regulating a paused polymerase: the role of heat …
TRANSCRIPT
The Pennsylvania State University
The Graduate School
The Huck Institutes of the Life Sciences Graduate Program in Genetics
REGULATING A PAUSED POLYMERASE: THE ROLE OF HEAT SHOCK FACTOR, AND THE
CORRELATION BETWEEN POLYMERASE PAUSING AND SYNCHRONOUS PATTERNS OF
TRANSCRIPTIONAL INDUCTION
A Thesis in
Genetics
by
Laura M. Stefanik
©2012 Laura M. Stefanik
Submitted in Partial Fulfillment of the Requirements
for the Degree of
Master of Science
May 2012
ii
The thesis of Laura M. Stefanik was reviewed and approved* by the following:
David Gilmour Professor of Molecular and Cell Biology Thesis Adviser
Joseph Reese Professor of Biochemistry and Molecular Biology Robert Paulson Associate Professor of Veterinary and Biomedical Sciences Head of the Intercollege Graduate Program in Genetics
*Signatures are on file in the Graduate School
iii
ABSTACT
The regulation of gene expression can occur at multiple points along the pathway of
transcription and translation. One mechanism of regulating gene expression levels involves the
pausing of RNA Polymerase II (RNA Pol II) on genes by the protein complexes DSIF and NELF. RNA
Pol II is then poised to rapidly transcribe the genes in response to an appropriate stimulus. On the
heat shock protein (hsp) genes in Drosophila melanogaster, the transcriptional activator Heat Shock
Factor (HSF) senses cellular stress such as heat shock and reactivates a paused RNA Pol II to a state
of active transcription in a process that is collectively known as the heat shock response. In addition
to the heat shock response, the biological importance of Pol II pausing is evident from its correlation
with genes that are synchronously induced in an organized fashion during development.
This thesis discusses the purification of recombinant Drosophila melanogaster HSF to make
a polyclonal antibody against it for the purpose of using the antibody in various biochemical assays,
including electrophoretic mobility shifts and in vitro transcription reactions. The second part of the
thesis analyzes the contribution of the minimal promoter on transcriptional activation patterns and
the presence of a paused polymerase.
iv
TABLE OF CONTENTS
List of Figures…………………………………………………………………………………………………………………………………….v
List of Abbreviations…………………………………………………………………………………………………………………………vi
Acknowledgements……………………………………………………………………………………………………………………..….vii
Chapter 1. INTRODUCTION……………………………………………………………………………………………………………....1
Chapter 2. MATERIALS AND METHODS………………………………………………………………..............................5
Chapter 3. HSF PURIFICATION AND ANTIBODY PRODUCTION……………………………………………………..….16
Chapter 4. CHARACTERIZATION OF HEAT SHOCKED VS NON-HEAT SHOCKED NUCLEAR EXTRACTS…31
Chapter 5. PERMANGANATE GENOMIC FOOTPRINTING OF TWO TRANSGENIC CORE PROMOTERS..38
Appendix: List of LM-PCR Primers …………………………………………………………………………………………….…….55
Bibliography.........................................................................................................................................56
v
LIST OF FIGURES
Figure 3-1: 6xHis dHSF Purification of Soluble Protein ………………….....................................................17
Figure 3-2: 6xHis dHSF Purification of Insoluble Protein……………………………………………………………….…18
Figure 3-3: 6xHis dHSF Purification 2 of Insoluble Protein………………………………………………..……………..19
Figure 3-4: 6xHis dHSF Purification 3 of Insoluble Protein……………………………………………………………….20
Figure 3-5: HSF Gel Purification and Antigen Preparation for Shipment…………………………………………..21
Figure 3-6: Screening of Pre-Immune Serum from Rabbits 1, 2, and 3………………………………………….…22
Figure 3-7: Polytene Chromosome Immunofluorescence with Pre-Immune Serum From Rabbits 1, 2,
and 3…………………………………………………………………………………………….....................................................24
Figure 3-8: Western Blot of dHSF flow-through and Drosophila Nuclear Extract with anti-HSF Serum from Bleed 3………………………………………………………………………………………………………………………………..….26 Figure 3-9: Western Blot of Drosophila Nuclear Extract with anti-HSF Bleed 4 Serum…………….…….…27
Figure 4-1: In vitro Transcription of hsp70 Plasmid Template with non-Heat Shocked and Heat-
Shocked Drosophila Nuclear Extracts……………………………………………………………….................................33
Figure 4-2: HSF Gel Shift with Heat Shocked and Non-Heat Shocked Nuclear Extracts.......................35
Figure 5-1: Visual Representation of the Pnr_Tup_Yellow Transgene.................................................44
Figure 5-2: Permanganate Genomic Footprinting of the Pnr_Tup_Yellow Transgene and Endogenous
Tup gene in Toll10b mutants………………………………………………………………….……………………………….………46
Figure 5-3: Visual Representation of the Twist_Snail_Yellow Transgene…………………………………….……48
Figure 5-4: Permanganate Genomic Footprinting of the Twist_Snail_Yellow Transgene and
Endogenous Snail Transgene in Gd7 Mutants………………………………………………………………………………….50
vi
LIST OF ABBREVIATIONS
Abbreviation Description
DNA Deoxyribonucleic Acid
RNA Ribonucleic Acid
PCR Polymerase Chain Reaction
Pol II RNA Polymerase II
LM-PCR Ligation Mediated PCR
TSS Transcription Start Site
ChIP Chromatin Immunoprecipitation
qPCR Quantitative PCR
HSR Heat Shock Response
HSF Heat Shock Factor
FISH Fluorescent In Situ Hybridization
vii
ACKNOWLEDGEMENTS
The work in this thesis was made possible by the help and support I received from many
people. I would first like to thank my advisor, Dr. David Gilmour, for taking me on as a student and
training me in his lab. He was extremely helpful, understanding, and patient as I worked through
these projects. It would not have been possible for me to complete this body of work without his
guidance. I would also like to thank Dr. Mounia Lagha for giving me the opportunity to collaborate
with her and contribute to her exciting work.
All the members of Dr. Gilmour’s lab deserve a huge thank you for making this experience at
Penn State so enjoyable. Saikat, Bhavana, Jian, Yijun, Mike, Bede, Dan, Greg, and Doug not only
made the lab a fun place to work, but also helped me tremendously with all of my experiments.
Thank you all for your insight, patience, and support. In particular, I would like to thank Bhavana for
her patience in teaching me LM-PCR. It proved to be an important part of my work, and I cannot
thank her enough for helping me each step of the way with it.
I want to thank my family for supporting my curiosity in science, and for strongly
encouraging me to pursue graduate school in Genetics. Mom and Dad - thank you for everything.
Finally, I want to thank my brother, John, for teaching me what textbooks fail to mention - that an
extra twenty-first chromosome actually just codes for extra kindness, gentleness, and love. I love
you, Bug.
1
Chapter 1
Introduction.
RNA Polymerase II Promoter Proximal Pausing.
Cells rely on a consortium of proteins and non-coding RNAs to regulate the expression of
their genome. The conceptually simplified pathway of DNA being transcribed into RNA and RNA
being translated into amino acids is actually anything but simple; the cell must be capable at any
point in the pathway of deciding whether or not the gene product being expressed is necessary, and
in what quantity it should (or should not) be produced in. The proteins and non-coding RNAs that
regulate this expression have highly specific roles as transcription factors, translation factors,
chromatin remodelers, or splicing factors, to name a few. Together, these factors work to produce a
spatially and temporally controlled network that is capable of coordinately expressing a subset of
genes from the entire set in the genome.
