acetylation of MRPL10 and SdhA provide a more
![Page 5: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/5.jpg)
v
complete picture of mitochondrial translation and regulation of energy production in the
cell.
![Page 6: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/6.jpg)
vi
TABLE OF CONTENTS
LIST OF FIGURES ..................................................................................................... ix
LIST OF TABLES ....................................................................................................... xii
ABBREVIATIONS ..................................................................................................... xiii
ACKNOWLEDGMENTS ........................................................................................... xv
Chapter 1 Introduction ................................................................................................ 1
1.1 Mitochondrion ................................................................................................ 1 1.2 Mitochondrial Genome ................................................................................... 4 1.3 Oxidative Phosphorylation ............................................................................. 7 1.4 Mitochondrial Translation .............................................................................. 8
1.4.1 Initiation ............................................................................................... 8 1.4.2 Elongation ............................................................................................. 9 1.4.3 Termination .......................................................................................... 10
1.5 Mitochondrial Ribosome ................................................................................ 12 1.5.1 Small Subunit (28S) of Mammalian Mitochondrial Ribosome ............ 15 1.5.2 Large Subunit (39S) of Mammalian Mitochondrial Ribosome ............ 15 1.5.3 New Mitochondrial Ribosomal Proteins and Additional Functions ..... 17
1.6 Post-Translational Modifications of Proteins ................................................. 20 1.6.1 Lysine Acetyltransferases (KATs) and Deacetylases (KDACs) .......... 20 1.6.2 Mitochondrial Acetyltransferases and Sirtuins .................................... 23 1.6.3 Post-Translational Modifications of Mitochondrial Ribosomal
Proteins ................................................................................................... 28 1.7 Research Aims ................................................................................................ 29 1.8 References ....................................................................................................... 32
Chapter 2 Regulation of Mitochondrial Translation by SIRT3 .................................. 39
2.1 Rationale ......................................................................................................... 40 2.2 Introduction ..................................................................................................... 41 2.3 Materials and Methods ................................................................................... 45
2.3.1 Mitochondrial Ribosome Preparation and Reverse Phase – High Performance Liquid Chromatography (RP-HPLC). ............................... 45
2.3.2 Mass Spectrometric Analysis of Bovine Mitochondrial Ribosomal Proteins ................................................................................................... 46
2.3.3 In Vitro Deacetylation and Translation Assays .................................... 47 2.3.4 Mouse Mitochondrial Ribosome Isolation ........................................... 48 2.3.5 Immunoblotting Assays ........................................................................ 49 2.3.6 Plasmid Constructs ............................................................................... 50 2.3.7 Cell Culture .......................................................................................... 51
![Page 7: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/7.jpg)
vii
2.3.8 [35S]-Methionine Pulse-Labeling Assays ............................................. 52 2.3.9 Preparation of Mitochondrial Ribosomes from Cell Lines .................. 52 2.3.10 Complex I and IV Activity and ATP Determination Assays ............. 53 2.3.11 Expression and Purification MRPL10-MRPL12 Complex and
Reconstitution of Hybrid Ribosome ....................................................... 55 2.3.12 Statistical Analysis ............................................................................. 56
2.4 Results and Discussion .................................................................................. 57 2.4.1 The Mitochondrial Ribosomal Protein MRPL10 is Acetylated and
SIRT3 is Responsible for its Deacetylation ........................................... 57 2.4.2 SIRT3, NAD+-dependent Deacetylase is Associated with 55S
Mitochondrial Ribosome. ....................................................................... 66 2.4.3 Recombinant and Ribosome-Associated Endogenous NAD+-
dependent SIRT3 Deacetylates MRPL10 .............................................. 74 2.4.4 Overexpression of SIRT3 Regulates Mitochondrial Protein
Synthesis in HIB1B Cells ....................................................................... 85 2.4.5 Effect of SIRT3 Overexpression on MRPL12 Binding to the
Ribosome in HIB1B Cells ...................................................................... 87 2.4.6 The Effect of MRPL12 Knockdown and MRPL10 and MRPL12
Overexpression on Mitochondrial Protein Synthesis. ............................ 94 2.4.7 The Role of Acetylated Lysine Residues of MRPL10 on
Mitochondrial Translation and Cell Growth In Vivo. ............................ 98 2.4.8 The Role of MRPL10 Reversible Acetylation in the Composition
of Ribosomal L7/L12 Stalk and Mitochondrial Translation In Vitro. .... 104 2.5 Conclusions and Future Directions ................................................................. 111 2.6 Acknowledgment ............................................................................................ 116 2.7 References ....................................................................................................... 116
Chapter 3 Regulation of Succinate Dehydrogenase Activity by SIRT3 ..................... 121
3.1 Rationale ......................................................................................................... 122 3.2 Introduction ..................................................................................................... 123 3.3 Materials and Methods ................................................................................... 125
3.3.1 Isolation of Mitochondria from Mice Liver and Enrichment of Complex II .............................................................................................. 125
3.3.2 Two Dimensional-Gel and Immunoblotting Analysis ......................... 126 3.3.3 Mass Spectrometric Identification and Mapping of Acetylation
Sites ........................................................................................................ 127 3.3.4 Cell Culture .......................................................................................... 128 3.3.5 Complex II Enzymatic Activity Assay ................................................. 129 3.3.6 Statistical Analysis ............................................................................... 129
3.4 Results and Discussion ................................................................................... 130 3.4.1 Succinate Dehydrogenase is Acetylated and SIRT3 is Responsible
for its Deacetylation ............................................................................... 130 3.4.2 Role of Hyperacetylation of SdhA in Complex II Activity .................. 139
![Page 8: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/8.jpg)
viii
3.4.3 Role of Increased Level of SIRT3 Expression in Deaceylation of SdhA and Complex II Activity ............................................................... 140
3.5 Conclusions and Future Directions ................................................................. 146 3.6 Acknowledgment ............................................................................................ 149 3.7 References ....................................................................................................... 150
Chapter 4 Identification and Analysis of New Mammalian Mitochondrial Ribosomal Proteins: CHCHD1, AURKAIP1, and CRIF1 ................................... 152
4.1 Rationale ......................................................................................................... 153 4.2 Introduction ..................................................................................................... 154 4.3 Materials and Methods ................................................................................... 156
4.3.1 Preparation of Bovine Mitochondrial Ribosomal Subunits .................. 156 4.3.2 Identification of Mitochondrial Ribosomal Proteins by Mass
Spectrometry .......................................................................................... 157 4.3.3 Preparation of Crude Ribosomes from Human Cell Lines and
Isolated Mitochondria ............................................................................ 158 4.3.4 RNase A Treatment of Mitochondrial Ribosomes ............................... 160 4.3.5 Immunoblotting Analysis ..................................................................... 160 4.3.6 [35S]-Methionine Labeling of Mitochondrial Translation Products
In Vivo .................................................................................................... 161 4.3.7 Reverse Transcription Polymerase Chain Reaction (RT-PCR) ............ 162
4.4 Results and Discussion ................................................................................... 164 4.4.1 Identification of 55S Ribosomal Proteins by Tandem Mass
Spectrometry .......................................................................................... 164 4.4.2 Subunit Assignments of Newly Identified Ribosome-associated
Proteins ................................................................................................... 169 4.4.3 Localization of CHCHD1, AURKAIP1, and CRIF1 into the
Mitochondria and Their Roles in Mitochondrial Translation ................ 177 4.5 Conclusions and Future Directions ................................................................. 192 4.6 Acknowledgment ............................................................................................ 195 4.7 References ....................................................................................................... 195
Chapter 5 Concluding Remarks and Future Directions .............................................. 199
5.1 References ....................................................................................................... 206
Appendix A The Effect of GCN5L1 Knockdown in Hep3B and HIB1B Cells. ........ 209
Appendix B Strong-Cation Exchange (SCX) Chromatography Purification of Mitochondrial MRPL10-MRPL12 Stalk Complex .............................................. 215
![Page 9: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/9.jpg)
ix
LIST OF FIGURES
Figure 1.1: Mammalian mitochondrion. ...................................................................... 3
Figure 1.2: Products of mitochondrial genome and oxidative phosphorylation. ......... 6
Figure 1.3: Model for different stages of mitochondrial translation. ........................... 11
Figure 1.4: The 3D cryo-EM reconstruction mitochondrial ribosomes. ...................... 13
Figure 1.5: Model representing the mitochondrial L7/L12 stalk. ................................ 19
Figure 1.6: Substrates and biological functions of sirtuins and mitochondrial acetyltransferase(s). .............................................................................................. 26
Figure 2.1: Detection of acetylated mitochondrial ribosomal proteins. ....................... 59
Figure 2.2: Purification of MRPL10 and its acetylated forms by reverse phase -HPLC. ................................................................................................................... 62
Figure 2.3: Alignment of MRPL10 with identified acetylated lysine residues. .......... 64
Figure 2.4: Structural model for the location of acetylated lysine residues on ribosome and ribosomal L7/L12 stalk region. ...................................................... 65
Figure 2.5: The association of SIRT3 with mitochondrial 55S ribosomes. ................. 68
Figure 2.6: Dissociation of SIRT3 from the large subunit of mitochondrial ribosomes by RNase A treatment. ........................................................................ 69
Figure 2.7: Structural model of the SIRT3 and MRPL10 interactions in the L7/L12 stalk. ......................................................................................................... 72
Figure 2.8: Deacetylation of MRPL10 by the NAD+-dependent deacetylase, SIRT3. ................................................................................................................... 76
Figure 2.9: Role of MRPL10 acetylation in SIRT3 knock-out (Sirt3-/-) mice. ............ 77
Figure 2.10: Role of nicotinamide (NAM) and emetine on mitochondrial protein synthesis. ............................................................................................................... 79
Figure 2.11: Enhanced MRPL12 binding to the ribosome in SIRT3 knock-out mice. ...................................................................................................................... 81
Figure 2.12: Role of MRPL10 acetylation in mitochondrial translation in SIRT3 knock-out mice. .................................................................................................... 82
![Page 10: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/10.jpg)
x
Figure 2.13: Identification of two different forms of MRPL12. .................................. 84
Figure 2.14: Role of SIRT3 over-expression on mitochondrial protein synthesis in HIB1B cells. ......................................................................................................... 86
Figure 2.15: Effect of SIRT3 over-expression on MRPL10 acetylation and MRPL12 binding to the ribosome in HIB1B cells. .............................................. 88
Figure 2.16: Complex I activity in HIB1B cells overexpressing SIRT3. .................... 90
Figure 2.17: Effect of SIRT3 overexpression on Complex IV activity. ...................... 91
Figure 2.18: ATP production in HIB1B cells overexpressing SIRT3. ........................ 92
Figure 2.19: Citrate synthase activity in HIB1B cells overexpressing SIRT3. ........... 93
Figure 2.20: Effect of MRPL12 knockdown and MRPL10 and MRPL12 overexpressions on mitochondrial protein synthesis. ........................................... 96
Figure 2.21: Effect of MRPL12 knockdown and MRPL10 and MRPL12 overexpression on ribosomal L7/L12 stalk composition and OXPHOS subunits. ................................................................................................................ 97
Figure 2.22: The effect of MRPL10 LysAla, Gln, and Arg mutants on mitochondrial protein synthesis. ........................................................................... 102
Figure 2.23: The effect of MRPL10 LysAla, Gln, and Arg mutants on cell growth. .................................................................................................................. 103
Figure 2.24: Strong-cation exchange (SCX) chromatography purification of mitochondrial MRPL10-MRPL12 stalk complex. ............................................... 106
Figure 2.25: Poly(U)-directed in vitro translation assays using hybrid ribosomes. ..... 110
Figure 3.1A-B: Detection of SdhA as a novel SIRT3 substrate in SIRT3 knock-out mice liver mitochondria. ................................................................................. 131
Figure 3.1C: Identification of SdhA acetylation in SIRT3 knock-out mice liver mitochondria. ........................................................................................................ 132
Figure 3.2A: The collision-induced dissociation (CID) spectrum of the acetylated peptide. .................................................................................................................. 136
Figure 3.2B: Primary sequence alignment of acetylated peptides from mice SdhA and its homologs from different species. .............................................................. 137
Figure 3.2C: Crystal structure model of the chicken SdhA. ........................................ 138
![Page 11: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/11.jpg)
xi
Figure 3.3: Regulation of succinate dehydrogenase (Complex II) activity by deacetylation of SdhA. .......................................................................................... 142
Figure 3.4A-B: Effect of SIRT3 overexpression on SdhA deacetylation in K562 cells. ...................................................................................................................... 144
Figure 3.4C: Effect of SIRT3 overexpression on Complex II activity in K562 cells. ...................................................................................................................... 145
Figure 4.1: An experimental scheme for the purification of mitochondrial ribosomes and 28S and 39S subunits. ................................................................... 166
Figure 4.2: SDS-PAGE analyses of purified bovine 55S ribosomes and 28S and 39S subunits. ......................................................................................................... 167
Figure 4.3: Mitochondrial ribosomes prepared at different salt and detergent concentrations. ...................................................................................................... 168
Figure 4.4: Sedimentation of new MRPs with large complexes in human cell lines and mitochondria. ................................................................................................. 179
Figure 4.5: Distribution of new MRPs in 28S and 39S subunits. ................................ 182
Figure 4.6: RNA-dependent association of new MRPs with the 55S ribosome. ......... 183
Figure 4.7A: siRNA mediated knock-down of new MRPs. ........................................ 186
Figure 4.7B: RT-PCR analysis of mitochondrial- and nuclear-encoded transcripts. .. 187
Figure 4.8: Effect of new MRPs knock-down on mitochondrial protein synthesis. .... 188
Figure 4.9: Effect of new MRPs knock-down on OXPHOS subunits. ........................ 189
Figure 5.1: Model for the role of MRPL10 acetylation on MRPL12 binding to ribosome. .............................................................................................................. 201
Figure A1.1: The effect of GCN5L1 knockdown on acetylation and OXPHOS subunits in Hep3B cells. ....................................................................................... 212
Figure A1.2: The effect of GCN5L1 knockdown on mitochondrial protein synthesis in Hep3B cells. ...................................................................................... 213
Figure A2.1: Strong-cation exchange (SCX) chromatography purification of mitochondrial MRPL10-MRPL12 stalk complex. ............................................... 217
Figure A2.2: Dialyzed mitochondrial MRPL10-MRPL12 stalk complex. .................. 218
![Page 12: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/12.jpg)
xii
LIST OF TABLES
Table 1.1: List of mitochondrial and bacterial ribosomal proteins .............................. 14
Table 2.1: Peptides detected from tryptic digests of mitochondrial ribosomal protein bands corresponding to acetylation signals by capLC-MS/MS analysis. ................................................................................................................ 60
Table 2.2: Peptides detected from tryptic digests of mitochondrial ribosome associated bovine SIRT3 by capLC-MS/MS analysis. ......................................... 70
Table 3.1: Peptides detected from tryptic digests of protein band corresponding to acetylation signal in SIRT3 knock-out mice mitochondria by capLC-MS/MS analysis. ................................................................................................................ 135
Table 4.1: Peptide sequences of new mitochondrial ribosomal proteins identified from capLC-MS/MS analyses of in-gel tryptic digestions of 28S, 39S, and 55S proteins. ......................................................................................................... 170
Table 4.2: Relative distribution of new mitochondrial ribosomal proteins using emPAI (Exponentially Modified Protein Abundance Index) values. ................... 172
Table 4.3: GenBank™ and Swiss-Prot accession numbers of new mitochondrial ribosomal proteins found in various species. ........................................................ 173
Table 4.4: List of mammalian mitochondrial ribosomal proteins with their bacterial homologs ................................................................................................ 191
![Page 13: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/13.jpg)
xiii
ABBREVIATIONS
12S rRNA of the small subunit of the mitochondrial ribosome 16S rRNA of the large subunit of the mitochondrial ribosome 28S small subunit of the mitochondrial ribosome 30S small subunit of the bacterial ribosome 39S large subunit of the mitochondrial ribosome 50S large subunit of the bacterial ribosome 55S intact mitochondrial ribosomes 70S intact bacterial ribosomes aa-tRNA aminoacyl tRNA ADP adenosine diphosphate ATP adenosine triphosphate ATP6 ATP synthase subunit 6 ATP8 ATP synthase subunit 8 bp base pair capLC-ESI capillary liquid chromatography nanoelectrospray ionization CID collision-induced dissociation Complex I NADH dehydrogenase Complex II succinate dehydrogenase Complex III ubiquinol cytochrome c oxidoreductase Complex IV cytochrome c oxidase Complex V ATP synthase COXI cytochrome c oxidase subunit 1 COXII cytochrome c oxidase subunit 2 COXIII cytochrome c oxidase subunit 3 CP central protuberance CTD C-terminal domain cyro-EM cyro-electron microscopy Cytb subunit of ubiquinol cytochrome c oxidoreductase DAP3 death associated protein 3 DTT dithiothreitol EF-G mt mitochondrial elongation factor G EF-Tu mt mitochondrial elongation factor Tu E site exit site for tRNA fMet formylated methionine GCN5L1 general control of amino acid synthesis 5-like 1 HSP60 heat shock protein 60 IF1 bacterial initiation factor 1 IF2 bacterial initiation factor 2 IF2mt mitochondrial initiation factor 2 IF3 bacterial initiation factor 3 IF3mt mitochondrial initiation factor 3 IPG immobilized pH gradient kDa kilo daltons
![Page 14: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/14.jpg)
xiv
mgf Mascot generic file mRNA messenger RNA MRP mitochondrial ribosomal protein MS mass spectrometry MS/MS tandem mass spectrometry mtDNA mitochondrial genome NAD+ nicotinamide adenine dinucleotide NAM nicotinamide ND1 NADH dehydrogenase subunit 1 ND2 NADH dehydrogenase subunit 2 ND3 NADH dehydrogenase subunit 3 ND4 NADH dehydrogenase subunit 4 ND4L NADH dehydrogenase subunit 4L ND5 NADH dehydrogenase subunit 5 ND6 NADH dehydrogenase subunit 6 NTD N-terminal domain OXPHOS oxidative phosphorylation PAGE polyacrylamide gel electrophoresis PDB protein data bank PDCD9 programmed cell death protein 9 PMSF phenylmethylsulfonyl fluoride poly U polyphenylalanine P site peptidyl site for tRNA PTC peptidyl transferase site PTM post-translational modification PVDF polyvinylidene fluoride RF release factor ROS reactive oxygen species RP bacterial ribosomal protein rRNA ribosomal RNA SCX strong cation exchange chromatography SD standard deviation SDS sodium dodecyl sulfate SRL sarcin-ricin loop TCA tricarboxylic acid tRNA transfer RNA WT wild-type
![Page 15: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/15.jpg)
xv
ACKNOWLEDGMENTS
I would like to take this opportunity to appreciate the help and support of my
advisor Dr. Emine Koc. This dissertation would not have been possible without her
inspiring suggestions and constant encouragement throughout productive and stimulating
discussions, not to mention her knowledge of every aspect of mitochondrial ribosomes. It
has been an honor to work in her laboratory first as a research associate and then as a
graduate student. I am grateful for the invaluable advice, support, and friendship of my
co-advisor, Dr. Hasan Koc, on both an academic and a personal level. I would like to
thank him for sharing his expertise in mass spectrometry and for making sure we survive
through times of frustration. I am thankful to all of the members of Koc laboratory, Dr.
Miller-Lee, Dr. Han, and Dr. Akpinar for sharing their experience and for providing an
excellent environment to work and I appreciate all of the work done by the undergraduate
students that are not mentioned here. I especially thank Dr. Han for our collaboration in
MRPL10 acetylation project and the undergraduate students, Beril Kumcuoglu and
Nadiah Abu who did astounding job in new MRPs project. I would also like to
acknowledge my committee members, Dr. Cameron, Dr. Reese, Dr. Kao, and Dr. Lee for
all the intellectual input and guidance throughout my graduate life. I need to express my
gratitude to the members of Cameron laboratory for their friendship and support during
my PhD. I am also grateful to the friends I have made at Penn State and Marshall
University. Finally, I would like to acknowledge my family for their unconditional love
and support in addition to their patience and understanding that helped me endure the
tough times.
![Page 16: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/16.jpg)
Chapter 1
Introduction
1.1 Mitochondrion
Mitochondria (Greek mitos: thread; chondros: granule) were called bioblasts by
Richard Altmann in 1894 (1) and the aliens with permanent residence in our cells by
Erich Gnaiger (2). Mitochondria are composed of two compartmental spaces. First is the
matrix surrounded by the inner membrane impermeable to most small molecules,
including protons, and second is the intermembrane space enclosed by the permeable
outer membrane. In the 1950s, mitochondria were found to be the site of oxidative
phosphorylation (OXPHOS) in eukaryotes and they were called the powerhouse of the
cells (Fig. 1.1). They are responsible for providing more than 90 % of the total cellular
energy extracted from dietary calories. Dietary carbohydrates are degraded through
glycolysis to pyruvate, which is transported into mitochondria and converted to acetyl-
CoA by pyruvate dehydrogenase. The tricarboxylic acid cycle (TCA) oxidizes acetyl-
CoA by transferring hydrogens to the electron carriers, NAD+ and FAD, which drive
OXPHOS (Fig. 1.1). OXPHOS establishes an electrochemical gradient (Δψ) across the
inner mitochondrial membrane with complexes I, III, and IV pumping protons into the
inter membrane space (Fig. 1.2). This process provides the proton motive force which
drives the translocation of protons through the complex V, ATP synthase and this rotary
machine produces adenosine triphosphate (ATP) from adenosine diphosphate (ADP) and
![Page 17: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/17.jpg)
2
phosphate (Pi) (3,4). Overall, mitochondrial bioenergetics involves the intermediates,
acetyl-CoA, ATP, and NAD+ to monitor the availability of nutrition and the redox status
for maintenance of cellular homeostasis (4). However, mitochondria are also source of
reactive oxygen species (ROS) generated during the transfer of electrons through the
OXPHOS complexes. In addition, protons in the intermembrane space are channeled
through the uncoupling proteins (UCP) located in the inner membrane to generate heat in
brown adipocytes (5). The other critical physiological functions of mitochondria involve
apoptosis, calcium storage to respond to calcium signaling, ketone body formation, heme
biosynthesis, and amino acid degradation including some reactions of the urea cycle
(Fig. 1.1). Given this variety of roles in cellular physiology, any mitochondrial
abnormality in these processes could contribute to the mitochondrial diseases such as
type 2 diabetes, neurodegeneration as in Parkinson’s disease, aging, and cancer (3,6,7).
Unfortunately, there is no cure available for mitochondrial disorders, only treatments to
relieve symptoms (8).
![Page 18: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/18.jpg)
3
Figure 1.1: Mammalian mitochondrion.
Mitochondrion has two compartmental spaces, intermembrane space and matrix,
enclosed by inner and outer membranes. Pyruvate enters the mitochondrion through
pyruvate dehydrogenase (PDH) to generate acetyl-CoA. Oxidation of acetyl-CoA by the
tricarboxylic acid cycle (TCA) provides the reduced NADH to drive generation of ATP
which is translocated into cytosol by adenine nucleotide translocator (ANT) and voltage
dependent anion channel (VDAC). Respiratory chain complexes (I, II, III, IV, and V)
also generates reactive oxygen species (ROS) in addition to ATP synthesis. Uncoupling
proteins (UCP) generate heat by uncoupling the proton gradient (Δψ). Additional
mitochondrial metabolic functions include apoptosis with the release of cyctochrome c
(cyt c) into the cytosol and storage of cellular calcium for signaling.
![Page 19: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/19.jpg)
4
1.2 Mitochondrial Genome
Human mitochondria contain several hundreds or thousands of mitochondrial
genome copies depending on the cell type. Mitochondrial DNA (mtDNA) is a 16,569
base pair (bp) circular molecule and is maternally inherited (Fig. 1.2) (9). It encodes 22
mitochondrial tRNAs, 13 mRNAs, and 2 rRNAs, a total of 37 genes without any intron.
(9-11). MtDNA contains a 1.1 kb non-coding region called the D-loop which is involved
in the regulation of transcription and replication of the molecule, and the double stranded
structure is formed by its heavy and light strands (12). The Light strand provides genes
for only one mRNA, ND6, and eight tRNAs while the rest of the 37 genes are encoded by
the heavy strand (10,13,14). Mitochondrially-encoded mRNAs are translated by
mitochondrial ribosomes to synthesize 7 proteins (ND1, 2, 3, 4, 4L, 5, and 6) of Complex
I among 43 subunits in total, 1 protein (Cytb) of Complex III among 11 subunits in total,
3 proteins (COXI, II, and III) of Complex IV among 13 subunits in total, and 2 proteins
(ATPase 6 and 8) of Complex V among 16 subunits in total (Fig. 1.2). Interestingly, none
of the subunits of Complex II are encoded by the mitochondrial genome and there is no
proton translocation through this complex, which may explain why mitochondrial DNA
did not preserve any gene for this complex throughout evolution. The mitochondrially-
encoded proteins are all essential for forming the hydrophobic core and the assembly of
the OXPHOS complexes with the nuclear-encoded subunits. OXPHOS deficiency can be
caused by mutations in any member of protein synthesis machinery including tRNA,
rRNA, and proteins. Many mutations in mtDNA are linked to deafness, metabolic and
![Page 20: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/20.jpg)
5
neurodegenerative diseases, and result in myopathies, encephalopathy, diabetes, and
cancer (15-17).
![Page 21: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/21.jpg)
6
Figure 1.2: Products of mitochondrial genome and oxidative phosphorylation.
Mitochondrion has a circular DNA molecule and its own
transcription/translation machinery for the synthesis of essential subunits of respiratory
chain complexes (I, III, IV, V). Double stranded mtDNA, 16.5 kb, encodes ND1, 2, 3,
4, 4L, 5, and 6 subunits of Complex I (blue), Cytb subunit of Complex III (pink),
COXI, II, and III subunits of Complex IV (sky blue) and ATP6 and 8 subunits of
Complex V (red), which are translated by mitochondrial ribosomes (55S).
![Page 22: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/22.jpg)
7
1.3 Oxidative Phosphorylation
Most of the OXPHOS subunits are encoded by the nuclear DNA, translated by
cytosolic ribosomes, and then translocated into the mitochondria where they are
assembled along with the mitochondrial encoded subunits into functional complexes. The
TCA cycle and fatty acid oxidation are the biochemical pathways providing reduced
forms of co-factors, NADH (nicotinamide adenine dinucleotide) and FADH2 (flavin
adenine dinucleotide) to drive oxidative phosphorylation (6). Five different enzyme
complexes located on the inner membrane are responsible for the synthesis of ATP
(Fig. 1.2). Oxidative phosphorylation is initiated with the transfer of electrons from
NADH or succinate to ubiquinone (also called coenzyme Q or Q) by Complex I (NADH
dehydrogenase) or Complex II (succinate dehydrogenase), respectively (18,19). Then, the
reduced ubiquinone (also called ubiquinol or QH2) carries these electrons to Complex III
(cytochrome c reductase) which mediates the transfer to cytochrome c (cyt c) (20).
Complex IV (cytochrome c oxidase) generates H2O with the electrons from reduced cyt c
and oxygen (Fig. 1.2) (21,22). These processes are accompanied by proton translocation
into the intermembrane space through complexes I, III, and IV to generate an
electrochemical gradient (Δψ). In the final step, the proton-motive force drives protons
back into the matrix to provide energy for ATP synthesis through Complex V (ATP
synthase) (23).
Complexes I and III are involved in the generation of reactive oxygen species
(ROS) which are hydrogen peroxide and oxygen radicals. These species are associated
with mitochondrial dysfunction resulting in neurodegeneration since they target proteins,
![Page 23: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/23.jpg)
8
lipids, and nucleic acids (24,25). In addition, a mutation in Complex I subunit 4
converting highly conserved arginine to a histidine at codon 340 was implicated in the
atrophy of the optic nerve in adults (Leber's hereditary optic neuropathy) (26). Moreover,
the T8993C/G mutations of mtDNA affect ATPase6 subunit of Complex V and result in
Leigh syndrome in addition to the phenotype of ataxia and pigment retinopathy (27,28).
1.4 Mitochondrial Translation
Translation of mitochondrial mRNAs involves different stages similar to those in
bacteria (29). In mitochondria, mRNAs do not contain 5’-untranslated region (UTR) and
3’-UTRs other than a short polyA tail, and do not require a Shine-Dalgarno sequence as
needed in prokaryotes, or a 5’-cap as in eukaryotic cells for initiation of translation
(9,14). However, mitochondrial ribosomes need formyl-methionyl tRNA (fMet-tRNA)
for initiation as in bacteria (30). The three different stages of mitochondrial translation,
initiation, elongation, and termination are explained below (Fig. 1.3).
1.4.1 Initiation
There are two mitochondrial initiation factors, IF2mt and IF3mt involved in protein
synthesis in addition to fMet-tRNA and mRNA. Mitochondrial translation system lacks
IF1 which is essential in the bacterial translation initiation. IF2mt was demonstrated to
perform the role of IF1 with the additional 37 amino acid residue between domains V and
VI (31-33). The first step in translation initiation is the dissociation of intact ribosomes
![Page 24: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/24.jpg)
9
(55S) by IF3mt providing small subunit (28S) for binding of IF2mt-GTP and mRNA which
is fed into the protein rich mRNA entrance gate on the small subunit (31). This complex
promotes the binding of fMet-tRNA to the 5’ start codon and then association of
ribosomal large subunit (39S) releases the initiation factors after the hydrolysis of GTP to
GDP. At this step, the 55S initiation complex is formed and enters into the elongation
phase of protein synthesis (Fig. 1.3) (34).
1.4.2 Elongation
The polypeptide chain elongation phase of mitochondrial protein synthesis is
highly conserved between bacteria and mitochondria compared to the initiation and
termination phases in bacteria (34-36). It is initiated with the binding of the ternary
complex which is formed through the binding of EF-Tumt and aminoacyl-tRNA (aa-
tRNA) to the A-site of the 55S complex provided during the initiation step. Just after the
recognition of codon-anticodon interaction, GTP is hydrolyzed to GDP by EF-Tumt and it
is released from the complex (34). Peptide bond formation is catalyzed by the ribosome
itself followed by the translocation of deacetylated tRNA from the P-site to the E-site.
The energy from GTP hydrolysis on EF-Gmt drives the peptidyl-tRNA from the A-site to
the P-site, which is analogous to the bacterial protein synthesis (34,37). It was also
reported that the L7/L12 stalk proteins are involved in the translocation process by
promoting GTPase activity of elongation factors (38,39). Sequential repeats of the
elongation phase generate growing polypeptide chain through the peptide exit tunnel on
the ribosomal large subunit.
![Page 25: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/25.jpg)
10
1.4.3 Termination
The ribosome stalls when either UAA or UGA stop codon enters into the A-site.
These codons are recognized by release factor, RF1amt, which causes the release of
synthesized polypeptide by the hydrolysis of the peptidyl-tRNA bond by the peptidyl
transferase center with the energy from GTP (34,40). In bacterial protein synthesis, RF1
and RF2, which are small GTPases, recognize UAA or UAG and UAA or UGA as stop
codons to terminate translation, respectively (41,42). A third release factor, RF3,
catalyzes the release of RF1 and RF2 at the end of the termination process in order to
recycle the ribosomes in dissociated forms to keep them available for next initiation
phase.
![Page 26: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/26.jpg)
11
Figure 1.3: Model for different stages of mitochondrial translation.
Mitochondrial translation starts with IF3mt binding which provides dissociated large
subunit (39S) and small subunit (28S) for the initiation phase. The mitochondrial initiation
factors, IF2mt and IF3mt, are shown in green and pink, respectively. The mitochondrial
elongation factors, EF-Tumt and EF-Gmt, are shown in sky blue and red, respectively. The
release factor, RFmt, is shown in purple. The initiator tRNA (fMet-tRNA) and aminoacyl-
tRNA (aa-tRNA) are shown in light and dark green, respectively. GTP is designated with
orange and GDP with yellow color.
![Page 27: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/27.jpg)
12
1.5 Mitochondrial Ribosome
In eukaryotic cells, there are two types of ribosomes, cytoplasmic ribosomes
present in the cytosol and mitochondrial ribosomes located within mitochondria. The
mitochondrial translation machinery synthesizes only thirteen proteins of the oxidative
phosphorylation complexes and the synthesis of the rest of the cellular proteins are all
carried out by cytoplasmic ribosomes. Mammalian mitochondrial ribosomes have low
sedimentation coefficients (55S) and they are formed by association of small subunit
(28S) and large subunit (39S) complexes (Fig. 1.4) (43). These ribosomes are large
ribonucleoprotein complexes with a molecular mass of ~2.6x106 Da. They are closely
related to bacterial ribosomes compared to the cytosolic ribosomes, in terms of conserved
proteins in some functional domains on ribosome and susceptibility to similar antibiotics.
However, their protein to RNA ratio is totally reversed (67 % protein, 33 % RNA in
mitochondrial ribosome) (44). Mitochondrial ribosomes are composed of twenty-nine
proteins with 12S rRNA on the small subunit and forty-eight proteins with 16S rRNA on
the large subunit (45-47). These proteins are listed in Table 1.1 and this list is updated
with our recent findings in Chapter 4 (46).
![Page 28: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/28.jpg)
13
Figure 1.4: The 3D cryo-EM reconstruction mitochondrial ribosomes.
The mitochondrial ribosome contains nuclear-encoded mitochondrial ribosomal
proteins and mitochondrial-encoded rRNAs (12S, 16S). The small subunit is 28S and
shown in yellow and green. The large subunit is 39S and shown in sky blue and dark
blue. The regions conserved in bacterial and mitochondrial ribosomes are shown in
yellow and sky blue. The green and dark blue regions are the mitochondrial specific
proteins which have no homolog in bacterial ribosomes. Details of functional domains
shown in the figure are described in text. SRL: sarcin-ricin loop, CP: central
protuberance and PTC: the peptidyl transferase site in the large subunit. Platform is
located on the opposite side of shoulder in the mRNA binding path. Courtesy of Dr. R.
K. Agrawal.
![Page 29: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/29.jpg)
14
28S and 39S: small and large subunit of mitochondrial ribosome 30S and 50S: small and large subunit of bacterial ribosome New Class: mitochondria-specific ribosomal proteins *: List includes the newly identified ribosomal proteins in Chapter 4.
Table 1.1: List of mitochondrial and bacterial ribosomal proteins.*
28S 30S New Class 39S 50S New Class Missing S1 MRPS22 MRPL1 L1 MRPL37 MRPS2 S2 MRPS23 MRPL2 L2 MRPL38 Missing S3 MRPS24 MRPL3 L3 MRPL39 Missing S4 MRPS25 MRPL4 L4 MRPL40 MRPS5 S5 MRPS26 Missing L5 MRPL41 MRPS6 S6 MRPS27 Missing L6 MRPL42 MRPS7 S7 MRPS28 MRPL12 L7/L12 MRPL43 Missing S8 MRPS29 MRPL9 L9 MRPL44 MRPS9 S9 MRPS30 MRPL10 L10 MRPL45 MRPS10 S10 MRPS31 MRPL11 L11 MRPL46 MRPS11 S11 MRPS32 MRPL13 L13 MRPL48 MRPS12 S12 MRPS33 MRPL14 L14 MRPL49 Missing S13 MRPS34 MRPL15 L15 MRPL50 MRPS14 S14 MRPS35 MRPL16 L16 MRPL51 MRPS15 S15 MRPS36 MRPL17 L17 MRPL52 MRPS16 S16 MRPS37 (CHCHD1) MRPL18 L18 MRPL53 MRPS17 S17 MRPS38 (AURKAIP1) MRPL19 L19 MRPL54 MRPS18-1 S18 MRPS39 (PTCD3) MRPL20 L20 MRPL55 MRPS18-2 S18 MRPL21 L21 MRPL56 MRPS18-3 S18 MRPL22 L22 MRPL57 (RP_63) Missing S19 MRPL23 L23 MRPL58 (ICT1) Missing S20 MRPL24 L24 MRPL59 (CRIF1) MRPS21 S21 Missing L25 MRPL60 (C7orf30) MRPL27 L27 MRPL28 L28 MRPL47 L29 MRPL30 L30 Missing L31 MRPL32 L32 MRPL33 L33 MRPL34 L34 MRPL35 L35 MRPL36 L36
![Page 30: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/30.jpg)
15
1.5.1 Small Subunit (28S) of Mammalian Mitochondrial Ribosome
Analysis of the small subunit of mitochondrial ribosomal proteins (MRP) resulted
in identification of a total of twenty-nine proteins currently listed in Table 1.1 (updated in
Chapter 4) (48-50). Fourteen of them have homologs in the bacterial ribosome while the
other fifteen proteins are classified as mitochondria-specific ribosomal proteins. The
small subunit is structurally divided into three functional segments, the platform, the
head, and the body. First, the platform lines the region in between the head and body
parts and it is involved in the formation of the P-site on the ribosome and the mRNA
binding to the ribosome (50). The platform is formed by MRPS2, MRPS5, MRPS6,
MRPS21, and MRPS21 which interact with the central domain of 12S rRNA in addition
to one of the three MRPS18 variants (47,50). Next, the head region, composed of
MRPS2, MRPS7, MRPS9, MRPS10, and MRPS14, provides their interaction with the 3’
domain of the 12S rRNA (47,50). Proteins located in the platform and head regions have
essential functions in mRNA and tRNA binding to the bacterial ribosome (37,51-56).
Last, the body segment of the small subunit involves MRPS5, MRPS12, MRPS16,
MRPS17 interacting with the 5’ domain of the 12S rRNA (47).
1.5.2 Large Subunit (39S) of Mammalian Mitochondrial Ribosome
The large subunit of the mitochondrial ribosome consists of 16S rRNA and forty-
eight proteins, twenty-eight of which have homologs in the bacterial ribosome
(Table 1.1). The rest of them, MRPL37 to MRPL56, are mitochondria-specific ribosomal
proteins. There are three major structural units extending from the body, L1 stalk, L7/L12
![Page 31: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/31.jpg)
16
stalk, and the central protuberance (CP), which are identified as larger than their bacterial
counterparts (11). The CP region has MRPL18 which is homologous to RPL18 in
bacteria while this region misses other proteins homologous to RPL5 and RPL25 (57).
The L1 stalk proteins such as MRPL1, MRPL9, and MRPL28, have a higher molecular
mass than their corresponding partners in the bacterial ribosome. This might be a
compensation mechanism for the truncated 16S rRNA helices in mitochondrial ribosome
(58). The other functionally important region is the peptide exit tunnel which is
surrounded by MRPL22, MRPL23, and MRPL24. This region does not have a homolog
of RPL29 which is present in bacterial ribosomes. The functional role of the RPL29
might be replaced by other interacting proteins (11,59). The most important and relevant
functional region on the ribosome is the L7/L12 stalk, which is formed by RPL10,
RPL11, and multiple copies of RPL7/L12 dimers in bacteria. RPL7 is the N-terminally
acetylated form of RPL12. Since N-terminal acetylation of mitochondrial protein L12 is
not reported yet, MRPL12 designates the mitochondrial counterpart of L7/L12. In
mitochondria, the evolutionary conserved L7/L12 stalk of the large subunit is composed
of MRPL10, MRPL11, and MRPL12 (Fig. 1.5). The members of this stalk are all
essential and play significant roles during different stages of protein synthesis by
interacting with several different translation factors, IF2, EF-Tu, EF-G, and RF3
(39,60,61). The RPL7/L12 exists in different numbers of dimers on the ribosome. The
length of the L10 helix 8 is an important player in the determination of the total number
of RPL7/L12 dimers (62). In Escherichia coli, there are four copies of L7/L12 as two
dimers bound to the C-terminal domain of L10 (63). In addition, Thermotoga maritima
has six copies of RPL7/L12 forming three dimers localized on RPL10 which has
![Page 32: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/32.jpg)
17
additional amino acid residues at its helix 8 (64). However, there is no information
pertaining to the number of MRPL12 present on the mitochondrial ribosome. The
transient binding of MRPL12 to the ribosome makes it distinct from other ribosomal
proteins in terms of the regulation of ribosomal function. This flexible binding involves
only protein-protein interactions with MRPL10 without any rRNA interaction (65).
1.5.3 New Mitochondrial Ribosomal Proteins and Additional Functions
Mitochondria-specific ribosomal proteins present a new class of proteins which
do not have homologous counterparts in bacterial ribosome. These mitochondria-specific
ribosomal proteins are, MRPS29 (DAP3, death associated protein 3), MRPS30 (PDCD9,
programmed cell death protein 9), MRPL37, and MRPL41, all of which are known to be
involved in apoptosis (48,66-69). Furthermore, MRPL41 plays an important role in cell
cycle arrest by increasing the levels of p21 and p27 under serum starvation (66,70). On
the other hand, a member of peptidyl-tRNA hydrolase family protein, immature colon
carcinoma transcript-1 (ICT1), has been demonstrated to cleave the peptidyl-tRNA and
prevent them from stalling on mRNA lacking a stop codon in mitochondria (59).
In addition, several mitochondrial ribosomal proteins, such as MRPS23,
MRPL11, and MRPL28, were found to be expressed differentially in cervical cancer and
pancreatic tumor cells (71,72). Targeting MRPL28 and MRPL12 in this type of cells
leads to reduced mitochondrial activity but elevated glycolysis (73). Therefore, it is
plausible to suggest that the regulation of mitochondrial protein synthesis in addition to
![Page 33: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/33.jpg)
18
these newly acquired roles might be important in mitochondrial function and energy
production.
![Page 34: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/34.jpg)
19
Figure 1.5: Model representing the mitochondrial L7/L12 stalk.
The L7/L12 stalk comprises L10 (green) having a globular N-terminal domain
involved in binding to L11 (yellow) and providing C-terminal α-helix domain for the
binding of multiple copies of L7/L12 dimers (pink). The L7/L12 N-terminal domain
(NTD) interacting with L10 and the C-terminal domain (CTD) which binds to GTPases
are also labeled. Sarcin-ricin loop (SRL) of 23S rRNA provides the interaction sites for
translation factors. Protein Data Bank entries of 1MMS (T. maritima L11), 1RQU (E.
coli L7/L12 dimer), and 1S72 (Haloarcula marismortui 50S, where proteins and rRNA
are in aqua and gray, respectively) are used in this figure (61). Courtesy of Dr. Koc.
![Page 35: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/35.jpg)
20
1.6 Post-Translational Modifications of Proteins
Post-translational modifications (PTMs) are covalent, mostly reversible,
alterations to one or more amino acids of a protein target after its synthesis. These
modifications include acetylation, phosphorylation, methylation, glycosylation,
ubiquitination, nitrosylation, and proteolysis that determine activity state, localization,
turnover, and interactions with other cellular molecules such as proteins, nucleic acids,
lipids, and cofactors (74). Mass spectrometry-based methods provide highly sensitive
detection and mapping of PTMs using MS/MS spectra of peptides from in-gel or in–
solution digestion with proteases, most common being trypsin.
Acetylation at ε-amino group of lysine residues can be detected by its
characteristic mass shift of +42 Da from unmodified forms. Acetylation of lysine residue
blocks its cleavage by trypsin due to charge neutralization. Therefore, the acetylated
peptides are detected in late fractions during reverse-phase chromatography separation
and identified as identified as a longer peptide with a miss-cleavage. Protein
phosphorylation on serine, threonine, or tyrosine residues is similarly detected by 80 Da
increase in mass, which is diagnostic for the addition of HPO3. Site of phosphorylation
can be mapped using the mass shift in the corresponding fragment ion peak in tandem
mass spectrum of the phosphorylated peptide.
1.6.1 Lysine Acetyltransferases (KATs) and Deacetylases (KDACs)
Acetylation of proteins involves the transfer of acetyl group from acetyl-CoA to
the ε-amino group on target lysine, which results in the charge neutralization. It is one of
![Page 36: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/36.jpg)
21
the best characterized histone tail modifications regulated by histone acetyltransferases
(HATs) and histone deacetylases (HDACs) (75). Lysine acetylation on histones is
associated with transcription activation by opening of chromatin structure and
recruitment of bromodomain containing transcriptional factors, such as SWI/SNF and the
SAGA (76,77). There are three main HATs families: GNATs (general control non-
derepressible 5 (Gcn5)-related N-acetyltransferases), p300/CBP (adenoviral E1A-
associated protein of 300 kDa/CREB-binding protein), and MYST proteins. Members of
the GNAT family include HAT1 (histone acetyltransferase 1), Gcn5, PCAF, Elp3, Hat1,
Hpa2, and Nut1 (78). MYST proteins are founded by MOZ (monocytic leukemia zinc
finger protein), YBF2/SAS3, SAS2 (something about silencing 2), and Tip60 (HIV Tat-
interactive protein of 60 kDa). The members of the MYST family suggest a relation of
histone acetylation to leukemogenesis, gene silencing, and HIV biology (79,80). HATs
mostly form multisubunit complexes which are important in regulating acetyltransferase
activity by targeting them to specific chromosomal regions and in modulating the
substrate specificity of HATs. They are under a dynamic relationship with HDACs. There
are four classes of HDACs in humans; class I (HDAC1, -2, -3, and -8), class II (HDAC4,
-5, -6, -7, -9, and -10), class III (sirtuin [silent information regulator 2 (Sir2)-related
protein] SIRT1-7), class IV (HDAC11) (75,81). NAD+ requirement of sirtuins as the
cofactor makes them distinct from other HDACs, which share sequence homology and
are dependent on Zn2+ for deacetylase activity. They show variation in their cellular
localization (82). NuRD (nucleosome remodeling deacetylase complex), an HDAC1/2
complex, was demonstrated to be involved in cancer metastasis (83). HDAC3 complexes
were linked to histone demethylation and cell-cycle regulation (84). Hda6 (histone
![Page 37: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/37.jpg)
22
deacetylase 6), which was identified as a class I HDAC in Arabidopsis thaliana, was
implicated in heterochromatin formation by interacting with different chromatin
modifiers (85).
HATs and HDACs are broadly referred to as KATs (lysine acetyltransferases) and
KDACs (lysine deacetylases) after the identification of non-histone proteins as targets of
acetylation and deacetylation (86). P53, NF-κB (nuclear factor-κB), STAT3, tubulin, c-
Myc, HIF1α (hypoxia-inducible factor), HMG (high mobility group) proteins, and Ku70
are among these non-histone targets which are involved in many biological processes
such as cell proliferation, survival, and apoptosis (86-88). Acetylation of nonhistone
proteins has been demonstrated to modulate protein functions by altering their stability,
cellular localization, and interactions with nucleotide or other proteins (86).
The members of class III KDACs or sirtuins (SIRT1-7) are homologous to the
yeast Sir2 (silent information regulator 2). They deacetylate the target acetylated lysine
residues by consuming NAD+ as a cofactor and then they release NAM (nicotinamide)
and O-Acetyl-ADPR (O-acetyl-ADP-ribose). SIRT1, SIRT6, and SIRT7 are located in
nucleus, SIRT2 in the cytoplasm, and SIRT3, SIRT4, and SIRT5 are primarily
mitochondrial. SIRT1, SIRT3, and SIRT5 deacetylate the target proteins in an NAD+-
dependent manner; however, SIRT6 functions as an NAD+-dependent ADP-
ribosyltransferase. SIRT2 and SIRT4 have both NAD+-dependent deacetylase and ADP-
ribosyltransferase activity (89). The enzymatic activity of SIRT7 has not yet been
determined. Its involvement in the activation of RNA polymerase I transcription was
demonstrated (90). They control the metabolic response to oxidative stress by targeting a
variety of proteins in different cellular compartments. In mammalian cells, it was shown
![Page 38: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/38.jpg)
23
that calorie restriction activates SIRT1, which increases the life span of the cell by
reducing stress-induced apoptosis (91). SIRT1 deacetylates PGC1α and HIF1α to
modulate the balance between oxidative and glycolytic metabolism under low energy
status of the cell. Low glycolysis rate results in the activation of SIRT1 due to elevated
NAD+ levels and, therefore, deacetylation of PGC1α promotes the mitochondrial
biogenesis and oxidative metabolism (92). It also mediates the response to the oxidative
stress by deacetylating HSF (heat shock factor). Ku70, which is a DNA repair factor
induced by calorie restriction, is deacetylated by SIRT1 to promote cell survival (93).
SIRT2 deacetylates α-tubulin and perturbs cell motility by effecting microtubule
dynamics (94,95). SIRT6 is an ADP-ribosyltransferase which plays a role in the
regulation of genomic stability by functioning in base excision repair of single stranded
DNA breaks (96,97). SIRT6 along with SIRT1 inhibit the transcriptional activity of NF-
κB to protect pancreatic β cells from inflammatory response (98,99). Overall, the NAD+-
dependent reactions of sirtuins connect energy metabolism and cellular survival
pathways. The targets described above implicate them in a wide range of diverse cellular
processes; such as glucose homeostasis, cellular growth, and stress resistance.
1.6.2 Mitochondrial Acetyltransferases and Sirtuins
In recent years, a tremendous amount of work has been reported about the role of
acetylation modifying the ε-amino group of lysine residues of proteins in regulation of
energy metabolism (100-106). Almost ~30 % of mitochondrial proteins have been
identified as acetylated by high-throughput proteomic approaches (87,107). Majority of
![Page 39: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/39.jpg)
24
post-translationally modified proteins are involved in mitochondrial metabolic pathways,
including oxidative phosphorylation, fatty acid oxidation, and the urea cycle
(100,103,108-110).
In a recent report, GCN5L1 has been identified as a component of the
mitochondrial acetyltransferase system. It was demonstrated to acetylate respiratory chain
subunits and inhibit their enzymatic activities (Fig. 1.6) (111). On the other hand, three
members of class III histone deacetylases, SIRT3, SIRT4 and SIRT5, have been localized
into mitochondria (102,103,112,113). Their activity depends on the availability of NAD+
which is a cosubstrate in the deacetylation and ADP-ribosylation of target proteins (114).
This reaction generates nicotinamide (NAM) and 2`-O-Acetyl-ADP-ribose resulting in
deacetylated lysine residues.
Acetyl-CoA synthetase 2 (AceCS2) is one of the first substrates identified for
SIRT3 in mitochondria. It is activated by SIRT3 deacetylation to enhance acetyl-coA
production (109,115,116). Respiratory chain complexes in mitochondria were found to be
regulated by reversible acetylation (Fig. 1.6). Acetylation of the NDUFA9 subunit of
Complex I inhibits its activity and SIRT3 reverses this inhibition by deacetylation. We
also discovered that Complex II activity is regulated in a similar manner by reversible
acetylation of succinate dehydrogenase flavoprotein subunit, SdhA (see Chapter 3) (100).
SIRT3 knock-out mice displays no obvious phenotypes except lower basal ATP levels
(107,108). Overexpression of SIRT3 in brown adipocytes elevates the consumption of
oxygen, which indicates the increased activity of oxidative phosphorylation, and results
in reduced ROS production in these cells (117). Overall, these findings demonstrate the
important role of SIRT3 in direct regulation of oxidative phosphorylation and
![Page 40: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/40.jpg)
25
maintenance of basal ATP levels (100,108). In beta cell mitochondria, SIRT4 is involved
in repressing the activity of glutamate dehydrogenase by ADP-ribosylation and therefore
reducing the insulin secretion in response to amino acids (113). In addition, SIRT5
deacetylates carbamoyl phosphate synthetase 1 (CPS1) which leads to activation of
enzymatic function in ammonia detoxification and disposal during the urea cycle. This
highlights the importance of regulation of the urea cycle during sirtuin-mediated
mitochondrial adaptation under conditions of energy limitation (Fig. 1.6) (103).
Mitochondrial sirtuins appear to work together to regulate the mitochondrial adaptation;
SIRT3 and SIRT4 may stimulate production of ammonia and SIRT5 activates the urea
cycle to process this ammonia (118). In addition, energy production from fat might be
involved in reduction of ROS generation since electrons are translocated to the
respiratory chain Complex II by FADH2. In this way, overall ROS generation per se
might be decreased since one of the ROS sources, the Complex I, is bypassed (119). In
conclusion, mitochondrial sirtuins mediate the metabolic adaptation to funnel fuel
sources, fatty acids and aminoacids, to be used as energy sources during energy
limitation.
![Page 41: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/41.jpg)
26
Figure 1.6: Substrates and biological functions of sirtuins and mitochondrial
acetyltransferase(s).
SIRT1, SIRT6, and SIRT7 reside in nucleus. SIRT1 deactylates PGC1α (PPAR
gamma coactivator 1-alpha) and HIF1α (hypoxia-inducible factor 1-alpha) to modulate the
balance between oxidative and glycolytic metabolism under low energy status of the cell. It
also targets HSF (heat shock factor) and Ku70 (DNA repair factor) to mediate the oxidative
stress and DNA damage response, respectively. SIRT1 along with SIRT6 inhibit the NF-κB
activity to regulate inflammatory response. SIRT7 was demonstrated to be a positive
regulator of RNA polymerase I transcription. SIRT2 functions as α-tubulin deacetylase in
the cytoplasm.
![Page 42: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/42.jpg)
27
SIRT3, SIRT4, and SIRT5 are localized in mitochondria. SIRT3 targets
respiratory chain Complexes I (NDUFA9) and II (SdhA) and activates oxidative
phosphorylation. Recently identified mitochondrial acetyltransferase, GCN5L1, reverses
the effects of SIRT3 on Complexes I and II. In addition, SIRT3 deacetylates MRPL10 in
the ribosome and down regulates protein synthesis. SIRT4 ADP-ribosylates glutamate
dehydrogenase (GDH) and controls insulin secretion in pancreatic β-cells. Carbamoyl
phosphate synthetase (CPS1), which catalyzes the first and rate limiting step of the urea
cycle, is activated by SIRT5.
![Page 43: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/43.jpg)
28
1.6.3 Post-Translational Modifications of Mitochondrial Ribosomal Proteins
Large scale mass spectrometry based analyses of post-translational modifications
(PTMs), especially phosphorylation and acetylation of ribosomal proteins have led to the
discovery of regulation of ribosomal activity by these modifications (120-125).
Mitochondrial ribosomes are responsible for the synthesis of thirteen essential subunits of
respiratory chain complexes that oxidize acetyl-CoA and NADH to generate ATP for
cellular needs. In order to maintain mitochondrial and cellular energy homeostasis, these
metabolites in addition to NAD+ might be important for the modulatory enzymes to sense
the energy and redox state of the mitochondria and cell. These modulators are the
kinases, acetyl transferases, and deacetylases/ADP-ribosyl transferases located in
mitochondria (105,111,122,125,126).
PTMs of ribosomal proteins might lead to conformational changes resulting in
protein-protein and protein-RNA reorganization (126-128). These modified ribosomal
proteins are mostly found in functionally important parts of the ribosome, L7/L12 stalk,
sarcin-ricin loop, and peptide exit tunnel, peptidyl transferase center, which are highly
conserved between bacterial and mitochondrial ribosomes as described earlier. MRPS7,
MRPS11, and variants of MRPS18 were found to be phosphorylated at residues
important for mRNA-binding during the initiation phase of protein synthesis (121).
MRPS16 is another phosphorylated protein involved in subunit association, and has been
found to be lethal when it has a mutation causing immature synthesis (121,129). MRPL2
and MRPL27 are positioned in the region forming the peptidyl transferase center and
their phosphorylation is implicated in regulation of mitochondrial protein synthesis
![Page 44: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/44.jpg)
29
(121,128). Moreover, MRPS29, which is a mitochondria-specific ribosomal protein and
has a role in apoptosis, has been studied in detail for its phosphorylated residues and how
these residues regulate its function in mitochondrial protein synthesis and apoptosis
(120). The sarcin-ricin loop region is involved in promoting GTPase activity of
translation factors along with the ribosomal L7/L12 stalk proteins. Some of the proteins
in this region, MRPL3, MRPL13, and MRPL19, have been identified as phosphorylated
as well. The other member of this stalk, MRPL10 is acetylated which is involved in the
regulation of protein synthesis (see Chapter 2) (124).
The mitochondrial translation machinery and ribosomal proteins are recognized as
essential components of mitochondrial dysfunction in apoptosis and cancer due to their
roles in mitochondrial energy homeostasis. Defects in MRPS16 and MRPS22 have been
associated with severe respiratory dysfunction because of deficiency in oxidative
complexes. (129,130). Furthermore, aberrant expression of certain ribosomal proteins,
MRPS23, MRPL11, MRPS29, and MRPS30 are implicated in several tumors, cervical
and breast cancer (71,72,131,132).
1.7 Research Aims
As described in the previous sections, mitochondrial ribosomes are responsible
for the synthesis of essential proteins involved in energy generation. The regulation of
mitochondrial translation by PTMs of ribosomal proteins would also be involved in
mitochondrial function/dysfunction. To test this hypothesis, the role of ribosomal protein
phosphorylation and acetylation in the regulation of mitochondrial translation and
![Page 45: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/45.jpg)
30
apoptosis has been investigated (120,133,134). Phosphorylation of mitochondrial
ribosomal proteins was demonstrated to be critical for induction of apoptosis and
regulation of translation (133). Steady-state levels of phosphorylation and acetylation of
mitochondrial ribosomal proteins were identified using mass spectrometry-based
proteomics (133,134). We applied capillary liquid chromatography - nanoelectrospray
ionization - tandem mass spectrometry (capLC-MS/MS) based proteomics to identify
acetylated mitochondrial ribosomal proteins involved in translation.
By performing two-dimensional gel electrophoresis followed with mass
spectrometry analyses of mitochondrial ribosomal proteins, we identified MRPL10 as the
major acetylated protein and mapped the acetylated lysine residues which might induce
conformational changes to the protein and might affect its interaction with other
ribosomal proteins. MRPL10 is a member of one of the highly conserved functional sites
in the mitochondrial ribosome, L7/L12 stalk. This stalk is composed of MRPL10,
MRPL11, and multiple dimers of MRPL12. It is essential for protein synthesis in all
organisms due to interactions with elongation and initiation factors during various stages
of translation. In bacteria, acetylation of L12 was demonstrated to stabilize the interaction
between stalk proteins due to increased hydrophobicity by acetylation (135). The
acetylated lysine residues of MRPL10 are located near the pivotal point of the L10 where
it interacts with MRPL12 dimers in the crystal structure model of the stalk (Fig. 5.1). In
addition, in our preliminary analyses of SIRT3 knock-out mice, we detected changes in
the MRPL12 amounts compared to other ribosomal proteins. Based on the evidence
above, we hypothesize that reversible acetylation of MRPL10 is important in the
modulation of MRPL12 binding to ribosomes and regulation of the mitochondrial protein
![Page 46: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/46.jpg)
31
synthesis. Next, the interaction of SIRT3 with the mitochondrial ribosome was revealed
by immunoblotting analyses of sucrose gradient fractions containing separated ribosomal
subunits. Since SIRT3 is involved in the modulation of mitochondrial functions in
response to energetically changing environment by monitoring the altered energy and
redox state, we investigated the effect of SIRT3 in MRPL10 acetylation and
mitochondrial translation. In SIRT3 knock-out mice, elevated acetylation of MRPL10
resulted in improved stability of MRPL12 binding to the L7/L12 stalk accompanied with
enhanced mitochondrial translation. On the other hand, HIB1B, a brown adipocyte tissue
cell line stably overexpressing SIRT3, displayed reduction in the acetylation status of
MRPL10 which resulted in destabilization of MRPL12 on the ribosome. Moreover, the
activities of Complex I and Complex IV and total ATP production were assayed in
SIRT3 overexpressing cells. Overall, we present a regulatory role of MRPL10 acetylation
modulating composition of the L7/L12 stalk and mitochondrial translation in response to
cellular energy needs monitored by SIRT3.
In our analysis of liver mitochondrial proteins from SIRT3 knock-out mice, we
detected acetylation of additional target proteins. The report about the regulation of
Complex I activity and oxidative phosphorylation by SIRT3 encouraged us to perform
more functional studies with SIRT3 knock-out mice liver mitochondria. We revealed the
flavoprotein (SdhA) subunit of Complex II, succinate dehydrogenase as an additional
substrate for SIRT3. Deacetylation of the SdhA subunit resulted in increased Complex II
activity in wild type mice. By employing mass spectrometry-based proteomics, we
mapped the acetylated residues which are possibly involved in the entry of substrate to
the active site of the enzyme in order to regulate its enzymatic activity. This study
![Page 47: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/47.jpg)
32
identifies SdhA as a novel substrate of the NAD+-dependent deacetylase, SIRT3,
involved in regulation of Complex II activity through reversible acetylation.
Mitochondrial ribosomes are more closely related to bacterial ribosomes than
eukaryotic cytosolic ribosomes, which supports the evolutionary perspective of
endosymbiosis theory. Most of the mammalian mitochondrial ribosomal proteins are
homologous to their bacterial counterparts in terms of their structure and function.
However, the amount of protein on the ribosome relative to ribosomal RNA is totally
reversed and mitochondrial ribosome acquired additional proteins. The improved
sensitivity of mass spectrometry-based proteomic tools and increased availability of
expressed sequence tags from different organisms in databases prompted us to reevaluate
the protein components of mitochondrial ribosomes. In Chapter 5, we report three
additional members of the mitochondrial ribosome; CHCHD1, AURKAIP1, and CRIF1,
and their functional implication on mitochondrial protein synthesis by employing siRNA
mediated knockdown in cell lines.
1.8 References
1. Altmann, R. (1894) Die Elementarorganismen und ihre Beziehungen zu den Zellen (The Elementary Organisms and Their Relationships to the Cells). Zweite vermehrte Auflage (Second Extended) Ed., Verlag Von Veit & Comp., Leipzig.
2. Gnaiger, E. (2005) Mitochondr Physiol Network 10(9), 1-152 3. Finley, L. W., Haas, W., Desquiret-Dumas, V., Wallace, D. C., Procaccio, V.,
Gygi, S. P., and Haigis, M. C. (2011) PLoS One 6(8), e23295 4. Lombard, D. B., Tishkoff, D. X., and Bao, J. (2011) Handb Exp Pharmacol 206,
163-188 5. Nedergaard, J., Ricquier, D., and Kozak, L. P. (2005) EMBO Rep 6(10), 917-921 6. Wallace, D. C. (2005) Annu Rev Genet 39, 359-407 7. Wood-Kaczmar, A., Gandhi, S., Yao, Z., Abramov, A. Y., Miljan, E. A., Keen,
G., Stanyer, L., Hargreaves, I., Klupsch, K., Deas, E., Downward, J., Mansfield,
![Page 48: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/48.jpg)
33
L., Jat, P., Taylor, J., Heales, S., Duchen, M. R., Latchman, D., Tabrizi, S. J., and Wood, N. W. (2008) PLoS One 3(6), e2455
8. Suomalainen, A. (2011) Semin Fetal Neonatal Med 16(4), 236-240 9. Anderson, S., de Bruijn, M. H., Coulson, A. R., Eperon, I. C., Sanger, F., and
Young, I. G. (1982) J Mol Biol 156(4), 683-717 10. Anderson, S., Bankier, A. T., Barrell, B. G., de Bruijn, M. H., Coulson, A. R.,
Drouin, J., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger, F., Schreier, P. H., Smith, A. J., Staden, R., and Young, I. G. (1981) Nature 290(5806), 457-465
11. Sharma, M. R., Koc, E. C., Datta, P. P., Booth, T. M., Spremulli, L. L., and Agrawal, R. K. (2003) Cell 115(1), 97-108
12. Bonawitz, N. D., Clayton, D. A., and Shadel, G. S. (2006) Mol Cell 24(6), 813-825
13. Tomecki, R., Dmochowska, A., Gewartowski, K., Dziembowski, A., and Stepien, P. P. (2004) Nucleic Acids Res 32(20), 6001-6014
14. Jacob, S. T., and Schindler, D. G. (1972) Biochem Biophys Res Commun 48(1), 126-134
15. Wallace, D. (1992) Annu Rev Biochem 61, 1175-1212 16. Brandon, M., Baldi, P., and Wallace, D. C. (2006) Oncogene 25(34), 4647-4662 17. Perez-Martinez, X., Funes, S., Camacho-Villasana, Y., Marjavaara, S., Tavares-
Carreon, F., and Shingu-Vazquez, M. (2008) Curr Top Med Chem 8(15), 1335-1350
18. Hirst, J. (2005) Biochem Soc Trans 33(Pt 3), 525-529 19. Cecchini, G. (2003) Annu Rev Biochem 72, 77-109 20. Berry, E. A., Guergova-Kuras, M., Huang, L. S., and Crofts, A. R. (2000) Annu
Rev Biochem 69, 1005-1075 21. Calhoun, M. W., Thomas, J. W., and Gennis, R. B. (1994) Trends Biochem Sci
19(8), 325-330 22. Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H.,
Shinzawa-Itoh, K., Nakashima, R., Yaono, R., and Yoshikawa, S. (1996) Science 272(5265), 1136-1144
23. Boyer, P. D. (1997) Annu Rev Biochem 66, 717-749 24. Murphy, M. P. (2009) Biochem J 417(1), 1-13 25. Muller, F. L., Liu, Y., and Van Remmen, H. (2004) J Biol Chem 279(47), 49064-
49073 26. Wallace, D. C., Singh, G., Lott, M. T., Hodge, J. A., Schurr, T. G., Lezza, A. M.,
Elsas, L. J., 2nd, and Nikoskelainen, E. K. (1988) Science 242(4884), 1427-1430 27. Tatuch, Y., Christodoulou, J., Feigenbaum, A., Clarke, J. T., Wherret, J., Smith,
C., Rudd, N., Petrova-Benedict, R., and Robinson, B. H. (1992) Am J Hum Genet 50(4), 852-858
28. Tatuch, Y., Pagon, R. A., Vlcek, B., Roberts, R., Korson, M., and Robinson, B. H. (1994) Eur J Hum Genet 2(1), 35-43
29. Eberly, S. L., Locklear, V., and Spremulli, L. L. (1985) J Biol Chem 260(15), 8721-8725
30. Spencer, A. C., and Spremulli, L. L. (2004) Nucleic Acids Res 32(18), 5464-5470 31. Koc, E. C., and Spremulli, L. L. (2002) J Biol Chem 277(38), 35541-35549
![Page 49: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/49.jpg)
34
32. Liao, H. X., and Spremulli, L. L. (1990) J Biol Chem 265(23), 13618-13622 33. Liao, H. X., and Spremulli, L. L. (1991) J Biol Chem 266(31), 20714-20719 34. Christian, B. E., and Spremulli, L. L. (2011) Biochim Biophys Acta
http://dx.doi.org/10.1016/j.bbagrm.2011.11.009 35. Schmeing, T. M., Voorhees, R. M., Kelley, A. C., Gao, Y. G., Murphy, F. V. t.,
Weir, J. R., and Ramakrishnan, V. (2009) Science 326(5953), 688-694 36. Gao, Y. G., Selmer, M., Dunham, C. M., Weixlbaumer, A., Kelley, A. C., and
Ramakrishnan, V. (2009) Science 326(5953), 694-699 37. Noller, H. F., Yusupov, M. M., Yusupova, G. Z., Baucom, A., and Cate, J. H.
(2002) FEBS Lett 514(1), 11-16 38. Agrawal, R. K., Linde, J., Sengupta, J., Nierhaus, K. H., and Frank, J. (2001) J
Mol Biol 311(4), 777-787 39. Helgstrand, M., Mandava, C. S., Mulder, F. A., Liljas, A., Sanyal, S., and Akke,
M. (2007) J Mol Biol 365(2), 468-479 40. Soleimanpour-Lichaei, H. R., Kuhl, I., Gaisne, M., Passos, J. F., Wydro, M.,
Rorbach, J., Temperley, R., Bonnefoy, N., Tate, W., Lightowlers, R., and Chrzanowska-Lightowlers, Z. (2007) Mol Cell 27(5), 745-757
41. Sprinzl, M., Brock, S., Huang, Y., Milovnik, P., Nanninga, M., Nesper-Brock, M., Rutthard, H., and Szkaradkiewicz, K. (2000) Biol Chem 381(5-6), 367-375
42. Rodnina, M. V., Stark, H., Savelsbergh, A., Wieden, H. J., Mohr, D., Matassova, N. B., Peske, F., Daviter, T., Gualerzi, C. O., and Wintermeyer, W. (2000) Biol Chem 381(5-6), 377-387
43. O'Brien, T. W., Denslow, N. D., Faunce, W., Anders, J., Liu, J., and O'Brien, B. (1993) Structure and function of mammalian mitochondrial ribosomes. In: Nierhaus, K., Franceschi, F., Subramanian, A., Erdmann, V., and Wittmann-Liebold, B. (eds). The translational apparatus: Structure, function regulation and evolution., Plenum Press, New York
44. Koc, E. C., Haque, M. E., and Spremulli, L. L. (2010) Israel Journal of Chemistry 50(1), 45-59
45. Koc, E. C., Ranasinghe, A., Burkhart, W., Blackburn, K., Koc, H., Moseley, A., and L.L., S. (2001) FEBS Lett. 492, 166-170
46. Koc, E. C., Burkhart, W., Blackburn, K., Schlatzer, D. M., Moseley, A., and Spremulli, L. L. (2001) JBC 276, 43958-43969
47. Koc, E. C., Burkhart, W., Blackburn, K., Moseley, A., Koc, H., and Spremulli, L. L. (2000) J Biol Chem 275(42), 32585-32591
48. Cavdar Koc, E., Ranasinghe, A., Burkhart, W., Blackburn, K., Koc, H., Moseley, A., and Spremulli, L. L. (2001) FEBS Lett 492(1-2), 166-170
49. Koc, E. C., Burkhart, W., Blackburn, K., Koc, H., Moseley, A., and Spremulli, L. L. (2001) Protein Sci 10(3), 471-481
50. Koc, E. C., Burkhart, W., Blackburn, K., Moseley, A., and Spremulli, L. L. (2001) J.Biol.Chem. 276, 19363-19374
51. Noller, H. F., Yusupov, M. M., Yusupova, G. Z., Baucom, A., Lieberman, K., Lancaster, L., Dallas, A., Fredrick, K., Earnest, T. N., and Cate, J. H. (2001) Cold Spring Harb Symp Quant Biol 66, 57-66
![Page 50: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/50.jpg)
35
52. Yusupova, G. Z., Yusupov, M. M., Cate, J. H., and Noller, H. F. (2001) Cell 106(2), 233-241
53. Yusupov, M. M., Yusupova, G. Z., Baucom, A., Lieberman, K., Earnest, T. N., Cate, J. H., and Noller, H. F. (2001) Science 292(5518), 883-896
54. Lancaster, L., Culver, G. M., Yusupova, G. Z., Cate, J. H., Yusupov, M. M., and Noller, H. F. (2000) RNA 6(5), 717-729
55. Culver, G. M., Cate, J. H., Yusupova, G. Z., Yusupov, M. M., and Noller, H. F. (1999) Science 285(5436), 2133-2136
56. Cate, J. H., Yusupov, M. M., Yusupova, G. Z., Earnest, T. N., and Noller, H. F. (1999) Science 285(5436), 2095-2104
57. Koc, E. C., Burkhart, W., Blackburn, K., Moyer, M. B., Schlatzer, D. M., Moseley, A., and Spremulli, L. L. (2001) J Biol Chem 276(47), 43958-43969
58. Haque, M. E., Elmore, K. B., Tripathy, A., Koc, H., Koc, E. C., and Spremulli, L. L. (2010) J Biol Chem 285(36), 28353-28362
59. Richter, R., Rorbach, J., Pajak, A., Smith, P. M., Wessels, H. J., Huynen, M. A., Smeitink, J. A., Lightowlers, R. N., and Chrzanowska-Lightowlers, Z. M. (2010) EMBO J 29(6), 1116-1125
60. Savelsbergh, A., Mohr, D., Kothe, U., Wintermeyer, W., and Rodnina, M. V. (2005) EMBO J 24(24), 4316-4323
61. Diaconu, M., Kothe, U., Schlunzen, F., Fischer, N., Harms, J. M., Tonevitsky, A. G., Stark, H., Rodnina, M. V., and Wahl, M. C. (2005) Cell 121(7), 991-1004
62. Grebenyuk, E. S., Dokrunova, A. A., Davydov Ia, I., Tonevitsky, E. A., and Tonevitsky, A. G. (2009) Bull Exp Biol Med 147(5), 587-591
63. Iben, J. R., and Draper, D. E. (2008) Biochemistry 47(9), 2721-2731 64. Ilag, L. L., Videler, H., McKay, A. R., Sobott, F., Fucini, P., Nierhaus, K. H., and
Robinson, C. V. (2005) Proc Natl Acad Sci U S A 102(23), 8192-8197 65. Griaznova, O., and Traut, R. R. (2000) Biochemistry 39(14), 4075-4081 66. Yoo, Y. A., Kim, M. J., Park, J. K., Chung, Y. M., Lee, J. H., Chi, S. G., Kim, J.
S., and Yoo, Y. D. (2005) Mol Cell Biol 25(15), 6603-6616 67. Kissil, J. L., Deiss, L. P., Bayewitch, M., Raveh, T., Khaspekov, G., and Kimchi,
A. (1995) J Biol Chem 270(46), 27932-27936 68. Miyazaki, T., Shen, M., Fujikura, D., Tosa, N., Kim, H. R., Kon, S., Uede, T., and
Reed, J. C. (2004) J Biol Chem 279(43), 44667-44672 69. Levshenkova, E. V., Ukraintsev, K. E., Orlova, V. V., Alibaeva, R. A., Kovriga, I.
E., Zhugdernamzhilyn, O., and Frolova, E. I. (2004) Bioorg Khim 30(5), 499-506 70. Kim, M. J., Yoo, Y. A., Kim, H. J., Kang, S., Kim, Y. G., Kim, J. S., and Yoo, Y.
D. (2005) Biochem Biophys Res Commun 338(2), 1179-1184 71. Lyng, H., Brovig, R. S., Svendsrud, D. H., Holm, R., Kaalhus, O., Knutstad, K.,
Oksefjell, H., Sundfor, K., Kristensen, G. B., and Stokke, T. (2006) BMC Genomics 7, 268
72. Robbins, P. F., el-Gamil, M., Li, Y. F., Topalian, S. L., Rivoltini, L., Sakaguchi, K., Appella, E., Kawakami, Y., and Rosenberg, S. A. (1995) J Immunol 154(11), 5944-5950
73. Chen, Y., Cairns, R., Papandreou, I., Koong, A., and Denko, N. C. (2009) PLoS One 4(9), e7033
![Page 51: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/51.jpg)
36
74. Mann, M., and Jensen, O. N. (2003) Nat Biotechnol 21(3), 255-261 75. Yang, X. J., and Seto, E. (2007) Oncogene 26(37), 5310-5318 76. Hassan, A. H., Prochasson, P., Neely, K. E., Galasinski, S. C., Chandy, M.,
Carrozza, M. J., and Workman, J. L. (2002) Cell 111(3), 369-379 77. Hassan, A. H., Neely, K. E., and Workman, J. L. (2001) Cell 104(6), 817-827 78. Kimura, A., Matsubara, K., and Horikoshi, M. (2005) J Biochem 138(6), 647-662 79. Sterner, D. E., and Berger, S. L. (2000) Microbiol Mol Biol Rev 64(2), 435-459 80. Lee, K. K., and Workman, J. L. (2007) Nat Rev Mol Cell Biol 8(4), 284-295 81. Blander, G., and Guarente, L. (2004) Annu Rev Biochem 73, 417-435 82. Shakespear, M. R., Halili, M. A., Irvine, K. M., Fairlie, D. P., and Sweet, M. J.
(2011) Trends Immunol 32(7), 335-343 83. Denslow, S. A., and Wade, P. A. (2007) Oncogene 26(37), 5433-5438 84. Karagianni, P., and Wong, J. (2007) Oncogene 26(37), 5439-5449 85. Aufsatz, W., Stoiber, T., Rakic, B., and Naumann, K. (2007) Oncogene 26(37),
5477-5488 86. Glozak, M. A., Sengupta, N., Zhang, X., and Seto, E. (2005) Gene 363, 15-23 87. Kim, S. C., Sprung, R., Chen, Y., Xu, Y., Ball, H., Pei, J., Cheng, T., Kho, Y.,
Xiao, H., Xiao, L., Grishin, N. V., White, M., Yang, X. J., and Zhao, Y. (2006) Mol Cell 23(4), 607-618
88. Choudhary, C., Kumar, C., Gnad, F., Nielsen, M. L., Rehman, M., Walther, T. C., Olsen, J. V., and Mann, M. (2009) Science 325(5942), 834-840
89. Westphal, C. H., Dipp, M. A., and Guarente, L. (2007) Trends Biochem Sci 32(12), 555-560
90. Ford, E., Voit, R., Liszt, G., Magin, C., Grummt, I., and Guarente, L. (2006) Genes Dev 20(9), 1075-1080
91. Cohen, H. Y., Miller, C., Bitterman, K. J., Wall, N. R., Hekking, B., Kessler, B., Howitz, K. T., Gorospe, M., de Cabo, R., and Sinclair, D. A. (2004) Science 305(5682), 390-392
92. Rodgers, J. T., Lerin, C., Haas, W., Gygi, S. P., Spiegelman, B. M., and Puigserver, P. (2005) Nature 434(7029), 113-118
93. Jeong, J., Juhn, K., Lee, H., Kim, S. H., Min, B. H., Lee, K. M., Cho, M. H., Park, G. H., and Lee, K. H. (2007) Exp Mol Med 39(1), 8-13
94. North, B. J., and Verdin, E. (2007) J Biol Chem 282(27), 19546-19555 95. North, B. J., Marshall, B. L., Borra, M. T., Denu, J. M., and Verdin, E. (2003)
Mol Cell 11(2), 437-444 96. Lombard, D. B., Schwer, B., Alt, F. W., and Mostoslavsky, R. (2008) J Intern
Med 263(2), 128-141 97. Mostoslavsky, R., Chua, K. F., Lombard, D. B., Pang, W. W., Fischer, M. R.,
Gellon, L., Liu, P., Mostoslavsky, G., Franco, S., Murphy, M. M., Mills, K. D., Patel, P., Hsu, J. T., Hong, A. L., Ford, E., Cheng, H. L., Kennedy, C., Nunez, N., Bronson, R., Frendewey, D., Auerbach, W., Valenzuela, D., Karow, M., Hottiger, M. O., Hursting, S., Barrett, J. C., Guarente, L., Mulligan, R., Demple, B., Yancopoulos, G. D., and Alt, F. W. (2006) Cell 124(2), 315-329
![Page 52: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/52.jpg)
37
98. Kawahara, T. L., Michishita, E., Adler, A. S., Damian, M., Berber, E., Lin, M., McCord, R. A., Ongaigui, K. C., Boxer, L. D., Chang, H. Y., and Chua, K. F. (2009) Cell 136(1), 62-74
99. Lee, J. H., Song, M. Y., Song, E. K., Kim, E. K., Moon, W. S., Han, M. K., Park, J. W., Kwon, K. B., and Park, B. H. (2009) Diabetes 58(2), 344-351
100. Cimen, H., Han, M. J., Yang, Y., Tong, Q., Koc, H., and Koc, E. C. (2010) Biochemistry 49(2), 304-311
101. Wallace, D. C., and Fan, W. Mitochondrion 10(1), 12-31 102. Huang, J. Y., Hirschey, M. D., Shimazu, T., Ho, L., and Verdin, E. (2010)
Biochim Biophys Acta 1804(8), 1645-1651 103. Nakagawa, T., Lomb, D. J., Haigis, M. C., and Guarente, L. (2009) Cell 137(3),
560-570 104. Imai, S. (2009) Curr Opin Clin Nutr Metab Care 12(4), 350-356 105. Hirschey, M. D., Shimazu, T., Huang, J. Y., and Verdin, E. (2009) Methods
Enzymol 457, 137-147 106. Sundaresan, N. R., Samant, S. A., Pillai, V. B., Rajamohan, S. B., and Gupta, M.
P. (2008) Mol Cell Biol 28(20), 6384-6401 107. Lombard, D. B., Alt, F. W., Cheng, H. L., Bunkenborg, J., Streeper, R. S.,
Mostoslavsky, R., Kim, J., Yancopoulos, G., Valenzuela, D., Murphy, A., Yang, Y., Chen, Y., Hirschey, M. D., Bronson, R. T., Haigis, M., Guarente, L. P., Farese, R. V., Jr., Weissman, S., Verdin, E., and Schwer, B. (2007) Mol Cell Biol 24, 8807-8814
108. Ahn, B. H., Kim, H. S., Song, S., Lee, I. H., Liu, J., Vassilopoulos, A., Deng, C. X., and Finkel, T. (2008) Proc Natl Acad Sci U S A 105(38), 14447-14452
109. Schwer, B., Bunkenborg, J., Verdin, R. O., Andersen, J. S., and Verdin, E. (2006) Proc Natl Acad Sci U S A 103(27), 10224-10229
110. Gerhart-Hines, Z., Rodgers, J. T., Bare, O., Lerin, C., Kim, S. H., Mostoslavsky, R., Alt, F. W., Wu, Z., and Puigserver, P. (2007) EMBO J 26(7), 1913-1923
111. Scott, I., Webster, B. R., Li, J. H., and Sack, M. N. (2012) Biochem J 443(3), 655-661
112. Onyango, P., Celic, I., McCaffery, J. M., Boeke, J. D., and Feinberg, A. P. (2002) Proc Natl Acad Sci U S A 99(21), 13653-13658
113. Haigis, M. C., Mostoslavsky, R., Haigis, K. M., Fahie, K., Christodoulou, D. C., Murphy, A. J., Valenzuela, D. M., Yancopoulos, G. D., Karow, M., Blander, G., Wolberger, C., Prolla, T. A., Weindruch, R., Alt, F. W., and Guarente, L. (2006) Cell 126(5), 941-954
114. Verdin, E., Hirschey, M. D., Finley, L. W., and Haigis, M. C. (2010) Trends Biochem Sci 35(12), 669-675
115. North, B. J., and Sinclair, D. A. (2007) Trends Biochem Sci 32(1), 1-4 116. Hallows, W. C., Lee, S., and Denu, J. M. (2006) Proc Natl Acad Sci U S A
103(27), 10230-10235 117. Shi, T., Wang, F., Stieren, E., and Tong, Q. (2005) J Biol Chem 280(14), 13560-
13567 118. Haigis, M. C., and Sinclair, D. A. (2010) Annu Rev Pathol 5, 253-295 119. Guarente, L. (2008) Cell 132(2), 171-176
![Page 53: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/53.jpg)
38
120. Miller, J. L., Koc, H., and Koc, E. C. (2008) Protein Sci 17(2), 251-260 121. Soung, G. Y., Miller, J. L., Koc, H., and Koc, E. C. (2009) J Proteome Res 8(7),
3390-3402 122. Zhao, S., Xu, W., Jiang, W., Yu, W., Lin, Y., Zhang, T., Yao, J., Zhou, L., Zeng,
Y., Li, H., Li, Y., Shi, J., An, W., Hancock, S. M., He, F., Qin, L., Chin, J., Yang, P., Chen, X., Lei, Q., Xiong, Y., and Guan, K. L. (2010) Science 327(5968), 1000-1004
123. Zhang, J., Sprung, R., Pei, J., Tan, X., Kim, S., Zhu, H., Liu, C. F., Grishin, N. V., and Zhao, Y. (2009) Mol Cell Proteomics 8(2), 215-225
124. Yang, Y., Cimen, H., Han, M. J., Shi, T., Deng, J. H., Koc, H., Palacios, O. M., Montier, L., Bai, Y., Tong, Q., and Koc, E. C. (2010) J Biol Chem 285(10), 7417-7429
125. Koc, E. C., and Koc, H. (2012) Biochim Biophys Acta 1819(9-10), 1055-1066 126. Macek, B., Gnad, F., Soufi, B., Kumar, C., Olsen, J. V., Mijakovic, I., and Mann,
M. (2008) Mol Cell Proteomics 7(2), 299-307 127. Traugh, J. A., and Traut, R. R. (1972) Biochemistry 11(13), 2503-2509 128. Mikulik, K., Suchan, P., and Bobek, J. (2001) Biochem Biophys Res Commun
289(2), 434-443 129. Miller, C., Saada, A., Shaul, N., Shabtai, N., Ben-Shalom, E., Shaag, A.,
Hershkovitz, E., and Elpeleg, O. (2004) Ann Neurol 56(5), 734-738 130. Saada, A., Shaag, A., Arnon, S., Dolfin, T., Miller, C., Fuchs-Telem, D., Lombes,
A., and Elpeleg, O. (2007) J Med Genet 44(12), 784-786 131. Mariani, L., Beaudry, C., McDonough, W. S., Hoelzinger, D. B., Kaczmarek, E.,
Ponce, F., Coons, S. W., Giese, A., Seiler, R. W., and Berens, M. E. (2001) Clin Cancer Res 7(8), 2480-2489
132. Stacey, S. N., Manolescu, A., Sulem, P., Thorlacius, S., Gudjonsson, S. A., Jonsson, G. F., Jakobsdottir, M., Bergthorsson, J. T., Gudmundsson, J., Aben, K. K., Strobbe, L. J., Swinkels, D. W., van Engelenburg, K. C., Henderson, B. E., Kolonel, L. N., Le Marchand, L., Millastre, E., Andres, R., Saez, B., Lambea, J., Godino, J., Polo, E., Tres, A., Picelli, S., Rantala, J., Margolin, S., Jonsson, T., Sigurdsson, H., Jonsdottir, T., Hrafnkelsson, J., Johannsson, J., Sveinsson, T., Myrdal, G., Grimsson, H. N., Sveinsdottir, S. G., Alexiusdottir, K., Saemundsdottir, J., Sigurdsson, A., Kostic, J., Gudmundsson, L., Kristjansson, K., Masson, G., Fackenthal, J. D., Adebamowo, C., Ogundiran, T., Olopade, O. I., Haiman, C. A., Lindblom, A., Mayordomo, J. I., Kiemeney, L. A., Gulcher, J. R., Rafnar, T., Thorsteinsdottir, U., Johannsson, O. T., Kong, A., and Stefansson, K. (2008) Nat Genet 40(6), 703-706
133. Miller, J. L., Cimen, H., Koc, H., and Koc, E. C. (2009) J Proteome Res 8(10), 4789-4798
134. Yang, Y., Cimen, H., Han, M. J., Shi, T., Deng, J. H., Koc, H., Palacios, O. M., Montier, L., Bai, Y., Tong, Q., and Koc, E. C. J Biol Chem 285(10), 7417-7429
135. Gordiyenko, Y., Deroo, S., Zhou, M., Videler, H., and Robinson, C. V. (2008) J Mol Biol 380(2), 404-414
![Page 54: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/54.jpg)
Chapter 2
Regulation of Mitochondrial Translation by SIRT3
This chapter of dissertation was reproduced in part with permission from Yongjie
Yang*, Huseyin Cimen*, Min-Joon Han*, Tong Shi, Jian-Hong Deng, Hasan Koc,
Orsolya M. Palacios, Laura Montier, Yidong Bai, Qiang Tong, and Emine C. Koc. (2010)
NAD+-dependent deacetylase SIRT3 regulates mitochondrial protein synthesis by
deacetylation of the ribosomal protein MRPL10. J. Biol. Chem.; 285 (10):7417-7429.