An early step in the process of a gene being expressed is transcription. Transcription itself
can be regulated at any of its three fundamental steps of initiation, elongation, or termination. One
such regulatory mechanism occurs after RNA Polymerase II (Pol II) has successfully initiated
transcription, but before it has transitioned into productive elongation (Rougvie & Lis, 1988). This
mechanism keeps Pol II in a transcriptionally engaged, but paused, state on gene promoters and is
referred to as RNA Polymerase II promoter-proximal pausing (Core & Lis, 2008; D. S. Gilmour, 2009;
J. Li & Gilmour, 2011). Chromatin immunoprecipitation followed by microarray chip analysis (ChIP-
chip) showed that the majority of genes containing Pol II in Drosophila are enriched for Pol II and
necessary pausing factors at the promoter, making pausing a widespread regulatory mechanism
employed by the cell(Gilchrist et al., 2011).
2
Factors Involved in Pol II Pausing.
A tightly regulated network of proteins is responsible for first setting up a paused
polymerase on a given gene, reactivating Pol II to a state of productive elongation upon receiving an
appropriate signal, and, finally, restoring it to a paused state when the gene transcript is no longer
needed. Two proteins that are responsible for setting up a paused polymerase are Negative
Elongation Factor (NELF) and DRB-Sensitivity Inducing Factor (DSIF)(T Wada, Takagi, Yamaguchi,
Watanabe, & Handa, 1998; C.-huey Wu et al., 2003; Yuki Yamaguchi, Takagi, & Wada, 1999). A
second DNA binding factor important for setting up a paused polymerase on a subset of genes with
a paused polymerase is GAGA factor(Lee et al., 2008).
Heat Shock Factor and its Role in Reactivating a Paused Pol II.
The reactivation of a paused polymerase to a state of active elongation occurs in response
to the proper signal, such as the reactivation of the hsp70 gene in response to heat shock. The DNA
binding protein Heat Shock Factor (HSF) is the transcriptional activator shown to mediate the heat
shock response(Fernandes, Xiao, & Lis, 1995; Jedlicka, Mortin, & Wu, 1997). Drosophila
melanogaster contains one copy of the HSF gene. In unstressed cells, HSF is predominantly present
in a monomeric form and is unable to bind DNA. Upon heat shock, HSF trimerizes, enabling
cooperative binding of the three DNA binding domains of each of the three HSF peptides to the
inverted repeat Heat Shock Elements (HSEs) at heat shock gene promoters. Transactivation domains
of HSF are then exposed and modified, granting HSF its full transcriptional activation potential (Carl
Wu, 1995). Recent studies have shown that HSF’s DNA binding capability is regulated by acetylation;
specifically, the acetyl transferase CBP has been shown to facilitate the loss of HSF from the heat
shock promoter during the recovery from heat shock (Ghosh, Missra, & Gilmour, 2011;
Westerheide, Anckar, & Jr, 2009). The post-translational modifications regulating HSF’s function are
thus critical to understanding the mechanism of the heat shock response in full.
3
The mechanism of HSF reactivating a paused Pol II to a state of active transcription in
response to heat shock or other stresses has not been entirely uncovered. Three HSF peptides
activate transcription by first trimerizing and binding DNA at heat shock loci. Presumably other
factors are recruited by HSF to mediate the reactivation to transcription of Pol II. The kinase Positive
Transcription Elongation Factor b (P-TEFb) has been shown to phosphorylate the C-terminal domain
of Pol II and alleviate repression by DSIF on Pol II, suggesting a hint at HSF’s mechanism of
reactivating transcription (T Wada et al., 1998). P-TEFb has also been shown to be recruited upon
heat shock to heat shock loci, and to follow the same spatial and temporal patterns as Pol II while it
transcribes across the gene (Boehm, Saunders, & Werner, 2003; J T Lis, Mason, Peng, Price, &
Werner, 2000; Zobeck, Buckley, & Zipfel, 2010). However, the link of HSF either recruiting or being
involved in the recruitment of P-TEFb has not been uncovered, as no interaction between HSF and
P-TEFb has been reported. Recent evidence shows that inhibition of P-TEFb prior to heat shock does
not affect the ability of Pol II on the hsp70 loci to transcribe about 100 nucleotides downstream, but
it does affect its ability to transcribe through the rest of the gene (Ni et al., 2008). This suggests that
Pol II can be reactivated from a paused complex to an elongating complex in the absence of P-TEFb,
but that P-TEFb is required for productive elongation through the whole gene. Thus, more work is
needed to understand in full the mechanism of HSF’s ability to activate transcription of a paused Pol
II in response to heat shock.
In this thesis, I describe a project in which I purified a recombinant version of Drosophila HSF
from Escherichia coli and raised antibody against it. I discuss the process of purifying recombinant
HSF, preparing the antigen for antibody production, and assessing the pre-immune serum of the
rabbit chosen for the project. I present western blots assessing the strength of the immunized rabbit
serum and verify its specificity for HSF. I also show that the antibody is capable of binding HSF both
in its native and denatured states, which is important for subsequent uses of the antibody for
4
experiments such as immunodepletion of HSF from cellular extracts or chromatin
immunoprecipitation (ChIP). The use of this antibody can be extended to experiments focused on
understanding HSF’s mechanism of transcriptional activation in response to heat shock.
Biological Significance of Pausing.
Pol II pausing is a regulatory mechanism that prepares a gene for activation upon receipt of
an appropriate stimulus, such as heat shock. In addition, Pol II pausing has been shown to be critical
for development. Its importance is evident by the fact that decreasing the activity of the NELF
complex by knockout of either of two NELF subunits (A or E) in Drosophila results in embryonic
lethality (Wang, Hang, Prazak, & Gergen, 2010). Many developmental control genes have been
shown to contain a paused Pol II(Zeitlinger et al., 2007). In addition, promoter proximal pausing has
been correlated with the synchronous transcriptional activation patterns of various developmental
genes in Drosophila embryos(Boettiger & Levine, 2009). Boettiger and Levine’s recent results
provided striking images of the spatial and temporal control of transcriptional activation of key
developmental genes, and the correlation of these genes with having a paused Pol II suggested that
the paused polymerase was responsible for such a pattern of activation. However, the correlation
could not be extended much further, as the necessity of Pol II pausing for maintaining a synchronous
activation pattern was not studied in more detail.
Dr. Mounia Lagha, a post-doctoral researcher in Dr. Michael Levine’s lab at the University of
California Berkeley, set out to further investigate the role of Pol II pausing in determining the
transcriptional activation pattern of developmental genes. She designed experiments to probe the
role of the core promoter in determining the transcriptional activation pattern, and the presence of
a promoter-proximally paused polymerase of candidate genes in vivo. The work presented in
Chapter 5 of this thesis shows her work (as of yet unpublished) to help explain and present the
background on my permanganate footprinting data on two of her transgenic constructs.
5
Chapter 2
Materials and Methods.
Purifying recombinant HSF Antigen for Antibody Production.
A plasmid coding for Drosophila melanogaster HSF (dHSF) with an N-terminal 6-Histidine
(6xHis) tag was obtained from Dr. John Lis (Cornell University, Ithaca, NY). The dHSF plasmid was
expressed in Rosetta BL21(DE3)pLysS cells, which contain a plasmid coding for tRNAs for multiple
codons that are infrequently used in Escherichia coli (specific for the amino acids arginine,
isoleucine, leucine, and proline). 6xHis dHSF was purified with a Clontech TALON® metal affinity
resin charged with cobalt. The purification scheme followed was specific to Clontech TALON® Metal
Affinity Resins User Manual section titled Batch/Gravity-Flow Column Purification and is described
below.