Copyright © 2010 by The American Society for Biochemistry and Molecular Biology,
Inc.
* These authors equally contributed to this work.
![Page 55: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/55.jpg)
40
2.1 Rationale
Protein lysine acetylation has been identified as a widespread post-translational
modification in almost 30 % of mitochondrial proteins and implicated to be involved in
regulatory mechanisms for energy metabolism, stress responses, and longevity (1-4).
Since most of ATP to be used for cellular energy is produced by oxidative
phosphorylation (OXPHOS) in mitochondria, it is essential to uncover the regulatory
mechanisms of its activity. Phosphorylation of mitochondrial ribosomes and
mitochondrial proteins is implicated in the regulation of protein synthesis and
mitochondrial function. However, there is still limited knowledge on the role of
acetylation in mitochondria. In this study, we identified mitochondrial ribosomal protein
L10 (MRPL10) as the major acetylated ribosomal protein and its NAD+-dependent
deacetylation by SIRT3 associated with the ribosome by employing mass spectrometry-
based proteomic tools and immunoblotting analyses. The acetylated lysine residues were
mapped by using tandem mass spectrometry and the importance of these residues in the
acetylation of MRPL10 was confirmed by site-directed mutagenesis studies. Moreover,
we have demonstrated the increased in vitro translational activity of bovine ribosomes
treated with nicotinamide (NAM), which is an inhibitor of SIRT3. In addition, the
mitochondrial ribosomes isolated from SIRT3 knock-out (Sirt3-/-) mice liver displayed
enhanced translational activity in our in vitro translation assays. To determine the
regulatory mechanism of mitochondrial ribosome acetylation, we analyzed the
mitochondrial ribosomes of SIRT3 knock-out mice and mouse brown adipocyte (HIB1B)
cells stably overexpressing SIRT3 for the changes in ribosomal proteins. The level of
![Page 56: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/56.jpg)
41
MRPL12 bound to ribosomes was found to be modulated by MRPL10 acetylation
compared to other ribosomal proteins. Therefore, we hypothesize regulation of MRPL12
binding to ribosomes by MRPL10 acetylation as a plausible mechanism to modulate
mitochondrial protein synthesis. In order to elucidate the role of acetylated lysine
residues mapped on MRPL10 in MRPL12 binding to the ribosome and translation, we
employed hybrid ribosomes constituted with bacterial ribosome without L7/L12 stalk and
mitochondrial stalk proteins, MRPL10 lysine mutants and MRPL12, in in vitro
translation activity assays. In addition, we compared the [35S]-methionine labeled
mitochondrial translation products from the cells transfected with MRPL10 lysine
mutants and their effect on cellular growth rates. Together, the data from these methods
serve as a framework for more directed future studies focusing on additional acetylated
lysine residues on MRPL10 which might be involved in MRPL12 binding to ribosomes.
Overall our findings suggest SIRT3-dependent reversible acetylation of MRPL10
might regulate the mitochondrial protein synthesis by modulating MRPL12 binding to the
ribosomes.
2.2 Introduction
OXPHOS provides over 90 % of the energy in the form of ATP to meet cellular
energy needs in mammalian mitochondria. Proteomic surveys of mitochondria acetylome
have revealed reversible acetylation of almost 30 % of the total mitochondrial proteome,
which are implicated in regulation of mitochondrial energy metabolism, signaling, and
apoptosis (1-6). Recently, it was discovered that GCN5L1 [GCN5(general control of
![Page 57: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/57.jpg)
42
amino acid synthesis 5)-like 1; also known as Bloc1s1], is one of the essential
components of the mitochondrial acetyltransferase system involved in acetylation of
electron transport chain proteins (7). Members of the class III histone deacetylases
(sirtuins), SIRT3, SIRT4, and SIRT5, have been found to reside in the mitochondria
(3,8,9). Sirtuins are homologs of yeast SIR2 (silent mating type information regulation 2)
and use NAD+ as a co-substrate, which suggests that they are nutrient sensitive
modulators regulating especially mitochondrial metabolic enzymes in response to the
[NADH]/[NAD+] ratio (10-12). Both SIRT3 and SIRT4 are required in an NAD+-
dependent manner for the maintenance of cell survival after genotoxic stress (13,14).
Genetic variations in the human Sirt3 gene have also been linked to longevity (13,14).
Also, SIRT3 expression in adipose tissue increases upon caloric restriction and cold
exposure (1,15). Mitochondrial acetyl-CoA synthetase 2 (ACS2) and glutamate
dehydrogenase (GDH) are the two key metabolic enzymes regulated by SIRT3 mediated
deacetylation (2,3,16).
Our previous findings about the importance of phosphorylation in mitochondrial
ribosomal proteins regulating mitochondrial protein synthesis served as a framework to
examine reversible acetylation of mitochondrial ribosomal proteins involved in regulation
of mitochondrial translation which is responsible for the synthesis of thirteen subunits
essential for the complexes in OXPHOS and for ATP production (17).
Mitochondria have their own genome encoding 2 rRNAs, 22 tRNAs, and 13
mRNAs that are utilized to synthesize essential subunits of the electron transport chain
complexes by its own translation machinery (18). The mitochondrial ribosome is similar
to the bacterial ribosome both structurally and functionally, but different in terms of
![Page 58: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/58.jpg)
43
having fewer rRNA and more proteins compared to the bacterial ribosome. The
mitochondrial ribosome (55S) is composed of a small subunit (28S) and a large subunit
(39S) containing 12S rRNA and 16S rRNA, respectively (19). Previously, our lab has
identified 77 mammalian mitochondrial ribosomal proteins, of which 29 are in the small
subunit and 48 are in the large subunit (20-24). Approximately half of these proteins have
homologs in bacterial ribosomes, while the remainders represent new classes of
ribosomal proteins (22,24). The functional core of the mitochondrial ribosome, which is
essential for proteins synthesis, is conserved according to cryo-EM reconstruction studies
(25). Notably, some mitochondrial ribosomal proteins have been mapped to regions
associated with disorders of mitochondrial energy metabolism (26). Changes in
expression levels and mutations in these ribosomal proteins affect mitochondrial protein
synthesis, cell growth, and apoptosis (27-31). Some of the ribosomal proteins with
bacterial homologs such as MRPS12, MRPS16, and MRPL12, have been shown to be
essential in mitochondrial protein synthesis (27,32-34). Particularly, the L7/L12 stalk
region, which consists of L10, L11, and multiple copies of L7/L12, is highly conserved
between species and is essential since it, along with the sarcin-ricin loop (SRL), forms the
GTPase active center that interacts with the translation initiation and elongation factors,
such as IF-2, EF-Tu, EF-G, and RF-3 (35-38). Previous studies also showed that when
L7/L12 was depleted, GTPase activation of both EF-Tu and EF-G was impaired (39).
Multiple L7/L12 dimers interact with L10 by protein-protein interactions. In Escherichia
coli and Bacillus subtilis, there are four copies of L7/L12 bound to the C-terminus of L10
as two dimers (40,41). On the other hand, in Thermotoga maritima and Thermus
thermophilus, six copies of L7/L12 as three dimers were found to associate with L10,
![Page 59: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/59.jpg)
44
which has additional residues at its C-terminus (42). However, the exact number of
MRPL12 needed to form the complete stalk in the mammalian mitochondria is not yet
known. In bacteria, it is known that post-translational modifications of L7/L12 by
phosphorylation and acetylation at the N-termini stabilize the interactions between L10
and L7/L12 (42,43). Moreover, changes in the L7/L12 content of ribosomes and L7/L12-
dependent translation activity in starvation and stationary phase of bacterial growth has
been reported (44-46). Similar to its bacterial homolog, the mitochondrial L7/L12
(MRPL12) is required for cell cycle progression and growth in Drosophila melanogaster
and accumulated during the G1-phase of growth stimulated cells (47-49). Changes in
mRNA expression levels and different isoforms of mitochondrial L7/L12 stalk proteins
were also reported to be critical for regulation of oxidative phosphorylation in cancer and
caloric restriction (50-52). In addition to its essential role in protein synthesis, free pools
of MRPL12 also couple mitochondrial translation to transcription by directly interacting
with the mitochondrial RNA polymerase to stimulate transcription in mitochondria
(32,53).
In this study, we provide evidence that mitochondrial protein synthesis is
regulated by reversible acetylation of MRPL10, and that its deacetylation by ribosome
associated SIRT3 in an NAD+-dependent manner modulates MRPL12 binding to
ribosome and thus the recruitment of translational factors during protein synthesis.
![Page 60: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/60.jpg)
45
2.3 Materials and Methods
2.3.1 Mitochondrial Ribosome Preparation and Reverse Phase – High Performance
Liquid Chromatography (RP-HPLC).
Preparation of mitochondrial ribosomes from bovine liver was adapted from
previously described methods (19, 21, 35, 36). To preserve the phosphorylation and
acetylation status of ribosomal proteins, phosphatase inhibitors (2 mM imizadole, 1 mM
Na3VO4, 1.15 mM Na2MoO4.2H2O, 1 mM NaF, 4 mM Na2C4H4O6.2H2O) and
deacetylase inhibitor (1 mM sodium butyrate) were added during the homogenization
process. Crude ribosomes prepared at 0.2, 0.4, and 1.6 % Triton X-100 concentrations
were loaded onto 10–30 % sucrose gradients and fractionated to isolate mitochondrial
55S ribosomes (16, 18, 34). To analyze rRNA dependent association of SIRT3 with
ribosomes, 20 A260 units of crude ribosome preparation obtained from bovine liver were
incubated in the absence and presence of RNase A and loaded onto another 10-30 %
linear sucrose gradient. After centrifugation, equal volumes of gradient fractions were
separated on 12 % SDS- polyacrylamide gels and immunoblotted with indicated
antibodies. Sirtuin inhibitor, 10 mM nicotinamide (NAM) was also used to treat pure
ribosomes to monitor acetylation changes and its effect on ribosomal activity in in vitro
translation assays with additional reaction with 10 µg/mL emetine as a cytoplasmic
translation inhibitor. For two-dimensional gel analysis, purified ribosomes were
sedimented by ultracentrifugation at 40,000 rpm for 5 h in a Beckman Type 40 rotor.
Acetone pellets of ribosome preparations (1.8 A260 units) were resuspended in two-
![Page 61: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/61.jpg)
46
dimensional lysis buffer consisting of 9.8 M urea, 2 % (w/v) Nonidet P-40, 2 %
ampholytes, pI 3–10 and 8–10, and 100 mM dithiothreitol (DTT). The samples were
loaded on non-equilibrium pH gradient electrophoresis tube gels and equilibrated in
buffer containing 60 mM Tris-HCl, pH 6.8, 2 % SDS, 100 mM DTT, and 10 % glycerol.
The 14 % second dimension gel was stained with Coomassie Blue, and the protein spots
corresponding to the acetylated ribosomal proteins were excised based on their locations
determined by immunoblotting analysis using anti-acetyl Lys antibody.
Approximately 5 A260 units of purified 55S ribosomes from bovine mitochondria
were incubated in 67 % glacial acetic acid for 16 h at 4oC to precipitate the rRNA. After
centrifuging at 18,000 g for 15 min, supernatant containing ribosomal proteins was
dialyzed in 6 % glacial acetic acid for 16 h at 4oC. HPLC analysis of ribosomal proteins
was conducted using a Shimadzu Model SCL-10Avp equipped with an SCL-10A diode
array detector (Shimadzu). The separation was performed on a 300 Å pore RP4 (5μm)
column (250 x 4.6 mm) (Eprogen Inc.). Solvent A was 0.1 % trifluoroacetic acid and
solvent B consisted of 0.1 % trifluoroacetic acid in acetonitrile. The gradient ranged from
5 % to 35 % B in 100 min, from 35 % to 55 % 100 min. The flow rate was 1.0 ml/min
and the column effluent was monitored at 215 nm.
2.3.2 Mass Spectrometric Analysis of Bovine Mitochondrial Ribosomal Proteins
In order to identify acetylated ribosomal proteins and the other ribosome-
associated proteins, in-gel and in-solution tryptic digestions were carried out using
ribosomes prepared at different Triton X-100 concentrations and analyzed by capillary
![Page 62: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/62.jpg)
47
liquid chromatography - nanoelectrospray ionization - tandem mass spectrometry
(capLC/MS/MS) (31,54,55). Tandem MS spectra obtained by fragmenting a peptide by
collision-induced dissociation (CID) were acquired using the capLC-MS/MS system that
consisted of a Surveyor HPLC pump, a Surveyor Micro AS autosampler, and an LTQ
linear ion trap mass spectrometer (ThermoFinnigan). The raw CID tandem MS spectra
were converted to Mascot generic files (.mgf) using the extract msn software
(ThermoFinnigan). Both, the .mgf and .raw files were submitted to site-licensed Mascot
(version 2.2) and Sequest search engines, respectively, to search against in-house
generated sequences of 55S proteins, all known human and bovine mitochondrial
proteins, and proteins in the Swiss-Prot database. The variable modifications were
methionine oxidation (+16 Da), acetylation of lysine residues (+42 Da) and
phosphorylation (+80 Da) of Ser, Thr, and Tyr residues. Up to 2 missed cleavages were
allowed for the protease of choice. Peptide mass tolerance and fragment mass tolerance
were set to 3 and 2 Da, respectively. Tandem MS spectra were manually evaluated at the
raw data level with the consideration of overall data quality, signal-to-noise of matched
peaks, and the presence of dominant peaks that did not match to any theoretical m/z
value.
2.3.3 In Vitro Deacetylation and Translation Assays
Deacetylation of ribosomal proteins was performed in the presence of NAD+ as a
substrate for the deacetylase using previously described methods (12,56). For this
reaction, 0.1 or 0.2 A260 units of sucrose gradient-purified or crude 55 S ribosomes,
![Page 63: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/63.jpg)
48
respectively, prepared in 0.2 % Triton X-100, were incubated with 3 mM NAD+ for 30
min at 37 °C in the presence and absence of 0.25 µg of recombinant mouse SIRT3.
Acetylated/deactylated ribosome samples were analyzed by immunoblotting using anti-
acetyl Lys antibody.
Poly(U)-directed in vitro translation assays were performed in 100 µl reactions
containing 50 mM Tris-HCl, pH 7.8, 1 mM DTT, 0.1 mM spermine, 40 mM KCl, 7.5
mM MgCl2, 2.5 mM phosphoenolpyruvate, 0.18 U pyruvate kinase, 0.5 mM GTP, 50 U
RNasin Plus, 12.5 µg/mL poly(U), 20 pmol [14C]-Phe-tRNA, 0.15 µM EF-Tumt, 1 µg EF-
Gmt, and varying amounts of mitochondrial ribosomes obtained from mitochondria. The
EF-Tumt and EF-Gmt were prepared from the recombinant proteins. The reaction mixtures
were incubated at 37°C for 15 min and terminated by the addition of cold 5 %
trichloroacetic acid followed by incubation at 90°C for 10 min. The in vitro translated
[14C] labeled-poly(Phe) was collected on nitrocellulose filter membranes and quantified
using a liquid scintillation counter.
2.3.4 Mouse Mitochondrial Ribosome Isolation
Mice in which the Sirt3 gene was targeted by gene trapping were obtained from
the Texas Institute for Genomic Medicine (Houston, TX) and liver tissues obtained from
Sirt3+/+, Sirt3+/-, and Sirt3-/- mice were kindly provided by Qiang Tong of Baylor College
of Medicine (57,58). The frozen liver tissues were resuspended in an isotonic
mitochondrial buffer (MB) (210 mM mannitol, 70 mM sucrose, 1 mM EDTA, 10 mM
HEPES-KOH, pH 7.5), supplemented with protease inhibitors (1 mM
![Page 64: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/64.jpg)
49
phenylmethylsulfonyl fluoride, 50 µg/ml leupeptin), and then homogenized in a Dounce
homogenizer on ice. The suspension was centrifuged at 400 g at 4 °C. This procedure was
repeated twice, and supernatants were centrifuged at 10,000 g at 4°C for 10 min to pellet
mitochondria. Mitochondria were lysed in a buffer containing 0.26 M sucrose, 20 mM
Tris-HCl, pH 7.6, 40 mM KCl, 20 mM MgCl2, 0.8 mM EDTA, 0.05 mM spermine, 0.05
mM spermidine, 6 mM β-mercaptoethanol, and 1.6 % Triton X-100, and the lysates were
loaded onto 34 % sucrose cushions and centrifuged at 100,000 g at 4°C for 16 h. The
crude ribosome pellets were resuspended in 20 mM Tris-HCl, pH 7.6, 40 mM KCl, 20
mM MgCl2 and 1 mM DTT.
2.3.5 Immunoblotting Assays
Protein samples for either one-dimensional or two-dimensional analysis were
loaded onto SDS-polyacrylamide gels and transferred to a polyvinylidene difluoride
(PVDF) membrane. The blot was probed with mouse monoclonal MRPS29 and HSP60
antibodies at 1:5000 dilution (BD-Transduction Laboratories), rabbit polyclonal MRPL10
antibodies against mouse and human at 1:3000 dilution and rabbit polyclonal human
MRPL41 and MRPL47 antibodies at 1:3000 (Covance), rabbit polyclonal anti-SIRT3
antiserum (against C-terminal domain of murine SIRT3) at 1:3000, mouse monoclonal
anti-FLAG M2-peroxidase at 1:3000 (Sigma-Aldrich), mouse monoclonal anti-acetyl Lys
antibody at 1:1000 (Cell Signaling Technology Inc.), and rabbit monoclonal His-tag
antibody at 1:5000 dilution (Rockland Immunochemicals). Oxidative phosphorylation
human antibody mixture (MitoProfile ® Total OXPHOS Antibody Cocktail,
![Page 65: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/65.jpg)
50
Mitosciences Inc.) was used at a 1:3000 dilution. The secondary antibody was
ImmunoPure antibody goat anti-mouse IgG (Pierce) at a 1:5000 dilution; goat antirabbit
IgG at a 1:1000 dilution; or Affinipure rabbit anti-mouse IgG, rabbit anti-goat IgG, or
goat anti-rabbit IgG (Jackson ImmunoResearch), all at a 1:10,000 dilution, followed by
development with the SuperSignal West Pico Chemiluminescent Substrate (Pierce)
according to the protocol provided by the manufacturer.
2.3.6 Plasmid Constructs
The human full-length MRPL10 coding sequence was amplified by reverse
transcription-PCR, using cDNA library of HeLa and the primer pair 5_-
AAACGGGGTACCATATGGGCTCCAAGGCTGTTACCCGC-3_ and 5_-
GCGGGTACCCTCGAGTTACTAATGGTGATGGTGATGATGCGAGTCCGGAACA
GTGTCAGG- 3_. For transient expression, the DNA fragments from MRPL10 was
digested with KpnI/XhoI, and then inserted into the pcDNA3.1-MycHis vector
(Invitrogen). MRPL10 mutants were created by site-directed mutagenesis (QuikChange_
II site-directed mutagenesis kits, Stratagene) at K124, K162, and K196. The primers for
K124A (AAG to GCG) forward (5_-cacaagatcctgatgGCggtcttccccaaccag) and reverse
(5_-ctggttggggaagaccGCcatcaggatcttgtg); K124Q (AAG to CAG) forward (5_-
cacaagatcctgatgCAggtcttccccaaccag) and reverse (5_-
ctggttggggaagaccTGcatcaggatcttgtg); K124R (AAG to AGG) forward (5_-
cacaagatcctgatgAGggtcttccccaaccag) and reverse (5_-
ctggttggggaagaccCTcatcaggatcttgtg); K162A (AAG to GCG) forward (5_-
![Page 66: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/66.jpg)
51
gaagagcccaaggtcGCggagatggtacgg) and reverse (5_-ccgtaccatctccGCgaccttgggctcttc);
K162Q (AAG to CAG) forward (5_-gaagagcccaaggtcCAggagatggtacgg) and reverse (5_-
ccgtaccatctccTGgaccttgggctcttc); K162R (AAG to AGG) forward (5_-
gaagagcccaaggtcAGggagatggtacgg) and reverse (5_-ccgtaccatctccCTgaccttgggctcttc);
K196A (AAG to GCG) forward (5_-ggctttatcaactactccGCgctccccagcctgccc) and reverse
(5_-gggcaggctggggagcGCggagtagttgataaagcc); K196Q (AAG to CAG) forward (5_-
ggctttatcaactactccCAgctccccagcctgccc) and reverse (5_-
gggcaggctggggagcTGggagtagttgataaagcc); K196R (AAG to AGG) forward (5_-
ggctttatcaactactccAGgctccccagcctgccc) and reverse (5_-
gggcaggctggggagcCTggagtagttgataaagcc) were utilized for the PCR amplification,
respectively. Mutated sequences are capitalized.
2.3.7 Cell Culture
The human embryonic kidney 293T (HEK293T) cells were cultured in DMEM
(Hyclone) supplemented with 10 % bovine calf serum (Hyclone, Logan, Utah), 100
IU/ml penicillin and 100 μg/ml streptomycin, at 37 oC and 5 % CO2 in a humidified
atmosphere. Mouse brown preadipocyte (HIB1B) cells with retroviral stable expression
of murine SIRT3 were previously described and were kindly provided by Qiang Tong of
Baylor college of Medicine (15,58). HIB1B cells were grown in the same complete
medium with puromycin (4 μg/mL).
HEK293T cells (4 X 105) were grown to about 80 % confluence in antibiotic-free
DMEM supplemented with 10 % FBS on 6 well plate. 4 μg of overexpression vector
![Page 67: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/67.jpg)
52
constructs and shRNA against MRPL12 (Open Biosystems Inc.) was used for
transfection experiments by using Lipofectamine 2000 (Invitrogen). After 2-4 days of
incubation with culture media, the transfected cells were lysed in cell lysis buffer (50 mM
Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 0.1 % SDS, and 0.5 % NP-40)
supplemented with a protease inhibitor cocktail (Sigma-Aldrich).
2.3.8 [35S]-Methionine Pulse-Labeling Assays
In order to measure mitochondrial protein synthesis activity using [35S]-
methionine, cells were cultured with dialyzed serum (25 mM Tris, pH 7.4, 137 mM
NaCl, 10 mM KCl) and minimum essential DMEM medium lacking methionine,
glutamine, and cysteine, after corresponding treatment. Cells were incubated with
emetine containing medium for 5 min to arrest cytoplasmic protein synthesis and added
0.2 mCi/ml of [35S]-methionine containing medium to label mitochondrially-encoded
thirteen proteins. After 2-4 h incubation, whole cell lysates were separated by SDS-
polyacrylamide gel which was dried and autoradiographed (58-60).
2.3.9 Preparation of Mitochondrial Ribosomes from Cell Lines
Approximately 4 X 107 HIB1B cells were collected and resuspended in lysis
buffer containing 50 mM Tris-HCl, pH 7.6, 0.26 M sucrose, 60 mM KCl, 20 mM MgCl2,
0.8 mM EDTA, 2 mM DTT, 0.05 mM spermine, 0.05 mM spermidine, proteinase
inhibitor cocktail (Sigma-Aldrich) by using 20 G needle. Cells were lysed by Dounce-
![Page 68: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/68.jpg)
53
homogenizer with addition of 1.6 % Triton X-100. Cell lysates were loaded onto 34 %
sucrose cushion buffer (50 mM Tris-HCl, pH 7.6, 60 mM KCl, 20 mM MgCl2, 6 mM
BME and 34 % sucrose) and centrifuged in a type 40 rotor (Beckman Coulter Inc.) at
40,000 rpm for 16 h to collect the crude ribosomes. Pellets were resuspended in 50 µL of
Base Buffer (50 mM Tris-HCl, pH 7.6, 60 mM KCl, 20 mM MgCl2, 1 mM DTT, and
protease inhibitor cocktail (Sigma-Aldrich). Ribosome suspensions were stored at -80 0C
for further analyses.
2.3.10 Complex I and IV Activity and ATP Determination Assays
Mitochondrial electron transport chain complex activity was measured by using
whole cell lysates prepared from HIB1B cells overexpressing SIRT3. Cells were
sonicated in a specific buffer for each enzyme activity and treated with n-dodecyl--
maltoside (1.67 μg/uL). The activity of Complex I was determined by monitoring the
reduction of 2,6-dichloroindophenolate (DCIP) at 600 nm as described (61). In brief, the
assay was performed in reaction buffer (25 mM potassium phosphate, pH 7.2, 5 mM
MgCl2, 2.5 mg/ml BSA, 2 mM KCN, 0.13 mM NADH, 60 μM DCIP, 65 μM
decylubiquinone, and 2 μg/mL antimycin A. The reaction was initiated by adding 100 μg
of cell lysate and reduction of DCIP was monitored for 10 min and another 10 min with
the addition of Complex I inhibitor, rotenone (2 μg/mL) to record rotenone insensitive
activity.
Complex IV (cytochrome c oxidase) activity was determined by measuring the
oxidation of ferrocytochrome c at 550 nm. The assay was performed in the presence of 10
![Page 69: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/69.jpg)
54
mM Tris-HCl, pH 7.0, 120 mM MgCl2, 25 mM sucrose, 11 μM ferrocytochrome c, and
varying amounts of cell lysate. Ferrocytochrome c was prepared by reducing it in 0.5 mM
DTT (62). The reaction was initiated with the addition of ferrocytochrome c to the
mixture and monitored for 3 min.
Freshly prepared HIB1B cell lysates in boiling water for 5 min were used to
measure cellular ATP concentration with ATP determination kit (Molecular Probe).
Chemiluminescent detection of ATP content was recorded as a function firefly luciferase
and luciferin by using Junitor LB 9509 Luminometer (Berthold Technologies). Protein
concentration of cell lysates was determined by BCA assay (Pierce) and RLU (relative
luminescent unit) was normalized to protein concentration.
Citrate synthase activity was determined by measuring the increase in absorbance
due to reduction of DTNB [5,5'-dithiobis-(2-nitrobenzoic acid)] at 412 nm. In the
presence of oxaloacetate, citrate synthase hydrolyzes thioester of acetyl-CoA resulting in
the formation of CoA with a thiol group. This thiol groups reacts with DTNB to form
TNB (5-thio-2-nitobenzoic acid), which is a yellow product observed by
spectrophotometry. About 100 µg of cell lysate was used for each measurement. The
assay was performed in the presence of 10 mM Tris-HCl, pH 7.0, 10 mM DTNB, 30 mM
acetyl-CoA, and varying amounts of cell lysate. The reaction was initiated with the
addition of 10 mM oxaloacetate to the mixture and monitored for 3 min.
![Page 70: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/70.jpg)
55
2.3.11 Expression and Purification MRPL10-MRPL12 Complex and Reconstitution
of Hybrid Ribosome
Human MRPL10 and MRPL12 (GenBank AB051618 and X79865) were
amplified from cDNA library of HeLa cells using the primers; MRPL10-NT1: Forward
5’-AAACGGGGTACCATATGGGCTCCAAGGCTGTTACCCGC-3’, Reverse 5’-
GCGGGTACCCTCGAGTTACTAATGGTGATGGTGATGATGCGAGTCCGGAACA
GTGTCAGG-3’; MRPL12-NT1: Forward 5’-
AAACGGCCATGGGTGCACCCCTGGATAACGCC-3’, Reverse 5’-
GCGGGTCTCGAGTTACTCCAGAACCACGGTGCC-3’. Corresponding MRPL10
mutants were created by site-directed mutagenesis (QuikChange_ II site-directed
mutagenesis kits, Stratagene) at K124, K162, and K196 by using the primers indicated in
plasmid constructs section. After cloning into pETDuet™-1 expression vector using NdeI-
XhoI for MRPL10 and NcoI-SalI for MRPL12, proteins were over-expressed by induction
with IPTG (200 μM) for 16 h at 18 °C. The cell lysate prepared with sonication was
centrifuged first 3,000 g for 15 min and then at 10,000 g for 30 min at 4 C.
Overexpressed complex proteins purified with Ni-NTA affinity column at 250 mM
imidazole, were dialyzed by using Spectra/Por 1 ® (SP, Spectrum Laboratories Inc.)
dialysis tubing in dialysis buffer (50 mM Tris, pH 8.0, 200 mM KCl, 1 mM DTT, and 10
% glycerol) to remove imidazole (63). The dialyzed sample was then applied to a strong
cation exchange gravity column (SCX, SP Sepharose Fast Flow column, GE Healthcare)
and eluted with step gradient salt of KCl; a linear gradient 50 mM –150 mM for 30 min,
400 mM – 500 mM for 10 min, and 500 mM – 1 M for 10 min. The fractions containing
![Page 71: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/71.jpg)
56
the MRPL10-MRPL12 complex were collected, combined, and dialyzed for further
analysis.
For the reconstitution of the hybrid ribosome, the L7/L12 stalk was removed from
bacterial 70S ribosomes by incubating in high salt extraction buffer (50 mM Tris-HCl, pH
7.6, 1 M NH4Cl, 20 mM MgCl2, 10 mM -mercaptoethanol) at 30 °C for 5 min followed
with addition of 1 mL of pre-warmed ethanol at 30 °C twice. Stripped ribosomes (70S-str)
were recollected by ultracentrifugation at 40,000 rpm for 16 h at 4 °C and ribosome pellet
was resuspended in reconstitution buffer (20 mM Tris-HCl, pH 7.5, 60 mM NH4Cl, 10
mM MgCl2, and 2 mM DTT). Stripped ribosomes (35 pmol) were incubated with purified
MRPL10-MRPL12 complex (70 pmol) and MRPL12 (280 pmol) at 37 °C for 15 min
before using in in vitro translation assay.
2.3.12 Statistical Analysis
Results are expressed as means ± s.d. of at least three independent experiments.
Statistical difference between test groups was analyzed by one-way ANOVA test.
Statistical significance was defined at P<0.05.
![Page 72: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/72.jpg)
57
2.4 Results and Discussion
2.4.1 The Mitochondrial Ribosomal Protein MRPL10 is Acetylated and SIRT3 is
Responsible for its Deacetylation
A combination of two-dimensional gel separation and capLC-MS/MS analyses
has been successfully used by our laboratory for the identification of ribosomal proteins
and their post-translational modifications (17,31,54,64,65). Acetylation of several
components of the translational machinery, either at N-terminal amino groups or at -
amino groups of Lys residues in bacteria, has been reported previously (66). To
determine the acetylated proteins of mammalian mitochondrial ribosomes, 55S ribosomes
were purified from the bovine liver using previously described methods (67,68).
Ribosomal proteins were then separated by one or two-dimensional gel electrophoresis,
and acetylated ribosomal proteins were identified by immunoblotting analysis with anti-
acetyl-Lys antibody, which detects protein only when it has been post-translationally
modified by acetylation on the -amino groups of Lys residues (Fig. 2.1). Protein bands
corresponding to acetylated proteins detected in the gel were excised, digested with
trypsin, and analyzed by capLC-MS/MS for identification as described in Materials and
Methods. The mass spectrometric analyses of one and two-dimensional gel spots revealed
the presence of two mitochondrial ribosomal proteins, MRPL10 (29.3 kDa) and MRPL19
(33.3 kDa) (Fig. 2.1, Table 2.1). After the cleavage of mitochondrial localization signal
sequence, their mature forms have very similar pIs and molecular masses and so they
![Page 73: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/73.jpg)
58
were detected in the same protein band (Fig. 2.1). However, the analyses with mass
spectrometry didn’t reveal any acetylated peptides from MRPL19 in the same protein
band giving the acetylation signal (Table 2.1). Furthermore, we didn’t detect any
significant acetylation of MRPL19 when it was immunoprecipitated using anti-Flag
antibody from HEK293T cells transiently transfected with pcDNA3-Flag vector
containing its coding sequence compared to MRPL10 which was found to be clearly
acetylated in parallel experiment (58). For this reason, MRPL10 has been designated as
the major acetylated protein of the 55S ribosome.
![Page 74: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/74.jpg)
59
Figure 2.1: Detection of acetylated mitochondrial ribosomal proteins.
Approximately 1.8 and 0.3 A260 units of purified bovine 55S ribosomes were
separated on two dimensional (2D) non-equilibrium pH gradient electrophoresis (2D-
NEPHGE) gel (courtesy of Dr. E. Koc) and one dimensional (1D) SDS-polyacrylamide
gel followed by detection of acetylated ribosomal proteins with anti-acetyl Lys antibody.
![Page 75: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/75.jpg)
60
Peptide Sequence m/z Mr Score
(experimental) MRPL10 QKLoMAVTEYIAPKPVVNPR 725.1 2172.3 39QacKLoMAVTEYIAPKPVVNPR 738.8 2213.3 22LoMAVTEYIAPKPVVNPR 958.5 1915.1 72oMIAVCQNVAoMSAEDK 822.5 1642.9 96VFPNQILKPFLEDSK 888.4 1774.8 69YQNLLPLFVGHNLLLVSEEPK 1213.1 2424.1 96VKEoMVRILK 567.7 1132.3 21VacKEoMVRILK 588.5 1173.5 15ILacKpSVPFLPLLGGCIDDTILSR 858.0 2571.0 47QGFINYpSacKLPpSLALAQGELVGGLpTLLTAR 1104.6 3310.9 54LPSLALAQGELVGGLTLLTAR 1048.2 2094.3 145THSLLQHHPLQLTALLDQYAR 1229.3 2455.8 78QQLEGDPVVPASAQPDPPNPVQDS 829.8 2486.3 83 MRPL19 FLSPEFIPPR 602.4 1202.8 79ILHIPEFYVGSILR 829.4 1656.8 68LDDSLLYLR 555.2 1108.4 87DALPEYSTFDMNMKPVAQEPSR 843.5 2527.3 80WSQPWLEFDoMMR 822.1 1642.2 62IEAAIWNEIEASK 737.7 1473.5 91
Collision-induced dissociation spectra of peptides were searched by MASCOT as
described. Modifications of peptides by acetylation (ac), phosphorylation (p), and
oxidation (o) were shown for each peptide. Courtesy of Dr. H. Koc.
Table 2.1: Peptides detected from tryptic digests of mitochondrial ribosomal protein
bands corresponding to acetylation signals by capLC-MS/MS analysis.
![Page 76: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/76.jpg)
61
For further confirmation of MRPL10 acetylation and mapping of the acetylated
Lys residues, mitochondrial ribosomal proteins isolated from bovine 55S ribosomes were
separated on reverse phase – high performance liquid chromatography (RT-HPLC) and
tryptic digests of the band(s) corresponding to the acetylated MRPL10 was analyzed by
capLC-MS/MS (Fig. 2.2 and Table 2.1). Acetylated and non-acetylated forms of
MRPL10 were well separated on the C4-reverse phase column, and the acetylated form
of MRPL10 was eluted in the later fraction as expected due to the neutralization of
positive charges on Lys residues by more hydrophobic acetyl groups. In the
immunoblotting analysis of HPLC fractions by anti-MRPL10 and anti-acetyl-Lys
antibodies, several different forms of MRPL10 were observed. This observation might be
because of differential modification(s) of MRPL10 by post-translational modifications
such as acetylation and phosphorylation (Fig. 2.2). Depending on the relative signal
intensities of acetylated and non-acetylated MRPL10, acetylated MRPL10 can be
estimated to be 30 % of the total MRPL10 found in the dissociated 39S subunits and 55S
ribosomes (Fig. 2.2). However, this estimation is based on recognition of all these
different forms of MRPL10 by anti-MRPL10 antibody equally (Fig. 2.2).
![Page 77: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/77.jpg)
62
Figure 2.2: Purification of MRPL10 and its acetylated forms by reverse phase -
HPLC.
Approximately, 5 A260 units of purified 55S ribosome preparation obtained from
bovine liver were incubated in the presence of glacial acetic acid as described in
Materials and Methods. After centrifugation, supernatant containing the ribosomal
proteins was separated with RP-HPLC using 5-55 % acetonitrile gradient. Equal volumes
of gradient fractions were separated on 12 % SDS-polyacrylamide gels and analyzed with
anti-acetyl Lys and anti-MRPL10 antibodies. Acetylated protein bands corresponding to
MRPL10 protein were shown by arrows.
![Page 78: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/78.jpg)
63
In addition, we also performed capLC-MS/MS analysis to map the acetylated Lys
residues from the tryptic digests of acetylated MRPL10 fractions. This analysis enabled
us to map several highly conserved acetylated Lys residues (Lys 46, 124, 162, 169, and
196) in bovine 55S ribosomes (Table 2.1). The majority of the Lys residues are highly
conserved in human, bovine, and mouse MRPL10 proteins (Fig. 2.3). In order to
investigate the contribution of highly conserved Lys residues in the acetylation of
MRPL10, wild type, double (Lys162Ala and Lys196Ala), or triple (Lys124Ala,
Lys162Ala, and Lys196Ala) mutants of MRPL10 were stably expressed in HeLa cells.
After the enrichment of the proteins using His-tag affinity chromatography, (58). The
acetylation status of MRPL10 gradually declined in both double and triple Lys to Ala
mutants compared to wild type (58).
![Page 79: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/79.jpg)
64
Figure 2.3: Alignment of MRPL10 with identified acetylated lysine residues.
Primary sequence alignment of MRPL10 homologs from different species, human
(NP660298), bovine (XP592952), mouse (NP080430), archaea (Thermotoga maritima
NP228266), and bacteria (Escherichia coli AAC43083) was created using the
CLUSTALW program in Biology Workbench and is displayed in BOXSHADE.
(*) denotes the acetylated lysine residues detected in the capLC-MS/MS analysis.
*
*
*
*
*
![Page 80: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/80.jpg)
65
Figure 2.4: Structural model for the location of acetylated lysine residues on
ribosome and ribosomal L7/L12 stalk region.
Crystal structures of bacterial ribosome (E. coli Protein databank entry 2AW4)
and archaeal L7/L12 stalk (T. maritima PDB: 1ZAX) were used to illustrate the location
of acetylated lysine residues (colored in red). Mitochondrial homologs of L7/L12 stalk
proteins L11 and L10 in complex with three L7/12 N-terminal-domain dimers were
shaded in yellow, green, and orange, respectively. The 50S ribosomal rRNA and
ribosomal proteins were colored in blue and pink, respectively. Pymol software from
DeLano Scientific LLC was used to generate structural models (69). Courtesy of Dr. E.
Koc.
![Page 81: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/81.jpg)
66
2.4.2 SIRT3, NAD+-dependent Deacetylase is Associated with 55S Mitochondrial
Ribosome.
Three members of the sirtuin family NAD+-dependent deacetylases, SIRT3,
SIRT4, and SIRT5, have been identified and localized in the mitochondria (6-8). They
have been implicated in several mitochondrial metabolic pathways. SIRT3 targets
Complex I subunit, NDUFA9 and Complex II SdhA; SIRT4 targets glutamate
dehydrogenase; SIRT5 targets carbamoyl phosphate synthetase 1 (57,70-72). Next, we
investigated whether any of the deacetylases mentioned above are associated with the
ribosome. Crude mitochondrial ribosomes were isolated at different salt and non-ionic
detergent concentrations to preserve their interactions with associated proteins and were
then fractionated on 10-30 % linear sucrose gradients (Fig. 2.5). Immunoblotting analyses
of the sucrose gradient fractions antibodies against acetyl-Lys, MRPL41, and SIRT3
revealed that SIRT3 containing fractions (12-18) overlapped with the acetylated-
MRPL10 and another large subunit ribosomal protein MRPL41 (Fig. 2.5). In order to
confirm the association of SIRT3 with mitochondrial ribosomes, ribosome preparations
were treated with RNase A and loaded on 10-30 % gradients (Fig. 2.6). RNase A
treatment only digests rRNAs of 55S ribosomes. Proteins physically associated with the
rRNA were spread through the gradient and no significant amounts of SIRT3 or MRPL10
were retained in the gradients (Fig. 2.6).
In our analysis, we have found SIRT3 association with the mitochondrial
ribosome only at low detergent and ionic conditions, implying a possibly transient
interaction. In addition to the immunoblotting analysis, in-gel proteolytic digestion and
![Page 82: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/82.jpg)
67
mass spectrometric analysis of the protein band detected with the anti-SIRT3 antibody
confirmed the association of SIRT3 with the ribosome (Table 2.2). Since the other
mitochondrial sirtuins, SIRT4 and SIRT5, were not detected in our analyses of ribosome
preparations, we concluded that SIRT3 is the mitochondrial deacetylase associated with
the ribosome. This finding is supported with a recent report stating that SIRT3 is the
major mitochondrial deacetylase in mice where no mitochondrial hyperacetylation is
detectable when the two other mitochondrial sirtuins, SIRT4 and SIRT5, are deleted (16).
![Page 83: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/83.jpg)
68
Figure 2.5: The association of SIRT3 with mitochondrial 55S ribosomes.
Crude mitochondrial ribosomes isolated from bovine liver were layered onto 10-
30 % linear sucrose gradients in order to sediment 55S ribosomes. Immunoblotting
analyses of corresponding fractions separated on 12 % SDS-polyacrylamide gel were
performed using antibodies against acetylated MRPL10, SIRT3, and MRPL41 to
demonstrate the co-sedimentation of SIRT3 with the 55S ribosome.
![Page 84: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/84.jpg)
69
Figure 2.6: Dissociation of SIRT3 from the large subunit of mitochondrial ribosomes
by RNase A treatment.
Approximately, 20 A260 units of crude ribosome preparation obtained from bovine
liver were incubated in the absence (A) and presence of RNase A (B) and loaded onto
two 10-30 % linear sucrose gradients. After centrifugation, equal volumes of gradient
fractions were separated on 12 % SDS-polyacrylamide gels and PVDF blots were probed
with SIRT3, MRPL10, acetyl-Lys and MRPL41 antibodies.
![Page 85: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/85.jpg)
70
Courtesy of Dr. H. Koc.
Table 2.2: Peptides detected from tryptic digests of mitochondrial ribosome
associated bovine SIRT3 by capLC-MS/MS analysis.
Peptide Sequence m/z Mr Score
(experimental)
KFLLQDIAELIK 717.5 1433.0 101 LYTQNIDGLER 662.8 1323.5 73 LVEAHGSLASATCTVCR 860.2 1718.3 56 DVAQLGDVVHGVK 669.5 1337.1 63 LVELLGWTDDIQDLIQR 1015.7 2029.3 104
![Page 86: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/86.jpg)
71
The interaction of SIRT3 with MRPL10 was investigated further with GST-pull-
down and co-immunoprecipitation assays to map the domains mediating this binding
(58). The first 148 amino acid (aa) residues of the MRPL10 N-terminal domain and
residues aa 156-171 on SIRT3 are found to be important for their association. These
domains were also evaluated using a structural model based on the coordinates of human
SIRT3 and the Thermotoga maritima L10-L7/L12 complex (Fig. 2.7) (73). As illustrated
in Fig. 2.7, the region within the first 148 residues of MRPL10 (marked in pink) required
for SIRT3 binding is probably the most accessible region for this interaction since
MRPL10 also interacts with MRPL11 and MRPL12 to form the mitochondrial L7/L12
stalk. The C-terminal helix 8 of Thermotoga L10 binds three L7/L12 dimers (two
L7/L12 dimers in E. coli) and the N-terminal globular domain interacts with the N-
terminal domain of L11 and SIRT3 (Fig. 2.7). Regions of MRPL10 and SIRT3
responsible for binding to each other, and their interactions with the rest of the ribosome,
are in agreement with the idea of a transient interaction between SIRT3 and the
mitochondrial ribosome. Moreover, acetylated Lys residues in MRPL10 are located near
the SIRT3 binding domain and reversible acetylation/deacetylation of these residues
could be involved in the regulation of ribosomal function by NAD+-dependent SIRT3
(Fig. 2.7). The L7/L12 stalk is known to be essential as well as the most highly regulated
and flexible region of the large subunit due to its interaction with elongation, initiation
and release factors during different stages of translation (37,74,75). For this reason, it is
plausible to suggest that the mitochondrial translational machinery might be regulated by
reversible acetylation of the L7/L12 stalk protein, MRPL10.
![Page 87: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/87.jpg)
72
K169
K196
K162
L7/12
L10 NTD
L10 CTD
K124L10
A B
DI
DII
DIII
39S Subunit
L1 stalk
L7/12 stalkL11 L10 PTC
SRL
SIRT3
CP
Figure 2.7: Structural model of the SIRT3 and MRPL10 interactions in the L7/L12
stalk.
A. Crystal structure model of the human SIRT3 was generated (Protein Data Bank
entry 3GLU) where MRP-L10 interaction site and acetyl-CoA synthetase 2 peptide at the
active site are represented in green and red, respectively. B. Structure of the L10-L7/L12
complex from T.maritima (1ZAX) was used to model L7/L12 stalk in mitochondria. In
the model, MRPL10 was colored in green, pink to represent SIRT3 binding site, and red
for the conserved Lys residues found to be acetylated in bovine MRPL10 (shown by
asterisks in Fig. 2.3). The three L7/L12 dimers (DI, DII, DIII) were colored in yellow.
C
![Page 88: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/88.jpg)
73
C. Models of the human SIRT3 and T. maritima L10-L7/L12 complex were used
to represent their possible interactions with 55S mitochondrial ribosomes using
coordinates from the E. coli 50S subunit (2AW4). The 50S ribosomal rRNAs, L10, L11,
and SIRT3 were colored in blue, green, yellow, and pink, respectively. The other
functional regions such as peptidyl transferase center (PTC), central protuberance (CP),
sarcin-ricin loop (SRL), L1, and L7/L12 stalks of the large subunit and ribosomal
proteins (salmon) were labeled in the model. The structural model was generated using
PyMol software (DeLano Scientific) (69). Courtesy of Dr. E. Koc.
![Page 89: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/89.jpg)
74
2.4.3 Recombinant and Ribosome-Associated Endogenous NAD+-dependent SIRT3
Deacetylates MRPL10
Given that the ribosomal protein MRPL10 is acetylated and interacts directly with
the NAD+-dependent deacetylase SIRT3, we also investigated the effects of SIRT3 by
performing in vitro deacetylation assays using purified bovine mitochondrial ribosomes
containing acetylated MRPL10 as the SIRT3 substrate. The NAD+-dependent
deacetylation of the ribosome associated MRPL10 by recombinant SIRT3 was detected
by immunoblotting analysis with anti-acetyl-Lys antibody (Fig. 2.8). In the presence of
NAD+, the acetylation level of the protein band containing MRPL10 significantly
decreased in the absence of SIRT3, presumably due to the catalytic activity of the
ribosome-associated endogenous SIRT3. This observation also confirmed the presence of
the ribosome-associated SIRT3 in the mitochondrial ribosome preparations. Furthermore,
the addition of recombinant SIRT3 to the in vitro deacetylation assay reaction further
decreased the acetylation level of MRPL10. In contrast, acetylated HSP70, which is
approximately 75 kDa and cosedimented with the ribosome, was neither deacetylated by
an endogenous deacetylase nor by the recombinant SIRT3 in vitro (Fig. 2.8).
We also assessed the acetylation level of MRPL10 in a SIRT3 knock-out (Sirt3-/-)
mouse to evaluate whether SIRT3 was the major deacetylase responsible for the
deacetylation of MRPL10. Analysis of mitochondrial ribosomes isolated from SIRT3
knock-out (Sirt3-/-), wild-type (Sirt3+/+), and heterozygote (Sirt3+/-) mice revealed that the
MRPL10 in the Sirt3-/- mice was more heavily acetylated than in either of the other two
more strains (Fig. 2.9). Immunoblottings were also probed with mouse anti-MRPL10 and
![Page 90: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/90.jpg)
75
anti-MRPS29 antibodies to ensure equal loading of mitochondrial ribosomal proteins
(Fig. 2.9). The increase in acetylation of glutamate dehydrogenase (GDH) confirms the
hyperacetylation state of Sirt3-/- mice (Fig. 2.9)(16).
Overall, the data we obtained strongly suggest that the mitochondrial SIRT3 is
associated with the mitochondrial ribosome and also involved in specific deacetylation of
MRPL10. Moreover, in the absence of SIRT3, the amount of MRPL10 acetylation was
increased compared to the MRPL10 isolated from wild type and heterozygote mice
expressing SIRT3.
We also performed poly(U)-directed in vitro translation assays to monitor
mitochondrial ribosome activity as a function of the acetylation status of MRPL10. This
assay is one of the primary techniques in assessing the interactions of mitochondrial
elongation factors with the L7/L12 stalk of the ribosome (76,77). To test the role of
reversible acetylation in mitochondrial ribosome activity using this in vitro assay, we first
isolated mitochondrial ribosomes from SIRT3 knock-out (Sirt3-/-), wild-type (Sirt3+/+)
and heterozygote (Sirt3+/-) mouse liver mitochondria and performed poly(U)-directed
poly(phenylalanine) synthesis in the presence of [14C]-tRNAPhe and the mammalian
mitochondrial elongation factors EF-Tumt and EF-G1mt (77). To ensure that equal
amounts of mitochondrial ribosomes were used in each in vitro translation assay,
ribosomes were quantified using A260 measurements and immunoblotting analysis was
performed with anti-MRPS29 antibody as an equal loading control (Fig. 2.9). In these
assays, mitochondrial ribosomes isolated from Sirt3-/- mice had a 50-60% higher
translational activity compared to those from Sirt3+/+ or Sirt3+/- mice (Fig. 2.9).
![Page 91: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/91.jpg)
76
Figure 2.8: Deacetylation of MRPL10 by the NAD+-dependent deacetylase, SIRT3.
In vitro deacetylation reactions using approximately 0.1 A260 units of 55S bovine
mitochondrial ribosomes were performed in the presence of 3 mM NAD+ and 0.2 μg of
recombinant SIRT3 as labeled. Immunoblotting analyses using anti-acetyl Lys antibody
to detect acetylated MRPL10 indicate the specific deacetylation of MRPL10, but not the
acetylated HSP70 sedimented with ribosomes, by endogenous and recombinant SIRT3 in
the presence of NAD+.
![Page 92: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/92.jpg)
77
Figure 2.9: Role of MRPL10 acetylation in SIRT3 knock-out (Sirt3-/-) mice.
Immunoblotting analyses with mitochondrial ribosomes prepared from Sirt3-/-,
Sirt3-/+, and Sirt3+/+ mice liver using anti-acetyl Lys antibody indicate the elevated
acetylation of ribosomal protein MRPL10 as well as glutamate dehydrogenase (GDH)
which was used as a control for hyperacetylation in absence of SIRT3. In order to ensure
equal loading, immunoblots were probed with anti-MRPL10 and anti-MRPS29
antibodies. Acetylated ribosomes promote mitochondrial protein synthesis in vitro.
Mitochondrial ribosomes (0.05-0.1 A260 units) isolated from Sirt3+/+, Sirt3+/-, and Sirt3-/-
mice liver mitochondria were used in the poly(U)-directed in vitro translation assays. One
way ANOVA test was used to compare the significance of values from three separate
experiments. Asterisk denotes p<0.05.
![Page 93: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/93.jpg)
78
Since nicotinamide (NAM) is a general inhibitor for sirtuins, including SIRT3,
mitochondrial ribosomes prepared in the presence or absence of nicotinamide and
cytoplasmic translation inhibitor emetine were also examined by poly(U)-dependent
translation assays (Fig. 2.10 ). In these assays, we first verified the increased acetylation
of mitochondrial ribosomes prepared in the presence of nicotinamide and tested the
translation activity of these ribosomes. In agreement with the increased activity obtained
in Sirt3-/- mice, the translation activity of mitochondrial ribosomes from nicotinamide
treated mitochondria was significantly higher and this activity was not inhibited by
cytoplasmic translation inhibitor emetine (Fig. 2.10). These results from SIRT3 knock-
out (Sirt3-/-) mice and NAM-treated bovine mitochondria indicate that ribosomes
containing acetylated MRPL10 are more active in protein synthesis in vitro.
![Page 94: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/94.jpg)
79
Figure 2.10: Role of nicotinamide (NAM) and emetine on mitochondrial protein
synthesis.
A. Immunoblotting analysis of mitochondrial ribosomes (0.2 A260) prepared in
the absence (Con) and presence of 10 mM nicotinamide (NAM) from bovine liver
mitochondria probed with anti-acetyl Lys, MRPL10 and MRPS29 antibodies. Relative
change in MRPL10 acetylation was graphed. B. Mitochondrial ribosomes (0.1-0.2 A260
units) isolated from control and NAM treated bovine liver mitochondria were used in the
poly(U)-directed in vitro translation assays described in Materials and Method. In vitro
translation assays using NAM treated ribosomes were also repeated by adding 1 mM
emetine (Dr. M.J. Han contributed to this experiment). One way ANOVA test was used
to compare the significance of values from three separate experiments. Asterisk denotes
p<0.05.
*
*
![Page 95: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/95.jpg)
80
We have also demonstrated the increased expression of mitochondrially encoded
cytochrome c oxidase subunit II (Complex IV, COII) compared to the nuclear-encoded
components of the oxidative phosphorylation complexes in SIRT3 knock-out mice
mitochondria (Fig. 2.11).
In SIRT3 knock-out mice, MRPL12 signal, indicated with an arrow, was slightly
increased compared to the other mitochondrial ribosomal proteins (Fig. 2.11). The
ribosomal protein MRPL10 is located in the L7/12 stalk of the ribosome and responsible
for binding of multiple copies of MRPL12. The components of this stalk are universally
conserved since they are essential for translocation of tRNA catalyzed by EF-G-
dependent GTP hydrolysis (78,79). Therefore, MRPL12 antibody was specifically chosen
to monitor changes in MRPL12. Mitochondrial ribosomes enriched from SIRT3 knock-
out mice by sedimentation through a 34% sucrose cushion and were evaluated for the
mitochondrial ribosome content using immunoblotting assays (Fig. 2.12). MRPL12 band
corresponding to lower molecular mass in the mitochondrial lysate was significantly
increased compared to MRPL10 and MRPL47. The MRPL10 and MRPL47 bands
displayed fewer signals in SIRT3 knock-out ribosome sample compared to wild type,
possibly due to less loading (Fig. 2.12). The in vitro translation assays were also repeated
and stimulation of mitochondrial translation in knock-out mice was confirmed with
increased acetylation of MRPL10 (Fig. 2.12). This observation implies that the
acetylation of MRPL10 in SIRT3 knock-out mice may stabilize MRPL12 binding to the
ribosome possibly contributing to elevated mitochondrial translation activity.
![Page 96: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/96.jpg)
81
Figure 2.11: Enhanced MRPL12 binding to the ribosome in SIRT3 knock-out mice.
Mitochondrial lysates from wild-type (Sirt3+/+) and knock-out (Sirt3-/-) were
separated on 12 % SDS-polyacrylamide gel and probed with OXPHOS antibody cocktail
to examine the effect of enhanced MRPL10 acetylation on the steady-state levels of
complex subunits. Mitochondrially encoded subunit of Complex IV, COII in SIRT3
knock-out mice is enhanced while no difference is observed in other subunits. Protein
blots were probed with anti-acetyl Lys antibody to show increased acetylation of
mitochondrial proteins and MRPL10 (indicated by arrows) in the absence of SIRT3 and
with HSP60, MRPL47, and MRPL10 antibodies to ensure equal protein loading.
MRPL12 signal displays an increase in its shorter form (indicated by an arrow).
![Page 97: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/97.jpg)
82
Figure 2.12: Role of MRPL10 acetylation in mitochondrial translation in SIRT3
knock-out mice.
Mitochondrial ribosomes were enriched from wild-type (Sirt3+/+) and SIRT3
knock-out (Sirt3-/-) mice liver mitochondria to evaluate changes in ribosomal protein
content by immunoblotting analyses. Approximately, 0.05 A260 units of ribosomes were
separated on 12 % SDS-polyacrylamide gel for the comparison. Immunoblots were
developed with antibodies as indicated in the figure. Arrows indicate the MRPL10
acetylation and ribosome bound MRPL12 (shorter form). Poly(U)-directed in vitro
translation assays were also conducted to demonstrate enhanced protein synthesis in
SIRT3 knock-out mice. Mitochondrial ribosomes (0.1 A260 units) enriched from wild-type
(Sirt3+/+) and SIRT3 knock-out (Sirt3-/-) mice liver mitochondria were used in in vitro
translation assays. The values are the mean SD for three separate measurements. One
way ANOVA test was used to compare the significance of values. Asterisk denotes
p<0.05.
*
![Page 98: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/98.jpg)
83
The two different forms of MRPL12 in mitochondria were characterized by two-
dimensional gel electrophoresis separation of mitochondrial proteins followed by
immunoblotting with MRPL12 antibody and identification of corresponding protein
bands with capLC-MS/MS analysis (Fig. 2.13).
![Page 99: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/99.jpg)
84
Figure 2.13: Identification of two different forms of MRPL12.
Mitochondrial ribosome were separated on two dimensional gels and protein
bands displaying MRPL12 signal after immunoblotting analysis were labeled with arrows
on Coomassie Blue-stained gel. Primary sequences of MRPL12 from bovine, mouse,
human and L12 from bacteria (E. coli) were aligned using CLUSTALW program in
Biology Workbench and is displayed in BOXSHADE. The N-terminal sequences of the
long and short form of MRPL12 are shown by arrows, and the calculated molecular
weights are 17.8 kDa and 16.5 kDa, respectively.
![Page 100: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/100.jpg)
85
2.4.4 Overexpression of SIRT3 Regulates Mitochondrial Protein Synthesis in HIB1B
Cells
The next goal is to examine potential mechanisms to elucidate the role of SIRT3-
dependent deacetylation of MRPL10 and/or ribosomal proteins in protein synthesis. For
this purpose, we employed brown adipocyte cells, HIB1B, overexpressing SIRT3 to label
mitochondrially encoded proteins by [35S]-methionine. The stable expression of the full-
length murine SIRT3 clone decreased the de novo synthesis of mitochondrially encoded
proteins by about 40 % in agreement with our SIRT3 knock-out mice data (Fig. 2.14)
In bacteria, multiple copies of L7/L12 form a very flexible stalk along with L10 to
recruit elongation factors during translation (37,80,81). Previous reports showed that the
bacterial homolog of MRPL12 plays a role in the recruitment of several different
GTPases, such as IF2, EF-Tu, RF-G, and RF3, that function in translation (35,37,79,82).
In order to understand the mechanism involved in regulation of translation by acetylation
of MRPL10, we focused our efforts on MRPL12 which binds to the ribosome by
interacting only with MRPL10 involving only protein-protein interaction. Therefore, it is
plausible to suggest that reversible acetylation of MRPL10 might change the L7/L12
stalk composition to modulate mitochondrial translation in response to changes in SIRT3
activity. Interestingly, the observed increase in MRPL12 incorporation into the
mitochondrial ribosome in SIRT3 knock-out mice without changes in other ribosomal
proteins supports this hypothesis (Fig. 2.12).
![Page 101: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/101.jpg)
86
Figure 2.14: Role of SIRT3 over-expression on mitochondrial protein synthesis in
HIB1B cells.
Control HIB1B cells stably expressing the empty vector (Con) and full-length (1-
334 aa) murine SIRT3 (SIRT3) were exposed to [35S]-methionine in the presence of a
cytosolic translation inhibitor, emetine. A representative electrophoretic pattern of the de
novo synthesized translational products was presented. ND1, -2, -3, -4, -4L, -5, and -6 are
subunits of Complex I; Cytb is subunit of Complex III; COI, -II, and -III are subunits of
Complex IV; ATP6 and ATP8 are subunits of the Complex V. Coomassie Blue staining
of the same gel was performed to ensure equal protein loading in the gel. The combined
intensities of mitochondrially encoded proteins from each lane were used as the overall
quantitation of the mitochondrial protein synthesis (Dr. M. J. Han contributed to this
experiment). One way ANOVA test was used to compare the significance of
measurements from three experiments. Asterisk denotes p<0.05.
*
![Page 102: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/102.jpg)
87
2.4.5 Effect of SIRT3 Overexpression on MRPL12 Binding to the Ribosome in
HIB1B Cells
To examine the effect of SIRT3 over-expression on MRPL12 binding to the
mitochondrial ribosome, we performed immunoblotting analyses to check the expression
of MRPL12 and incorporation of MRPL12 into the mitochondrial ribosome in control
and SIRT3 over-expressing HIB1B cells. We isolated mitochondria from each cell line
and checked expression level of MRPL12. Flag-tagged ectopically expressed SIRT3 was
confirmed using an anti-Flag antibody. Immunoblotting analyses with anti-MRPL10,
anti-MRPL47, anti-SdhA, and anti-HSP60 antibodies were performed to ensure equal
loading amounts (Fig. 2.15). However, no significant change was detected in expression
level of MPRL12 in mitochondrial lysates between HIB1B and SIRT3 over-expressing
cells. To investigate the possible flexible binding of MRPL12 on the mitochondrial
ribosome, immunoblotting analyses were performed using ribosomes enriched from
HIB1B and SIRT3 over-expressing cells. These results showed a significant reduction in
MRPL12 binding on the ribosome (Fig. 2.15). Furthermore, immunoblotting with anti-
acetyl Lys antibody showed reduced acetylation of MRPL10 in SIRT3 over-expressing
cells. Probing with anti-MRPL10 and anti-MRPL47 antibodies was also performed to
ensure equal loading amounts (Fig. 2.15).
![Page 103: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/103.jpg)
88
Figure 2.15: Effect of SIRT3 over-expression on MRPL10 acetylation and MRPL12
binding to the ribosome in HIB1B cells.
A. Approximately, 20 g of mitochondrial lysates from control and SIRT3
expressing cells were separated on 12 % SDS-polyacrylamide gel, and immunoblotting
analyses were performed with corresponding antibodies (Dr. M. J. Han contributed to this
experiment.). B. Over-expression of the Flag-tagged SIRT3 decreased acetylation of
MRPL10 which reduced MRPL12 binding on mitochondrial ribosomes in HIB1B cells.
Approximately, 0.05 A260 of mitochondrial ribosomes, which were enriched from control
and SIRT3 over-expressing cells by centrifuging through 34 % cushion buffer, was
separated on 12 % SDS-polyacrylamide gel, and immunoblotting analyses were performed
using antibodies as indicated.
![Page 104: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/104.jpg)
89
The changes in the translational activity of mitochondrial ribosomes which
synthesize thirteen essential proteins of the electron transport chain complexes might
result in changes of complex activities and ATP production. As shown in Fig. 2.16 and
Fig. 2.17, reduction in the activities of Complexes I and IV was in agreement with the
decline in protein synthesis in SIRT3 over-expressing cells. Not only was the activity of
Complex I and IV reduced in SIRT3 over-expression cells, but also total ATP production
(Fig. 2.18). These effects appeared to be specific, since citrate synthase activity, a key
enzyme of the Krebs cycle and indicator of mitochondrial function, was comparable in
control and SIRT3 over-expressing cells (Fig. 2.19). We observed over 40 % of reduction
in 13 mitochondrially-encoded proteins in SIRT3 over-expressing HIB1B cells; however,
the production of ATP was reduced by only about 20-30 % compared to control cells
(Fig. 2.18). This discrepancy could be explained by direct regulation of OXPHOS
complexes by SIRT3-dependent deacetylation. We and other groups reported that
activities of Complexes I and II are stimulated by SIRT3-deacetylation of their nuclear
encoded subunits (57,72). This implies that the activities of OXPHOS complexes and
ATP production could be regulated by both acetylation and translation of their
components in a SIRT3-dependent manner to maintain basal ATP level (57,72,83).
![Page 105: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/105.jpg)
90
Figure 2.16: Complex I activity in HIB1B cells overexpressing SIRT3.
Whole cell lysates were prepared from HIB1B control (Con) and SIRT3 over-
expressing (SIRT3) cells. Cells were lysed by n-dodecyl--maltoside and sonication in
ice cold water. The activity of Complex I was determined by monitoring the reduction of
2,6-dichloroindophenolate (DCIP) at 600 nm as preciously described in Materials and
Methods. The reaction was initiated by adding 100 μg of cell lysate, and the reduction of
DCIP was monitored for 10 min at 600 nm. After adding Complex I inhibitor, rotenone,
samples were monitored for an additional 10 min. Only the rotenone sensitive Complex I
activity was presented. The results were expressed as the percent of control. The mean ±
SD was calculated from three independent experiments. Value of ٭P < 0.05 was
considered statistically significant. One way ANOVA test was used to compare the
significance of values.
![Page 106: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/106.jpg)
91
Figure 2.17: Effect of SIRT3 overexpression on Complex IV activity.
Complex IV activity was determined by measuring the oxidation of
ferrocytochrome c at 550 nm and reported as percent of relative change in OD550. About
100 µg of cell lysate was used for each measurement. One way ANOVA test was used to
compare the significance of values. Asterisk denotes for ٭P < 0.05.
![Page 107: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/107.jpg)
92
Figure 2.18: ATP production in HIB1B cells overexpressing SIRT3.
ATP production as a function of luciferase activation measured at 560 nm using
2-10 µg of cell lysates. Relative luminescent unit (RLU) was normalized by the protein
concentration of each lysate. The results were expressed as the percent of control. The
mean ± SD was calculated from three independent experiments (Courtesy of Dr. M. J.
Han). One way ANOVA test was used to compare the significance of values. Value of ٭P
< 0.05 was considered statistically significant.
![Page 108: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/108.jpg)
93
Figure 2.19: Citrate synthase activity in HIB1B cells overexpressing SIRT3.
Citrate synthase activity was determined by measuring the increase in absorbance
due to reduction of DTNB [5,5'-dithiobis-(2-nitrobenzoic acid)] at 412 nm, coupled to the
reduction of CoA by citrate synthase in the presence of oxaloacetate. About 100 µg of
cell lysate was used for each measurement.
![Page 109: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/109.jpg)
94
2.4.6 The Effect of MRPL12 Knockdown and MRPL10 and MRPL12
Overexpression on Mitochondrial Protein Synthesis.
The composition of the L7/L12 stalk and the nature of MRPL10 and multiple
copies of MRPL12 interactions are unknown in mitochondria. In bacteria, multiple copies
of L12 bind to L10 via protein-protein interactions to form the L7/L12 stalk. The
interaction between L10 and L12 is sensitive to ionic conditions. We employed shRNA
mediated knockdown of MRPL12 (shL12) in HEK293T cells in order to verify the effect
of MRPL12 knockdown on mitochondrial translation by pulse labeling of de novo
synthesized mitochondrially-encoded thirteen proteins in the presence of cytoplasmic
translation inhibitor, emetine, as described in Materials and Methods (Fig. 2.20). In
addition, MRPL10 and MRPL12 were overexpressed (L10 and L12, respectively) to
compare the effect of changing MRPL12 levels on mitochondrial ribosomal activity
(Fig. 2.20). The knockdown of MRPL12 reduced the total pulse labeling of thirteen
proteins compared to control cells (Con), while MRPL10 and MRPL12 overexpression
resulted in an elevated level of [35S]-methionine incorporation into mitochondrially-
encoded proteins. This finding suggests the involvement of MRPL12 in mitochondrial
translation activity. Immunoblotting analysis of these samples revealed the reduction in
MRPL12 expression level; especially the ribosome bound shorter form, in knockdown
cells resulting in lower ribosomal activity (Fig. 2.21). It was recently reported that the
free and longer form of MRPL12, which is ribosome unbound version, is involved in the
regulation of mitochondrial transcription by directly interacting with mitochondrial RNA
polymerase (POLRMT) (53). It is possible that the knock down of MRPL12 results in
![Page 110: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/110.jpg)
95
decreased mitochondrial translation activity in addition to decreased POLRMT activity.
HSP60 was used to ensure equal loading of mitochondrial proteins and MRPS29 and
MRPL47 for mitochondrial ribosomal proteins. His-tag immunoblotting was performed
to detect overexpressed MRPL10 and MRPL12. Immunoblotting assay with MRPL12
antibody did not display increase in MRPL12 possibly due to limited recognition by the
antibody. In addition, the steady-state levels of OXPHOS subunits, Complex IV, the
mitochondrial-encoded subunit, did not reveal much difference between the lysates
prepared from these cell lines (Fig. 2.21). We quantitated the immunoblotting signals of
Complex IV and Complex III subunits in MRPL12 knock-down and control cells. Even
they showed fewer signals in control sample, relative signal intensities were similar when
compared to the signal intensities of Complex IV and Complex III (Fig. 2.21).
![Page 111: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/111.jpg)
96
Figure 2.20: Effect of MRPL12 knockdown and MRPL10 and MRPL12
overexpressions on mitochondrial protein synthesis.
HEK293T cells transfected with MRPL12 shRNA (shL12) construct and
MRPL10 (L10) and MRPL12 (L12) overexpression constructs were exposed to [35S]-
methionine in the presence of a cytosolic translation inhibitor, emetine, for 2 h at 37oC.
Approximately, 40 μg of cell lysate from each sample were separated on 14 % SDS-
polyacrylamide gel. Electrophoretic pattern of the de novo synthesized translational
products was presented. ND1, -2, -3, -4, -4L, -5, and -6 are subunits of Complex I; Cytb
is subunit of Complex III; COI, -II, and -III are subunits of Complex IV; ATP6 and ATP8
are subunits of the Complex V. Coomassie blue staining of the same gel was performed
to ensure equal protein loading in the gel. The combined intensities from each lane were
used as the overall quantitation of the mitochondrial protein synthesis compared to
control. One way ANOVA test was used to compare the significance of values from three
experiments. Values of ٭P < 0.05 were considered statistically significant.
*
* *
![Page 112: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/112.jpg)
97
Figure 2.21: Effect of MRPL12 knockdown and MRPL10 and MRPL12
overexpression on ribosomal L7/L12 stalk composition and OXPHOS subunits.
Cell lysates from HEK293T cells containing MRPL12 knockdown (shL12) and
MRPL10 (L10) and MRPL12 (L12) overexpression were analyzed with immunoblotting
assay using His-tag and MRPL2 antibodies. Reduction of MRPL12 and overexpression
of MRPL10 and MRPL12, were demonstrated. MRPS29 and MRPL47 antibodies were
used as controls for other ribosomal proteins and HSP60 antibody for mitochondrial
proteins. OXPHOS antibody probing shows the steady-state levels of complex subunits,
where relative quantitation of Complex IV to Complex III is given as a graph.
![Page 113: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/113.jpg)
98
2.4.7 The Role of Acetylated Lysine Residues of MRPL10 on Mitochondrial
Translation and Cell Growth In Vivo.
MRPL10 is one of the essential components of the mitochondrial L7/L12 stalk
since it possibly provides the binding sites for multiple copies of MRPL12 via protein-
protein interactions. In E. coli, the L7/L12-stalk is a pentameric complex in which there
are four copies of L12 bound to L10 per ribosome (40). On the other hand, in T. maritima
the L7/L12 stalk is formed by a copy of L10 and six copies of L12 as three dimers per
ribosome (37). Bacterial L10 has a globular N-terminal and a flexible C-terminal α-helix
domain involved in binding to L11 and binding of L12 dimers, respectively. In the
mammalian mitochondrial ribosome, however, the composition of the L7/L12 stalk and
the nature of the MRPL10 and MRPL12 interaction(s), in particular the role of MRPL10
acetylation in the composition of the stalk and interaction of proteins forming the stalk is
not known. Previously, expression of two different forms of MRPL12 was reported in
human mitochondria (48). We have also confirmed the presence of two different forms of
MRPL12 in bovine mitochondria (Fig. 2.13). Interestingly, we detected changes in the
expression of one of these two different forms of MRPL12 in the ribosomes of SIRT3
knock-out mice and HIB1B cells overexpressing SIRT3, as a function of MRPL10
acetylation/deacetylation (Fig. 2.11 and Fig. 2.15). Based on these results, the acetylated
Lys residues of MRPL10 might be involved in modulating the number of MRPL12
dimers comprising the stalk and be important for regulation of mammalian mitochondrial
protein synthesis and cell growth.
![Page 114: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/114.jpg)
99
To determine the modulation of MRPL12 binding to MRPL10 by reversible
acetylation, we constructed expression vectors (control without insert) including
MRPL10 wild-type (WT) and its triple lysine residues at positions Lys124, Lys169, and
Lys196 which were mutated to Gln to mimic hyperacetylation and Ala or Arg to mimic
hypoacetylation, respectively, as described in Materials and Methods. The triple Gln
mutation of MRPL10 was expected to demonstrate the effect of acetylation since it would
not introduce the charge found on Lys residues and this would possibly provide a
stronger MRPL10-MRPL12 interaction. Conversely, Arg mutations of MRPL10 would
provide the charge on its side chain and this was expected to exert the effect of
nonacetylated Lys residues on MRPL12 binding. Introducing additional positive charges
to MRPL10 may interfere with MRPL12 binding to the ribosome. Moreover, Ala does
not have a long side chain as Lys does so the replacement of Lys with Ala in MRPL10
would introduce a structural and/or conformational change to the surface where MRPL12
binds. The triple Ala mutant of MRPL10 might also display reduced binding of MRPL12
to the mitochondrial ribosome due to the disruption of protein-protein interactions.
HEK293T cells transfected with corresponding constructs were grown for four
more days to overexpress MRPL10 constructs. Then, these cells were treated with
emetine, cytoplasmic translation inhibitor, followed by the incubation with [35S]-
methionine to specifically label mitochondrial protein synthesis products (Fig. 2.22).
Overexpression of MRPL10 (WT) and Gln mutant of MRPL10 resulted in elevated
mitochondrial translation, implying a dominant negative effect of these forms of
MRPL10 in cells (Fig. 2.22). However, Arg mutant of MRPL10 displayed a reduced
level of ribosomal activity compared to control cells. Overexpression of MRPL10
![Page 115: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/115.jpg)
100
proteins were confirmed by immunoblotting analysis using a His-tag antibody. The same
samples were also immunoblotted using MRPL12, MRPS29, and MRPL47 antibodies to
reveal the changes in ribosomal proteins and HSP60 antibody to verify mitochondrial
protein content in these cells (Fig. 2.22). Immunoblotting assays with the cell lysates did
not confirm that these changes were caused by alterations in the MRPL12 amounts since
they did not correlate with the ribosomal activity. However, ribosome bound version of
MRPL12 was not detected here. Immunoblotting with mitochondrial ribosomes by using
MRPL12 antibody might reveal the effect of MRPL10 constructs on MRPL12 binding to
ribosomes. Cell proliferation assay using WST1 reagent was performed to compare the
growth rates of cells overexpressing MRPL10 constructs. The calculated proliferation
rates of cells were graphed relative to control cells transfected with empty expression
vector (Fig. 2.23). The cells overexpressing wild type MRPL10 and its Gln mutant
displayed a significant increase in the growth rate. Conversely, proliferation rate of cells
overexpressing Ala mutant of MRPL10 was reduced, but not in cells overexpressing Arg
mutant. Overexpression of MRPL10 constructs might have some effect on cell growth;
however, their incorporation level into mitochondrial ribosomes affecting translation
would be reduced if they impair the mitochondrial protein synthesis. Here, incorporation
of MRPL10 mutants into mitochondrial ribosomes would be enforced to exert the effect
of Lys mutations on mitochondrial protein synthesis and therefore cell growth. This
effect could possibly be enhanced in cells where the endogenous MRPL10 was targeted
to be depleted or knockdown. Overall, these findings suggest the possible importance of
acetylated lysine residues in MRPL10 and their roles in the formation and/or composition
![Page 116: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/116.jpg)
101
of the mitochondrial L7/L12 and protein synthesis activity which affects overall cell
growth.
![Page 117: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/117.jpg)
102
Figure 2.22: The effect of MRPL10 LysAla, Gln, and Arg mutants on mitochondrial protein synthesis.
HEK293T cells were transfected with pcDNA 3.1+ (NC or CON), pcDNA-MRPL10 wild type (WT) and its lysine mutants (A: Ala, Q: Gln, and R: Arg) to overexpress MRPL10. [35S]-methionine labeling of mitochondrial-encoded proteins was performed in the presence of a cytosolic translation inhibitor, emetine to comparemitochondria translation activity between samples. Approximately, 40 μg of lysates were separated on SDS-polyacrylamide gels and electrophoretic pattern of the de novosynthesized translational products was presented. ND1, -2, -3, -4, -4L, -5, and -6 are subunits of Complex I; Cytb is subunit of Complex III; COI, -II, and -III are subunits of Complex IV; ATP6 and ATP8 are subunits of the Complex V. Coomassie blue stainingof the same gel was performed to ensure equal protein loading in the gel. The combinedintensities from each lane were used as the overall quantitation of the mitochondrial protein synthesis relative to control. One way ANOVA test was used to compare thesignificance of measurements from three experiments. Asterisks denote p<0.05.As control, His-tag antibody for overexpression of MRPL10 constructs, MRPS29 and MRPL47 antibodies for ribosomal proteins and HSP60 antibody for mitochondrialproteins were examined. MRPL12 immunoblotting analysis indicates the change in itsexpression level in cell lysates.
![Page 118: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/118.jpg)
103
Figure 2.23: The effect of MRPL10 LysAla, Gln, and Arg mutants on cell growth.
The cell proliferation assay using reagent WST1 was employed to quantitate cell
growth of HEK293T cells overexpressing MRPL10 wild type (WT) and its lysine
mutants (Ala: A, Q: Gln, and R: Arg). After transfection of cells with control (CON) or
corresponding expression vectors, 5 x 103 cells were grown 3 more days. Then, WST1
assay reagent was added and cells were incubated at 37oC following the method provided
by manufacturer. Growth rate of cells were graphed as relative ratio to control cells from
three separate plates. One way ANOVA test was used to compare the significance of
values and the value of *P < 0.05 was considered statistically significant.
*
*
*
![Page 119: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/119.jpg)
104
2.4.8 The Role of MRPL10 Reversible Acetylation in the Composition of Ribosomal
L7/L12 Stalk and Mitochondrial Translation In Vitro.
In order to elucidate the mechanism involved in the regulation of mitochondrial
L7/L12 stalk composition by reversible acetylation, we examined the MRPL10 and
MRPL12 interaction(s) in vitro. In our previous studies, MRPL10 and MRPL12 complex
formation and co-purification of the complex was achieved from bacteria co-expressing
MRPL10 and MRPL12 genes cloned into a bacterial expression vector, pET-Duet-1 (63).
We identified the contaminating proteins, such as groEL, HSP70, EF-P, and ribosomal
protein L4, co-purified with our MRPL10-MRPL12 complex by nickel-nitrilotriacetic
acid (Ni-NTA) affinity chromatography (63). Similarly, we have utilized this approach to
test the lysine mutant constructs of MRPL10 to examine how these mutations affect the
stoichiometry of MRPL10-MRPL12. Point mutations of MRPL10 were created by site-
directed mutagenesis at Lys124, Lys162, and Lys196 by generating LysAla in addition
to LysArg and LysGln to mimic hypoacetylation and hyperacetylation, respectively
as described in Materials and Methods. petDUET® overexpression system (Invitrogen
Inc.) having one of these MRPL10 constructs including His-tag at its C-terminal end and
MRPL12 was co-expressed in E. coli. By employing Ni-NTA affinity chromatography
followed by strong-cation exchange (SCX) chromatography, we attempted to purify His-
tagged MRPL10 under native conditions to maintain its interaction with MRPL12
(Fig. 2.24). For SCX-chromatography, we optimized the elution conditions with
application of step-gradient of salt; 1inear 50 mM to 150 mM KCl to remove non-
retained proteins for the first 30 min, then linear 400 mM to 500 mM KCl in 10 min to
![Page 120: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/120.jpg)
105
elute the stalk proteins which was followed by a linear increase of KCl concentration to 1
M in another 5 min to elute the retained proteins. Fractions were monitored by UV
detection at 260 nm and then analyzed by SDS-polyacrylamide gel electrophoresis
(Fig. 2.24). The chromatogram shows two separate peaks for wild type MRPL10 –
MRPL12 construct in agreement with our previous purification analysis (blue line in
Fig. 2.24), confirming the additional stable complex formation with chaperones (63).
However, the chromatography profiles for MRPL10 lysine mutants did not overlap with
that of the wild type sample possibly because of different amounts of MRPL12 bound to
MRPL10 lysine mutants, which confirms the importance of these lysine residues in
maintaining the MRPL10-MRPL12 interactions (Fig. 2.24). For this reason, we
performed immunoblotting assays using the His-tag antibody to ensure equal amounts of
MRPL10 were provided in in vitro translation assays using hybrid ribosomes (Fig. 2.25).
![Page 121: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/121.jpg)
106
Figure 2.24: Strong-cation exchange (SCX) chromatography purification of
mitochondrial MRPL10-MRPL12 stalk complex.
Ni-NTA chromatography purified wild type and mutant MRPL10-MRPL12
complexes (Ini) were applied on SCX column to remove contaminants (FT: flow-
through, E1: first fraction) where fractions were monitored with a UV detector at 260 nm
to trace the proteins during application of step gradient of salt, KCl (dashed line). In the
elution profile, stalk complexes containing MRPL10 wild type (WT) were labeled with
blue solid line and lysine mutants, Ala (A), Gln (Q), Arg (R) were marked in black, red,
and green, respectively. Fractions were analyzed on SDS-polyacrylamide gels to locate
MRPL10-MRPL12 complexes.
*: Fractions were combined and dialyzed to be used in activity assays.
![Page 122: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/122.jpg)
107
The MRPL10-MRPL12 complexes purified from SCX-column were used in the
reconstitution of hybrid ribosomes in order to assess their roles in poly(U)-directed
poly(Phe) synthesis in the presence of [14C]-tRNAPhe and the mammalian mitochondrial
elongation factors EF-Tumt and EF-G1mt (77). SCX-column fractions containing
MRPL10-MRPL12 complexes were combined and analyzed on the same SDS-
polyacrylamide gel to examine the degree of MRPL12 binding to MRPL10 lysine
mutants. Wild type MRPL10 displays the highest amount of MRPL12 retained during
purification followed by Q mutant mimicking hyperacetylation status and by the A
mutant. The amount of MRPL12 bound to MRPL10 was reduced in the R mutant,
hypoacetylated state of the protein (Fig. 2.25). This finding suggests that
acetylation/deacetylation of these lysine residues might be critical in terms of modulating
the L7/L12 stalk composition to regulate mitochondrial translational activity. In order to
examine this possibility, bacterial ribosomes lacking L10 and L12 (stripped ribosomes,
70S-str) were prepared by sedimenting ribosomes in the presence of 1 M NH4Cl and 50
% ethanol at 37oC to selectively remove these proteins (39,63). After incubation of the
purified mitochondrial MRPL10-MRPL12 complexes with the stripped ribosomes, we
recovered hybrid bacterial ribosome containing the mitochondrial L7/L12 stalk by
ultracentrifugation through a 30 % sucrose cushion as described in Materials and
Methods (63). In order to determine the activity of these hybrid ribosomes, polyU-
directed in vitro translation assays were performed as described previously (37,76,77). As
shown in Fig. 2.25, we used the activity of the reconstituted ribosome with recombinant
bacterial L10 and L12 to compare the activities of ribosomes reconstituted with the
![Page 123: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/123.jpg)
108
corresponding MRPL10-MRPL12 complexes. While bacterial stalk proteins recovered
the translational activity of ribosomes, mitochondrial stalk complexes did not restore the
poly-(Phe) synthesis activity which was similar to the inactive stripped ribosome level
(Fig. 2.25). It is possible that impurities and improperly folded MRPL10-MRPL12
complex were probably the factors affecting the activity of reconstituted ribosomes.