Transforming bacteria with HSF plasmid.
100 µl of Rosetta(DE3)pLysS Escherichia coli cells were incubated with 10 ng of dHSF plasmid
on ice for thirty minutes. Cells were heat shocked for 90 seconds at 42°C in a thermal cycler and
immediately placed on ice. All cells were transferred to a 1.7 mL tube and allowed to recover in 1 mL
of LB plus 6% glucose at 37°C for one hour. The cells were pelleted and resuspended in 100 µl LB.
Transformants were grown under 100 µg/mL ampicilin and 34 µg/mL chloramphenicol selection on
sterile LB/agar bacteria plates. Colonies of transformed cells were picked off the plates to use for
5mL starter cultures as described in the next section.
Growth of HSF-transformed bacterial culture.
Rosetta(DE3)pLysS cells transformed with dHSF plasmid were grown overnight in 5 milliliters
of LB broth containing 100 µg/mL ampicilin (Amp+) and 34 µg/mL chloramphenicol (Cm+) at 37°C
with shaking. One milliliter of the 5 mL starter culture was used to inoculate a one liter culture,
6
which was grown at 37°C until reaching an OD600nm between 0.1 and 0.2, as measured with a
spectrophotometer. The temperature of the incubator was then dropped to 18°C and cells
continued to grow with shaking for approximately 1.5 hours until reaching an OD600nm of between 0
.4 and 0.7. One mL of culture was removed to use for SDS-PAGE analysis of uninduced cells. IPTG at
a final concentration of 0.2mM was added to the culture to induce expression of the plasmid, and
the culture continued to grow at 18°C for approximately twelve hours. One milliliter of induced
culture was reserved for SDS-PAGE analysis of induced cells.
Separation of soluble and insoluble protein fractions.
The cells were centrifuged at 7000 x g for 15 minutes at 4°C. Cells were kept on ice
throughout the procedure. The pellets were resuspended in 40mL Lysis Buffer (20 mM Tris Cl (pH
8.0), 500 mM NaCl, 10% glycerol , 0.1% NP-40) supplemented with 5mM β-mercaptoethanol and 45
µl protease inhibitor cocktail (1.6 mg/ml Benzamidine HCl, 1 mg/ml Aprotinin, 1 mg/ml Pepstatin A,
1 mg/ml Leupeptin dissolved in 100 % Ethanol) and incubated on ice for fifteen minutes. Cells were
divided into four 50 mL falcon tubes and sonicated (6 x 10 pulses, 50% duty control, output =
3.0/4.0). The sonicated cell lysate was centrifuged at 20000g for 45 minutes at 4°C to pellet out the
insoluble material (protein purified from the insoluble pellet is described in “Purifying HSF from the
soluble fraction” below).
Preparation of Talon resin and Binding of His-tagged protein to the Talon resin.
Three mL of Talon resin suspension was used to make a 1.5 mL final bed volume. The resin
was washed and equilibrated two times with 15 mL of binding buffer (20 mM Tris Cl (pH 8.0), 500
mM NaCl, 10% glycerol , 0.1% NP-40). 8M urea was included in the binding buffer when the resin
was used to purify protein from the insoluble fraction. No imidazole was included in the
lysis/binding buffer in order to allow maximum binding of HSF to the resin and reduce the amount
of HSF that was found in the unbound fractions during prior purification attempts.
7
The supernatant was added to 1 mL of pre-washed Talon metal affinity resin in a 50 mL
falcon tube and incubated overnight at 4°C with end over top rotation or incubated at room
temperature with shaking for one hour to allow the poly-histidine-tagged HSF to bind the resin. The
resin and bound protein were centrifuged at 700g for 5 minutes. The supernatant was saved as
Unbound Fraction 1 for SDS-PAGE analysis. The resin and bound proteins were washed with 30 mL
of lysis/binding buffer (no imidazole) and shook on a platform for ten minutes at room temperature.
The resin was centrifuged again at 700g for 5 minutes and the supernatant was removed and saved
for SDS-PAGE analysis as Unbound Fraction 2. This wash was repeated and the next supernatant was
saved as Unbound Fraction 3. The resin and bound proteins were then briefly vortexed in 1.5 mL
(one bed volume) of lysis/binding buffer.
Elution of bound protein.
The resin was packed into a 2 mL gravity flow column at 4°C and washed with 500 µl of
lysis/binding buffer containing 10 mM imidazole (pH 8.0). The flow through from each wash was
saved as Wash 1, 2, or 3. Bound proteins were then eluted in 500 µl fractions. The first three
fractions were eluted with lysis/binding buffer plus 250 mM imidazole (pH 8.0), and subsequent
fractions were eluted with 400 mM imidazole (pH8.0). For each elution, 500 µl of buffer was added
to the column with the end cap in place and incubated for 3 minutes. The end cap was then
removed for 15 minutes while the eluate dripped through the column. The end cap was put back on
for the next elution, and all subsequent elutions were repeated in this way. A 20µl aliquot of each
fraction was reserved for SDS-PAGE analysis and Bradford assay. All remaining protein was flash-
frozen in liquid nitrogen and stored at -80°C.
Purifying HSF from the insoluble fraction.
A small-scale test purification of the soluble and insoluble fractions showed that HSF was
distributed approximately equally in the soluble and insoluble fractions. HSF was therefore purified
8
from the insoluble fraction as well as the soluble fraction to obtain the necessary amount of antigen
for antibody production.
Resuspension of insoluble proteins in urea.
The insoluble fraction that pelleted out of the above purification after sonciation and
centrifugation was resuspended in 30 mL lysis/binding buffer plus 8M urea. The pellet was
homogenized and then passed through a two-pass needle to fully break down the pellet. The slurry
was centrifuged for 15 minutes at 3000g at room temperature to remove debris.
Binding of denatured proteins to Talon resin and removal of urea from binding
buffer.
The supernatant was retained and added to a 1mL bed volume of pre-washed and
equilibrated (*note: this equilibration was with lysis/binding buffer + 8M urea) resin. The
resin/supernatant mixture incubated for one hour at room temperature on a platform shaker. The
resin and bound proteins were centrifuged at 700g for 5 minutes and the supernatant was removed
and retained as Unbound Fraction 1. The resin was incubated on a platform shaker in 5 mL of
lysis/binding buffer containing 8M urea for 15 minutes. The sample was then centrifuged at 700g for
5 minutes and the supernatant was retained as Unbound Fraction 2. This wash was repeated four
more times with decreasing concentrations of urea in the lysis/binding buffer (6M, 4M, 2M, and
none) and all supernatants were retained as Flow Throughs 3, 4, 5, and 6. The resin and bound
proteins were resuspended in 1.5 mL lysis/binding buffer and was packed into a 2 mL gravity flow
column. Washes and elutions were done the same as described in the Purifying HSF from the soluble
fraction section above.
9
HSF Antigen Preparation for Shipment
TCA Precipitation of Eluted Protein.