Purification of MRPL10 is challenging because of its hydrophobicity. Providing
MRPL12 in the same expression system improved its solubility and recovery at the
affinity chromatography purification step. However, proteins co-purified with MRPL10-
MRPL12 complex, such as groEL, HSP70, and EF-P, were probably reducing the
exposure of His-tag on MRPL10 to Ni-NTA resin, which decreased the amount of
purified MRPL10. These chaperon proteins might be associated with MRPL10-MRPL12
complex due to improper folding of overexpressed protein (s), which might also affect
their activity in in vitro translation assays. Removal of the co-purified proteins by SCX-
chromatography possible exposed hydrophobic regions on MRPL10 and its mutants to
induce protein aggregation. In addition, dialysis of protein preparations to remove
imidazole and salt after each Ni-NTA- and SCX-chromatography steps, respectively,
caused precipitation of MRPL10-MRPL12 complex.
These experiments will be repeated with highly purified stalk complex proteins to
demonstrate the effect of the acetylated lysine residues on MRPL12 binding and
ribosomal activity. To improve purification of MRPL10-MRPL12 by using Ni-NTA
affinity chromatography, bacterial cell lysate will be prepared in the presence of
additional ATP and magnesium salts since the association of contaminating proteins
might be reduced in this way (84). Another approach was the immunoprecipitation of
![Page 124: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/124.jpg)
109
MRPL10 by using His-tag antibody. However, immunoprecipitation of the complex
using the bacterial lysate containing overexpressed MRPL10-MRPL12 complex or the
Ni-NTA chromatography purified complex, did not enrich MRPL10-MRPL12 complex
due to the lack of binding specificity of the MRPL10-MRPL12 complex to the His-tag
antibody (data not shown). In addition, extended time of incubations with antibody and
solutions might perturb the activity of the MRPL10.
![Page 125: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/125.jpg)
110
Figure 2.25: Poly(U)-directed in vitro translation assays using hybrid ribosomes.
Stripped ribosomes (35 pmol of 70S-str) were reconstituted with bacterial L10 (70
pmol of bacL10) and L12 (280 pmol of bacL12) or corresponding mitochondrial L10 (70
pmol of MRPL10) and L12 (280 pmol of MRPL12) stalk proteins purified from SCX
column at 37oC for 15 min. The poly(U)-directed in vitro translation assay was carried
out at 37oC for 30 min and stopped by cold 5 % trichloroacetic acid addition on ice for 5
min. After incubation at 90oC for 10 min, samples were filtered through the nitrocellulose
membrane and the amount of [14C]-labeled-poly(Phe) was quantitated using liquid
scintillation counter. Graph was expressed as the relative percent of synthesized
poly(Phe) compared to the control bacterial ribosome (70S).
![Page 126: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/126.jpg)
111
2.5 Conclusions and Future Directions
Mitochondria are the essential organelle for eukaryotic cells since they generate
most of the ATP through oxidative phosphorylation (OXPHOS) for cellular metabolism.
Slower metabolic rates with reduction in OXPHOS and ATP production is correlated
with lower caloric intake resulting in an extended lifespan (186). SIRT3, mitochondrial
NAD+-dependent deacetylase, is implicated in those effects by deacetylating
mitochondrial proteins (108,109,113,117,143,172). Similarly, SIRT3 may be involved in
coordinating the activity of mitochondrial protein synthesis machinery through MRPL10
deacetylation in response to the changes in the [NADH]/[NAD+] ratio in the mammalian
mitochondria. Our findings suggest that mitochondrial protein synthesis is regulated by
NAD+-dependent activity of SIRT3 on MRPL10 acetylation level in bovine ribosomes.
This hypothesis is supported by employing SIRT3 knock-out mice. Liver mitochondria
isolated from SIRT3 knock-out mice liver displays hyperacetylated MRPL10 and/or
ribosomes which results in more protein synthesis, leading to an increase in the
expression of mitochondrially-encoded components of the oxidative phosphorylation.
Conversely, HIB1B cells overexpressing SIRT3 demonstrates deacetylation of MRPL10
and/or ribosomes which may impair the synthesis of mitochondrially-encoded proteins,
and therefore, reduces the rate of oxidative phosphorylation by lowering the expression
of essential subunits of respiratory chain complexes. The analysis of mitochondrial
ribosomes from SIRT3 knock-out mice and HIB1B cells overexpressing SIRT3 displays
that changes in MRPL12 binding to the ribosomes is an important factor involved in the
acetylation mediated regulation of protein synthesis in ribosomes.
![Page 127: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/127.jpg)
112
Multiple copies of MRPL12 dimers interact with MRPL10 to form the
mitochondrial L7/L12 stalk. This stalk region is evolutionary conserved and essential for
the recruitment of elongation factors EF-Tu and EF-G during protein synthesis (187,188).
In E. coli, the L7/L12-stalk is composed of four copies of L12 bound to L10 per ribosome
(156). On the other hand, in T. maritima the L7/L12 stalk contains a copy of L10 and to
six copies of L12 as three dimers per ribosome (61). Bacterial L10 has a globular N-
terminal and a flexible C-terminal α-helix domain involved in binding to L11 and binding
of L12 dimers, respectively. In the mammalian mitochondrial ribosome; however, the
composition of the L7/L12 stalk and the nature of the MRPL10 and MRPL12
interaction(s), in particular the role of MRPL10 acetylation on the composition of the
stalk and interaction of proteins forming the stalk is not known. Acetylation of L12 at the
N-terminal end was shown to increase the interaction and stability between the stalk
proteins in E. coli due to increased hydrophobicity by acetylation (135). Intriguingly,
acetylation of the bacterial ribosomal L10 is also reported and the acetylated lysine
residues in both bacterial and mitochondrial L10 are mapped to the N-terminal globular
domain of L10 towards the elongation factor binding cavity under the L7/L12 stalk
region. The bacterial and mitochondrial L12 homologs have a highly conserved lysine
rich CTDs, therefore, packing this lysine-rich domain into a lysine-rich L10 surface
would not be possible due to charge repulsion. In this scenario, having a neutralized L10
surface by acetylation would stabilize the lysine-rich CTD of L12 between the N- and C-
terminal domains of L10 and L11, respectively (Fig. 5.1). Based on these results and our
findings in SIRT3 knock-out mice and HIB1B cells overexpressing SIRT3, it is feasible
to postulate that the SIRT3-dependent reversible acetylation of MRPL10 regulates
![Page 128: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/128.jpg)
113
mitochondrial protein synthesis by modulating protein-protein, specifically MRPL10-
MRPL12, interactions in the L7/L12 stalk region of the ribosome.
In order to confirm the importance of mitochondrial L7/L12 stalk proteins,
MRPL10 and MRPL12, in mitochondrial translation, shRNA mediated knockdown of
MRPL12 and overexpression of MRPL10 and MRPL12 was performed in HEK293T
cells. Reduction of the de novo synthesized mitochondrial-encoded thirteen proteins in
pulse labeling assay confirms the importance of MRPL12 in ribosomal activity.
Conversely, the cells overexpressing MRPL10 and MRPL12 displays elevated labeling of
synthesized products, which highlights the implication of these L7/L12 stalk proteins in
protein synthesis in mitochondria. To determine the modulation of MRPL12 binding to
MRPL10 by reversible acetylation and its effect on mitochondrial translation, Gln and
Arg mutants at selected three acetylated residues, Lys124, Lys169, and Lys196,
mimicking hyperacetylation and hypoacetylation, respectively, were employed in in vivo
studies. The triple Gln mutation of MRPL10 is expected to demonstrate the effect of
acetylation since it would not introduce the charge found on Lys residues and this would
possibly provide a stronger MRPL10-MRPL12 interaction. Conversely, Arg mutant
provides the charge on its side chain and is anticipated to reduce MRPL12 binding to
ribosome and thus mitochondrial translation similar to the effect of nonacetylated Lys
residues. The triple Ala mutant of MRPL10 might also display reduced binding of
MRPL12 to the mitochondrial ribosome due to the disruption of protein-protein
interactions since Ala does not have a long side chain as Lys does. However, the pulse
labeling and cell growth rate assays with the cells overexpressing MRPL10 mutants did
not reveal significant effect on mitochondrial protein synthesis and cell proliferation
![Page 129: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/129.jpg)
114
compared to the cells containing wild type MRPL10. One possibility of not seeing a
significant change between the cells might be the different import rate into mitochondria
and also different incorporation level of MRPL10 mutants into mitochondrial ribosomes.
It might be challenging to get the same level of incorporation of MRPL10 mutants into
the mitochondrial ribosomes since they would incorporate endogenous MRPL10 to
overcome the defect in protein synthesis caused by the MRPL10 constructs. However,
depletion of endogenous MRPL10 in these cells might enforce mitochondrial ribosomes
to harbor MRPL10 constructs and improve the effect of Lys mutations on MRPL12
binding to ribosomes, mitochondrial protein synthesis, and therefore cell growth in vivo.
Furthermore, there may be additional acetylated lysine residues on MRPL10 and their
mutants might also be required to demonstrate the significant effect of lysine residues
involved in the modulation of MRPL10 interaction with MRPL12 on the stalk. On the
other hand, the in vitro approach employing hybrid ribosomes to assess the effect of
acetylated lysine residues on MRPL10 in MRPL12 binding to the ribosomes and protein
synthesis was not conclusive. The MRPL10-MRPL12 complexes used in the
reconstitution of hybrid ribosomes contain impurities and possibly improperly folded
MRPL10 constructs, which might affect the activity of hybrid ribosomes in poly(U)-
directed poly(Phe) synthesis assays. The experiments to improve the purification of
MRPL10-MRPL12 complex and activity assays are under progress to determine the
effect of acetylated Lys residues and their mutants in MRPL12 binding and protein
synthesis. Instead of the reconstitution of hybrid ribosomes with purified MRPL10-
MRPL12 complexes, bacterial ribosomes which incorporate these constructs during their
overexpression might also be used in poly(U)-directed in vitro translation assays. As
![Page 130: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/130.jpg)
115
described in our in vivo approach, different incorporation levels of the MRPL10
constructs into bacterial ribosomes as opposed to wild type MRPL10 and RPL10 might
result in ambiguous results with reduced effect of the MRPL10 mutants in protein
synthesis. Future studies may involve the deletion of bacterial RPL10 (and possibly
RPL12) with recombination techniques and the expression of MRPL10-MRPL12
complexes (189). In this system, the stability and activity of MRPL10 constructs would
be improved since they are incorporated into ribosomes in the bacterial cells.
Overall, our preliminary in vivo and in vitro studies demonstrated that acetylated
Lys residues on MRPL10 might possibly modulate MRPL12 binding to ribosomes
resulting in the regulation of mitochondrial translation and cell growth. These methods
have laid out the initial framework to uncover the significant role of the MRPL10
acetylation in MRPL12 binding to the ribosome. Reversible acetylation of MRPL10 may
be one of the key regulatory mechanisms that modulates MRPL12 binding to the
ribosomal stalk and the synthesis of mitochondrially-encoded essential proteins of
respiratory chain complexes. This regulation is possibly mediated by SIRT3, ribosome
associated NAD+-dependent deacetylase, which monitors the changes in mitochondrial
metabolism through the [NADH]/[NAD+] ratio. Increased levels of NAD+ by caloric
restriction will stimulate SIRT3 and it will perform its protective functions in
mitochondria by deacetylating its target proteins. Most of the metabolic enzymes will be
activated to restore the NADH levels for ATP production by OXPHOS. On the other
hand, deacetylation of MRPL10 and decreased MRPL12 on the ribosomes reduce the
mitochondrial translation rate and additional synthesis of respiratory chain components
due to low NADH levels. Conversely, when the NADH level is high, acetylation of
![Page 131: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/131.jpg)
116
MRPL10 triggers the binding of MRPL12 to enhance protein synthesis rate to support the
OXPHOS and ATP production rates.
2.6 Acknowledgment
We would like to thank Dr. Qiang Tong for providing SIRT3 knockout mice liver
mitochondria and HIB1B cells overexpressing SIRT3.
2.7 References
1. Kim, S. C., Sprung, R., Chen, Y., Xu, Y., Ball, H., Pei, J., Cheng, T., Kho, Y., Xiao, H., Xiao, L., Grishin, N. V., White, M., Yang, X. J., and Zhao, Y. (2006) Mol Cell 23(4), 607-618
2. Hallows, W. C., Lee, S., and Denu, J. M. (2006) Proc Natl Acad Sci U S A 103(27), 10230-10235
3. Schwer, B., Bunkenborg, J., Verdin, R. O., Andersen, J. S., and Verdin, E. (2006) Proc Natl Acad Sci U S A 103(27), 10224-10229
4. Gerhart-Hines, Z., Rodgers, J. T., Bare, O., Lerin, C., Kim, S. H., Mostoslavsky, R., Alt, F. W., Wu, Z., and Puigserver, P. (2007) EMBO J 26(7), 1913-1923
5. Jackson, P. J., and Harris, D. A. (1986) Biochem J 235(2), 577-583 6. Dinardo, M. M., Musicco, C., Fracasso, F., Milella, F., Gadaleta, M. N., Gadaleta,
G., and Cantatore, P. (2003) Biochem Biophys Res Commun 301(1), 187-191 7. Scott, I., Webster, B. R., Li, J. H., and Sack, M. N. (2012) Biochem J 443(3), 655-
661 8. Michishita, E., Park, J. Y., Burneskis, J. M., Barrett, J. C., and Horikawa, I.
(2005) Mol Biol Cell 16(10), 4623-4635 9. Onyango, P., Celic, I., McCaffery, J. M., Boeke, J. D., and Feinberg, A. P. (2002)
Proc Natl Acad Sci U S A 99(21), 13653-13658 10. Imai, S., Armstrong, C. M., Kaeberlein, M., and Guarente, L. (2000) Nature
403(6771), 795-800 11. Smith, J. S., Brachmann, C. B., Celic, I., Kenna, M. A., Muhammad, S., Starai, V.
J., Avalos, J. L., Escalante-Semerena, J. C., Grubmeyer, C., Wolberger, C., and Boeke, J. D. (2000) Proc Natl Acad Sci U S A 97(12), 6658-6663
12. Landry, J., Sutton, A., Tafrov, S. T., Heller, R. C., Stebbins, J., Pillus, L., and Sternglanz, R. (2000) Proc Natl Acad Sci U S A 97(11), 5807-5811
![Page 132: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/132.jpg)
117
13. Rose, G., Dato, S., Altomare, K., Bellizzi, D., Garasto, S., Greco, V., Passarino, G., Feraco, E., Mari, V., Barbi, C., BonaFe, M., Franceschi, C., Tan, Q., Boiko, S., Yashin, A. I., and De Benedictis, G. (2003) Exp Gerontol 38(10), 1065-1070
14. Yang, H., Yang, T., Baur, J. A., Perez, E., Matsui, T., Carmona, J. J., Lamming, D. W., Souza-Pinto, N. C., Bohr, V. A., Rosenzweig, A., de Cabo, R., Sauve, A. A., and Sinclair, D. A. (2007) Cell 130(6), 1095-1107
15. Shi, T., Wang, F., Stieren, E., and Tong, Q. (2005) J Biol Chem 280(14), 13560-13567
16. Lombard, D. B., Alt, F. W., Cheng, H. L., Bunkenborg, J., Streeper, R. S., Mostoslavsky, R., Kim, J., Yancopoulos, G., Valenzuela, D., Murphy, A., Yang, Y., Chen, Y., Hirschey, M. D., Bronson, R. T., Haigis, M., Guarente, L. P., Farese, R. V., Jr., Weissman, S., Verdin, E., and Schwer, B. (2007) Mol Cell Biol 24, 8807-8814
17. Miller, J. L., Cimen, H., Koc, H., and Koc, E. C. (2009) J Proteome Res 8(10), 4789-4798
18. Wallace, D. C. (2005) Annu Rev Genet 39, 359-407 19. Patel, V. B., Cunningham, C. C., and Hantgan, R. R. (2001) J Biol Chem 276(9),
6739-6746 20. O'Brien, T. W., Fiesler, S., Denslow, N. D., Thiede, B., Wittmann-Liebold, B.,
Mouge, E., Sylvester, J. E., and Graack, H.-R. (1999) JBC 274, 36043-36051 21. Koc, E. C., Burkhart, W., Blackburn, K., Moseley, A., Koc, H., and Spremulli, L.
L. (2000) J Biol Chem 275(42), 32585-32591 22. Koc, E. C., Burkhart, W., Blackburn, K., Moseley, A., and Spremulli, L. L.
(2001) J.Biol.Chem. 276, 19363-19374 23. Suzuki, T., Terasaki, M., Takemoto-Hori, C., Hanada, T., Ueda, T., Wada, A., and
Watanabe, K. (2001) J Biol Chem 276(24), 21724-21736 24. Koc, E. C., Burkhart, W., Blackburn, K., Schlatzer, D. M., Moseley, A., and
Spremulli, L. L. (2001) JBC 276, 43958-43969 25. Sharma, M. R., Koc, E. C., Datta, P. P., Booth, T. M., Spremulli, L. L., and
Agrawal, R. K. (2003) Cell 115(1), 97-108 26. O'Brien T, W., O'Brien B, J., and Norman, R. A. (2005) Gene 354, 147-151 27. Miller, C., Saada, A., Shaul, N., Shabtai, N., Ben-Shalom, E., Shaag, A.,
Hershkovitz, E., and Elpeleg, O. (2004) Ann Neurol 56(5), 734-738 28. Kissil, J. L., Cohen, O., Raveh, T., and Kimchi, A. (1999) EMBO J 18(2), 353-
362 29. Chintharlapalli, S. R., Jasti, M., Malladi, S., Parsa, K. V., Ballestero, R. P., and
Gonzalez-Garcia, M. (2005) J Cell Biochem 94(3), 611-626 30. Yoo, Y. A., Kim, M. J., Park, J. K., Chung, Y. M., Lee, J. H., Chi, S. G., Kim, J.
S., and Yoo, Y. D. (2005) Mol Cell Biol 25(15), 6603-6616 31. Miller, J. L., Koc, H., and Koc, E. C. (2008) Protein Sci 17(2), 251-260 32. Wang, Z., Cotney, J., and Shadel, G. S. (2007) J Biol Chem 282(17), 12610-
12618 33. Emdadul Haque, M., Grasso, D., Miller, C., Spremulli, L. L., and Saada, A.
(2008) Mitochondrion 8(3), 254-261
![Page 133: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/133.jpg)
118
34. Zanotto, E., Lehtonen, V., and Jacobs, H. T. (2008) Biochim Biophys Acta 1783(12), 2352-2362
35. Terasaki, M., Suzuki, T., Hanada, T., and Watanabe, K. (2004) J Mol Biol 336(2), 331-342
36. Agrawal, R. K., Linde, J., Sengupta, J., Nierhaus, K. H., and Frank, J. (2001) J Mol Biol 311(4), 777-787
37. Diaconu, M., Kothe, U., Schlunzen, F., Fischer, N., Harms, J. M., Tonevitsky, A. G., Stark, H., Rodnina, M. V., and Wahl, M. C. (2005) Cell 121(7), 991-1004
38. Harms, J. M., Wilson, D. N., Schluenzen, F., Connell, S. R., Stachelhaus, T., Zaborowska, Z., Spahn, C. M., and Fucini, P. (2008) Mol Cell 30(1), 26-38
39. Mohr, D., Wintermeyer, W., and Rodnina, M. V. (2002) Biochemistry 41(41), 12520-12528
40. Subramanian, A. R. (1975) J Mol Biol 95(1), 1-8 41. Griaznova, O., and Traut, R. R. (2000) Biochemistry 39(14), 4075-4081 42. Ilag, L. L., Videler, H., McKay, A. R., Sobott, F., Fucini, P., Nierhaus, K. H., and
Robinson, C. V. (2005) Proc Natl Acad Sci U S A 102(23), 8192-8197 43. Gordiyenko, Y., Deroo, S., Zhou, M., Videler, H., and Robinson, C. V. (2008) J
Mol Biol 380(2), 404-414 44. Papadopoulos, G., Grudinin, S., Kalpaxis, D. L., and Choli-Papadopoulou, T.
(2006) Eur Biophys J 35(8), 675-683 45. Ramagopal, S. (1976) Eur J Biochem 69(1), 289-297 46. Ramagopal, S., and Subramanian, A. R. (1974) Proc Natl Acad Sci U S A 71(5),
2136-2140 47. Frei, C., Galloni, M., Hafen, E., and Edgar, B. A. (2005) EMBO J 24(3), 623-634 48. Marty, L., Taviaux, S., and Fort, P. (1997) Genomics 41(3), 453-457 49. Marty, L., and Fort, P. (1996) J Biol Chem 271(19), 11468-11476 50. Goertzel, B., Pennachin, C., de Alvarenga Mudado, M., and de Souza Coelho, L.
(2008) Rejuvenation Res 11(4), 735-748 51. Chen, Y., Cairns, R., Papandreou, I., Koong, A., and Denko, N. C. (2009) PLoS
One 4(9), e7033 52. Lyng, H., Brovig, R. S., Svendsrud, D. H., Holm, R., Kaalhus, O., Knutstad, K.,
Oksefjell, H., Sundfor, K., Kristensen, G. B., and Stokke, T. (2006) BMC Genomics 7, 268
53. Surovtseva, Y. V., Shutt, T. E., Cotney, J., Cimen, H., Chen, S. Y., Koc, E. C., and Shadel, G. S. (2011) Proc Natl Acad Sci U S A 108(44), 17921-17926
54. Soung, G. Y., Miller, J. L., Koc, H., and Koc, E. C. (2009) J Proteome Res 8(7), 3390-3402
55. Miller, J. L., Cimen, H., Koc, H., and Koc, E.C. (2009) J. Proteome Res. 8(10), 4789-4798
56. Landry, J., and Sternglanz, R. (2003) Methods 31(1), 33-39 57. Cimen, H., Han, M. J., Yang, Y., Tong, Q., Koc, H., and Koc, E. C. (2010)
Biochemistry 49(2), 304-311 58. Yang, Y., Cimen, H., Han, M. J., Shi, T., Deng, J. H., Koc, H., Palacios, O. M.,
Montier, L., Bai, Y., Tong, Q., and Koc, E. C. (2010) J Biol Chem 285(10), 7417-7429
![Page 134: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/134.jpg)
119
59. Chomyn, A. (1996) Methods Enzymol 264, 197-211 60. Jeffreys, A. J., and Craig, I. W. (1976) Eur J Biochem 68(1), 301-311 61. Janssen, A. J., Trijbels, F. J., Sengers, R. C., Smeitink, J. A., van den Heuvel, L.
P., Wintjes, L. T., Stoltenborg-Hogenkamp, B. J., and Rodenburg, R. J. (2007) Clin Chem 53(4), 729-734
62. Birch-Machin, M. A., and Turnbull, D. M. (2001) Methods Cell Biol 65, 97-117 63. Han, M. J., Cimen, H., Miller-Lee, J. L., Koc, H., and Koc, E. C. (2011) Protein
Expr Purif 78(1), 48-54 64. Koc, E. C., Blackburn, K., Burkhart, W., and Spremulli, L. L. (1999) Biochem
Biophys Res Comm 266, 141-146 65. Koc, E. C., Burkhart, W., Blackburn, K., Koc, H., Moseley, A., and Spremulli, L.
L. (2001) Prot.Sci. 10, 471-481 66. Zhang, J., Sprung, R., Pei, J., Tan, X., Kim, S., Zhu, H., Liu, C. F., Grishin, N. V.,
and Zhao, Y. (2009) Mol Cell Proteomics 8(2), 215-225 67. Matthews, D. E., Hessler, R. A., Denslow, N. D., Edwards, J. S., and O'Brien, T.
W. (1982) J Biol Chem 257, 8788-8794 68. Spremulli, L. L. (2007) Methods Mol Biol 372, 265-275 69. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-
Kunstleve, R. W., Jiang, J. S., Kuszewski, J., Nilges, M., Pannu, N. S., Read, R. J., Rice, L. M., Simonson, T., and Warren, G. L. (1998) Acta Crystallogr D Biol Crystallogr 54(Pt 5), 905-921
70. Nakagawa, T., Lomb, D. J., Haigis, M. C., and Guarente, L. (2009) Cell 137(3), 560-570
71. Haigis, M. C., Mostoslavsky, R., Haigis, K. M., Fahie, K., Christodoulou, D. C., Murphy, A. J., Valenzuela, D. M., Yancopoulos, G. D., Karow, M., Blander, G., Wolberger, C., Prolla, T. A., Weindruch, R., Alt, F. W., and Guarente, L. (2006) Cell 126(5), 941-954
72. Ahn, B. H., Kim, H. S., Song, S., Lee, I. H., Liu, J., Vassilopoulos, A., Deng, C. X., and Finkel, T. (2008) Proc Natl Acad Sci U S A 105(38), 14447-14452
73. Jin, L., Galonek, H., Israelian, K., Choy, W., Morrison, M., Xia, Y., Wang, X., Xu, Y., Yang, Y., Smith, J. J., Hoffmann, E., Carney, D. P., Perni, R. B., Jirousek, M. R., Bemis, J. E., Milne, J. C., Sinclair, D. A., and Westphal, C. H. (2009) Protein Sci 18(3), 514-525
74. Wahl, M. C., and Moller, W. (2002) Curr Protein Pept Sci 3(1), 93-106 75. Allen, G. S., Zavialov, A., Gursky, R., Ehrenberg, M., and Frank, J. (2005) Cell
121(5), 703-712 76. Woriax, V., Bullard, J. M., Ma, L., Yokogawa, T., and Spremulli, L. L. (1997)
Biochim Biophys Acta 1352, 91-101 77. Hunter, S. E., and Spremulli, L. L. (2004) Biochemistry 43(22), 6917-6927 78. Gao, Y. G., Selmer, M., Dunham, C. M., Weixlbaumer, A., Kelley, A. C., and
Ramakrishnan, V. (2009) Science 326(5953), 694-699 79. Helgstrand, M., Mandava, C. S., Mulder, F. A., Liljas, A., Sanyal, S., and Akke,
M. (2007) J Mol Biol 365(2), 468-479 80. Wieden, H. J., Wintermeyer, W., and Rodnina, M. V. (2001) J Mol Evol 52(2),
129-136
![Page 135: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/135.jpg)
120
81. Savelsbergh, A., Mohr, D., Kothe, U., Wintermeyer, W., and Rodnina, M. V. (2005) EMBO J 24(24), 4316-4323
82. Mulder, F. A., Bouakaz, L., Lundell, A., Venkataramana, M., Liljas, A., Akke, M., and Sanyal, S. (2004) Biochemistry 43(20), 5930-5936
83. Yang, Y., Cimen, H., Han, M. J., Shi, T., Deng, J. H., Koc, H., Palacios, O. M., Montier, L., Bai, Y., Tong, Q., and Koc, E. C. J Biol Chem 285(10), 7417-7429
84. Thain, A., Gaston, K., Jenkins, O., and Clarke, A. R. (1996) Trends Genet 12(6), 209-210
![Page 136: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/136.jpg)
Chapter 3
Regulation of Succinate Dehydrogenase Activity by SIRT3
This chapter of dissertation was reproduced with permission from Huseyin
Cimen, Min-Joon Han, Yongjie Yang, Qiang Tong, Hasan Koc, and Emine C. Koc.
(2010) Regulation of Succinate Dehydrogenase Activity by SIRT3 in Mammalian
Mitochondria. Biochemistry; 49 (2):304–311. Copyright © 2010 by American Chemical
Society.
![Page 137: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/137.jpg)
122
3.1 Rationale
A member of the sirtuin family of NAD+-dependent deacetylases, SIRT3 was
identified as one of the major mitochondrial deacetylase located in mammalian
mitochondria responsible for deacetylation of several metabolic enzymes and
components of oxidative phosphorylation. Regulation of protein deacetylation by SIRT3
is important for mitochondrial metabolism, cell survival and longevity. In this study, we
identified one of the Complex II subunits, succinate dehydrogenase flavoprotein (SdhA)
subunit, as a novel SIRT3 substrate in SIRT3 knock-out mice. Several acetylated Lys
residues were mapped by tandem mass spectrometry and we determined the role of
acetylation on Complex II activity in SIRT3 knock-out mice. In agreement with SIRT3
dependent activation of Complex I, we observed that deacetylation of SdhA subunit
increased the Complex II activity in wild type mice. In addition, we treated K562 cell
lines with nicotinamide and kaempferol to inhibit deacetylase activity of SIRT3 and
stimulate SIRT3 expression, respectively. Stimulation of SIRT3 expression decreased the
acetylation of SdhA subunit and increased Complex II activity in kaempferol treated cells
compared to control and nicotinamide treated cells. Evaluation of acetylated residues in
the SdhA crystal structure from porcine and chicken suggest that acetylation of
hydrophilic surface of SdhA may control the substrate entry to the active site of the
protein and regulate the enzyme activity. Our findings constitute the first evidence for the
regulation of Complex II activity by the reversible acetylation of the SdhA subunit as a
novel substrate of the NAD+- dependent deacetylase, SIRT3.
![Page 138: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/138.jpg)
123
3.2 Introduction
Reversible acetylation of mitochondrial proteins is critical for regulation of many
biological processes, including oxidative phosphorylation and the Krebs cycle (1-7).
Flavoprotein of the succinate dehydrogenase complex (Complex II SdhA subunit) was
identified as one of the acetylated proteins of mice liver mitochondria in two independent
high throughput mapping of acetylated proteins by tandem mass spectrometry (2,7).
Complex II or succinate dehydrogenase (SDH) is found as an inner membrane-bound
enzyme complex and it is the only enzyme that participates in both the Krebs cycle and
oxidative phosphorylation in mitochondria. It has four different protein subunits;
hydrophilic subunits SdhA and SdhB facing the matrix side of the inner membrane and
hydrophobic subunits, SdhC and SdhD, tethering the complex in the phospholipid
membrane. SdhA is a 70 kDa large flavoprotein subunit containing covalently bound
FAD and substrate binding site for the entry point of electrons to Complex II. SDH plays
such an important role in the mitochondria, that severe deficiency of this enzyme is
incompatible with life. However, point or milder mutations in the C-terminal domain of
SdhA lead to Leigh syndrome and various neurodegenerative disorders (8). Mutations of
the other SDH subunits containing Fe-S cofactors have been associated with generation
of reactive oxygen species causing tumor formation (9).
Post-translational modifications of SdhA by phosphorylation at tyrosine residues
and acetylation at lysine residues were previously reported (2,7,10). Interestingly, six
acetylated lysine residues in SdhA were mapped in the LC-MS/MS analysis of well-fed
rat mitochondria in two independent studies (2,7). However, neither enzymes responsible
![Page 139: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/139.jpg)
124
for reversible acetylation and phosphorylation nor their regulatory roles of these post-
translational modifications on SdhA or Complex II activity are known. Several members
of the class III histone deacetylases (sirtuins) SIRT3, SIRT4, and SIRT5 have been found
to reside in mitochondria (6,11,12). Sirtuins use NAD+ as a cosubstrate, and both SIRT3
and SIRT4 are required to maintain cell survival after genotoxic stress in a NAD+-
dependent manner, and genetic variations in the human SIRT3 gene have been linked to
longevity (13,14). We have previously shown that SIRT3 expression in adipose tissue is
increased by caloric restriction and cold exposure (2,15). Mitochondrial acetyl-CoA
synthetase 2 and glutamate dehydrogenase (GDH) are the two key metabolic enzymes
regulated through deacetylation by SIRT3 (1,6,16). Thus, SIRT3 was determined to be
the major deacetylase that modulates mitochondrial function in response to
[NADH]/[NAD+] ratio by regulating the activity of key metabolic enzymes (6,12,16,17).
In addition to metabolic enzymes, nuclear encoded subunits of the electron
transport chain complexes and ribosomes responsible for the synthesis of 13 essential
proteins of the oxidative phosphorylation were found to be regulated by reversible
acetylation (2). In our recent studies we demonstrated that the mitochondrial ribosomal
protein MRPL10 is acetylated and its deacetylation by the NAD+-dependent deacetylase
SIRT3 regulates mitochondrial protein synthesis (18). Additionally, Complex I subunit
NDUFA9 is also determined to be a SIRT3 substrate and acetylation/deacetylation of this
protein is proposed to regulate and maintain basal ATP levels in mammalian
mitochondria (17). However, contribution of Complex II acetylation was overlooked on
oxidative phosphorylation and ATP production in the same study (17).
![Page 140: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/140.jpg)
125
Here, we confirmed that one of the subunits of Complex II, SdhA, is indeed a
highly acetylated protein and it is a novel SIRT3 substrate as shown in SIRT3 knock-out
mice using various proteomic techniques. We have also determined the SIRT3-dependent
activation of Complex II in wild-type mice and in cells over-expressing SIRT3. Our
results reported in this study suggest a more global role for SIRT3 in regulating oxidative
phosphorylation by reversible acetylation of the Complex II subunit SdhA, and therefore,
ATP production in mammalian mitochondria.
3.3 Materials and Methods
3.3.1 Isolation of Mitochondria from Mice Liver and Enrichment of Complex II
SIRT3 knock-out mice were obtained from the Texas Institute for Genomic
Medicine (Houston, TX, USA). Briefly, these mice were produced by generating
embryonic stem (ES) cells (Omnibank no. OST341297) bearing a retroviral promoter trap
that functionally inactivates one allele of the Sirt3 gene, as described previously (19).
Liver tissue obtained from SIRT3 knock-out (Sirt3-/-), wild-type (Sirt3+/+), and
heterozygote (Sirt3+/-) mice was resuspended in an isotonic mitochondrial buffer (MB)
(210 mM mannitol, 70 mM sucrose, 1 mM EDTA, 10 mM HEPES-KOH pH 7.5),
supplemented with protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 50 µg/ml
leupeptin), and then homogenized in a Dounce homogenizer (Wheaton) on ice. The
suspension was centrifuged at 400 x g on a microcentrifuge (ThermoForma) at 4°C. This
![Page 141: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/141.jpg)
126
procedure was repeated twice, and supernatants were centrifuged at 10,000 g at 4°C for
10 min to pellet mitochondria. After the mitochondrial pellets were lysed in a buffer
containing 0.26 M sucrose, 20 mM Tris-HCl, pH 7.6, 40 mM KCl, 20 mM MgCl2, 0.8
mM EDTA, 0.05 mM spermine, 0.05 mM spermidine, 6 mM β-mercaptoethanol, and 1.6
% Triton X-100, mitochondrial lysates were loaded on to 34 % sucrose cushions and
centrifuged at 100,000 g at 4°C for 16 h. The cushion layers enriched for acetylated
proteins were precipitated with acetone.
3.3.2 Two Dimensional-Gel and Immunoblotting Analysis
Acetone precipitated protein pellets were resuspended in Destreak rehydration
buffer (Amersham Biosciences Inc.) and loaded onto the IPG strips ( pI 3-10) (Bio-Rad
Laboratories, Inc.). IPG strips were rehydrated overnight and run on the Ettan IPGphor
(Amersham Biosciences Inc) according to the manufacturer’s protocols. After running the
first dimension the strips were equilibrated in 6 M urea, 0.375 M Tris-HCl pH 8.8, 2 %
SDS, 20 % glycerol, and 2 % (w/v) DTT for 10 min. The strips then were equilibrated in
the equilibration buffer containing 2.5 % (w/v) iodoacetamide and loaded onto the second
dimension SDS-polyacrylamide gel. The gels were either stained with Coomassie Blue or
transferred to a PVDF membrane to be probed with acetyl Lys antibody at a 1:3000
dilution or SIRT3 antibody at a 1:1000 dilution (Cell Signaling Technology Inc.), a
monoclonal SdhA (Complex II subunit 70 kDa Fp) antibody at a 1:5000 dilution
(MitoSciences Inc.) or β-Actin antibody at a 1:5000 dilution (Abcam Inc.). The
secondary antibody was ImmunoPure antibody goat anti-mouse IgG (Pierce
![Page 142: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/142.jpg)
127
Biochemicals Inc.) at a 1:5000 dilution or goat anti-rabbit IgG at a 1:1000 dilution or
Affinipure rabbit anti-mouse IgG, Rabbit anti-goat IgG, or goat anti-rabbit IgG (Jackson
Immuno Research) each at 1:10,000 dilution, followed by development with the
SuperSignal West Pico Chemiluminescent Substrate (Pierce Biochemicals Inc.) according
to the protocol provided by the manufacturer.
3.3.3 Mass Spectrometric Identification and Mapping of Acetylation Sites
SDS-polyacrylamide gel protein bands or 2D-gel spots corresponding to
acetylated proteins were excised and digested in-gel with trypsin prior to liquid
chromatography tandem mass spectrometry (capLC-MS/MS) analysis. The capLC-
MS/MS analysis performed by an LTQ mass spectrometer equipped with a nano-
electrospray ionization source and Surveyor MS Pump Plus HPLC system and Surveyor
Micro AS autosampler (ThermoFisher Co.). The in-gel tryptic digests (3-5 µL) were
injected and loaded onto a peptide trap (MiChrom peptide CapTrap, C8 like resin, 0.3
mm x 1 mm, 5µm) over 3 min at 10 µL/min for on-line desalting and concentration. The
peptide trap was then placed in line with the analytical column, a PicoFrit column (0.075
mm x 150 mm) packed in-house with Supelco's Wide Bore C18 (5 µm, 300 Å) resin. The
column was eluted at 250 nL/min using a gradient that consisted of 0.1 % formic acid
(Solvent A) and 0.1 % formic acid in acetonitrile (Solvent B). The peptides were eluted
by ramping the solvent B to 40 % over 30 min. Tandem MS spectra were acquired for
ions above a predetermined intensity threshold using the automated data-dependent
acquisition. The spectra were processed and searched against the protein sequence
![Page 143: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/143.jpg)
128
database Swiss-Prot using a locally maintained Mascot 2.2 (Matrix Science) and
Proteome Discoverer 1.0 (ThermoFisher) search engines to identify proteins and
modifications. Mass tolerance was 3 amu and 2 amu for precursor and product ions,
respectively. Up to 2 missed cleavages were allowed for digestion by trypsin and
methionine oxidation (+16 Da) and lysine acetylation (+42 Da) were considered as
variable modifications.
3.3.4 Cell Culture
Approximately, 7 x 107 K562 (human chronic myelogenous leukemia cell line)
cells was grown in RPMI 1640 medium (Mediatech Inc.) supplemented with 10 % (v/v)
bovine calf serum (Hyclone) and 100 IU/ml penicillin and 100 μg/ml streptomycin, at
37oC and 5 % CO2 in a humidified atmosphere. Cells were treated with nicotinamide
(Calbiochem) or kaempferol (Sigma, St. Louis, MO) for 16 or 48 h at 10 mM or 50 µM
final concentrations, respectively. For immunoblotting, cell pellets were lysed in a buffer
containing 50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 0.5 %
NP-40, 0.1 % SDS, supplemented with protease inhibitor cocktail (Sigma-Aldrich).
After incubation on ice for 10 min, soluble protein fraction was collected by
centrifugation at 14,000 g at 4°C for 15 min.
![Page 144: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/144.jpg)
129
3.3.5 Complex II Enzymatic Activity Assay
Mitochondria and K562 cell pellets prepared as indicated above were lysed in a
buffer containing 300 mM mannitol, 20 mM sodium phosphate, pH 7.2, 10 mM KCl, 5
mM MgCl2, and 2 mg/ml dodecyl-β-D-maltoside. Preincubation of varying amounts of
mitochondrial and K562 cell lysates in a buffer containing 300 mM mannitol, 20 mM
sodium phosphate, pH 7.2, 10 mM KCl, 5 mM MgCl2, 50 mM sodium succinate, 40 mM
sodium azide, prior to the addition of 50 µM 2,6-dichloroindophenolate in order to fully
activate succinate dehydrogenase. Complex II enzymatic activity was recorded by
monitoring the reduction of 2,6-dichloroindophenolate at 600 nm. The rate is calculated
by dividing the absorbance difference between two linear points by the time point
difference [Rate = (absorbance 1 – absorbance 2) / (time 2 – time 1) (20).
3.3.6 Statistical Analysis
Results are expressed as means ± SD of at least three separate experiments.
Statistical difference between test groups was analyzed by one-way ANOVA test and
significance was defined at P<0.05.
![Page 145: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/145.jpg)
130
3.4 Results and Discussion
3.4.1 Succinate Dehydrogenase is Acetylated and SIRT3 is Responsible for its
Deacetylation
We have recently identified acetylated and phosphorylated protein(s) of
mitochondrial ribosomes using a combination of immunoblotting and capillary LC-
MS/MS analysis and identified NAD+-dependent SIRT3 as the deacetylase responsible
for deacetylation of MRPL10 (18,21,22). Using a similar strategy, we identified
acetylated proteins specifically deacetylated by SIRT3 in wild type and SIRT3 knock-out
mice liver mitochondria to determine SIRT3 substrates. For this purpose, mitochondria
were isolated from SIRT3 knock-out (Sirt3-/-), wild-type (Sirt3+/+), and heterozygote
(Sirt3+/-) mouse liver mitochondria. Acetylated proteins in mitochondrial lysates were
detected by immunoblotting performed with acetyl-Lys antibody, which revealed two
major protein bands at around ~70 kDa and ~55 kDa with an increased level of
acetylation in SIRT3 knock-out mice mitochondrial lysate as indicated by arrows
(Fig. 3.1A). Our findings suggest that these two proteins are potential substrates of
NAD+-dependent SIRT3 since they were highly acetylated in the absence of SIRT3
expression in knock-out mice (Fig. 3.1A). The lack of SIRT3 expression in the whole
liver or liver mitochondria from the SIRT3 knock-out mice was confirmed by
immunoblotting analysis (data not shown) (23).
![Page 146: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/146.jpg)
131
Figure 3.1A-B: Detection of SdhA as a novel SIRT3 substrate in SIRT3 knock-out
mice liver mitochondria.
A) Increased acetylation of mitochondrial proteins was detected in mitochondrial
lysates by immunoblotting with acetyl Lys (N-acetyl K) antibody. As a control for equal
loading, protein blot was developed with Hsp60 antibody. B) Approximately, 2 mg
of Sirt3−/− mice liver mitochondrial lysate were layered on 34 % sucrose cushion and
fractioned into five separate layers (the top is 1 and bottom is 5). Equal volumes of each
fraction were separated on SDS-polyacrylamide gel and acetylated proteins in each
fraction were detected by immunoblotting analysis. The total Sirt3−/− mice liver
mitochondrial lysate (ML) layered on the cushion was also analyzed to locate the
acetylated proteins in the fractions. Arrows show the location of SIRT3 substrates
glutamate dehydrogenase (GDH) and the flavoprotein subunit of succinate
dehydrogenase (SdhA).
![Page 147: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/147.jpg)
132
Figure 3.1C: Identification of SdhA acetylation in SIRT3 knock-out mice liver
mitochondria.
C) Approximately, 50 μl of fraction 3 from Sirt3+/+ or Sirt3−/− mice liver
mitochondria was separated on 2D-polyacrylamide gels and acetylated proteins were
detected with acetyl Lys (N-acetyl K) antibody. The acetylated 2D-gel spots
corresponding to the Coomassie Blue-stained gel spots were digested in-gel and
identified by mass spectrometry. The protein identification determined by mass
spectrometry was confirmed by immunoblotting using SdhA antibody.
![Page 148: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/148.jpg)
133
To identify the proteins in these bands and simplify the protein content for 2D-gel
separation, mitochondrial lysate obtained from SIRT3 knock-out mice was fractionated
on a 34 % sucrose cushion containing nonionic detergent Triton-X100. Immunoblotting
analysis of fractions showed that the two major acetylated proteins at ~70 and ~55 kDa
were in fractions 3 and 4, respectively, implying the presence of these proteins in large
protein complexes (Fig. 3.1B). For the identification of 70 kDa proteins, 2D-gel
electrophoresis was performed using fraction 3, and protein blot was probed with acetyl-
Lys antibody (Fig. 3.1C). Protein bands corresponding to acetylated protein detected in
2D-gel were excised, digested in-gel with trypsin, and analyzed by cap LC-MS/MS for
identification. The mass spectrometric analyses of the 2D-gel spots revealed the presence
of the flavoprotein subunit of succinate dehydrogenase (SdhA) in ~70 kDa protein spot
(Table 3.1). The other protein was identified as glutamate dehydrogenase (GDH) using
the same approach. Acetylation of glutamate dehydrogenase and role of SIRT3 on its
deacetylation was previously reported (16). Therefore, we focused our efforts in
determining the acetylation and deacetylation of SdhA in mitochondria obtained from
SIRT3 knock-out and wild type mice. In order to confirm the deacetylation of SdhA by
SIRT3, immunoblotting and Coomassie Blue-stained gels of protein lysates were
compared (Fig. 3.1C). Even though the SdhA signals obtained by its specific antibody in
both SIRT3 knock-out and wild type fractions were comparable, the acetylation signal
significantly increased in mitochondrial fraction from SIRT3 knock-out mice (Fig. 3.1C).
This observation supports the possibility that deacetylation of SdhA is due to the
expression of endogenous SIRT3 in wild type mice mitochondria while the absence of
![Page 149: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/149.jpg)
134
SIRT3 expression in knock-out mice causes hyper acetylation of the SdhA subunit
(Fig. 3.1C).
In addition to confirming the acetylation of the SdhA subunit by immunoblotting,
one of the acetylated tryptic peptides was also identified with a Mascot score of 74 in the
capLC-MS/MS analysis of the 2D-gel spots that was previously detected. The collision-
induced dissociation (CID) spectrum of the acetylated peptide, AFGGQSLacKFGK, is
given in Fig. 3.2A. In high throughput analysis of acetylated proteins from well-fed rat
liver mitochondria, several other acetylated lysines were identified (1-7). Alignment of
these acetylated peptides with the conserved regions in several other mammalian and
chicken mitochondrial forms and Eshcerichia coli SdhA shows that the acetylated lysines
are highly conserved in these proteins (Fig. 3.2B) (24). To demonstrate the location of
acetylated lysines in the SdhA subunit, we modeled Complex II structure using the
coordinates of the chicken mitochondrial Complex II (Fig. 3.2C). In this structure,
conserved acetylated lysine residues (K179, K485, K498, and K538) in the mouse
sequence are labeled as red surfaces in the SdhA subunit (Fig. 3.2B and C). All these
residues are located on the hydrophilic surface of the subunit supporting the reversible
acetylation of these residues by changes in [NADH]/[NAD+] ratios.
![Page 150: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/150.jpg)
135
Courtesy of Dr. H. Koc.
Table 3.1: Peptides detected from tryptic digests of protein band corresponding to
acetylation signal in SIRT3 knock-out mice mitochondria by capLC-MS/MS
analysis.
Peptide Sequence m/z Mascot Score ISQLYGDLK 1036.6 38 HTLSYVDIK 1075.6 41 WHFYDTVK 1095.6 48 NTVIATGGYGR 555.4 83 SMQNHAAVFR 589.2 66
AFGGQSLKacFGK 592.2 74 KHTLSYVDIK 602.8 57 AKNTVIATGGYGR 655.2 82 GEGGILINSQGER 666.2 84 VTLEYRPVIDK 667.3 63 TGHSLLHTLYGR 678.2 88 ANAGEESVMNLDK 698.2 98 VDEYDYSKPIQGQQK 899.8 82 VRVDEYDYSKPIQGQQK 1027.4 102 NTVIATGGYGRTYFSCTSAHTSTGDGTAMVTR 1102.1 41
![Page 151: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/151.jpg)
136
Figure 3.2A: The collision-induced dissociation (CID) spectrum of the acetylated
peptide.
A) The CID spectrum of acetylated peptide detected in capLC-MS/MS analysis of
2D-gel spot of SdhA from SIRT3 knock-out mice mitochondria. Courtesy of Dr. H. Koc.
![Page 152: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/152.jpg)
137
Figure 3.2B: Primary sequence alignment of acetylated peptides from mice SdhA
and its homologs from different species.
B) Acetylated peptides of mouse SdhA were aligned with corresponding residues
from human, bovine, pig, chicken, and E. coli. (*) denotes the acetylated Lys residues
detected in the capLC-MS/MS analysis. The alignment was created with CLUSTALW
program in Biology Workbench and displayed in BOXSHADE.
![Page 153: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/153.jpg)
138
Figure 3.2C: Crystal structure model of the chicken SdhA.
C) Crystal Structure of chicken SdhA (Protein Databank entry 1YQ3) was used to
represent the four subunits SdhA (green), SdhB (cyan), SdhC (pink), and SdhD (yellow).
The conserved Lys residues found to be acetylated in mouse SdhA (shown by asterisks in
B) are colored in red. Courtesy of Dr. E. Koc.
![Page 154: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/154.jpg)
139
3.4.2 Role of Hyperacetylation of SdhA in Complex II Activity
In order to determine the effect of acetylation on oxidation of succinate to
fumarate by Complex II activity, we measured the oxidation of 2,6-
dichloroindophenolate (DCIP) in mitochondrial suspensions obtained from SIRT3 knock-
out and wild type mice. First, mitochondrial suspensions obtained from these mice were
separated on a 12 % SDS-polyacrylamide gel and evaluated for the SdhA, Hsp60, and
acetylation levels by immunoblotting with specific antibodies. Although the same amount
of SdhA and Hsp60 were loaded in the gels, the degree of acetylation was much higher in
mitochondrial suspension from SIRT3 knock-out mice compared to wild type mice
(Fig. 3.3A). After confirming the presence of equal amounts of SdhA in these samples,
we performed the Complex II activity assays at several different amounts of
mitochondrial suspensions obtained from SIRT3 knock-out and wild type mice
(Fig. 3.3B). In these assays, the activity of complex II was followed by the transfer of
electrons from succinate to DCIP at 600 nm (Fig. 3.3B). As plotted in Fig. 3.3B, the rate
of reactions was measured as changes in the absorbance at 600 nm over time as a
function of the amount of mitochondrial suspension used in the assays. At 15 µg of
mitochondria suspension, the difference between the rate of Complex II activity from
SIRT3 knock-out mice and wild type mice was about ~30 % (Fig. 3.3B). To demonstrate
the linearity of the percent inhibition detection by the assay, different amounts of
mitochondrial lysate were used; however, the percent inhibition did not change
significantly above 15 µg of mitochondrial suspension. Here, reduction of DCIP was
directly related to the SdhA activity since electrons from succinate is first transferred to
![Page 155: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/155.jpg)
140
the enzyme bound cofactor, FAD, in the SdhA subunit. For this reason, decrease in
Complex II activity can be attributed to increased acetylation of SdhA in mitochondria
from SIRT3 knock-out mice (Fig. 3.3B).
3.4.3 Role of Increased Level of SIRT3 Expression in Deaceylation of SdhA and
Complex II Activity
The significant increase in acetylation of several proteins in SIRT3 knock-out
mice mitochondria (Fig. 3.1A and Fig. 3.3A) prompted us to determine the effect of
SIRT3 overexpression. Stimulation of sirtuins, class III histone deacetylases, by several
polyphenolic compounds such as resveratrol and kaempferol has been suggested recently
(25-27). Specifically, kaempferol treatment of the chronic myelogenous leukemia, K562,
cell line has been shown to increase the level of SIRT3 expression in these cell lines (27).
Moreover, nicotinamide is a general sirtuin inhibitor and has been shown to inhibit
SIRT3-dependent deacetylation of GDH and NDUFA9 (17,28). To demonstrate the effect
of SIRT3 expression on Complex II activity, we treated K562 cells with 50 µM
kaempferol or 10 mM nicotinamide for either 16 or 48 h and monitored the changes in
acetylation and expression of SIRT3 by immunoblotting analysis using whole cell lysates
(Fig. 3.4A). Nicotinamide treatment did not further increase the acetylation of proteins
possibly due to their hyperacetylated state caused by glucose rich media used to grow
these cells. Reprobing of the membranes was performed with SdhA and Hsp60 antibodies
to ensure equal amounts of protein loading in the SDS-polyacrylamide gels. Consistent
with the increased expression of SIRT3 in kaempferol-treated cells, the overall
![Page 156: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/156.jpg)
141
acetylation level of proteins decreased compared to that in the control and nicotinamide-
treated cells (Fig. 3.4).
![Page 157: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/157.jpg)
142
Figure 3.3: Regulation of succinate dehydrogenase (Complex II) activity by
deacetylation of SdhA.
Hyperacetylation of SdhA decreases Complex II activity in SIRT3 knock-out
mice. A. Equal amounts of lysates obtained from Sirt3+/+ and Sirt3−/− mice liver
mitochondria were separated on 12 % SDS-polyacrylamide gel and probed with acetyl
Lys (N-acetyl K), SdhA, and Hsp60 antibodies. B. Complex II activity was measured as
the rate of DCIP reduction, monitored at 600 nm using different amounts of
mitochondrial lysates from Sirt3+/+ and Sirt3−/− mice liver mitochondria. One way
ANOVA test was used to compare the significance of values from three separate
experiments. Asterisks denote p<0.05.
![Page 158: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/158.jpg)
143
In addition to the detection of overall changes in acetylation of proteins in K562
cells, we fractionated the cell lysates treated with kaempferol and nicotinamide along
with untreated cells on 34 % sucrose cushion containing 1.6 % Triton-X100 to enrich for
SdhA protein. Similar to the pattern obtained in fractionation of mice liver mitochondria,
SdhA remained associated and sedimented with the rest of the Complex II subunits in
fractionation of kaempferol- and nicotinamide-treated cells as confirmed by
immunoblotting analyses (Fig. 3.4B). Especially in the nicotinamide treated and the
control cells, acetylated protein signal (shown by arrows) overlapped with the SdhA
signal in the reprobing of the membranes with the specific SdhA antibody. On the other
hand, acetylation of SdhA was significantly reduced in kaempferol-treated cells, despite
the strong SdhA signal obtained with the Sdh antibody in the reprobing. Interestingly, the
acetylation signal coming from the lower band was also affected by kaempferol and
nicotinamide treatments (Fig. 3.4B).
Again, to determine the role of SdhA acetylation on Complex II activity, we
performed Complex II enzyme activity assays using whole cell lysates obtained from
nicotinamide-and kaempferol-treated K562 cells, which revealed that the Complex II was
about ~20 % more active in kaempferol-treated cells compared to the Complex II activity
from nicotinamide-treated cells (Fig. 3.4C). The Complex II activity in control cells was
similar to the activity of nicotinamide-treated cells, possibly due to their comparable
acetylation status (Fig. 3.4C).
![Page 159: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/159.jpg)
144
Figure 3.4A-B: Effect of SIRT3 overexpression on SdhA deacetylation in K562 cells.
A. Immunoblotting analysis of K562 cell lysates obtained from control (Cont),
nicotinamide- (Nam), and kaempferol- (Kaem) treated cells. Approximately, 20 μg of
control and treated K562 cell lysates from each sample were loaded onto 12 % SDS-
polyacrylamide gels and immunoblotting was performed as described above. Actin and
Hsp60 blots were shown to ensure equal loading of protein amounts (Dr. M. J. Han
contributed this experiment). B. Equal amounts (about 2 mg) of control and treated K562
cell lysates were layered on a 34 % sucrose cushion and fractionated into eight 1 mL
aliquots after high speed centrifugation. Equal volumes of each fraction (1–8) were
acetone precipitated and loaded on 12 % SDS-polyacrylamide gels for immunoblotting
analysis. Arrows show the location of acetylated protein overlapping with the SdhA
signal.
![Page 160: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/160.jpg)
145
Figure 3.4C: Effect of SIRT3 overexpression on Complex II activity in K562 cells.
C. Complex II activity was monitored using different amounts of kaempferol- and
nicotinamide-treated K562 cell lysates. The analysis was done in triplicate and values
shown are the mean ±SD. One way ANOVA test was used to compare the significance of
the values. Asterisks denote p<0.05.
![Page 161: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/161.jpg)
146
3.5 Conclusions and Future Directions
Mitochondria are required for the production of more than 90 % of the ATP
required for survival of eukaryotic cells in oxidative phosphorylation. Regulation of
oxidative phosphorylation and Krebs cycle components by post-translational
modifications has already been established (2,7,29,30). ADP/ATP and [NADH]/[NAD+]
ratios are important for regulation of these pathways either by post-translational
modifications such as phosphorylation and acetylation or by allosteric regulation.
Regulation of mitochondrial function by phosphorylation is known for a long time;
however, the recent progress in identification of mitochondria specific NAD+-dependent
sirtuins such as SIRT3, SIRT4, and SIRT5, revealed the importance of [NADH]/[NAD+]
ratio in regulation of protein and enzyme function in post-translational modifications by
reversible acetylation (14,28). One of the best characterized mitochondrial NAD+-
dependent deacetylase, SIRT3, has been known to regulate activities of several metabolic
enzymes and the Complex I subunit NDUFA9 by deacetylation (17). Moreover, we have
discovered its pivotal role in the regulation of mitochondrially encoded proteins of
oxidative phosphorylation by mitochondrial protein synthesis through specific
deacetylation of a ribosomal protein MRPL10 (18).
In this study, comparison of acetylated proteins in wild type and SIRT3 knock-out
mice mitochondria has led us to a novel substrate for SIRT3, the flavoprotein of succinate
dehydrogenase complex (SdhA), along with a known substrate, glutamate
dehydrogenase. SdhA is one of the hydrophilic subunits of the succinate dehydrogenase
involved in both the Krebs cycle and oxidative phosphorylation in mammalian
![Page 162: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/162.jpg)
147
mitochondria. Previously, in two independent high throughput surveys of the acetylated
proteins of the rat liver, several acetylated peptides were mapped from SdhA (2,7), while
it was reported as an unacetylated protein in a comprehensive study of SIRT3-dependent
deacetylation of Complex I subunit NDUFA9 (17). However, the role of acetylation in
the enzyme activity and the deacetylase responsible for this modification were not
determined previously.
We believe that the data presented here convincingly clarify the discrepancy
reported in the literature and demonstrate that SIRT3 is indeed the major mitochondrial
deacetylase controlling oxidative phosphorylation by reversible lysine acetylation
(16,17). In the comparison of 2D-gel immunoblotting of SIRT3−/− and SIRT3+/+ mice
liver mitochondria, SdhA was found to be hyperacetylated in the absence of SIRT3;
however, it is possible that the degree of acetylation in wild-type mice is regulated by
availability of acetyl-coA and/or NADH levels in the mitochondria. For this reason, we
have not observed complete deacetylation of SdhA in the wild-type mice liver
mitochondrial lysates (Fig. 3.1C and 3.3A). More importantly, we have shown the effect
of hyperacetylation on Complex II activity in SIRT3−/− liver mitochondria (Fig. 3.3B).
Interestingly, the Complex II activity in SIRT3 knock-out mice was ~ 30 % lower than
that of the wild-type, possibly due to incomplete deacetylation of SdhA in the wild-type
mice (Fig. 3.3B). Previously, none of the Complex II subunit proteins was reported as
acetylated proteins for the immunocaptured Complex II components in SIRT3 knock-out
mice (17). This discrepancy could be due to the sample preparation used by Ahn et al. as
they determined the acetylation of Complex II components after immunocapturing of the
complex (17). In addition to changes in SdhA acetylation and Complex II activity in
![Page 163: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/163.jpg)
148
SIRT3−/− and SIRT3+/+ mice mitochondria, we have shown a decrease in SdhA activity
while a slight increased level of acetylation was observed in cells treated with a general
deacetylase inhibitor, nicotinamide. In contrast, kaempferol treatment of the same cell
line caused an increase in the level of SIRT3 expression and significant deacetylation of
SdhA accompanied by 20 % increase in Complex II activity possibly due to SIRT3-
dependent deacetylation of SdhA. Surprisingly, the changes in acetylation of SdhA did
not completely inhibit the Complex II activity. As proposed previously, it is likely that
only a minor proportion of the protein is acetylated or acetylation only partially regulates
the enzyme activity even though mitochondrial protein hyperacetylation is dramatic in
SIRT3 knock-out mice (16). Additionally, conserved acetylated lysine residues in
mammalian SdhA are located on the surface of the protein, away from the active site of
the enzyme. Therefore, it is feasible to expect that acetylation of the positively charged
residues on the surface of the enzyme might either slightly change the affinity of the
enzyme for its negatively charged substrate, succinate, or induce conformational changes
to reduce the activity of the enzyme (Fig. 3.2C).
Regulation of Complex II activity by reversible acetylation of SdhA subunit
relates how oxidative phosphorylation and Krebs cycle components are regulated by
metabolite levels in mammalian mitochondria. In the case of high levels of reduced
cofactors such as NADH and FADH2 present in the mitochondria, there is no need for
further oxidation of acetyl-CoA in the Krebs cycle for generation of these cofactors to
support oxidative phosphorylation. Thus, it would be reasonable to suggest that
acetylation of SdhA just slows the Krebs cycle, as this process will also cause
accumulation of acetyl-CoA in the mitochondria. On the other hand, when NAD+ level
![Page 164: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/164.jpg)
149
increases in the mitochondria, SIRT3 and other NAD+-dependent deacetylases will be
activated and deacetylate SdhA and other acetylated components of the Krebs cycle. In
agreement with stimulation of catalytic activities of metabolic enzymes such as glutamate
dehydrogenase and acetyl-CoA synthetase 2 by deacetylation, deacetylation of SdhA also
stimulates Complex II or succinate dehydrogenase activity to promote the Krebs cycle for
the generation of reduced NADH and FADH2, as they are the electron donors for ATP
synthesis in oxidative phosphorylation. Another potential regulation of Complex II
activity is by phosphorylation of the SdhA subunit as it was found to be phosphorylated
by Fgr tyrosine kinase in vitro (10). Given its importance in oxidative phosphorylation, it
could be suggested that this enzyme can be regulated through cooperation or interplay
between these two different post-translational modifications at varying metabolite levels.
Moreover, in the case of complete inhibition of the complex, succinate accumulation
resulting from the decreased SdhA activity may cause deleterious effects in the cell due
to the absence of additional mitochondrial metabolic enzymes that can metabolize
succinate (8,9).
3.6 Acknowledgment
We thank Dr. Qiang Tong for providing SIRT3 knockout mice liver
mitochondria.
![Page 165: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/165.jpg)
150
3.7 References
1. Hallows, W. C., Lee, S., and Denu, J. M. (2006) Proc Natl Acad Sci U S A 103(27), 10230-10235
2. Kim, S. C., Sprung, R., Chen, Y., Xu, Y., Ball, H., Pei, J., Cheng, T., Kho, Y., Xiao, H., Xiao, L., Grishin, N. V., White, M., Yang, X. J., and Zhao, Y. (2006) Mol Cell 23(4), 607-618
3. Jackson, P. J., and Harris, D. A. (1986) Biochem J 235(2), 577-583 4. Dinardo, M. M., Musicco, C., Fracasso, F., Milella, F., Gadaleta, M. N., Gadaleta,
G., and Cantatore, P. (2003) Biochem Biophys Res Commun 301(1), 187-191 5. Gerhart-Hines, Z., Rodgers, J. T., Bare, O., Lerin, C., Kim, S. H., Mostoslavsky,
R., Alt, F. W., Wu, Z., and Puigserver, P. (2007) EMBO J 26(7), 1913-1923 6. Schwer, B., Bunkenborg, J., Verdin, R. O., Andersen, J. S., and Verdin, E. (2006)
Proc Natl Acad Sci U S A 103(27), 10224-10229 7. Choudhary, C., Kumar, C., Gnad, F., Nielsen, M. L., Rehman, M., Walther, T. C.,
Olsen, J. V., and Mann, M. (2009) Science 325(5942), 834-840 8. Briere, J. J., Favier, J., El Ghouzzi, V., Djouadi, F., Benit, P., Gimenez, A. P., and
Rustin, P. (2005) Cell Mol Life Sci 62(19-20), 2317-2324 9. King, A., Selak, M. A., and Gottlieb, E. (2006) Oncogene 25(34), 4675-4682 10. Salvi, M., Morrice, N. A., Brunati, A. M., and Toninello, A. (2007) FEBS Lett
581(29), 5579-5585 11. Michishita, E., Park, J. Y., Burneskis, J. M., Barrett, J. C., and Horikawa, I.
(2005) Mol Biol Cell 16(10), 4623-4635 12. Onyango, P., Celic, I., McCaffery, J. M., Boeke, J. D., and Feinberg, A. P. (2002)
Proc Natl Acad Sci U S A 99(21), 13653-13658 13. Rose, G., Dato, S., Altomare, K., Bellizzi, D., Garasto, S., Greco, V., Passarino,
G., Feraco, E., Mari, V., Barbi, C., BonaFe, M., Franceschi, C., Tan, Q., Boiko, S., Yashin, A. I., and De Benedictis, G. (2003) Exp Gerontol 38(10), 1065-1070
14. Yang, H., Yang, T., Baur, J. A., Perez, E., Matsui, T., Carmona, J. J., Lamming, D. W., Souza-Pinto, N. C., Bohr, V. A., Rosenzweig, A., de Cabo, R., Sauve, A. A., and Sinclair, D. A. (2007) Cell 130(6), 1095-1107
15. Shi, T., Wang, F., Stieren, E., and Tong, Q. (2005) J Biol Chem 280(14), 13560-13567
16. Lombard, D. B., Alt, F. W., Cheng, H. L., Bunkenborg, J., Streeper, R. S., Mostoslavsky, R., Kim, J., Yancopoulos, G., Valenzuela, D., Murphy, A., Yang, Y., Chen, Y., Hirschey, M. D., Bronson, R. T., Haigis, M., Guarente, L. P., Farese, R. V., Jr., Weissman, S., Verdin, E., and Schwer, B. (2007) Mol Cell Biol 24, 8807-8814
17. Ahn, B. H., Kim, H. S., Song, S., Lee, I. H., Liu, J., Vassilopoulos, A., Deng, C. X., and Finkel, T. (2008) Proc Natl Acad Sci U S A 105(38), 14447-14452
18. Yang, Y., Cimen, H., Han, M. J., Shi, T., Deng, J. H., Koc, H., Palacios, O. M., Montier, L., Bai, Y., Tong, Q., and Koc, E. C. (2010) J Biol Chem 285(10), 7417-7429
![Page 166: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/166.jpg)
151
19. Orsolya, M. P., Carmona, J. J., Shaday, M., Chen, K. Y., Manabe, Y., Ward III, J. L., Goodyear, L. J., and Tong, Q. (2009) Aging 392, 608-611
20. Birch-Machin, M. A., and Turnbull, D. M. (2001) Methods Cell Biol 65, 97-117 21. Miller, J. L., Cimen, H., Koc, H., and Koc, E. C. (2009) J Proteome Res 8(10),
4789-4798 22. Miller, J. L., Koc, H., and Koc, E. C. (2008) Protein Sci 17(2), 251-260 23. Cimen, H., Han, M. J., Yang, Y., Tong, Q., Koc, H., and Koc, E. C. (2010)
Biochemistry 49(2), 304-311 24. Huang, L. S., Sun, G., Cobessi, D., Wang, A. C., Shen, J. T., Tung, E. Y.,
Anderson, V. E., and Berry, E. A. (2006) J Biol Chem 281(9), 5965-5972 25. Lagouge, M., Argmann, C., Gerhart-Hines, Z., Meziane, H., Lerin, C., Daussin,
F., Messadeq, N., Milne, J., Lambert, P., Elliott, P., Geny, B., Laakso, M., Puigserver, P., and Auwerx, J. (2006) Cell 127(6), 1109-1122
26. Baur, J. A., Pearson, K. J., Price, N. L., Jamieson, H. A., Lerin, C., Kalra, A., Prabhu, V. V., Allard, J. S., Lopez-Lluch, G., Lewis, K., Pistell, P. J., Poosala, S., Becker, K. G., Boss, O., Gwinn, D., Wang, M., Ramaswamy, S., Fishbein, K. W., Spencer, R. G., Lakatta, E. G., Le Couteur, D., Shaw, R. J., Navas, P., Puigserver, P., Ingram, D. K., de Cabo, R., and Sinclair, D. A. (2006) Nature 444(7117), 337-342
27. Marfe, G., Tafani, M., Indelicato, M., Sinibaldi-Salimei, P., Reali, V., Pucci, B., Fini, M., and Russo, M. A. (2009) J Cell Biochem 106(4), 643-650
28. Haigis, M. C., Mostoslavsky, R., Haigis, K. M., Fahie, K., Christodoulou, D. C., Murphy, A. J., Valenzuela, D. M., Yancopoulos, G. D., Karow, M., Blander, G., Wolberger, C., Prolla, T. A., Weindruch, R., Alt, F. W., and Guarente, L. (2006) Cell 126(5), 941-954
29. Distler, A. M., Kerner, J., and Hoppel, C. L. (2007) Biochim Biophys Acta 1774(5), 628-636
30. Gottlieb, R. A. (2007) Methods Mol Biol 357, 127-137
![Page 167: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/167.jpg)
Chapter 4
Identification and Analysis of New Mammalian Mitochondrial Ribosomal
Proteins: CHCHD1, AURKAIP1, and CRIF1
This chapter of dissertation was reproduced with permission from Emine C.
Koc, Huseyin Cimen, Beril Kumcuoglu, Nadiah Abu, Gurler Akpinar, Md. Haque,
Linda Spremulli, Hasan Koc. Identification and Characterization of CHCHD1,
AURKAIP1, and CRIF1 as New Members of the Mammalian Mitochondrial
Ribosome. Nucleic Acids Research (Manuscript submitted.) Copyright © 2012 by
Oxford University Press.
![Page 168: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/168.jpg)
153
4.1 Rationale
Mitochondrially encoded components of the oxidative phosphorylation
(OXPHOS) complexes are all essential and synthesized by 55S ribosomes in
mammalian mitochondria. In the initial identification of mitochondrial ribosomal
proteins (MRPs), it was challenging to identify MRPs with no clear homologs in
bacteria due to the limited availability of expressed sequence tag (ESTs) from
different organisms in the databases. With the improvement in genome sequencing
and increased sensitivity of mass spectrometry (MS)-based technologies, we have
identified five additional proteins as new MRPs; MRPS37 (Coiled-coil-helix-coiled-
coil-helix domain containing protein 1-CHCHD1), MRPS38 (Aurora kinase A
interacting protein 1-AURKAIP1), MRPS39 (Pentatricopeptide repeat-containing
protein 3-PTCD3), MRPL58 (Immature colon carcinoma transcript 1 protein-ICT1),
and MRPL59 (CR-6 interacting factor 1-CRIF1), and a ribosome-associated assembly
factor, C7orf30, in highly purified 55S ribosomes. The human PTCD3 and ICT1 and
yeast homologs of CHCHD1 and AURKAIP1 had been observed to be associated
with mitochondrial ribosomes previously. Here, we also report that CHCHD1 and
AURKAIP1 are bona fide small subunit proteins and CRIF1 is a bona fide large
subunit protein of the 55S ribosome in mammalian mitochondria and demonstrate that
they have essential roles in mitochondrial protein synthesis in vivo.
![Page 169: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/169.jpg)
154
4.2 Introduction
Mammalian mitochondria are responsible for providing over 90 % of the
energy used by cells in the form of ATP through oxidative phosphorylation
(OXPHOS). ATP production by this process depends on electron transport chain
complexes and the ATP synthase, components of which are encoded by both the
nuclear and mitochondrial genomes. In mammals mitochondrial DNA encodes the
information for only 13 essential proteins required for OXPHOS in addition to 22
tRNAs and 2 rRNAs. The 13 proteins encoded within the mitochondrial genome are
synthesized on 55S ribosomes using the specialized translational system within the
organelle.
Mammalian mitochondrial ribosomes (55S) consist of small (28S) and large
(39S) subunits (1,2). The 55S ribosome is composed of ~80 mitochondrial ribosomal
proteins (MRPs) and all of these proteins are encoded by nuclear genes and imported
into mitochondria where they are assembled into the ribosome with mitochondrially
transcribed rRNAs (3-6). About a decade ago, almost all of the proteins present in
these ribosomes were identified by using various proteomic techniques. This initial
analysis indicated that the small subunit of the ribosome contains 29 proteins while
the large subunit has about 50 proteins (5-11). About half of these proteins in
mammalian mitochondrial ribosomes have homologs in bacterial ribosomes and play
a role either in the assembly and structure of ribosomes or in the initiation, elongation,
or termination phases of mitochondrial translation. The functions and locations of the
mitochondrial-specific proteins are not known; however, they may replace some of
the functions of bacterial ribosomal proteins that are not present in the mitochondrial
ribosome. They may also provide additional function(s) critical for protein synthesis
![Page 170: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/170.jpg)
155
or its regulation in mammalian mitochondria (5,6). Although it is not possible to
determine the exact locations of these mitochondrial-specific proteins without x-ray
structural information, cryo-EM reconstruction studies indicated that they are
distributed on the exterior surface of the ribosome (12,13). It is clear that some of the
mitochondrial-specific ribosomal proteins are located in functionally important
regions of the ribosome particularly at the mRNA entrance gate in the small subunit,
and at the polypeptide exit tunnel and the central protuberance region of the large
subunit creating specific structures on the mitochondrial ribosome (12,13).
In many instances mitochondrial-specific ribosomal proteins were identified
when searching for their additional functions due to lack of homology with known
ribosomal proteins in bacteria and eukaryotic 80S ribosomes. For example,
mitochondrial-specific MRPs such as MRPS29 (DAP3-death associated protein 3),
MRPS30 (PDCD9-programmed cell death protein 9), MRPL37, and MRPL41 have
been reported to be involved in apoptosis (5,6,14-17). While major mutations of
MRPs causing functional changes in mitochondrial translation are shown to be lethal,
aberrantly expressed MRPs are also related to many different tumors including breast,
gliomas, squamous cell carcinoma, and osteosarcoma (6,18-21). Therefore, a
complete list of mitochondrial ribosomal proteins will be fundamental for our
understanding of the mitochondrial translational machinery and its contribution to
mitochondrial energy production and biogenesis in health and disease.
In the present study, we reevaluated protein components of the mammalian
mitochondrial ribosome using mass spectrometry (MS)-based proteomics and
identified five potential new mitochondrial ribosomal proteins: coiled-coil-helix-
coiled-coil-helix domain containing protein 1 (CHCHD1), aurora kinase A interacting
protein 1 (AURKAIP1), pentatricopeptide repeat-containing protein 3 (PTCD3),
![Page 171: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/171.jpg)
156
immature colon carcinoma transcript 1 protein (ICT1), CR-6 interacting factor 1
(CRIF1 also known as growth arrest and DNA-damage-inducible proteins-interacting
protein 1 (Gadd45GIP1)), and a ribosome-associated assembly factor C7orf30. The
new mitochondrial ribosomal proteins; CHCHD1, AURKAIP1, and PTCD3 were
assigned to the small subunit and ICT1 and CRIF1 were assigned to the large subunit
of the 55S ribosome.
4.3 Materials and Methods
4.3.1 Preparation of Bovine Mitochondrial Ribosomal Subunits
Mitochondrial ribosomes from bovine liver were prepared using a previously
described method at high and low ionic strength and at several different detergent
concentrations (Fig. 4.1) (5,6,22,23). The high ionic strength and detergent
concentrations used the standard conditions of 300 mM KCl and 1.6 % Triton X-100
(10). For the preparation of mitochondrial ribosomes at low salt and detergent
conditions, mitochondrial lysates were prepared in a buffer containing 50 mM Tris-
HCl, pH 7.6, 40 mM KCl, 20 mM MgCl2, 6 mM -mercaptoethanol, 0.2 % Triton X-
100, and 1 mM phenylmethylsulfonyl fluoride (PMSF). The mitochondrial lysate was
layered onto a 34 % cushion solution (40 mM KCl, 20 mM MgCl2, 50 mM Tris-HCl,
pH 7.6, 6 mM -mercaptoethanol, and 34 % (w/w) sucrose). Samples were
centrifuged at 35,000 rpm for 16 h at 4 ºC in a Beckman type-50.2 rotor. The pellet
was collected as crude mitochondrial ribosomes and resuspended in a buffer prepared
with 40 mM KCl, 20 mM MgCl2, 20 mM Tris-HCl pH 7.6, 1 mM dithiothreitol
![Page 172: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/172.jpg)
157
(DTT), and protease inhibitor cocktail from Sigma-Aldrich. Samples were then
subjected to centrifugation through a 10-30 % linear sucrose gradient in buffer
containing 40 mM KCl, 20 mM MgCl2, 50 mM Tris-HCl pH 7.6, 1 mM DTT.
Fractions containing 55S ribosomes were combined and the ribosomes were collected
by centrifugation at 40,000 rpm for 16 h (Fig. 4.2A). The concentration of Mg2+ in the
preparations was reduced to 2 mM by dialysis in order to dissociate ribosomes into
28S and 39S subunits and the samples were separated again on a linear 10-30 %
sucrose gradient containing 2 mM Mg2+. Highly purified 28S and 39S subunits were
collected by centrifugation at 40,000 rpm for 16 h (Fig. 4.2B).
4.3.2 Identification of Mitochondrial Ribosomal Proteins by Mass Spectrometry
To identify the proteins of mammalian mitochondrial ribosomes, purified
ribosomal 28S and 39S subunits and 55S samples were separated on SDS-
polyacrylamide gel and corresponding protein bands were excised into at least thirty
equal gel pieces which were processed by performing in-gel tryptic digestion using
methods previously established in our laboratory (Fig. 4.2B) (24-26). Tryptic digests
were analyzed by capillary liquid chromatography-nanoelectrospray ionization-
tandem mass spectrometry (capLC-MS/MS). Extracted tryptic peptides (3-5 μL) were
injected and loaded into a peptide trap (Michrom peptide CapTrap, C8 like resin, 0.3
× 1 mm, 5 μm) over 3 min at 10 μL/min for online desalting and concentration. With
the use of the six-port switching valve, the peptide trap was then placed in-line with
the analytical column, a PicoFrit column (0.075 × 150 mm) packed in-house with
Wide Bore C18 reverse phase resin (Supelco Co., 5 μm, 300 Å). Tandem MS spectra
![Page 173: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/173.jpg)
158
of tryptic peptides were obtained by collision-induced dissociation (CID) in an LTQ
linear ion trap mass spectrometer (ThermoFinnigan) system including a Surveyor
HPLC pump and a Surveyor Micro AS autosampler.
MS/MS spectra were processed by Xcalibur 2.0 and searched against
nonredundant protein and Swiss-Prot and UnitProtKB databases using the Mascot
server. Additionally, the search was repeated using a bovine protein sequence
database generated in-house. Protein information obtained from the database searches
and the scores of mitochondrial ribosomal proteins which were observed in multiple
bands were compared. To increase the data quality, proteins with a Mascot score
lower than 45 were excluded from the list.
Ribosomal proteins were assigned to subunits according to their abundance in
28S and 39S fractions. Exponentially modified Protein Abundance Index (emPAI)
score was calculated to compare the protein abundance in each sample using a
previously reported method (27). Briefly, the ratio of observed unique parent ion
number in the analysis to the observable peptide number from in silico digestion is
used as PAI in the formula: emPAI = 10^(PAI) – 1.
4.3.3 Preparation of Crude Ribosomes from Human Cell Lines and Isolated
Mitochondria
HeLa cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM)
media (Cellgro, Mediatech Inc.), supplemented with 10 % (v/v) bovine calf serum
(Hyclone Laboratories) and 100 IU/ml penicillin and 100 μg/ml streptomycin, at 37oC
and 5 % CO2 in a humidified atmosphere. For the whole cell lysate preparation,
![Page 174: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/174.jpg)
159
approximately 4 x 107 HeLa cells were combined and lysed in 2 mL of buffer
containing 50 mM Tris-HCl, pH 7.6, 0.26 M sucrose, 60 mM KCl, 20 mM MgCl2, 0.8
mM EDTA, 2 mM DTT, 0.05 mM spermine, 0.05 mM spermidine, 1.6 % Triton X-
100, and protease inhibitor cocktail from Sigma-Aldrich using a Dounce homogenizer
(Wheaton). In order to isolate mitochondria, approximately 2 x 107 HeLa cells were
resuspended in 1 mL of an isotonic mitochondrial buffer (MB) (210 mM mannitol, 70
mM sucrose, 1 mM EDTA, 10 mM HEPES-KOH, pH 7.5), supplemented with
protease inhibitors (1 mM PMSF and protease cocktail from Sigma-Aldrich), and then
homogenized in a Dounce homogenizer on ice. The suspension was centrifuged at
400 x g on a microcentrifuge (ThermoForma) at 4°C. The pellet was resuspended in
another 1 mL of MB and the 400 x g centrifugation was repeated. Supernatants were
combined and centrifuged at 10,000 x g at 4°C for 10 min to pellet mitochondria. The
mitochondrial pellets were lysed in a buffer containing 0.26 M sucrose, 20 mM Tris-
HCl, pH 7.6, 40 mM KCl, 20 mM MgCl2, 0.8 mM EDTA, 0.05 mM spermine, 0.05
mM spermidine, 6 mM β-mercaptoethanol, and 1.6 % Triton X-100 using a Dounce
homogenizer.
To collect the crude ribosomes, whole cell and mitochondrial lysates (2 mL)
were layered onto a 34 % sucrose cushion (4 mL) in buffer (50 mM Tris-HCl, pH 7.6,
60 mM KCl, 20 mM MgCl2, and 6 mM β-mercaptoethanol) and centrifuged in a Type
40 rotor (Beckman Coulter) at 40,000 rpm for 16 h. The post-ribosomal supernatant
was fractionated into six separate layers (designated L1 to L6) for analysis and the
pellet was collected as a crude ribosomal fraction (Fig. 4.4). The crude ribosome
preparations including mitochondrial and cytoplasmic ribosomes for whole cell lysate
and only mitochondrial ribosomes for the mitochondrial lysate were resuspended in
50 µL of Base Buffer III (50 mM Tris-HCl, pH 7.6, 60 mM KCl, 20 mM MgCl2, 1
![Page 175: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/175.jpg)
160
mM DTT, and protease inhibitor cocktail (Sigma-Aldrich). Ribosome suspensions
were stored at -80oC for further analyses.
4.3.4 RNase A Treatment of Mitochondrial Ribosomes
In order to confirm the direct or indirect interaction of new MRPs with rRNA
of mitochondrial ribosome, approximately, ~5 A260 units of a crude preparation of
ribosomes obtained from bovine liver were incubated in the absence or presence of
RNase A and loaded onto separate 10-30 % linear sucrose gradients in buffer
containing 40 mM KCl, 20 mM MgCl2, 50 mM Tris-HCl pH 7.6 and 1 mM DTT
(28). After centrifugation, equal volumes (25 μL) of gradient fractions were separated
on 12 % SDS-polyacrylamide gel and probed with corresponding antibodies after
transferring to PVDF membranes (Fig. 4.6).
4.3.5 Immunoblotting Analysis
Ribosome samples collected from HeLa and bovine mitochondria including
sucrose gradient fractions, purified 55S ribosomes and 28S and 39S subunits were
separated on 12 % SDS-polyacrylamide gels. Proteins were transferred to PVDF
membranes which were probed with rabbit polyclonal anti-CHCHD1 antibody at a
1:1000 dilution (Abcam), rabbit anti-AURKAIP1 antibody at a 1:1000 dilution
(Sigma-Aldrich), goat anti-CRIF1 antibody at a 1:500 dilution (Santa Cruz
Biotechnology), mouse monoclonal anti-MRPS29 and anti-HSP60 antibodies at
1:5000 dilutions (BD Transduction Laboratories), and mouse anti-OXPHOS
![Page 176: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/176.jpg)
161
(MITOPROFILE ® Total OXPHOS Antibody Cocktail, Mitosciences Inc.) at 1:5000
dilution (Abcam Inc.), or rabbit polyclonal human anti-MRPL47 and mouse
polyclonal human anti-MRPS18-2 antibodies at 1:5000 dilutions (Covance Inc.) for
16 h at 4ºC. The secondary antibodies, donkey anti-goat IgG (Santa Cruz
Biotechnology) for CRIF1, goat anti-mouse IgG (Pierce Biochemicals Inc.) for
MRPS29, HSP60 and OXPHOS, and goat anti-rabbit IgG for CHCHD1, AURKAIP1,
and MRPL47, were all used at 1:5000 dilutions. The membranes were developed
using SuperSignal West Pico Chemiluminescent (Pierce Biochemicals Inc.) according
to the protocol provided by the manufacturer.