One volume of 100% (w/v) Trichloroacetic acid (TCA) was added to 4 volumes of protein
sample and incubated for ten minutes on ice. The protein/TCA mixture was centrifuged at 14,000
rpm for 5 minutes at 4°C. The supernatant was discarded and the pellet was washed with 200µl of
ice-cold acetone. The sample was again centrifuged at 14,000 rpms for 5 minutes at 4°C. The
acetone wash was repeated. The protein pellet was dried in a 95°C heating block for 5 minutes to
evaporate off the residual acetone. The protein was resuspended in 200 µl of sample loading buffer
(125 mM Tris Cl (pH 6.8), 2.5% SDS, .125% bromophenol blue, 12.5% glycerol) plus 250 mM DTT (50
µl of 1M DTT and 150 µl sample loading buffer).
SDS-PAGE Purification.
The 200 µl sample was boiled for 5 minutes in a water bath and ran on an 8% SDS-PAGE gel
(without a comb to allow for the entire sample to be run on one gel). The gel was rapidly rinsed in
ddH2O and stained in 100mL of 0.3M CuCl2 for 5 minutes at room temperature on a shaking
platform. The gel was rinsed for three minutes with ddH2O. The band corresponding to the HSF-
sized product was cut out with a razor blade and stored in a 15 mL falcon tube. The band was
lyophilized overnight in a Savant refrigerated vapor trap (ThermoScientific). The lyophilized band
was ground up with a mortar and pestle and resuspended in 500 µl of PBS, and the antigen slurry
was shipped at room temperature to Pocono Farms for injection into the rabbit.
Nuclear Extract Preparation.
Drosophila melanogaster nuclear extracts were prepared according to the methods
previously described from wild-type embryos(Biggin & Tjian, 1988). Two types of extracts were
prepared: one extract was prepared from non-heat shocked embryos, and the other was prepared
from heat-shocked embryos. The non-heat-shock preparation was made from 60 grams of embryos
10
collected every twelve hours over a period of three days. Trays of embryos were stored in a plastic
container at 4°C until all embryos were collected. The final extract was dialyzed in HEMG buffer to a
final concentration of .17 HEMG. The preparation was aliquoted into 500 and 100 μl fractions, flash
frozen in liquid nitrogen, and stored at -80°C. The protein concentration of the non-heat shocked
extract was 12 mg/mL.
In addition to the non-heat shocked extract, two preparations of nuclear extracts from heat-
shocked embryos were made. Both preparations started with 25 g of embryos. Heat-shocked
extracts were prepared from fewer embryos than the non-heat-shocked preparation so that
embryos did not have to be stored at 4°C for any time, which may have interfered with the heat
shock. It has been shown that HSF undergoes extensive modification upon heat shock. In an attempt
to keep HSF in its heat-shock-activated form, phosphatase inhibitors β-glycerophosphate (25 mM)
and sodium pyrophosphate (2 mM) were added to Buffers I, AB, and C. The heat shock was done
after embryos were dechorionated. Embryos were heat shocked uncovered in a 250 mL flask at 37°C
in 150 mL of pre-warmed dissection buffer (130 mM NaCl, 5 mM KCl, 1.5 mM CaCl2) with shaking in
a 37°C incubator for twenty minutes. The first preparation of heat shocked-nuclear extract was
dialyzed to a final HEMG concentration of .17M HEMG and contained 10 mg/mL of protein. This
preparation will be called “heat shock extract 1” for the rest of this thesis. The second concentration
dialyzed to .12M HEMG and contained 5 mg/mL of protein (called “heat shock extract 2” for the rest
of this thesis).
Western Blots.
Protein samples were run on an 8% or 10% SDS-PAGE gel and transferred to a 0.2 µm
nitrocellulose membrane with a BioRad semi-dry transfer cell running at 10V for 1.5 hours. Protein
transfer was verified with Ponceau staining. Blots were blocked for one hour in 5% milk/TBST (50
mM Tris, 150 mM NaCl, 0.05% Tween 20) for one hour with shaking at room temperature. The blots
11
were probed overnight at 4°C with HSF antibody from Jon Lis’ lab at a 1 to 5,000 dilution in 2%
milk/TBST or various test dilutions of the pre or post-immune serum (dilutions indicated on the
appropriate figures). Three washes in 2% milk/TBST for ten minutes were done in separate
containers to rinse off unbound primary antibody. The blots were probed with either an HRP-
conjugated anti-rabbit secondary antibody (1 to 10,000 dilution in 2% milk/TBST) or a Cy5-
conjugated rabbit secondary antibody (1 to 3,000 dilution in 2% milk/TBST) for 90 minutes. Blots
probed with the HRP conjugated secondary antibody were treated with peroxidase substrate for five
minutes and exposed to X-ray film. Blots probed with the Cy5 conjugated secondary antibody were
scanned on a Typhoon (GE Healthcare).
Polytene Chromosome Squashes.
The following protocol was described in (Champlin, Frasch, Saumweber, & Lis, 1991).
Three pairs of salivary glands from wild type larvae were isolated in dissection buffer (130
mM NaCl, 6 mM KCl, 1.5 mM CaCl2). The dissection buffer was then removed from the glands and 50
µl of Solution A (15 mM Tris-Cl (pH 7.4), 60 mM KCl, 15 mM NaCl, 1.5 mM spermine, 1.5 mM
spermidine, 1% Triton-X-100) was added for 5 -10 seconds. Solution A was removed, and 50 µl of
Solution B (1% Triton X-100, 3.7% formaldehyde (EM grade)) was used to fix the glands for thirty
seconds. Solution B was removed and 50 µl of Solution G (50% glacial acetic acid) was added for
three minutes. Glands were transferred into 10 µl of Solution G on a siliconized cover slip. A glass
slide was placed over the coverslip, and the coverslip was tapped with the end of a needle probe to
spread the chromosomes. Chromosomes were viewed under a light microscope to ensure good
spreading. Slides were flash frozen in liquid nitrogen, the coverslip was removed, and slides were
stored overnight in a coplin jar covered in 95% ethanol.
Slides were rehydrated in TBS (50 mM Tris, 150 mM NaCl) twice for 5 minutes each. The
chromosomes were blocked with 20 µl of 10% Fetal Bovine Serum (FBS) diluted in TBS with a
12
coverslip in place. Coverslips were gently removed by shaking in a petri dish of TBS and slides were
washed for five minutes in TBS. The primary antibody was diluted in 10% FBS. Pre-immune serum
was diluted 1 to 100. A primary antibody against the C terminal domain of RNA Polymerase II, 8WG-
16, (used as a positive control), was diluted 1:50. The slides were incubated with the primary
antibody with a coverslip in place overnight at 4°C. The slides were washed twice for five minutes
each in TBS. The secondary antibody (anti-rabbit Alexa 488 or anti-mouse Alexa 588) was diluted
1:100 in 10% FBS. Slides were incubated with the secondary antibody with a coverslip in place in a
humid chamber in the dark for one hour. Coverslips were removed in PBS. Slides were washed in
PBS containing a 1 to 100,000 dilution of Hoechst stain for 20 minutes. Slides were then washed in
just PBS for 20 minutes. Coverslips were mounted onto the slides with 20 µl of glycerol plus 2.5%
propyl gallate. Slides were visualized on a fluorescent microscope and stored at 4°C in a dark
chamber.
In vitro transcription reactions with nuclear extracts.
Twenty µg of heat shocked or non-heat shocked nuclear extract was diluted in HEMG (25
mM HEPES (pH 7.6), 12.5 mM MgCl2, 0.1mM EDTA (pH 7.9), 10% glycerol) to a final volume of 20 µl
on ice. 14 µl of Premix 1 was added to the reaction and the pre-initiation complex was allowed to
assemble at room temperature for 20 minutes (final concentrations of Premix1: 20 mM HEPES (pH
7.5), 2.5 ng/ µl Hsp70 template, 50 µg/µl HaeIII-cut E.coli genomic DNA, 1 mM DTT, 0.8 units/ µl
RNase Inhibitor). ATP and UTP were added to a final concentration of 100 µM. 2 µl of alpha 32P-CTP
(10µCi/µl, 6000 Ci/mmole) was present during the pulse phase. The reaction was incubated at room
temperature for ten minutes. CTP and GTP were each added to a final concentration of 100 µM.