4.3.6 [35S]-Methionine Labeling of Mitochondrial Translation Products In Vivo
Human embryonic kidney 293T (HEK293T) cell lines were cultured in
DMEM (Cellgro, Mediatech Inc.) supplemented with 10 % bovine calf serum
(Hyclone), 100 IU/ml penicillin and 100 μg/ml streptomycin, at 37oC and 5 % CO2 in
a humidified atmosphere. Cells were transfected with control siRNA (sc-44235) and
siRNA against CHCHD1 (sc-90488), AURKAIP1 (sc-72472), and CRIF1 (sc-97804)
from Santa Cruz Biotechnology using Lipofectamine™ 2000 (Invitrogen) according
to the protocol provided by the manufacturer. The transfected cells were grown in
transfection medium for 2 days prior to labeling with [35S]-methionine. Labeling
experiments were performed in the presence of dialyzed serum (25 mM Tris-HCl, pH
7.4, 137 mM NaCl, and 10 mM KCl) and minimum essential DMEM medium which
does not contain methionine, glutamine, and cysteine (10,29,30). Cells were incubated
with emetine containing medium for 5 min to arrest cytoplasmic protein synthesis and
![Page 177: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/177.jpg)
162
0.2 mCi/ml of [35S]-methionine (Perkin Elmer) containing medium was added to label
the mitochondrially-encoded proteins. After a 2 h incubation, cells were lysed in
buffer containing 50 mM Tris-HCl, pH 7.6, 150 mM NaCl, 1 mM EDTA, 1 mM
EGTA, 0.1 % SDS and 0.5 % NP-40 supplemented with 1 mM PMSF and protease
inhibitor cocktail (Sigma-Aldrich). Whole cell lysates (40 μg) were electrophoresed
through 12 % SDS-polyacrylamide gel. The gels were dried on 3MM chromatography
paper (Whatman) and then total intensities of the signals were quantified by
phosphorimaging analyses (Fig. 4.8) (31). Results from four independent experiments
were analyzed using the ANOVA test. Values of P<0.05 were considered statistically
significant. siRNA mediated knockdown efficiency of corresponding mitochondrial
ribosomal protein was confirmed with immunoblotting analysis of whole cell lysate or
crude ribosomal fraction prepared as stated above (Fig. 4.7A).
4.3.7 Reverse Transcription Polymerase Chain Reaction (RT-PCR)
Total RNA was isolated from siRNA transfected HEK293T cells by using
RNeasy Mini Kit from Qiagen and the cDNA was synthesized using the
ThermoScriptTM RT-PCR system (Invitrogen). Primers used: CHCHD1 forward 5'-
ACCTCTCATTCTAGCTAACCGCGT -3', reverse 5'-
AGACTCTCCCAGGGTTTCCTGTAT -3'; AURKAIP1 forward 5'-
TCCACCGCAATCCTACCAGTGT -3', reverse 5'-
CGAACTTGATCTGCTTGCGTCTCA -3'; CRIF1 forward 5'-
GATGATTGTGAACTGGCAGCAGCA -3', reverse 5'-
CGCCTCCTTCTTCCGTTTCTGTTT -3'; ND6 forward 5'-
![Page 178: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/178.jpg)
163
GAGTGTGGGTTTAGTAATGGGGTTTGTGGGG -3', reverse 5'-
CCTATTCCCCCGAGCAATCTC -3'; COI forward 5'-
ATTTAGCTGACTCGCCACACTCCA -3', reverse 5'-
TAGGCCGAGAAAGTGTTGTGGGAA -3'; COII forward 5'-
ATGGCACATGCAGCGCAAGTA -3', reverse 5'-
CTATAGGGTAAATACGGGCCC-3'; ATP6 forward 5'-
TAATACGACTCACTATAGATGAACGAAAATATGT -3', reverse 5'-
TTTTTTTTTTTTTTTTTTTTTTCATTGTTGGGTGGTGATTAG -3'; 12s rRNA
forward 5'- AATAGGTTTGGTCCTAGCCTAGCC -3’, reverse 5'-
GTTCGTCCAAGTGCACTTTCCAG -3'; MRPS29 forward 5'-
ATGGACCGACACGGGTATTGTACC -3', reverse 5'-
AAGGCCATGGGGAAATACAGTC -3'; MRPL47 forward 5'-
AAACGGGGTACCGAGATGGCTGCGGCCGGTTTGGCCC -3', reverse 5'-
CCGCTCGAGTTAATGGTGATGGTGATGATGGACAAGACTTGACTTTTGGG
C -3'; glyceraldehyde 3-phosphate dehydrogenase (GAPDH) forward 5'-
GTCTTCACCACCATGGAGAAGG -3', reverse 5'-
ATGAGGTCCACCACCCTGTTGC -3';. Reactions were performed according to the
instructions provided by the manufacturer. Samples were visualized using ChemiDoc
XRS system employing Quantity One® 1D analysis software (Bio-Rad). Quantitative
graph was constructed by relative signal intensities to GAPDH sample.
![Page 179: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/179.jpg)
164
4.4 Results and Discussion
4.4.1 Identification of 55S Ribosomal Proteins by Tandem Mass Spectrometry
The majority of the protein components of mammalian mitochondrial
ribosomes were identified by our group as well as several other groups using
proteomic strategies a decade ago (5-9,32,33). However, due to the limited
availability of bovine or rat protein and DNA sequence information, some of the
ribosomal and/or ribosome-associated proteins were not detected and identified by
matching the tandem MS data to the publicly available ESTs or protein databases
available at that time. An analysis of the protein composition of a large
macromolecular complex requires the preparation of the complex under conditions
that are strong enough to remove contaminants but are gentle enough to prevent the
loss of protein components that are more loosely bound. In order to reevaluate the
protein composition and eliminate transiently associated proteins, mammalian
mitochondrial ribosomes were purified under two different salt and detergent
conditions from bovine liver (Fig. 4.1) (23). The 10-30 % linear sucrose gradient
separation of mitochondrial ribosomes was carried out at 20 mM Mg2+ to collect 55S
particles (Fig. 4.1).
The protein compositions of the 55S preparations prepared under the two
different salt and detergent conditions were compared on SDS-polyacrylamide gels
(Fig. 4.2A). In general, the gel pattern was similar in both ribosomal preparations;
however, the sample prepared at high salt/detergent concentrations contained
relatively lower amounts of high molecular weight proteins. The proteins in these
![Page 180: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/180.jpg)
165
bands may be subunits of the large enzyme complexes co-sedimenting with the
mitochondrial ribosome fractions (Fig. 4.2 and Fig. 4.3). The gels were sliced into
thirty fractions and in-gel tryptic digestion of each gel piece was analyzed by capLC-
MS/MS. Their peptide/protein contents were determined by matching MS/MS spectra
to an in-house protein sequence database generated by the combination of ~ 30,000
bovine proteins found in the Swiss-Prot and UniProtKB databases. The complete list
of the previously unidentified proteins was created by excluding MRPs identified
earlier, mitochondrial metabolic pathway proteins, and oxidative phosphorylation
proteins. In these analyses, CHCHD1, AURKAIP1, PTCD3, ICT1, CRIF1, and
C7orf30 were repeatedly found as additional ribosome-associated proteins with high
confidence in both low and high salt and detergent preparations (Table 4.1). With the
exception of large complexes of metabolic enzymes, specifically 2-oxoglutarate and
pyruvate dehydrogenases and ATP synthase F1 subunits sedimenting with the
ribosomes, proteins consistently found in both low and high salt and detergent
preparations of 55S ribosomes were considered as possible components of the
mitochondrial translational machinery and/or ribosomal proteins (Table 4.1).
![Page 181: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/181.jpg)
166
Figure 4.1: An experimental scheme for the purification of mitochondrial ribosomes and 28S and 39S subunits.
In order to obtain purified 55 ribosomes and 28S and 39S subunits using sequential linear sucrose gradients, bovine
mitochondrial lysates were prepared at different ionic and detergent conditions to remove mitochondrial metabolic enzymes co-
sedimenting with the mitochondrial ribosome. Experimental details are included in Materials and Methods.
![Page 182: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/182.jpg)
167
Figure 4.2: SDS-PAGE analyses of purified bovine 55S ribosomes and 28S and 39S subunits.
A. Approximately 0.5 A260 units of mitochondrial ribosomes (55S) purified at
two different salt and detergent concentrations (Low and High, see Materials and
Methods for details) were separated by 14 % SDS-polyacrylamide gels and stained
with Coomassie Blue. B. Purified mitochondrial (55S) ribosomes (~10 A260) prepared
at high salt and detergent conditions were dissociated into the small (28S) and large
(39S) subunits by sedimentation through another 10-30 % linear sucrose gradient in
the presence of 2 mM Mg2+. The same amounts (0.5 A260) of subunits and 55S
ribosomes was separated by SDS-polyacrylamide gel which was excised into 30
pieces for in-gel digestion of protein bands with trypsin for LC-MS/MS analysis to
identify their protein content. These samples were prepared for analysis by B.
Kumcuoglu and N. Abu. Gel fractions containing the peptides detected from newly
identified MRPs are marked on the image.
A B
![Page 183: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/183.jpg)
168
Figure 4.3: Mitochondrial ribosomes prepared at different salt and detergent
concentrations.
Approximately 50-60 A260 units of low (A) and high (B) salt and detergent
preparations of crude ribosomes were separated on 10-30 % linear sucrose gradients to
sediment purified 55S ribosomes (fractions containing purified 55S ribosomes are
shown by arrows). Different subsets of metabolic enzyme complexes were removed by
sedimentations performed at low and high salt and detergent conditions; however, 55S
fractions shown by arrows mainly contained the components of the mitochondrial
translation machinery. Each fraction corresponding to dissociated small (28S) and
large (39S) subunits and intact (55S) ribosomes was separated by 12 % SDS-
polyacrylamide gels. The 55S fractions shown by arrows were collected for the
preparation of purified 28S and 39S subunits. Dr. G. Akpinar contributed to this
experiment.
![Page 184: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/184.jpg)
169
4.4.2 Subunit Assignments of Newly Identified Ribosome-associated Proteins
In order to categorize newly identified proteins as either MRPs or proteins
involved in translation, subunit assignments of these proteins was essential. Bovine
55S ribosomes prepared at high salt and detergent conditions (Fig. 4.2A) were
sedimented on another 10-30 % linear sucrose gradient containing 2 mM Mg2+ to
promote dissociation of the small (28S) and large (39S) subunits (Fig. 4.3). Purified
28S, 39S, and 55S samples were separated on SDS-polyacrylamide gel and stained
with Coomassie Blue (Fig. 4.2B). Although the amount of high molecular weight
proteins found in the 55S ribosome preparation decreased, a few of them still
remained associated with the 28S and 39S subunits in the second sucrose gradient
(Fig. 4.2B). The Coomassie Blue stained gel clearly showed the differential
protein/MRP distribution in the 28S and 39S fractions (Fig. 4.2B). Each lane was cut
into thirty equal pieces; in-gel tryptic digestions were carried out and the resulting
peptides analyzed by capLC-MS/MS and database searches were performed as
described for the analysis of 55S ribosomal proteins (Fig. 4.2B).
![Page 185: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/185.jpg)
170
Table 4.1: Peptide sequences of new mitochondrial ribosomal proteins identified
from capLC-MS/MS analyses of in-gel tryptic digestions of 28S, 39S, and 55S
proteins.
Name Sequence Score m/z Mr(expt) CHCHD1 SIQEDLGELGSLPPR 112 805.7 1609.4 KPILKPNKPLILANHVGER 97 713.2 2136.7 SIQEDLGELGSLPPRK 85 870.4 1738.7 AURKAIP1 EAPPGWQTPK 83 556.7 1109.6 AGLKEAPPGWQTPK 74 740.7 14.79.4 PTCD3 ADVHTFNSLIEATALVVNAK 150 1057.8 2113.7 TWDKVAVLQALASTVHR 145 948.4 1894.9 AHTQALSMYTELLNNR 143 931.9 1861.7 DLELAYQVHGLLNTGDNR 124 1014.9 2027.9 GSSLIIYDIMDEITGK 118 878.3 1754.6 DEGADIAGTEEVVIPK 113 821.7 1641.5 QMVAQNVKPNLQTFNTILK 110 1094.5 2186.9 DPDDDMFFQSAMR 102 788.2 1574.4 LTADFTLSQEQK 95 691 1379.9 SDLKEEILMLMAR 91 775.4 1548.9 EALGDLTALTSDSESDSDSDTSKDK 90 863.8 2588.4 VAVLQALASTVHR 88 683 1364.1 NELLNEFMDSAK 80 706.3 1410.5 ASSSPAQAVEVVK 79 636.7 1271.4 TFSPKDPDDDMFFQSAMR 72 723.6 2167.9 AGHQLGVTWR 63 563.4 1124.7 LEMIPQIWK 55 579.4 1156.8 WNNILDLLK 54 564.9 1127.9 EEILMLMAR 51 553.6 1105.2 ICT1 DMIAEASQPATEPSKEDAALQK 124 1165.9 2329.9 FHLASADWIAEPVR 119 806.8 1611.5 SAYSLDKLYPESR 95 766.3 1530.7 QGNDDIPVDR 90 565.3 1128.5
AGELILTSEYSR 79 670.4 1338.8 VPGDAKQGNDDIPVDR 69 565.6 1693.9 GADTAWRVPGDAK 60 672.6 1343.2
CRIF1 AAAMAAAAAQDPADSETPDS 116 930.9 1859.8 HGAASGVDPGSLWPSR 115 797.5 1593.1 EQLLELEAEER 77 680.3 1358.6 FQELLQDLEK 62 632.3 1262.7 MPQMIENWR 54 602.9 1203.8 C7orf30 YTDYFVIGSGTSTR 100 784.0 1566.0 FDIDMLVSLLR 84 670.3 1338.6 Table is generated by Dr. E. Koc and Dr. H. Koc.
![Page 186: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/186.jpg)
171
In general, the same set of proteins, which was consistently found in capLC-
MS/MS analyses of 55S ribosomes prepared at different ionic and detergent
conditions, was also identified in 28S and 39S subunits. The proteins transiently
associated with the 55S ribosome including mitochondrial EF-Tu and ribosome
release factor (RRF) were released when the 55S ribosome preparation was
dissociated into 28S and 39S ribosome in the second sucrose gradient at 2 mM Mg2+.
Six new proteins (CHCHD1, AURKAIP1, PTCD3, ICT1, CRIF1, and C7orf30) were
consistently observed in 28S or 39S subunits and 55S ribosomes making it crucial to
determine whether these proteins are bona fide ribosomal proteins or ribosome-
associated proteins. As marked in Fig. 4.2B, the gel slices where the peptides detected
from these proteins by capLC-MS/MS analyses were in good agreement with their
expected molecular masses after removal of mitochondrial import signals (34). In
addition, the experimental emPAI scores described by Ishihama et al. (27) were
calculated to demonstrate the relative protein abundance in each subunit using the
ratio of peptides detected by capLC-MS/MS analyses to the number of observable
peptides obtained from in silico digestion of a protein (Table 4.2). The GenBank™
and Swiss-Prot access numbers of the newly identified MRPs used in the emPAI
determination are listed in Table 4.3. The agreement between the emPAI scores for
the 55S ribosome and either 28S or 39S subunit values for each protein (except
PTCD3 and ICT1) clearly shows that these proteins were associated with the
ribosome and its subunits at conditions used in our experiments (Table 4.2). Slight
variations in emPAI scores could be due to the variations in excision of gel slices,
extraction of peptides and/or data dependent acquisition of peptides by the capLC-
MS/MS system. Some of the characteristics of these new ribosomal proteins are
described below.
![Page 187: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/187.jpg)
172
Table 4.2: Relative distribution of new mitochondrial ribosomal proteins using
emPAI (Exponentially Modified Protein Abundance Index) values.
Subunit CHCHD1 AURKAIP1 PTCD3 ICT1 CRIF1 C7orf30
28S 3.30 0.27 169.61 0.97 0.49 0.22
39S ND 0.19 0.64 1.09 2.02 0.48
55S 3.14 0.27 22.77 0.86 2.11 0.30
Peptides (ion score cut off of ≥ 45) were used in emPAI calculations.
ND; not detected.
![Page 188: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/188.jpg)
173
Table 4.3: GenBank™ and Swiss-Prot accession numbers of new mitochondrial
ribosomal proteins found in various species.
MRP Protein Human Bovine Mouse
MRPS37 CHCHD1 Q96BP2 Q2HJE8 XP_852408
MRPS38 AURKAIP1 Q9NWT8 Q0VCJ1 XM_843641
MRPS39 PTCD3 Q96EY7 Q2KI62 XP_532975
MRPL59 ICT1 Q14197 Q3T116 XP_533118
MRPL60 CRIF1 Q8TAE8 A1A4P4 XP_533898
MRPL61 C7orf 30 Q96EH3 Q0P562 Q9CWV0
![Page 189: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/189.jpg)
174
CHCHD1: Although a signal peptide cleavage site was not predicted by MitoProt II,
the probability of a mitochondrial localization of bovine CHCHD1 is 81% (34). The
full length bovine CHCHD1 is about 13.6 kDa. Mass spectrometry analysis of tryptic
peptides extracted from the protein bands excised from 28S, 39S, and 55S lanes
resulted in identification of CHCHD1 peptides in 28S and 55S samples but not in 39S
subunits (Table 4.2). The emPAI values calculated using detected CHCHD1 peptides
clearly suggest that this protein is mainly associated with the small subunit of
mitochondrial ribosomes (Table 4.2). Although the mammalian mitochondrial
CHCHD1 has a homolog in yeast mitochondrial ribosome, MRP10, which has about
20% sequence identity (35,36), here we provide the first experimental evidence for
CHCHD1 being a component of the animal mitochondrial small subunit. This is
confirmed with immunoblotting analysis of purified mitochondrial ribosomal subunits
in Fig. 4.5.
AURKAIP1: AURKAIP1, also known as Aurora-A-interacting protein (AIP), was
first described as a regulator of Aurora-A kinase, which is a Ser/Thr kinase involved
in cell cycle progression and tumorigenesis (37-39). The unknown domain found in
AURKAIP1 homologs is described as DUF1713 and this unknown domain has high
homology with the C-terminal domain of yeast COX24. The calculated molecular
mass of the full length AURKAIP1 is 22.4 kDa; however, the mature protein migrates
at about 16 kDa (Fig. 4.2B). It is possible that AURKAIP1 has a longer signal peptide
than the predicted signal peptide which provides a 99% possibility for the
translocation of this protein into mitochondria. Translocation of AURKAIP1 into the
mitochondria has also been experimentally validated by the Human Protein Atlas
(HPA) project (40). AURKAIP1 was repeatedly detected in the capLC-MS/MS
analyses of low and high salt preparation of bovine mitochondrial ribosomes and
![Page 190: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/190.jpg)
175
subunits. The calculated emPAI values for peptides obtained from purified 28S and
39S preparations suggested association of AURKAIP1 with the small subunit since its
emPAI value for 28S subunit is 30 % higher than that of the 39S subunit (Table 4.2).
This observation was also supported by immunoblotting analysis performed for
AURKAIP1 distribution in these samples in Fig. 4.5.
PTCD3: We first reported PTCD3 as an mRNA-binding protein associated with the
28S subunit as a PET309 homolog due to the presence of the pentatricopeptide
repeats (41). Association of PTCD3 with the small subunit has also been reported in
addition to its essential role in mitochondrial translation (42). We have discovered
that it is one of the 28S subunit proteins interacting with mitochondrial initiation
factor 3 (43). The full length bovine PTCD3 is 77.8 kDa with a pI of 6.0, possibly the
largest protein and one of the most acidic components of the 55S ribosome. It is
highly conserved among its animal mitochondrial homologs (Fig. 4.2B). Due to the
size and lower pI of the PTCD3 compared to the basic proteins of the mitochondrial
ribosome, nineteen unique peptides were detected in capLC-MS/MS analyses
(Table 4.1). In agreement with the earlier observations, PTCD3 peptides were mainly
detected in protein bands excised from 28S and 55S lanes (Table 4.2). Its subunit
localization is also supported by the emPAI values shown in Table 4.2; specifically,
the high experimental emPAI value for peptides identified in the 28S subunit sample
as well as in the 55S sample indicates that PTCD3 is a ribosomal component
associated with both 28S subunit and 55S ribosomes. The presence of a trace amount
of PTCD3 in 39S preparations could be due to the presence of a small amount of the
28S subunits in the large subunit fractions analyzed. This cross-fractionation is not
uncommon even for MRPs with clear bacterial homologs (6). High emPAI scores of
![Page 191: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/191.jpg)
176
the 28S subunit and 55S ribosomes enabled us to conclude that PTCD3 is a
mitochondrial-specific MRP mainly associated with the 28S subunit.
ICT1: This protein belongs to the polypeptide release family of proteins and is the
first example of a peptidyl-tRNA hydrolase activity provided by an integral
component of the large subunit (44). ICT1 is essential for the hydrolysis of peptidyl-
tRNAs on prematurely terminated mRNAs lacking a stop codon (44,45). Tryptic
peptides detected by capLC-MS/MS analyses of protein bands are listed in Table 4.1.
ICT1 peptides were detected in the 28S, 39S, and 55S samples, making the calculated
emPAI values of the ICT1 in 28S and 39S subunits very close to each other. The
experimental emPAI scores were not different enough to assign ICT1 to a particular
subunit (Table 4.2). The human ICT1 was previously shown to be associated with the
large subunit (44); however, our MS data does not clearly support association of ICT1
with the large subunit. Here, it is plausible to suggest that ICT1 is located near the
interface region of the large subunit and a fraction of ICT1 also sediments with the
small subunit.
CRIF1: The calculated molecular mass of the full length bovine CRIF1 is 25.7 kDa.
The mitochondrial localization signal peptide is predicted to be in the first 28 amino
acid residues with a 90 % possibility which was calculated by MitoProt II (34). The
calculated molecular weight for the mature CRIF1 is 22.9 kDa and this value is in
agreement with the migration of the protein in SDS-polyacrylamide gel detected by
capLC-MS/MS (Fig. 4.2B). The emPAI values calculated from five unique CRIF1
peptides detected in the 39S and 55S samples strongly suggest that the mitochondrial
CRIF1 is a large subunit protein (Table 4.2). Association of CRIF1 with the large
subunit is also demonstrated with immunoblotting assay of sucrose gradient fractions
and of the purified subunits from these fractions (Fig. 4.5).
![Page 192: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/192.jpg)
177
C7orf30: Bovine C7orf30 is a 234 amino acid residue long protein with a predicted
signal peptide cleavage site within the first 45 residues. C7orf30 has a homolog in
bacteria, ybeB. C7orf30 was recently discovered to be essential for the assembly or
stability of mitochondrial ribosomes by interacting with the large subunit of the
ribosome analogous to bacterial ybeB (46,47). Its role in translation is confirmed by
siRNA knock-down studies in human cell lines causing an overall reduction in
expression of mitochondrially expressed proteins (46,47). In agreement with these
recent studies, a fraction of C7orf30 remained associated with the 55S ribosome and
39S subunits in the LC-MS/MS analyses of the ribosome and its subunits prepared
under different salt conditions (Table 4.2).
4.4.3 Localization of CHCHD1, AURKAIP1, and CRIF1 into the Mitochondria
and Their Roles in Mitochondrial Translation
In the capLC-MS/MS analyses of purified bovine mitochondrial ribosomal
proteins presented above, we clearly demonstrated that CHCHD1 and AURKAIP1 are
small subunit proteins and CRIF1 is a highly conserved large subunit protein of the
55S ribosome. However, various ectopically expressed forms of CRIF1 in human cell
lines have been shown to localize to the nucleus and to be involved in transcriptional
activation (48). In order to evaluate the mitochondrial ribosome association of
CHCHD1, AURKAIP1, and CRIF1, HeLa whole cell and mitochondrial lysates
prepared under non-denaturing conditions were centrifuged through a 34 % sucrose
cushion, a step analogous to that used in the preparation of bovine liver mitochondrial
ribosomes (Fig. 4.4). This process enriched the multimeric complexes of human cell
![Page 193: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/193.jpg)
178
and mitochondrial lysates resistant to high salt and non-ionic detergent treatment at
the bottom layer and pellet, mainly as ribosomes. In immunoblotting analyses of
postribosomal supernatant layers and crude ribosomal pellets obtained from the whole
cell and mitochondrial lysates, new MRPs were found mainly in the pellet along with
two mitochondrial ribosomal proteins; MRPS29 and MRPL47, confirming their co-
localization with the mitochondrial ribosome and/or the other large complexes in
mitochondria (Fig. 4.4).
![Page 194: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/194.jpg)
179
Figure 4.4: Sedimentation of new MRPs with large complexes in human cell lines and
mitochondria.
A. Whole cell lysate (WCL) and B. mitochondrial lysate (MITO) obtained from
human cell lines were layered on sucrose cushion preparations. After 16 h centrifugation,
post-ribosomal supernatant layers (Layers 1 to 6) and crude ribosome pellet (P) were
collected and analyzed by immunoblotting probed with CHCHD1, AURKAIP1, CRIF1,
MRPS29, MRPL47, and HSP60 antibodies.
![Page 195: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/195.jpg)
180
Following the enrichment of multimeric complexes of mitochondria, the crude
bovine mitochondrial ribosomal pellet was layered and sedimented through a 10-30 %
linear sucrose gradient to separate free subunits and 55S ribosomes (Fig. 4.5A). Again
the immunoblotting analysis of sucrose gradient fractions with antibodies against
MRPS29, and MRPL47 confirmed the association of new MRPs only with the
mitochondrial ribosome (Fig. 4.5A). Free-pools of new MRPs in early fractions of the
sucrose gradient are absent which implies that each of these proteins is an integral part
of the ribosome rather than a ribosome-associated factor which dissociates from the
ribosomes as observed for EF-Tu, RRF, or C7orf30. In order to confirm the
association of CHCHD1 and AURKAIP1 with the small subunit and CRIF1 with the
large subunit, fractions corresponding to the 55S ribosome were combined and
dissociated into 28S and 39S subunits by lowering the Mg2+ concentration prior to
their separation on another linear sucrose gradient (Fig. 4.5B). Immunoblotting
analyses of purified subunits and 55S ribosome displays overlapping signals of
CHCHD1 and AURKAIP1 with MRPS29 antibody in 28S and 55S confirming their
association with the small subunit, and of CRIF1 with MRPL47 antibody in the 39S
and 55S fractions indicating its association with the large subunit (Fig. 4.5B). Further
evidence for RNA-dependent association of these new MRPs with the mitochondrial
ribosome was provided by the RNase A-treatment of the 55S ribosome prior to the
loading on the sucrose gradient. As shown by the immunoblotting analysis, signals
from the new MRPs completely disappeared in the sucrose gradient fractions of 55S
ribosomes treated with RNase A similar to the other mitochondrial ribosomal proteins
while the HSP60 signal remained in these fractions (Fig. 4.6). The data obtained by
capLC-MS/MS and immunoblotting analyses together suggest that CHCHD1 and
![Page 196: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/196.jpg)
181
AURKAIP1 are newly described components of the small subunit while CRIF1 is a
bona fide component of the large subunit of mitochondrial ribosomes.
![Page 197: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/197.jpg)
182
Figure 4.5: Distribution of new MRPs in 28S and 39S subunits.
A. Crude bovine mitochondrial ribosomes prepared at high salt conditions
(~10 A260) were layered on a 10-30 % sucrose gradient. Sedimentation of intact
ribosomes and ribosomal subunits into the sucrose gradient were analyzed by
immunoblotting using MRPS18-2, MRPS29, and MRPL47 antibodies to mark the
small (28S) and large subunit (39S) locations. CHCHD1 and AURKAIP1 co-
sediments with the 28S subunit and 55S ribosomes, while CRIF1 co-sediments
mainly with the 39S subunit and 55S ribosomes. B. Purified 28S and 39S subunits
(~0.2 A260) obtained from dissociation of 55S fractions shown in (A) at 2 mM Mg2+
were separated on a 12 % SDS-polyacrylamide gel and analyzed by immunoblotting
using CHCHD1, AURKAIP1, CRIF1, MRPS29, and MRPL47 antibodies to confirm
subunit distribution of the new MRPs.
![Page 198: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/198.jpg)
183
Figure 4.6: RNA-dependent association of new MRPs with the 55S ribosome.
Same amounts of crude bovine mitochondrial ribosomes (~5 A260), Control
(A) and RNAse A-treated (B), were sedimented on 10-30 % sucrose gradients.
Sedimentation of the new MRPs with ribosomal subunits and 55S ribosomes in the
absence and presence of RNAse A was analyzed by immunoblotting using CHCHD1,
AURKAIP1, CRIF1, MRPS29, MRPL47, and HSP60 antibodies. Equal volumes of
sucrose gradient fractions were also analyzed by 12 % SDS-polyacrylamide gel.
![Page 199: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/199.jpg)
184
Mitochondrial ribosomes synthesize thirteen essential subunits of the
OXPHOS complexes, including subunits of Complex I (ND1, ND2, ND3, ND4,
ND4L, ND5 and ND6), Complex III (Cytb), Complex IV (COI, COII, COIII), and
Complex V (ATP6 and ATP8). Given the association of the new MRPs with the
mitochondrial ribosome described above, we next examined the effect of CHCHD1,
AURKAIP1, and CRIF1 knock-down on the de novo synthesis of mitochondrially-
encoded proteins by [35S]-methionine labeling in the presence of the cytoplasmic
protein synthesis inhibitor, emetine. For this purpose, HEK293T cells were
transfected with control siRNA and corresponding specific siRNAs to CHCHD1,
AURKAIP1, and CRIF1. The specific knock-down of CHCHD1, AURKAIP1, and
CRIF1 in HEK293T cell lines transfected with siRNA was confirmed by
immunoblotting analysis of whole cell lysate for AURKAIP1, MRPS29, MRPL47,
and HSP60 and crude ribosomal fraction for CHCHD1 and CRIF1 using
corresponding antibodies (Fig. 4.7A) in addition to the RT-PCR assay (Fig. 4.7B).
Next, the expression of [35S]-methionine labeled mitochondrial proteins were
analyzed by SDS-PAGE (Fig. 4.8). In cells transfected with siRNAs to new MRPs,
mitochondrial protein synthesis was decreased by at least 30 % compared to the cells
transfected with control siRNA while the total protein content of the cell lysates were
comparable (Fig. 4.8). Given that a considerable amount of new MRPs remained in
siRNA knock-down cells, the 30% reduction in overall mitochondrial translation is
significant (Fig. 4.8). In addition, when we analyzed the steady state levels of
oxidative phosphorylation subunits in these samples, the reduction in Complex IV
subunit, COII, which is a mitochondrial encoded protein, but not in the subunits of
Complex V, Complex III, and Complex II, which are nuclear encoded, implies the
essentiality of these proteins in mitochondrial protein synthesis as a member of
![Page 200: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/200.jpg)
185
ribosomes (Fig. 4.9). Clearly, the inhibition of protein synthesis in knock-down cells
was due to a reduction in expression of new MRPs since the reprobing of the same
membrane with MRPS29, MRPL47, and HSP60 antibodies showed no difference in
total ribosome or mitochondrial contents (Fig. 4.7A). In order to confirm that the
observations in knock-down cells were not due to changes in the transcription levels
of mitochondrial proteins or ribosomal RNA, transcription levels of ND6, COI, COII,
ATP6, 12S rRNA, MRPS29, MRPL47, and GAPDH were assayed by RT-PCR. Their
levels in knock-down cells were not altered when compared to the cells transfected
with control siRNA (Fig. 4.7B). Altogether, these observations suggest that
CHCHD1, AURKAIP1, and CRIF1 all have essential roles in mitochondrial protein
synthesis as a component of the small and large subunit proteins in the 55S ribosome.
![Page 201: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/201.jpg)
186
Figure 4.7A: siRNA mediated knock-down of new MRPs.
Expression of new MRPs in control HEK293T and siRNA transfected cells
was analyzed by immunoblotting analysis using antibodies against CHCHD1,
AURKAIP1, CRIF1, HSP60, MRPS29, and MRPL47. HSP60 antibody was used as a
loading control for total mitochondrial and MRPS29 and MRPL47 antibodies are for
ribosome contents. Signal intensities were graphed relative to siCon.
* : crude ribosome preparations were used instead of cell lysate as in others.
![Page 202: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/202.jpg)
187
Figure 4.7B: RT-PCR analysis of mitochondrial- and nuclear-encoded transcripts.
Transcript levels of CHCHD1, AURKAIP1, and CRIF1 were shown as an
indication of knock-down efficiency in cell lines transfected with control siRNA and
siRNAs for corresponding new MRP. Mitochondrial encoded ND6, COI COII, ATP6,
and 12S rRNA, and nuclear encoded MRPS29 and MRPL47 were examined by RT-
PCR reactions in the same samples as well. RT-PCR reactions with GAPDH were
performed as a positive control. Signal intensities were quantified relative to siCon and
given as a graph.
![Page 203: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/203.jpg)
188
Figure 4.8: Effect of new MRPs knock-down on mitochondrial protein synthesis.
A. De novo synthesis of mitochondrial proteins was evaluated in control and
siRNA transfected HEK293T cells (CON: control and knock-down of corresponding
MRP) by pulse labeling of proteins in the presence of [35S]-methionine and a
cytosolic translation inhibitor, emetine. A. representative electrophoretic pattern of the
de novo synthesized translational products is presented. ND1, -2, -3, -4, -4L, -5, and -
6 are subunits of Complex I; Cytb is a subunit of Complex III; COI, -II, and -III are
subunits of Complex IV; ATP6 and ATP8 are subunits of Complex V. Coomassie
Blue staining of the same gel was performed to ensure equal protein loading in the
gel. B. The combined intensities of 13 mitochondrially-encoded proteins from each
lane were used as an overall quantitation of mitochondrial protein synthesis.
Shown is the mean ± SD of four independent experiments. Results were analyzed by
one way ANOVA test; *, P < 0.05.
* * *
![Page 204: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/204.jpg)
189
Figure 4.9: Effect of new MRPs knock-down on OXPHOS subunits.
Immunoblotting analysis of whole cell lysates prepared from control siRNA
and new MRP specific siRNA transfected HEK293T cells to examine the steady state
levels of nuclear encoded subunits of Complex V, III, and II and mitochondrial
encoded subunit of Complex IV, COII. The same immunoblot was used to probe with
MRPS29, MRPL47, and HSP60 to ensure equal loading.
![Page 205: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/205.jpg)
190
4.4.4 Nomenclature
Two-dimensional gel analysis of the mitochondrial ribosomal proteins in
bovine liver suggested the presence of as many as 33 ribosomal proteins in the 28S
subunit and 52 ribosomal proteins in the 39S subunit (5,6). These proteins were
designated S1 through S33 for the 28S subunit and L1 through L52 for the 39S
subunit in order of decreasing molecular mass. However, this nomenclature system
did not provide consistency for designation of same proteins from different
organisms. Hence, we adopted a system of nomenclature, in which proteins with
prokaryotic homologues are given the same number as the corresponding ribosomal
protein in E. coli. Proteins without bacterial homologues are given the next available
number. Bacterial ribosomes have proteins designated S1 through S21 in the 28S
subunit and L1 through L36 in the large subunit. Additionally, previously identified
mammalian ribosomal proteins without bacterial homologues were designated S22
through S36 for the 28S subunit and L37 through L57 for the 39S subunit. As a result,
newly identified small subunit proteins; CHCHD1, AURKAIP1, and PTCD3, will be
named as MRPS37, MRPS38, and MRPS39 and ICT1 and CRIF1, as newly identified
large subunit proteins MRPL58 and MRPL59, respectively (Table 4.4).
![Page 206: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/206.jpg)
191
28S and 39S: small and large subunit of mitochondrial ribosome 30S and 50S: small and large subunit of bacterial ribosome New Class: mitochondria-specific ribosomal proteins
Table 4.4: List of mammalian mitochondrial ribosomal proteins with their bacterialhomologs
28S 30S New Class 39S 50S New Class Missing S1 MRPS22 MRPL1 L1 MRPL37 MRPS2 S2 MRPS23 MRPL2 L2 MRPL38 Missing S3 MRPS24 MRPL3 L3 MRPL39 Missing S4 MRPS25 MRPL4 L4 MRPL40 MRPS5 S5 MRPS26 Missing L5 MRPL41 MRPS6 S6 MRPS27 Missing L6 MRPL42 MRPS7 S7 MRPS28 MRPL12 L7/L12 MRPL43 Missing S8 MRPS29 MRPL9 L9 MRPL44 MRPS9 S9 MRPS30 MRPL10 L10 MRPL45 MRPS10 S10 MRPS31 MRPL11 L11 MRPL46 MRPS11 S11 MRPS32 MRPL13 L13 MRPL48 MRPS12 S12 MRPS33 MRPL14 L14 MRPL49 Missing S13 MRPS34 MRPL15 L15 MRPL50 MRPS14 S14 MRPS35 MRPL16 L16 MRPL51 MRPS15 S15 MRPS36 MRPL17 L17 MRPL52 MRPS16 S16 MRPS37 (CHCHD1) MRPL18 L18 MRPL53 MRPS17 S17 MRPS38 (AURKAIP1) MRPL19 L19 MRPL54 MRPS18-1 S18 MRPS39 (PTCD3) MRPL20 L20 MRPL55 MRPS18-2 S18 MRPL21 L21 MRPL56 MRPS18-3 S18 MRPL22 L22 MRPL57 (RP_63) Missing S19 MRPL23 L23 MRPL58 (ICT1) Missing S20 MRPL24 L24 MRPL59 (CRIF1) MRPS21 S21 Missing L25 MRPL60 (C7orf30) MRPL27 L27 MRPL28 L28 MRPL47 L29 MRPL30 L30 Missing L31 MRPL32 L32 MRPL33 L33 MRPL34 L34 MRPL35 L35 MRPL36 L36
![Page 207: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/207.jpg)
4.5 Conclusions and Future Directions
Ribosomal proteins have roles in ribosome assembly, substrate binding, and/or
different stages of translation (initiation, elongation, and termination). The MRPs with
bacterial homologs are expected to have conserved functions in ribosome structure and
translation. For the mammalian mitochondrial-specific proteins without known homologs
in other ribosomes, it is highly challenging to determine whether a ribosome-associated
protein is a genuine ribosomal protein or a factor transiently associated with the
ribosome. The criteria used in this study, however, allowed us to assign the newly
identified proteins as mitochondrial-specific ribosomal proteins due to their distribution
similar to that of the MRPs with bacterial homologues in highly purified subunit and
ribosome preparations (Table 4.1). With the newly identified MRPs, the number of
mammalian mitochondrial ribosomal proteins is brought to 31 for the small subunit and is
increased to 51 for the large subunit (Table 4.4) (5,6,11,33,49). It is not feasible to assign
specific roles for the majority of mitochondrial-specific proteins without structural
information and their relative locations in the ribosome; however, many of them have
been shown to be essential for mitochondrial protein synthesis and/or function. For
instance, the yeast homologue of MRPS37 (CHCHD1), MRP10, was found to be
indispensible for mitochondrial translation (50,51). A respiratory defect caused by a null
mutant of MRP10 was recovered by the reintroduction of the MRP10 gene in a wild-type
mitochondrial DNA background (35). Similarly, MRPS38 (AURKAIP1) is a possible
homolog of yeast COX24p involved in processing and translation of COX I mRNA (52).
![Page 208: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/208.jpg)
193
Unlike the mitochondrially encoded genes in yeast, mammalian mitochondrial genes do
not contain introns to be processed or require minimal processing. MRPS37 and MRPS38
are ribosomal small subunit proteins involved in translation since their knock-down in
cells impairs the mitochondrial translation of thirteen essential proteins of oxidative
phosphorylation. However, their specific role in mammalian mitochondrial translation
remains to be discovered.
siRNA knock-down of MRPS39 (PTCD3) decreased Complex III and Complex
IV activities possibly by directly affecting mRNA binding to the mitochondrial ribosome
(42). In fact, PTCD3 was identified as one of the IF3mt interacting proteins in the small
subunit (43). Although the majority of the MRPs forming the platform of the mRNA-
binding path in the 28S subunit are bacterial homologs such as MRPS7, MRPS11,
MRPS18, and MRPS21, the shoulder region and the mRNA-gate of the 28S subunit are
mainly formed by mitochondrial-specific MRPs (28). Therefore, it is possible that
MRPS39 is one of the proteins forming the mRNA-binding path interacting with the 5’-
ends of mitochondrial mRNAs.
MRPL58 was initially identified as immature colon carcinoma transcript 1 (ICT1)
since it was one of the transcripts differentially expressed in colorectal tumors that
deviate from the normal maturation pathway in colon epithelium (53,54). Later, it was
discovered to be an unusual member of a release factor family involved in termination of
mitochondrial translation with a codon-independent peptidyl-tRNA hydrolase activity
associated with the mitochondrial ribosome (44,55). It was also recently reported that
MRPL58 is essential for cell viability since its knock-down resulted in reduced
![Page 209: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/209.jpg)
194
cytochrome c oxidase activity, mitochondrial membrane potential, and eventually
apoptotic cell death (45).
The other new large subunit protein MRPL59 (CRIF1) has been identified as a
transcription co-factor which controls the G1/S phase of the cell cycle (56). It also
negatively regulates the stability of a transcription factor NRF2 (nuclear respiratory
factor 2), which promotes expression of many mitochondrial proteins and proteins
involved in oxidative damage, by ubiquitination (48). Here, the majority of these studies
were performed using the ectopically expressed form of CRIF1 with a tag at its amino
terminus; therefore, it is possible that the majority of tagged CRIF1 may not get
incorporated into the 55S ribosome due to masking of mitochondrial targeting signal and
is subsequently translocated into the nucleus. Another explanation could be that a very
small fraction of CRIF1 is located into the nucleus to manifest its function as a
transcription co-factor. However, when the tag is placed at protein’s carboxy terminus,
the protein is targeted to mitochondria (57). Recently, it has been reported to be
interacting with ATAD3 as a component of mitochondrial nucleoprotein complexes
confirming CRIF1 to be localized in mitochondria (57). Endogenous levels of CRIF1 has
been shown to be dramatically reduced in epithelial cell cancers in thyroid and breast
which is in agreement with possible mitochondrial dysfunction reported in many different
cancer types (56). In this study, we provided very strong evidence for CRIF1 being a
bona fide ribosomal protein and an essential component of the mitochondrial translation
machinery in vivo.