After a five minute incubation, 200 µl of stop solution was added to the reaction (20mM EDTA (pH
8.0), 200 mM NaCl, 1% SDS, 0.25 µg/µl Torula yeast RNA, 0.1 µg/ µl Protease K). The reaction was
incubated in stop solution for five minutes. A phenol chloroform isoamyl alcohol extraction was
13
performed to remove proteins from the reaction and the organic phase was discarded. 100 of high
salt buffer (30 mM Tris-Cl (pH 8.0), 500 mM NaCl (pH7.5)) was added. 8ul of biotinylated hsp70
primer was added to the reaction, and hybridization of the primer to the transcript products was
allowed to occur overnight at room temperature.
The next day, 120 µl of magnetic beads were added to the reaction for 15 minutes. A
magnetic rack was used to isolate the magnetic beads/biotinylated-primer/transcript complex. The
beads were washed twice with 300 µl wash buffer (10 mM Tris-Cl (pH7.5), 5 mM EDTA (pH 8.0), 50
mM NaCl, 0.5mg/mL yeast tRNA). The beads were resuspended in 15 µl of sample loading buffer
and heated at 95°C for 5 minutes. Samples were analyzed on a 10% polyacrylamide sequencing gel.
HSF Gel shifts.
Ten µl of binding buffer (100 mM NaCl, 15 mM Tris-Cl (pH 7.0), 0.1 mM EGTA, 0.5 mM DTT,
5% glycerol, 0.1% NP40) was added to 2 µl of labeling mix (5 µg tRNA, 1 µg Hae III-digested E. coli
genomic DNA, and 5 fmoles labeled template). Ten µg of nuclear extract were diluted in 15 µl 0.15
M HEMG (0.15M KCl, 25 mM HEPES (pH 7.6), 12.5 mM MgCl2, 0.1mM EDTA (pH 7.9), 10% glycerol).
The binding reaction was assembled by mixing the binding buffer/labeling mix and nuclear extract
together. Reactions sat at room temperature for 10 minutes and were then placed on ice. For
reactions in which antibody was tested, the serum was added after binding had occurred. Pre-
immune serum or post-immune serum was diluted in PBS, and indicated volumes (specific for each
reaction, indicated on gel figures) were added to the binding reaction for ten minutes at room
temperature. Reactions were placed on ice after binding. Samples were loaded onto a 1% TAE
agarose gel and ran at 4°C. The gel was dried onto an X-ray film with a hairdryer, exposed overnight
to a phosphorimager, and scanned on the Typhoon (GE healthcare).
14
Potassium Permanganate Treatment of Embryos.
Dr. Mounia Lagha at the University of California Berkeley collected and permanganate-
treated 2-4 hour old embryos with 40 mM KMnO4 for for sixty seconds. She extracted DNA and sent
the prepared DNA to our lab for subsequent piperdine cleavage and LM-PCR analysis. She also
Proteinase-K treated genomic DNA from embryos and sent it to our lab for permanganate treatment
(for Naked 30” control) or formic acid treatment (for GA ladder), piperdine cleavage, and LM-PCR
analysis.
Potassium Permangante Treatment of Genomic DNA to prepare Naked 30” DNA.
Twenty mM KMnO4 was prepared in dissection buffer (130 mM NaCL, 5 mM KCL, 1.5 mM
CaCl2). The solution was rocked at room temperature for ten minutes and chilled on ice for thirty
minutes. 1 µg of genomic DNA was dissolved in 100 µl dissection buffer and was treated with 100 µl
ice-cold 20 mM KMnO4 for thirty seconds on ice. The reaction was stopped with 200 µl stop solution
(20 mM Tris (pH 7.5), 20 mM NaCL, 40 mM EDTA, 1% SDS, 0.4M β-mercaptoethanol). The treated
DNA was precipitated with 40 µl 3M sodium acetate (pH 5.2) and 1 mL of chilled 100% ethanol.
Samples were incubated on ice for a minimum of thirty minutes and centrifuged at 16,000 x g for 30
minutes at 4°C. Pellets were washed with chilled 75% ethanol. The pelleted DNA was dissolved in 20
µl TE (10 mM Tris (pH 8.0), 1 mM EDTA) for piperdine cleavage.
Formic Acid Treatment of Genomic DNA to prepare GA ladder.
One µg of genomic DNA was dissolved in 10 µl TE and brought to a final volume of 20 µl with
ddH20. Genomic DNA was treated with 50 µl of 99% formic acid and incubated for 5 minutes at 15°C
in a thermal cycler. 200 µl of stop solution (0.3M sodium acetate (pH 7.0), 50 µg/mL yeast tRNA) was
added to the reaction, and 750 µl chilled ethanol was added to precipitate the DNA. The samples
were centrifuged at 16,000 X g for 30 minutes at 4°C. The pelleted DNA was resuspended in 90 µl
ddH20 for piperdine cleavage.
15
Piperdine Cleavage.
Seventy-five µl of ddH20 and 10 µl of piperdine was added to approximately 500 ng of DNA
diluted in 15 µl TE. The cleavage reaction was incubated at 90°C for thirty minutes in a thermal
cycler. 300 µl ddH20 was added to stop the reaction, and the solution was transferred to a fresh 1.7
mL centrifuge tube. The cleaved DNA was extracted twice with 800 µl isobutanol, once with 400 µl
isobutanol, and once with 400 µl ether. Samples were incubated at 65°C for twenty minutes to
evaporate residual ether. The total volume was adjusted to 100 µl with ddH20, and samples were
ethanol precipitated with 10 µl 3M sodium acetate (pH 7.0) and 250 µl ice-cold ethanol. Pelleted
DNA was dissolved in 10 µl of 0.5X TE and transferred to a fresh 0.65 mL tube. Cleaved DNA was
quantified with a NanoDrop and 100 ng of DNA was used for subsequent LM-PCR reactions.
LM-PCR.
LM-PCR reactions were performed as preciously described (D. S. Gilmour & Fan, 2009). All
reactions started with 100ng of piperdine-cleaved DNA.
16
CHAPTER 3
HSF Purification and Antibody Production.
Introduction. Heat Shock Factor (HSF) is the transcriptional activator of the heat shock response, an
important mechanism used by the cell that renders it capable of sustaining high temperatures and
other stresses. The mechanism of HSF’s ability to activate a paused Pol II on the heat shock protein
(hsp) genes is not entirely understood. This chapter discusses the purification of a polyclonal
antibody raised in rabbit against Drosophila melanogaster HSF. I present the process of expressing
and purifying HSF, preparing the antigen for shipment, deciding on a rabbit to use for injection, and
assessing bleeds 3 and 4 after the rabbit was immunized. The use of this antibody can be applied to
various biochemical studies in an attempt to understand the mechanism of HSF’s ability to
reactivate a paused Pol II in response to a cellular stress.
Purification of his-tagged recombinant HSF.
A plasmid coding for Drosophila melanogaster (dHSF) was expressed as described in Chapter
2. A test expression was carried out to analyze whether the expressed dHSF protein was found
mainly in the soluble or insoluble fraction (Lanes 4 and 5, Figure 3-1). This test expression revealed
that dHSF was split between the soluble and insoluble fractions, with slightly more in the insoluble
fraction. The first purification was carried out using the soluble fraction to be consistent with the
protocol described for the Clontech TALON® Metal Affinity Resin (Figure 3-1). The proteins loaded
onto the TALON® cobalt column (Lane 6, Figure 3-1) were bound to the resin for 1 hour at room
temperature with end-over-top rotation. Most of the protein did not bind the cobalt column (Lane
7, Figure 3-1). This protein may have aggregated and thus prevented the his-tag from being exposed
to the column. A Bradford assay was used to estimate the concentration of HSF in elution fractions
17
2, 3, and 4. Assuming that HSF makes up about 30-50% of the protein in the elutions, approximately
0.6 – 1 mg of HSF protein was obtained from this purification.
As a considerable amount of HSF was also in the insoluble fraction of protein from this same
bacterial culture, I purified HSF from the insoluble pellet by resuspending the pellet in Lysis Buffer
18
plus 8M Urea and bound the protein to the TALON® cobalt column for one hour at room
temperature (Figure 3-2). Again, much of the HSF protein was released into the unbound fraction
(Figure 3-2, Lane 7). The total HSF amount of the proteins that eluted from the column was
estimated to be about 300 µg.
19
A third purification was done in order to obtain enough protein to send for antibody
production. HSF was again purified from the insoluble fraction (Figure 3-3). This protein failed to
bind the column, however, due to a loss of cobalt (as was evidenced from the pale pink color in
comparison to the normal dark pink color of the column). The Talon column was freshly regenerated
according to the protocol provided in the Talon user manual, and the unbound fraction from Figure
3-3 was passed over the regenerated column (Figure 3-4). Most of the protein was concentrated in
elution fraction 2. A Bradford assay was used to quantify a total of about 300 μg of HSF in elution
fractions 1-4.
20
21
HSF Antigen Preparation and Shipment.
HSF antigen was sent to Pocono Rabbit Farm and Laboratory in Canadensis, Pennsylvania for
antibody production in two separate shipments. Antigen was gel purified according to the methods
described in Chapter 2. Elution fractions 2, 3, 4, and 5 (Figure 3-2) were used for the first antigen
shipment. The copper stained gel of the TCA-precipitated elution fractions is shown in Figure 3-5a
(before the HSF gel slice was cut out). The total protein sent was estimated to be 300 μg. A second
preparation was sent (Figure 3-5b) using elution fractions 1-5 in Figure 3-4 and elution fractions 2, 3,
and 4 in Figure 3-1. The total HSF protein in this shipment was estimated to be 650 μg.
Pre-immune screens.
To decide which rabbit to use for HSF antigen injection, three rabbits were tested for their
background level of antibody production against Drosophila melanogaster proteins. Rabbit pre-
immune serum was used to probe either Drosophila nuclear extract western blots or Drosophila
polytene chromosome squashes to check for background levels of reactivity. 10 μg or 50 µg of non-
heat shocked nuclear extracts were loaded on a 10% SDS-PAGE gel, transferred to a 0.2 micron
nitrocellulose membrane, and probed with a 1:1000 dilution of the pre-immune serum from each
22
rabbit (Figure 3-6 A, B, C). The Lis lab HSF antibody was used as a positive control (1:5000 dilution) to
probe two separate lanes, also with 10 and 50 μg of non-heat shocked nuclear extract (Figure 3-6 D).
Rabbit 3 showed substantial background reactivity in the region around where HSF runs (about 100
kDa) (Figure 3-6 C). Both Rabbits 1 and 2 showed minimal background reactivity on the western blot
(Figure 3-6 A, B).
Pre-immune serum from each rabbit was also tested with immunofluorescence of
Drosophila polytene chromosome squashes to help further distinguish between Rabbits 1 and 2. A
1:100 dilution of pre-immune serum from each rabbit was used to probe polytene chromosomes
from three pairs of wild-type salivary glands. Alexa fluor-conjugated secondary antibodies were used
23
at a 1:100 dilution. 8WG-16, an antibody against the C-terminal domain of Drosophila Pol II (mouse
monoclonal), was used as a positive control for this experiment at a 1:50 dilution. Rabbit 1 showed
the least background reactivity against Drosophila proteins associated with the polytene
chromosomes compared to Rabbits 2 and 3 (Figure 3-7). From both of these results, I decided to use
Rabbit 1 for antibody production against the HSF antigen.
24
25
Bleeds. Pocono Farms injected between 100 and 200 μg of HSF antigen into the rabbit for the first
injection (day 0), and between 50 and 100 μg on days 14 and 28. All other injections contained
between 20 and 50 μg of HSF antigen. A 5 mL monthly volume of serum for five months (bleeds 1 –
5) was received once a month. After five months of monthly bleeds, production bleeds were started,
during which the rabbit was bled once a week, again in approximately 5 mL aliquots. We received
sixteen production bleeds total spanning sixteen weeks. The rabbit was exsanguinated and the final
bleed contained approximately 20 mL of serum.
Serum from Bleeds 3 and 4 were used to probe a western blot to assess the strength of the
antibody. Pre-immune and anti-HSF serum from Bleed 3 were both used at a 1:1000 dilution to
probe a western blot with the flow through from recombinant HSF purified over the Talon column
(Unbound Fraction 1, Figure 3-1) and dilutions of non-heat shocked nuclear extracts (Figure 3-8).
The antibody showed strong signal for the full length recombinant 6xHis dHSF around 100 kDa
(Figure 3-8, lane 5), but relatively weak signal for the nuclear extracts (Figure 3-8, lanes 7 and 8).
26
A 1:1000 dilution of both pre-immune serum and anti-HSF serum from bleed 4 were used to probe a
western blot of increasing amounts of Drosophila nuclear extracts to assess whether the signal
improved at all from bleed 3 to bleed 4 (Figure 3-9). The antibody showed high specificity as there
was only one band in the immune serum (Figure 3-9, lanes 6-9), and little background as there were
no bands in the pre-immune serum (Figure 3-9, lanes 1-4).
27
28
Discussion.
An important consideration in producing antibodies is to verify that the serum shows high
specificity for the correct antigen. A crucial step in reaching that goal was the gel purification of the
HSF antigen in Figure 3-5. As seen in all elution fractions from Figures 3-1, 3-2, and 3-4, the HSF
elutions contained many contaminating bands other than the expected HSF band. Some of these
proteins may have been truncation or degradation products of the recombinant HSF. In particular,
one band around 40 kDa in the western blot in Figure 3-7 is also in the dHSF flow-through lane
probed with anti-HSF serum (lane 5) but not in the dHSF flow-through lane probed with pre-immune
serum (lane 1). (Note: this western blot did not probe the elution fractions directly, but the bands in
the flow through can be taken to represent the bands in the elution fractions because it is highly
unlikely that there is any one protein that bound the column without some of it going into the flow
through.) Three other bands, in contrast, do show up in the flow through lane probed with pre-
immune serum, suggesting that these proteins are not degradation products of HSF. The bands
other than HSF seen with the anti-HSF serum may be HSF truncation or degradation products, or
they may also be E. coli proteins. The gel purification of HSF in Figure 3-5 was extremely helpful,
however, in getting minimal background reactivity to E. coli proteins and enhancing the specificity of
the serum for HSF.