![Page 210: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/210.jpg)
195
Given that the mitochondrial translational machinery and its components are
essential for the expression of OXPHOS subunits, studies related to the identification of
new components of the translational machinery and their specific roles in translation have
the utmost importance in understanding the energy production by OXPHOS. A
completed picture of the mitochondrial translation machinery will also allow us to assess
mitochondrial dysfunction manifested as neurodegenerative diseases, aging, diabetes, and
cancer.
4.6 Acknowledgment
This work was supported in part by the National Institutes of Health grants
[R01GM32734 to L.L.S., R01GM071034 to E.C.K.].
4.7 References
1. O'Brien, T. W., Denslow, N. D., Faunce, W., Anders, J., Liu, J., and O'Brien, B. (1993) Structure and function of mammalian mitochondrial ribosomes. In: Nierhaus, K., Franceschi, F., Subramanian, A., Erdmann, V., and Wittmann-Liebold, B. (eds). The translational apparatus: Structure, function regulation and evolution., Plenum Press, New York
2. Pel, H., and Grivell, L. (1994) Mol Biol Rep 19, 183-194 3. De Vries, H., and van der Koogh-Schuuring, R. (1973) Biochem Biophys Res Comm
54, 308-314 4. Pietromonaco, S., Denslow, N., and O'Brien, T. W. (1991) Biochimie 73, 827-836 5. Koc, E. C., Burkhart, W., Blackburn, K., Moseley, A., and Spremulli, L. L. (2001) J.
Biol. Chem. 276, 19363-19374 6. Koc, E. C., Burkhart, W., Blackburn, K., Schlatzer, D. M., Moseley, A., and
Spremulli, L. L. (2001) J. Biol. Chem. 276, 43958-43969 7. Goldschmidt-Reisin, S., Kitakawa, M., Herfurth, E., Wittmann-Liebold, B.,
Grohmann, L., and Graack, H.-R. (1998) J Biol Chem 273, 34828-34836
![Page 211: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/211.jpg)
196
8. Graack, H.-R., Bryant, M., and O'Brien, T. W. (1999) Biochem. 38, 16569-16577 9. Koc, E. C., Blackburn, K., Burkhart, W., and Spremulli, L. L. (1999) Biochem
Biophys Res Comm 266, 141-146 10. Yang, Y., Cimen, H., Han, M. J., Shi, T., Deng, J. H., Koc, H., Palacios, O. M.,
Montier, L., Bai, Y., Tong, Q., and Koc, E. C. (2010) J. Biol. Chem. 285(10), 7417-7429
11. Suzuki, T., Terasaki, M., Takemoto-Hori, C., Hanada, T., Ueda, T., Wada, A., and Watanabe, K. (2001) J Biol Chem 276(24), 21724-21736
12. Sharma, M. R., Koc, E. C., Datta, P. P., Booth, T. M., Spremulli, L. L., and Agrawal, R. K. (2003) Cell 115(1), 97-108
13. Agrawal, R. K. S., M. R.; Yassin, A.; Lahiri, I.; Spremulli, L. L. (2011) Structure and function of organaller ribosomes as revealed by cryo-EM in ribosomes:Structure, functions and dynamics, Springer-Verlag
14. Yoo, Y. A., Kim, M. J., Park, J. K., Chung, Y. M., Lee, J. H., Chi, S. G., Kim, J. S., and Yoo, Y. D. (2005) Mol Cell Biol 25(15), 6603-6616
15. Chintharlapalli, S. R., Jasti, M., Malladi, S., Parsa, K. V., Ballestero, R. P., and Gonzalez-Garcia, M. (2005) J Cell Biochem 94(3), 611-626
16. Levshenkova, E. V., Ukraintsev, K. E., Orlova, V. V., Alibaeva, R. A., Kovriga, I. E., Zhugdernamzhilyn, O., and Frolova, E. I. (2004) Bioorg Khim 30(5), 499-506
17. Carim, L., Sumoy, L., Nadal, M., Estivill, X., and Escarceller, M. (1999) Cytogenet Cell Genet 87(1-2), 85-88
18. Mariani, L., Beaudry, C., McDonough, W. S., Hoelzinger, D. B., Kaczmarek, E., Ponce, F., Coons, S. W., Giese, A., Seiler, R. W., and Berens, M. E. (2001) Clin Cancer Res 7(8), 2480-2489
19. Lyng, H., Brovig, R. S., Svendsrud, D. H., Holm, R., Kaalhus, O., Knutstad, K., Oksefjell, H., Sundfor, K., Kristensen, G. B., and Stokke, T. (2006) BMC Genomics 7, 268
20. Miller, C., Saada, A., Shaul, N., Shabtai, N., Ben-Shalom, E., Shaag, A., Hershkovitz, E., and Elpeleg, O. (2004) Ann. Neurol. 56(5), 734-738
21. Bonnefoy, N., Bsat, N., and Fox, T. D. (2001) Mol Cell Biol 21(7), 2359-2372 22. Matthews, D. E., Hessler, R. A., Denslow, N. D., Edwards, J. S., and O'Brien, T. W.
(1982) J Biol Chem 257, 8788-8794 23. Spremulli, L. L. (2007) Methods Mol Biol 372, 265-275 24. Miller, J. L., Cimen, H., Koc, H., and Koc, E. C. (2009) J. Proteome Res. 8(10),
4789-4798 25. Miller, J. L., Koc, H., and Koc, E. C. (2008) Protein Sci. 17(2), 251-260 26. Soung, G. Y., Miller, J. L., Koc, H., and Koc, E. C. (2009) J Proteome Res 8(7),
3390-3402 27. Ishihama, Y., Oda, Y., Tabata, T., Sato, T., Nagasu, T., Rappsilber, J., and Mann, M.
(2005) Mol Cell Proteomics 4(9), 1265-1272 28. Cimen, H., Han, M. J., Yang, Y., Tong, Q., Koc, H., and Koc, E. C. (2010)
Biochemistry 49(2), 304-311 29. Chomyn, A. (1996) Methods Enzymol 264, 197-211 30. Leary, S. C., and Sasarman, F. (2009) Methods Mol Biol 554, 143-162 31. Jeffreys, A. J., and Craig, I. W. (1976) Eur J Biochem 68(1), 301-311
![Page 212: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/212.jpg)
197
32. O'Brien, T. W., Fiesler, S., Denslow, N. D., Thiede, B., Wittmann-Liebold, B., Mouge, E., Sylvester, J. E., and Graack, H.-R. (1999) J. Biol. Chem. 274, 36043-36051
33. Koc, E. C., Burkhart, W., Blackburn, K., Moseley, A., Koc, H., and Spremulli, L. L. (2000) J Biol Chem 275(42), 32585-32591
34. Claros, M. G., and Vincens, P. (1996) Eur J Biochem 241, 770-786 35. Jin, C., Myers, A. M., and Tzagoloff, A. (1997) Curr Genet 31(3), 228-234 36. Graack, H.-R., Grohman, L., Kitakawa, M., Schafer, K., and Kruft, V. (1992) Eur J
Biochem. 206, 373-380 37. Kiat, L. S., Hui, K. M., and Gopalan, G. (2002) J Biol Chem 277(47), 45558-45565 38. Lim, S. K., and Gopalan, G. (2007) Biochem. J. 403(1), 119-127 39. Lim, S. K., and Gopalan, G. (2007) Oncogene 26(46), 6593-6603 40. Uhlen, M., Oksvold, P., Fagerberg, L., Lundberg, E., Jonasson, K., Forsberg, M.,
Zwahlen, M., Kampf, C., Wester, K., Hober, S., Wernerus, H., Bjorling, L., and Ponten, F. (2010) Nat Biotechnol 28(12), 1248-1250
41. Koc, E. C., and Spremulli, L. L. (2003) Mitochondrion 2(4), 277-291 42. Davies, S. M., Rackham, O., Shearwood, A. M., Hamilton, K. L., Narsai, R.,
Whelan, J., and Filipovska, A. (2009) FEBS Lett 583(12), 1853-1858 43. Haque, M. E., Koc, H., Cimen, H., Koc, E. C., and Spremulli, L. L. (2011) Biochim
Biophys Acta 1814(12), 1779-1784 44. Richter, R., Rorbach, J., Pajak, A., Smith, P. M., Wessels, H. J., Huynen, M. A.,
Smeitink, J. A., Lightowlers, R. N., and Chrzanowska-Lightowlers, Z. M. (2010) EMBO J 29(6), 1116-1125
45. Handa, Y., Hikawa, Y., Tochio, N., Kogure, H., Inoue, M., Koshiba, S., Guntert, P., Inoue, Y., Kigawa, T., Yokoyama, S., and Nameki, N. (2010) J Mol Biol
46. Rorbach, J., Gammage, P. A., and Minczuk, M. (2012) Nucleic Acids Res 40(9), 4097-4109
47. Wanschers, B. F., Szklarczyk, R., Pajak, A., van den Brand, M. A., Gloerich, J., Rodenburg, R. J., Lightowlers, R. N., Nijtmans, L. G., and Huynen, M. A. (2012) Nucleic Acids Res 40(9), 4040-4051
48. Kang, H. J., Hong, Y. B., Kim, H. J., and Bae, I. (2010) J Biol Chem 285(28), 21258-21268
49. O'Brien T, W., O'Brien B, J., and Norman, R. A. (2005) Gene 354, 147-151 50. Smits, P., Smeitink, J. A., van den Heuvel, L. P., Huynen, M. A., and Ettema, T. J.
(2007) Nucleic Acids Res 35(14), 4686-4703 51. Smits, P., Rodenburg, R. J., Smeitink, J. A., and van den Heuvel, L. P. (2009) J
Inherit Metab Dis DOI: 10.1007/s10545-009-0968-4 52. Barros, M. H., Myers, A. M., Van Driesche, S., and Tzagoloff, A. (2006) J Biol
Chem 281(6), 3743-3751 53. van Belzen, N., Diesveld, M. P., van der Made, A. C., Nozawa, Y., Dinjens, W. N.,
Vlietstra, R., Trapman, J., and Bosman, F. T. (1995) Eur J Biochem 234(3), 843-848 54. van Belzen, N., Dinjens, W. N., Eussen, B. H., and Bosman, F. T. (1998) Histol
Histopathol 13(4), 1233-1242 55. Haque, M. E., Elmore, K.B., Tripathy, A., Koc, H., Koc, E.C., and Spremulli, L.L.
(2010) J. Biol. Chem.
![Page 213: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/213.jpg)
198
56. Chung, H. K., Yi, Y. W., Jung, N. C., Kim, D., Suh, J. M., Kim, H., Park, K. C., Song, J. H., Kim, D. W., Hwang, E. S., Yoon, S. H., Bae, Y. S., Kim, J. M., Bae, I., and Shong, M. (2003) J Biol Chem 278(30), 28079-28088
57. He, J., Cooper, H. M., Reyes, A., Di Re, M., Sembongi, H., Litwin, T. R., Gao, J., Neuman, K. C., Fearnley, I. M., Spinazzola, A., Walker, J. E., and Holt, I. J. (2012) Nucleic Acids Res
![Page 214: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/214.jpg)
Chapter 5
Concluding Remarks and Future Directions
The mitochondria provide most of the cellular energy in the form of ATP through
respiratory chain complexes in eukaryotic cells. During the transfer of electrons through
these complexes, mitochondria generate reactive oxygen species (ROS) which is
implicated in cellular death and aging. Given that mitochondrial ribosomes are
responsible for translating the essential subunits of the respiratory chain complexes
crucial for oxidative phosphorylation, post-translational modifications of ribosomal
proteins may be one mechanism of regulating ATP production in order to maintain
energy homeostasis in the eukaryotic cell. This is plausible since acetyl-CoA, NAD+, and
ATP are the mitochondrial metabolites which are involved in acetylation, deacetylation,
and phosphorylation of target proteins, respectively. Our group previously reported the
implication of phosphorylated ribosomal proteins in regulation of mitochondrial
translation (1). In addition, recent studies have demonstrated that reversible acetylation is
involved in the regulation of mitochondrial enzymes, akin to their phosphorylation (2-7).
Overall, our findings in chapter 2 suggest that MRPL10 is the major acetylated
ribosomal protein in mitochondria, which is a bona fide substrate for NAD+-dependent
deacetylase, SIRT3. Similar to the bacterial ribosomes, MRPL10 serves the structural
surface for MRPL12 binding to the L7/L12 stalk region on the ribosome. MRPL12 plays
a significant role in translation by recruiting initiation, elongation, and release factors to
the ribosome (8-10). In bacterial ribosomes, acetylation of RPL12 was found to stabilize
![Page 215: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/215.jpg)
200
the interaction between stalk proteins due to increased hydrophobicity by acetylation
(11). The location of acetylated lysine residues on MRPL10, which were mapped using
mass spectrometry-based proteomic analyses, prompted us to reveal the role of
acetylation in modulation of protein-protein interactions in the L7/L12 stalk and
mitochondrial protein synthesis (Fig. 5.1). In SIRT3 knock-out mice, increased
acetylation status of mitochondrial ribosome enhanced MRPL12 binding to the ribosome
and recruitment of elongation factors to increase translation. On the other hand, SIRT3
over-expression reduced MRPL12 binding to ribosomes by deacetylation of MRPL10. In
addition, deacetylation of the mitochondrial ribosome impairs the mitochondrial protein
synthesis and suppresses the activities of respiratory chain Complexes I and IV resulting
in reduced ATP production in cells overexpressing SIRT3. We therefore propose a model
where the SIRT3-dependent reversible acetylation of MRPL10 may cause changes in
MRPL12 binding to the ribosome by neutralizing the positively charged lysine residues
to regulate mitochondrial protein synthesis (Fig. 5.1).
![Page 216: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/216.jpg)
201
Figure 5.1: Model for the role of MRPL10 acetylation on MRPL12 binding to
ribosome.
The mitochondrial L7/L12 stalk is formed by MRPL10 (green), MRPL11 (yellow),
and MRPL12 (blue), which are highly conserved between mammalian mitochondria and
bacteria. SIRT3 removes acetyl groups in an NAD+-dependent reaction producing
nicotinamide (NAM) and O-acetyl-ADP-ribose (O-Acetyl-ADPR). Deacetylated lysine
residues located at the N-terminal domain of MRPL10 and lysine residues in MRPL12
were shaded in red. Crystal structure model of the T. thermophilus 50S subunit (PDB:
2WRL) and solution structure of the E. coli L7/L12 dimers (PDB: 1RQU) were used to
model location of multiple copies of MRPL12 on the ribosome. The 50S ribosomal 23S
and 5S rRNA, and ribosomal proteins were colored in cyan and pink, respectively.
Structural models were generated by PyMol software (DeLano Scientific LLC) (12).
Courtesy of Dr. E. Koc.
![Page 217: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/217.jpg)
202
Overall data suggest that modulation of MRPL12 binding to the ribosome might
be one of the crucial mechanisms that regulate the synthesis of thirteen essential
components of OXPHOS complexes and ATP production in response to SIRT3 activity
in mitochondria.
In order to reveal the direct correlation between MRPL10 acetylation and
MRPL12 binding to ribosome and mitochondrial translation, site-directed mutagenesis
studies were performed on selected three acetylated residues, Lys124, Lys169, and
Lys196, to generate Arg and Gln mutants mimicking hypoacetylation and
hyperacetylation, respectively. However, due to the technical difficulties in our
preliminary studies, the in vitro and in vivo translation assays performed with MRPL10
mutants were not conclusive (Chapter 2). It is also possible that MRPL10 might have
additional acetylated lysine residues, which are involved in the modulation of MRPL10
interaction with MRPL12 on the stalk. One approach might be followed in the future
experiments is to knock-out RPL10 in bacteria with recombination techniques and to
supplement the bacteria with various RPL10 and MRPL10 plasmids including their
lysine mutants to construct a hybrid ribosomal system (13). In this system, stability of
MRPL10 expressed in bacteria would be enhanced due to its incorporation into the
bacterial ribosomes. Since the bacteria lack RPL10, the resulting ribosomes would be
mostly the hybrid ribosomes containing MRPL10. This process would also maintain the
activity of MRPL10. In our petDUET® overexpression system (Invitrogen Inc.),
recombinant MRPL10 and its mutants over-produced in bacteria was mostly insoluble
possibly because of its hydrophobic nature even though MRPL12 was also included in
the expression system to promote and stabilize MRPL10-MRPL12 complex formation.
![Page 218: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/218.jpg)
203
Even the soluble fraction of the partially purified MRPL10-MRPL12 complex did not
restore the translation activity of bacterial stripped ribosomes possibly due to the co-
purification of heat-shock proteins in my preliminary studies as opposed to our earlier
published studies (8).
The source of protein acetylation in mitochondria was not known and believed to
be a non-enzymatic reaction due to the abundance of acetyl-CoA in mammalian
mitochondria until recently (14). An alternative view was that mitochondrial proteins
could be acetylated prior to their import into mitochondria. However, a recent report on
the acetylation of ATP synthase F0 subunit 8, which is encoded and synthesized in
mitochondria, strongly suggested the presence of an acetyltransferase in mitochondria
(7). In a recent report, a component of the mitochondrial acetyltransferase system,
GCN5L1, was demonstrated to catalyze the acetylation of respiratory chain targets and
inhibit their enzymatic activities (15). This enzyme reverses the effects of sirtuins in
mitochondria. We will perform experiments with GCN5L1 to determine whether it is
involved in the acetylation of MRPL10 and, therefore, in the modulation of L7/L12 stalk
composition. The identification of the other components of the mitochondrial
acetyltransferase which are responsible for the acetylation of mitochondrial ribosomal
proteins is also plausible by using mass spectrometry-based proteomics and biochemical
approaches in mammalian mitochondria.
Succinate dehydrogenase, which is involved in both the electron transport chain
and TCA cycle, was identified as a novel substrate of SIRT3 in our two-dimensional gel
electrophoresis separation followed by mass spectrometry and immunoblotting analyses
of SIRT3 knock-out mice liver mitochondria. SIRT3 dependent deacetylation of SdhA
![Page 219: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/219.jpg)
204
subunit of the enzyme increases its activity. Acetylated lysine residues on the enzyme are
located on the surface close to the substrate binding site. In another study, additional
acetylated lysine residues on succinate dehydrogenase were reported to be involved in the
regulation of its enzymatic activity (16). It is possible that there are still additional
acetylated lysine residues to be discovered or acetylation of lysines occurs in a sequence-
dependent manner to modify the surface of SdhA. Since succinate dehydrogenase
participates in both respiratory chain and TCA cycle, it is of great interest to study how
acetylated lysine residues are coordinated and how it contributes to the regulation of its
function during aging or under different conditions, such as exposure to hypoxia and
reactive oxygen species, and even in cells lacking mitochondrial DNA.
Identification of additional proteins and factors involved in translation is
important for deep understanding of the regulation of mitochondrial protein synthesis
machinery in mammals. Therefore, the discovery of three additional mitochondrial
ribosomal proteins described in Chapter 4 provides a more complete picture of
mitochondrial ribosomes and protein synthesis. To reveal their specific roles in
mitochondrial translation, further structural information of mitochondrial ribosomes is
required. Generation of highly specific antibodies against mitochondria-specific
ribosomal proteins and cryo-EM analysis with improved resolution may provide possible
roles of the newly identified ribosomal proteins. On the other hand, there are still
questions that need to be addressed in terms of the translation process. For instance, it is
still unclear how mitochondrial mRNAs are positioned on the ribosomes during
translation initiation and the factors that are involved in this process remain to be
discovered. Furthermore, the coordination of mitochondrial translation with other
![Page 220: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/220.jpg)
205
processes including replication and transcription of mitochondrial genome is still under
investigation to identify fundamental relevance of these processes (17,18).
Mitochondrial ribosomes, which are in the process of translating a subset of
respiratory chain subunits, were found to be associated with inner membrane through
Oxa1L (19). It is currently unknown where exactly the protein synthesis occurs in
mitochondria but translating ribosomes are believed to be enriched in intracristal regions
of inner membrane (20). Visualization of individual translating mitochondrial ribosomes
in the organelle is not possible due to limitations in optical resolution of fluorescence
microscopy. However, recent improvement in stimulated emission depletion microscopy
(STED), which was employed to visualize VDAC isoforms in mitochondria, might be
sufficient to detect and analyze ribosomes in mitochondria (21). With the availability of
highly specific antibodies against mitochondrial ribosomal proteins, this technique might
provide the visualization of ribosomes during translation. Heterogeneous population of
mitochondria in cells challenges the imaging techniques when heteroplasmy, which is the
co-existence of normal and mutant mtDNAs, needs to be studied in single mitochondrion.
In addition, heterogeneous population of mitochondria or even mitochondrial ribosomes
might be generated by genetic and biochemical modifications. For instance,
overexpression of a mutant mitochondrial ribosomal protein might provide a subset of
ribosomes with that mutant protein incorporated (or even a subset of mitochondria where
mutant protein is imported). Its effect on mitochondrial functions may not be significant
since abundant normal ribosomes could compensate this deficiency. Analysis of single
mitochondrion containing the target mutant protein and even further the analysis of
mitochondrial ribosomes having the mutant protein incorporated may provide the
![Page 221: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/221.jpg)
206
significant insight about the role of that particular mutation in mitochondrial protein
synthesis and mitochondrial dysfunction. Flow cytometry (FC), laser capture
microdissection (LCM), and optical tweezers (OT) are the main techniques employed to
separate single mitochondrion (22). FC is a quantitative tool employed in the analysis of
single mitochondrion under different conditions, such as mtDNA composition, membrane
potential, and ROS production (23-25). LCM is optically controlled removal of a single
mitochondrion from specific cells or tissue. The analysis of mtDNA from individual cells
or cancer tissue is automated with this technique (26,27). OT uses a highly focused
infrared laser beam to trap single mitochondrion from a single cell. This technique
provided the detection of heteroplasmy at mitochondrion level (28). Overall, these
techniques to study single mitochondrion are expected to be advanced enough to analyze
ribosomes from single mitochondrion.
In conclusion, acetylation of protein synthesis machinery and respiratory chain
complexes in mammalian mitochondria broadens our knowledge of the role of post-
translational modifications in mitochondrial respiration. Post-translational modifications
of mitochondrial proteins and their interrelationships might enable us to devise novel
strategies to understand and modulate mitochondrial function/dysfunction in disease
states in our future studies.
5.1 References
1. Miller, J. L., Cimen, H., Koc, H., and Koc, E. C. (2009) J Proteome Res 8(10), 4789-4798
2. Cimen, H., Han, M. J., Yang, Y., Tong, Q., Koc, H., and Koc, E. C. (2010) Biochemistry 49(2), 304-311
![Page 222: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/222.jpg)
207
3. Yang, Y., Cimen, H., Han, M. J., Shi, T., Deng, J. H., Koc, H., Palacios, O. M., Montier, L., Bai, Y., Tong, Q., and Koc, E. C. (2010) J Biol Chem 285(10), 7417-7429
4. Ahn, B. H., Kim, H. S., Song, S., Lee, I. H., Liu, J., Vassilopoulos, A., Deng, C. X., and Finkel, T. (2008) Proc Natl Acad Sci U S A 105(38), 14447-14452
5. Schwer, B., Bunkenborg, J., Verdin, R. O., Andersen, J. S., and Verdin, E. (2006) Proc Natl Acad Sci U S A 103(27), 10224-10229
6. Choudhary, C., Kumar, C., Gnad, F., Nielsen, M. L., Rehman, M., Walther, T. C., Olsen, J. V., and Mann, M. (2009) Science 325(5942), 834-840
7. Kim, S. C., Sprung, R., Chen, Y., Xu, Y., Ball, H., Pei, J., Cheng, T., Kho, Y., Xiao, H., Xiao, L., Grishin, N. V., White, M., Yang, X. J., and Zhao, Y. (2006) Mol Cell 23(4), 607-618
8. Han, M. J., Cimen, H., Miller-Lee, J. L., Koc, H., and Koc, E. C. (2011) Protein Expr Purif 78(1), 48-54
9. Miller, J. L. K., H.; Koc, E.C. (2009) In preparation 10. Datta, P. P., Sharma, M. R., Qi, L., Frank, J., and Agrawal, R. K. (2005) Mol Cell
20(5), 723-731 11. Gordiyenko, Y., Deroo, S., Zhou, M., Videler, H., and Robinson, C. V. (2008) J
Mol Biol 380(2), 404-414 12. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-
Kunstleve, R. W., Jiang, J. S., Kuszewski, J., Nilges, M., Pannu, N. S., Read, R. J., Rice, L. M., Simonson, T., and Warren, G. L. (1998) Acta Crystallogr D Biol Crystallogr 54(Pt 5), 905-921
13. Gaur, R., Grasso, D., Datta, P. P., Krishna, P. D., Das, G., Spencer, A., Agrawal, R. K., Spremulli, L., and Varshney, U. (2008) Mol Cell 29(2), 180-190
14. Guarente, L. (2011) Cold Spring Harb Symp Quant Biol 76, 81-90 15. Scott, I., Webster, B. R., Li, J. H., and Sack, M. N. (2012) Biochem J 443(3), 655-
661 16. Finley, L. W., Haas, W., Desquiret-Dumas, V., Wallace, D. C., Procaccio, V.,
Gygi, S. P., and Haigis, M. C. (2011) PLoS One 6(8), e23295 17. Surovtseva, Y. V., Shutt, T. E., Cotney, J., Cimen, H., Chen, S. Y., Koc, E. C.,
and Shadel, G. S. (2011) Proc Natl Acad Sci U S A 108(44), 17921-17926 18. He, J., Cooper, H. M., Reyes, A., Di Re, M., Sembongi, H., Litwin, T. R., Gao, J.,
Neuman, K. C., Fearnley, I. M., Spinazzola, A., Walker, J. E., and Holt, I. J. (2012) Nucleic Acids Res
19. Haque, M. E., Elmore, K. B., Tripathy, A., Koc, H., Koc, E. C., and Spremulli, L. L. (2010) J Biol Chem 285(36), 28353-28362
20. Christian, B. E., and Spremulli, L. L. (2011) Biochim Biophys Acta http://dx.doi.org/10.1016/j.bbagrm.2011.11.009
21. Neumann, D., Buckers, J., Kastrup, L., Hell, S. W., and Jakobs, S. (2010) PMC Biophys 3(1), 4
22. Pflugradt, R., Schmidt, U., Landenberger, B., Sanger, T., and Lutz-Bonengel, S. (2011) Mitochondrion 11(2), 308-314
23. Fuller, K. M., and Arriaga, E. A. (2003) Curr Opin Biotechnol 14(1), 35-41
![Page 223: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/223.jpg)
208
24. Wakabayashi, T., Teranishi, M. A., Karbowski, M., Nishizawa, Y., Usukura, J., Kurono, C., and Soji, T. (2000) Pathol Int 50(1), 20-33
25. Cavelier, L., Johannisson, A., and Gyllensten, U. (2000) Exp Cell Res 259(1), 79-85
26. Aldridge, B. A., Lim, S. D., Baumann, A. K., Hosseini, S., Buck, W., Almekinder, T. L., Sun, C. Q., and Petros, J. A. (2003) Biotechniques 35(3), 606-607, 609-610, 612
27. Kraytsberg, Y., Bodyak, N., Myerow, S., Nicholas, A., Ebralidze, K., and Khrapko, K. (2009) Methods Mol Biol 554, 315-327
28. Reiner, J. E., Kishore, R. B., Levin, B. C., Albanetti, T., Boire, N., Knipe, A., Helmerson, K., and Deckman, K. H. (2010) PLoS One 5(12), e14359
![Page 224: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/224.jpg)
Appendix A
The Effect of GCN5L1 Knockdown in Hep3B and HIB1B Cells.
GCN5L1, (general control of amino acid synthesis 5)-like 1, was recently
identified as an essential molecular component of the mitochondrial acetyltransferase
complex in HepG2 cells, human liver hepatocellular carcinoma cell line (1). It was
demonstrated to reverse the effects of SIRT3 on mitochondrial protein acetylation (1).
To examine the possible effect of GCN5L1 on mitochondrial protein synthesis,
we performed siRNA-mediated knockdown of GCN5L1 in Hep3B cells. We employed
Hep3B cells, human hepatoma cell lines, because of the high acetylation state of proteins,
which was expected to display significant reduction in protein acetylation with GCN5L1
knockdown. Whole cell lysate (WCL) and mitochondrial lysate (ML) prepared from
Hep3B cell lines transfected with control siRNA (Con) and GCN5L1 siRNA (siG) were
analyzed with immunoblotting assays to examine protein acetylation with anti-acetyl Lys
antibody, GCN5L1 knockdown with anti-GCN5L1 antibody, two forms of MRPL12 with
anti-MRPL12 antibody, and steady-state levels of OXPHOS subunits with MitoProfile®
total OXPHOS antibody cocktail (Fig. A1.1). Protein acetylation levels did not present
much difference between control and GCN5L1 knockdown samples. This might be due
to the growth condition of the cells since cells grown in rich media and under starvation
conditions might demonstrate different levels of protein acetylation. One of the
observations in GCN5L1 knockdown cells was their slower growth rate compared to the
![Page 225: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/225.jpg)
210
control cells; however, this needs to be confirmed by employing cell proliferation assays
with WST-1. On the other hand, when these experiments were repeated with anti-acetyl
Lys antibody, the results were inconclusive due to the inconsistent performance of the
antibody. As a result of similar protein acetylation levels in Hep3B samples,
mitochondrial protein synthesis did not display difference in steady state levels of
OXPHOS subunits, especially mitochondrially-encoded Complex IV subunit (Fig. A1.1).
Anti-GCN5L1 antibody did not recognize the acetyltransferase subunit in whole cell
lysate but in mitochondrial lysate it demonstrated a reduction in GCN5L1. It is possible
that the amount of GCN5L1 in knockdown cells was enough to maintain the acetylation
state of the proteins. In addition, immunoblotting analysis of the mitochondrial lysate
from GCN5L1 knockdown cells revealed the decrease in the shorter form of MRPL12
(Fig. A1.1). This observation needs to be confirmed by immunoblotting analysis of
enriched ribosomal fractions prepared from the GCN5L1 knockdown cells with anti-
MRPL12, anti-MRPL10, and anti-acetyl Lys antibodies.
One of the limitations in these experiments was the amount of sample required for
analyses. Mitochondrial lysates or enriched ribosomal fractions need to be prepared by
using cells from two 6-well plates for each sample set (Con vs siG) since the sample yield
for downstream analysis would not be enough for more than a couple of immunoblotting
assays.
Pulse labeling of mitochondrial translation products in Hep3B with GCN5L1
knockdown did not reveal a conclusive result due to the inefficient labeling of translation
products with [35S]-methionine (Fig. A1.2). On the other hand, pulse labeling assay with
![Page 226: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/226.jpg)
211
HIB1B cells (CON) and HIB1B cells overexpressing SIRT3 (SIRT3) with GCN5L1
knockdown did not demonstrate a significant effect on the mitochondrial translation
when compared GCN5L1 knockdown sample to control sample (Con) (Fig. A1.2).
However, there was a significant difference between control HIB1B transfected with
control siRNA and SIRT3 overexpressing HIB1B transfected with GCN5L1 siRNA. This
is probably due to the concerted activity of overexpressed SIRT3 and GCN5L1
knockdown, reducing the synthesis of mitochondrially-encoded proteins (Fig. A1.2).
These experiments need to be repeated to confirm the effect of GCN5L1 on
mitochondrial protein synthesis.
Overall, the efficient knockdown of GCN5L1 in cell lines and its effect on
mitochondrial translation activity might provide a more complete picture of the
regulation of ribosomal activity in mammalian mitochondria. The modulation MRPL12
stalk composition on mitochondrial ribosomes in respond to changes in expression and
activity of GCN5L1 might confirm the importance of MRPL10 acetylation and its role in
mitochondrial protein synthesis.
![Page 227: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/227.jpg)
212
Figure A1.1: The effect of GCN5L1 knockdown on acetylation and OXPHOS
subunits in Hep3B cells.
Immunoblotting analyses of whole cell lysates (WCL) and mitochondrial lysates
(ML) prepared from control siRNA (Con) and GCN5L1 specific siRNA (siG) transfected
Hep3B cells was performed to examine the protein acetylation, steady-state levels of
nuclear encoded subunits of Complex V, III, and II and mitochondrial encoded subunit of
Complex IV, COII, and MRPL12. GCN5L1 was not detected in WCL, while it was
reduced in ML. The same immunoblot was used to probe with MRPS29, MRPL47, and
HSP60 to ensure equal loading.
![Page 228: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/228.jpg)
213
Figure A1.2: The effect of GCN5L1 knockdown on mitochondrial protein synthesis
in Hep3B cells.
De novo synthesis of mitochondrial proteins was evaluated in control siRNA
(Con) vs GCN5L1 siRNA (siG) transfected Hep3B and HIB1B control (CON) and
SIRT3 overexpressing (SIRT3) cells by pulse labeling of proteins in the presence of
[35S]-methionine and a cytosolic translation inhibitor, emetine. Coomassie Blue staining
of the same gel was performed to ensure equal protein loading in the gel. The combined
intensities of 13 mitochondrially-encoded proteins from each lane were used as an overall
quantitation of mitochondrial protein synthesis.
![Page 229: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/229.jpg)
214
References:
1. Scott, I., Webster, B. R., Li, J. H., and Sack, M. N. (2012) Biochem J 443(3), 655-661
![Page 230: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/230.jpg)
Appendix B
Strong-Cation Exchange (SCX) Chromatography Purification of Mitochondrial
MRPL10-MRPL12 Stalk Complex
The importance of Lys124, Lys162, and Lys196 in the interaction between
MRPL10 and MRPL12 was examined by employing site-directed mutagenesis by
generating LysAla in addition to LysArg and LysGln to mimic hypoacetylation
and hyperacetylation, respectively, as described in Materials and Methods of Chapter 2.
In our purification approach with nickel-nitrilotriacetic acid (Ni-NTA) affinity
chromatography followed by strong-cation exchange (SCX) chromatography (Fig. 2.24),
the impurities and improperly folded MRPL10-MRPL12 complexes were possibly the
factors affecting the activity of reconstituted ribosomes. We attempted to improve the
purification of MRPL10-MRPL12 complex to examine the effects of the acetylated
lysine residues on MRPL12 binding and ribosomal activity (Fig. A2.1). Ni-NTA affinity
column purification of MRPL10-MRPL12 was performed by including 5 mM of ATP
and 2 mM MgCl2 in the buffers used to prepare bacterial cell lysate. This reduced the
association of contaminating proteins, such as groEL, HSP70, and EF-P with MRPL10-
MRPL12 complex (1,2). In addition, the buffer component of the solutions used in Ni-
NTA affinity chromatography purification was replaced with Tris-HCl (pH 7.6) (see Ini
in Fig. A2.1). The Ni-NTA column purified samples were then applied to the SCX gravity
column and eluted by using the conditions given in Materials and Methods section in
![Page 231: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/231.jpg)
216
Chapter 2 (Step gradient salt of KCl; a linear gradient 50 mM –150 mM for 30 min, 400
mM – 500 mM for 10 min, and 500 mM – 1 M for 10 min). Fractions were monitored by
UV detection at 260 nm and then analyzed by SDS-polyacrylamide gel electrophoresis.
The fractions containing the MRPL10-MRPL12 complex (labeled with * in Fig. A2.1)
were collected, combined, and dialyzed for further analysis in activity assays (Fig. A2.2).
SDS-polyacrylamide gel analysis of dialyzed samples displayed highly purified
MRPL10-MRPL12 complex to be used in poly(U)-directed poly(Phe) synthesis assays to
examine the effect of acetylated Lys residues and their mutants in the activity of hybrid
ribosomes (Fig. A2.2). The experiments involving the activity assays with the purified
MRPL10-MRPL12 complex are currently under progress.
![Page 232: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/232.jpg)
217
Figure A2.1: Strong-cation exchange (SCX) chromatography purification of
mitochondrial MRPL10-MRPL12 stalk complex.
Ni-NTA chromatography-purified wild type and mutant MRPL10-MRPL12
complexes (Ini) were applied on SCX column to remove contaminants (FT: flow-
through, 1: first fraction) where fractions were monitored with a UV detector at 260 nm
to trace the proteins during application of step gradient of salt, KCl (dashed line). In the
elution profile, stalk complexes containing MRPL10 wild type (WT) were labeled with
blue solid line and lysine mutants, Ala (A), Gln (Q), Arg (R) were marked in black, red,
and green, respectively. Fractions were analyzed on 14 % SDS-polyacrylamide gels to
locate MRPL10-MRPL12 complexes. *: Fractions were combined and dialyzed to be
used in activity assays.
![Page 233: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/233.jpg)
218
References:
1. Thain, A., Gaston, K., Jenkins, O., and Clarke, A. R. (1996) Trends Genet 12(6), 209-210
2. Han, M. J., Cimen, H., Miller-Lee, J. L., Koc, H., and Koc, E. C. (2011) Protein Expr Purif 78(1), 48-54
Figure A2.2: Dialyzed mitochondrial MRPL10-MRPL12 stalk complex.
The fractions containing MRPL10-MRPL12 stalk complex from SCX column
were combined and dialyzed against a dialysis buffer containing 50 mM Tris-HCl, pH
7.6, 200 mM KCl, 1 mM DTT, and 10 % glycerol for a total of 4 h at 4oC to reduce the
KCl amount. These samples will be employed to determine the effect of acetylated Lys
residues and their mutants in the activity of hybrid ribosomes in poly(U)-directed
poly(Phe) synthesis assays.
![Page 234: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/234.jpg)
VITA: HUSEYIN CIMEN
EDUCATION PhD Pennsylvania State University, Biochemistry and Molecular Biology. August 2012
Advisor: Assist. Prof. Emine C. Koc, Co-advisor: Assist. Prof. Hasan Koc BS Middle East Technical University, Molecular Biology and Genetics, May 2006
Advisor: Prof. Dr. Feride Severcan PUBLICATIONS 2012 _Koc EC*, Cimen H*, Kumcuoglu B, Abu N, Akpinar G, Haque ME, Spremulli LL, Koc H.
Identification and Characterization of CHCHD1, AURKAIP1, and CRIF1 as New Members of the Mammalian Mitochondrial Ribosome. Nucleic Acids Res. (Manuscript Submitted). (*: contributed equally).
_ Zhu JH, Gusdon AM, Cimen H, Van Houten B, Koc E, Chu CT. Impaired Mitochondrial Biogenesis Contributes to Depletion of Functional Mitochondria in Chronic MPP+ Toxicity: Dual Roles for ERK1/2. Cell Death Dis. 2012 May 24;3:e312. doi: 10.1038/cddis.2012.46.
2011 _Haque ME, Koc H, Cimen H, Koc EC, Spremulli LL. Contacts between mammalian mitochondrial translational initiation factor 3 and ribosomal proteins in the small subunit. Biochim Biophys Acta. 1814(12), 1779-84
_Surovtseva YV, Shutt TE, Cotney J, Cimen H, Chen SY, Koc EC, Shadel GS. Mitochondrial ribosomal protein L12 selectively associates with human mitochondrial RNA polymerase to activate transcription. Proc Natl Acad Sci USA. 108(44),17921-6
_Han MJ, Cimen H, Miller-Lee JL, Koc H, Koc EC. Purification of human mitochondrial ribosomal L7/L12 stalk proteins and reconstitution of functional hybrid ribosomes in Escherichia coli. Protein Expr Purif. 78(1), 48-54.
2010 _Yang Y*, Cimen H*, Han MJ*, Shi T, Deng JH, Koc H, Palacios OM, Montier L, Bai Y, Tong Q, Koc EC. NAD+-dependent deacetylase SIRT3 regulates mitochondrial protein synthesis by deacetylation of the ribosomal protein MRPL10. J Biol Chem. 285(10), 7417-29. (*: contributed equally)
_Cimen H, Han MJ, Yang Y, Tong Q, Koc H, Koc EC. Regulation of succinate dehydrogenase activity by SIRT3 in mammalian mitochondria. Biochemistry. 49(2), 304-11.
2009 _Miller JL, Cimen H, Koc H, Koc EC. Phosphorylated proteins of the mammalian mitochondrial ribosome: implications in protein synthesis. J Proteome Res. 8(10), 4789-98.
ABSTRACTS AND PRESENTATIONS2012 _Cimen H, Koc H, Koc EC. A newly identified protein regulates translation in mammalian
mitochondria. Experimental Biology 2012 meeting, San Diego, CA 2011 _Cimen H, Han MJ, Tong Q, Koc H, Koc EC. SIRT3 regulates mitochondrial translation by
modulating MRPL12 binding to ribosome. Experimental Biology 2011 meeting, Washington, DC 2009 _Cimen H, Yang Y, Shi T, Han MJ, Deng JH, Koc H, Palacios OM, Montier L, Bai Y, Tong Q, Koc
EC. NAD+-dependent deacetylase SIRT3, regulates mitochondrial protein synthesis by deacetylation of the ribosomal protein, MRPL10. Mitochondrial Medicine 2009, Vienna, VA (Selected for an oral presentation and received Third-Place Runner Cash Award, presented by Dr. Emine C. Koc)
2008 _Cimen H, Yang Y, Shi T, Han MJ, Deng JH, Koc H, Palacios OM, Montier L, Bai Y, Tong Q, Koc EC. Regulation of mitochondrial protein synthesis by a mitochondrial NAD+-dependent deacetylase SIRT3. Translational Control Meeting, Cold Spring Harbor, NY
FELLOWSHIPS, SCHOLARSHIPS, AND AWARDSApril 2012 2012 ASBMB Annual Meeting Grad/ Postdoc Travel Award Summer 2011 Braucher Pela Fay Scholarship, Dept. of Biochemistry and Molecular Biology,
Pennsylvania State University April 2011 2011 ASBMB Annual Meeting Grad/ Postdoc Travel Award 2007-2008 Homer F. Braddock Fellowship, Dept. of Biochemistry and Molecular Biology,
Pennsylvania State University
![Page 235: REGULATION OF MITOCHONDRIAL TRANSLATION AND …](https://reader030.vdocuments.mx/reader030/viewer/2022012700/61a345075c4c300f6e39baf9/html5/thumbnails/235.jpg)