Another important aspect of this chapter was the use of two assays to determine which
rabbit to use based on the pre-immune serum bleeds. The western blots in Figure 3-6 showed that
both rabbits 1 and 2 would have been acceptable choices (or at least equal choices) in terms of the
background reactivity of the pre-immune serum against Drosophila nuclear extract proteins.
However, the immunofluorescence of polytene chromosomes with the pre-immune serum from
each rabbit showed a striking difference between rabbits 1 and 2. Rabbit 1 pre-immune serum gave
minimal background reactivity on the polytene chromosome slides, but rabbit 2 pre-immune serum
29
showed significant background. The two slides had comparable levels of 8WG-16 staining though,
controlling for the efficiency of the reaction. This second assay therefore helped to make a final
decision in choosing rabbit 1 for HSF antigen injection and minimizing the amount of background
reactivity in the final anti-HSF serum.
The quality of the anti-HSF signal improved from bleed 3 to bleed 4 (compare HSF nuclear
extract signal in Figure 3-8 to figure 3-9). In particular, the specificity for HSF is improved in Bleed 4
(Figure 3-9). After bleed 4, the anti-HSF serum was no longer tested with these western blots, but
was used in gel shift reactions (discussed in Chapter 4), which further verified the specificity and
strength of the antibody.
An important use of the antibody in our lab will be to use it for immunodepletion of HSF
from nuclear extracts. HSF-depleted nuclear extracts would be useful in uncovering the mechanistic
underpinnings of HSF’s ability to reactive a paused polymerase to a state of active transcription.
Purified HSF from Drosophila S2 tissue culture cells could be added back to HSF-depleted nuclear
extracts in in-vitro transcription assays to see if the purified HSF-reaction is capable of producing full
length read-through transcripts in comparison to the “paused” products from reactions without
active HSF. Modifications or mutations to the active form of HSF could then be used to probe the
mechanism by determining which mutants maintain HSF’s ability to activate transcription and which
cause it to lose that ability.
For the anti-HSF serum to be capable of immunodepleting HSF from nuclear extracts,
however, it must have affinity for HSF in its native form. The anti-HSF’s affinity for HSF as seen in the
western blots in Figures 3-8 and 3-9 demonstrate its ability to recognize HSF in a denatured form. In
Chapter 4, I demonstrate that the anti-HSF serum is capable of binding HSF in its native form in a gel
shift reaction. Additionally, this shows that the anti-HSF serum has affinity for HSF when bound to
30
DNA. This result also confirmed that the anti-HSF serum is indeed recognizing HSF, which verifies its
use for subsequent experiments in our lab.
31
CHAPTER 4
Characterization of Heat Shocked versus Non Heat Shocked Nuclear Extracts.
Introduction.
This chapter discusses the preparation and characterization of nuclear extracts from 0-12
hour old Drosophila non-heat shocked and heat-shocked embryos. The purpose in creating heat
shocked extracts was to obtain an extract containing active HSF capable of activating a paused
polymerase in in vitro transcription reactions. The ability of HSF to activate the heat shock response
by binding to DNA was also analyzed with gel shift reactions of each extract. Although the heat
shocked extract contained an HSF with greater DNA binding activity than the non-heat shocked
extract, the heat shocked extract failed to reactivate paused Pol II and produce full length read-
through transcripts. These nuclear extracts can be further characterized, however, with the goal of
figuring out what mediates their different transcriptional activity.
Results.
Nuclear Extract Preparation: Non-Heat-Shocked and Heat-Shocked.
Both non heat-shocked and heat-shocked nuclear extracts were prepared from Drosophila
melanogaster wild-type embryos according to the method described in Chapter 2. One non-heat
shocked nuclear extract and two heat-shocked nuclear extracts were prepared.
In-vitro transcription assays. The transcription potential of these three nuclear extracts was tested using the in vitro
transcription method described in Chapter 2. The first in-vitro transcription reaction showed that
the non-heat-shocked extract produced paused transcripts (< 40 bases) as well as long read-through
transcripts (>150 bases) (Figure 4-1, lane 2). Heat-shock extract 1 produced paused transcripts, but
much less long read-through transcripts (Figure 4-1, lane 3). Heat shock extract 2 produced very
32
little transcripts of any size (Figure 4-1, lane 4), which is likely due to a loss of proteins needed for
efficient transcription when it dialyzed to an HEMG concentration of .12M HEMG. The non-heat
shock nuclear extract incubated with α-amanitin did not produce any transcription products as
expected (Figure 4-1, lane 5).
33
34
DNA binding activity of HSF in nuclear extracts.
It was predicted that a heat-shocked nuclear extract would contain transcriptional activity
capable of producing full read through products in excess of short transcripts produced from a
paused polymerase. The basis of this hypothesis was that the heat shocked nuclear extracts would
contain an active version of HSF capable of reactivating a paused polymerase on the hsp70
template. However, my heat-shocked nuclear extracts did not produce full-length read-through
transcripts, so I first probed the activity of HSF by checking for DNA binding activity. I performed a
gel shift of a 32P-TTP labeled probe containing six copies of the Heat Shock Element (HSE) as
described in Chapter 2 (Figure 4-3). Two separate gel shifts were done; either 20 µg or 10 µg of both
non-heat shocked and heat-shocked nuclear extract 1 were incubated with the 6xHSE probe for
twenty minutes at room temperature (Figure 4-2). In comparison to the probe-only lane, both the
non-heat shocked and heat shocked nuclear extracts caused a shift in the mobility of the 6xHSE
probe. (Figure 4-2, lanes 2 and 5 versus lane 1, A&B). In both panels, the majority of radioactivity is
shifted with the HSF/HSE complex in the heat shocked lanes, but not in the non-heat shocked lanes,
showing that HSF in the heat-shocked extract has greater DNA binding activity to the HSE than the
HSF in the non-heat shocked nuclear extract (Figure 4-2, lane 5 versus lane 2, A&B). However, the
reaction with 20 µg nuclear extract (panel A) shows greater binding of the non-heat shocked extract
compared to the reaction with 10 µg extract, showing that the reaction was likely at saturation
(Figure 4-2, lane 2, A&B).
To confirm that the mobility shift of the 6xHSE probe was due to HSF binding, anti-HSF
serum (described in Chapter 3) was added to the reaction after the complex had been allowed to
form. The anti-HSF serum caused a supershift of the initial HSE mobility shift, indicating that the
mobility shift in lanes 2 and 5 was indeed due to HSF binding (Figure 4-2, lanes 4 and 7, A&B). A
negative control of the pre-immune serum was used to show that anti-HSF serum was specific to the
35
HSF/HSE complex and that the supershift was not due to background binding of other proteins in
the serum to the complex (Figure 4-2, lanes 3 and 6, A&B).
Discussion.
The difference in the transcriptional activity of the non-heat shocked versus heat shocked
nuclear extracts depicted in Figure 4-1 is curious, as it suggests that the heat-shocked extract may
contain an activity capable of repressing transcription. (On the other hand, the heat shock may have
also inactivated a positive elongation factor). An experiment to test whether the heat shocked
nuclear extract contains such an activity would be to mix the non-heat shocked extract with the heat
shocked extract and see if the transcriptional ability of the non-heat shocked extract is repressed.
36
The similarity in the intensity of the paused products from both the non-heat shocked and heat
shocked extracts suggests that the level of initiation is the same in both reactions. However, a pulse-
only control can be done to verify that the amount of initiation in both extracts is the same, or
determine that the lack of read-through products in the non-heat shocked extract can be due to less
initiation.
A second consideration was that the preparation of heat-shocked extract used phosphatase
inhibitors, and the hyper phosphorylation status of various proteins may have affected the
transcriptional activity. To control for this, a non-heat shocked nuclear extract could be prepared
with the same phosphatase inhibitors to see if there is a difference in the transcriptional activity of
the non-heat shocked and heat-shocked nuclear extracts when both are prepared in the presence of
phosphatase inhibitors. Finally, the method of heat shocking the embryos may have caused the loss
of transcriptional ability. The heat shock is done by shaking the embryos for twenty minutes at 37°C
in an incubator, and the twenty minutes of shaking may have negatively affected the activity of
important elongation factors, such as P-TEFb. A method to check for this possibility would be to
prepare a mock heat shocked extract by performing the same manipulations to the embryos, but
keeping the dissection buffer at room temperature rather than 37°C.
The gel shift in Figure 4-2 was important for two reasons. First, it showed that the method
of preparing heat shocked nuclear extracts did produce an extract with an HSF capable of
responding to heat shock, as the protein was able to bind DNA (an important and required step in
the response to heat stress). Second, it provided evidence that the anti-HSF serum discussed in
Chapter 3 is capable of recognizing HSF in its native form.
Finally, the method of preparing a heat shocked extract has not been optimized, and it may
be important to consider other methods of heat shocking. For example, the heat shocked extracts
were prepared in the presence of phosphatase inhibitors in Buffers I, AB, and C. These buffers are
37
used to homogenize the embryos, resuspend nuclei, and dialyze the final extract in. Future attempts
at making heat shocked extracts may include phosphatase inhibitors in the dissection buffer used
during the heat shock as well, or otherwise may opt to not include them in buffers AB or C.
38
CHAPTER 5
Permanganate Genomic Footprinting of two Transgenic Constructs.
Introduction.
In a developing Drosophila embryo, gene expression is tightly regulated in both space and
time by a complex network of signaling molecules and other key factors. The transcriptional
activation pattern of specific genes can be visualized using fluorescent in situ hybridization (FISH),
which targets the introns of nascent transcripts with fluorescent probes. By using this technique,
several studies have looked in-depth at the unique activation patterns of key developmental genes
in the Drosophila embryo. These studies reveal a spectrum of transcriptional activation patterns that
can be grouped into two general categories: synchronous and stochastic. Genes that have a
synchronous transcriptional activation pattern appear to turn “on” in an organized fashion; a
majority of all nuclei that will eventually express the gene turn on at once. In contrast, a gene with a
stochastic activation pattern takes significantly longer to turn on in all nuclei that it will eventually
be expressed in. Thus, the initial activation pattern of a stochastic gene appears random or “patchy”
in FISH-confocal images (Boettiger & Levine, 2009).
It was shown that the synchronous activation pattern of certain genes correlates with the
presence of a paused polymerase (Boettiger & Levine, 2009). Specifically, two developmental genes,
pannier (pnr) and tail-up (tup) were included in this study. Pnr was shown to exhibit stochastic
expression and lack a paused Pol II, while tup was shown to exhibit synchronous expression and
contain a paused Pol II. Dr. Mounia Lagha, a post-doctoral researcher from Dr. Michael Levine’s lab,
wanted to investigate the mechanism underlying the correlation of a paused polymerase and
synchronous induction further. Her work focused on the role of the core promoter (100 to 200 bases
surrounding the TSS) in determining the transcriptional activation pattern of a gene.
39
By systematically replacing 200 bases of the core promoter of the pnr gene with 200 bases
of the tup gene and inserting the transgene (using targeted insertion) into the Drosophila genome,
Dr. Lagha was able to show that the transgenic pnr gene was transformed from a stochastic
transcriptional activation pattern to a synchronous pattern (discussed in more detail in Results). She
also showed that polymerase pausing was at least partially responsible for the synchronous
activation pattern. ChIP-Seq and ChIP-qPCR showed that the transgene was enriched for Pol II at its
promoter. To test whether the observed Pol II at the promoter was transcriptionally engaged, I
performed permanganate footprinting on her transgene. The permanganate footprinting was done
in a mutant fly line in which the transgene is silent (or does not produce full length transcripts), so
any polymerase observed at the promoter is thought to represent a paused polymerase. The
permanganate assay revealed that the polymerase on the transgene is indeed transcriptionally
engaged and resembles a hyper-reactivity pattern similar to that of the endogenous tup gene.
In addition, the second part of this chapter focuses on a second transgenic construct that Dr.
Lagha made. This transgene consisted of a 25 kb Bacterial Artificial Chromosome containing the
twist gene’s enhancer sequence and regulatory regions, with 100 bases of its core promoter
replaced by 100 bases of the snail promoter. Both the snail and twist genes were reported to be
activated in a synchronous manner. Dr. Lagha’s purpose in creating this line was to provide a second
example of a minimal promoter that was capable of transforming the transcriptional activation
pattern of a gene. However, there was no evidence of a “conversion” because both the twist gene
and snail gene were reported to be synchronously activated (data not shown). The snail gene was
reported to potentially have a paused polymerase, but the twist data was not as clear. However, her
transgenic construct showed evidence of a paused polymerase, and I performed permanganate
footprinting to analyze the status of the polymerase at the promoter of the transgene as detected
with Pol II ChIP-Seq.
40
Results.
Dr. Lagha’s work on the tail-up/pnr promoters.
The Levine lab used fluorescent in situ hybridization (FISH) to label nascent transcripts in the
developing Drosophila embryo. By creating fluorescent probes specifically designed to target the
introns of genes, they were able to visualize sites of active transcription due to the rapid
degradation of introns immediately after pre-mRNA splicing (data not shown). They then used high-
resolution confocal microscopy and semi-automated image segmentation algorithms (as described
in Boettiger, 2009) to label nuclei that show sites of activation at the onset of transcription. The
entire Drosophila embryo was visualized in this way to determine the transcriptional pattern of
various genes across a developing embryo.
Dr. Lagha’s analysis of the FISH confocal images of the two endogenous genes included in
Boettiger and Levine’s 2009 study, pnr and tup, showed two distinct patterns of transcriptional
activation. Embryos were analyzed during the one hour long nuclear cleavage cycle 14 (cc14).
Activation of a gene was defined as the time (in minutes) it took for 80% of the final pattern of the
gene’s expression to be reached. The expression pattern in mid and late cc14for pnr and tup
exemplified that pnr is activated in a stochastic manner, such that sites of transcription turn on in a
seemingly random pattern rather than all at once, while tup is activated in a synchronous manner –
transcription sites appear quickly and in an organized fashion across the embryo. The activation
pattern over time during cc14 can be graphed as the fraction of the core expression pattern “on”
versus time in cc14, which showed that pnr reaches 80% expression twenty minutes after tup (data
not shown).
Dr. Lagha next asked whether the activation pattern of tup could be affected by replacing
200 bases of its core promoter with 200 bases of the pnr promoter. To do this she created a tup
Bacterial Artificial Chromosome (BAC) with 200 bases of its core promoter replaced with 200 bases
41
of the pnr promoter. The transcription unit of the tup gene was replaced with the yellow gene
(called Tup_Pnr_Yellow). The transcriptional activation pattern of the Tup_Pnr_Yellow transgene
was delayed during cc14 compared to the Tup_Yellow transgene that contained the regular tup
promoter (data not shown).
This result showed that replacement of the pnr promoter could transform the rapid
activation pattern of tup into a more stochastic pattern as seen in the endogenous pnr gene. Dr.
Lagha next systematically probed whether the stochastic pattern of pnr could be transformed into a
more synchronous pattern by replacing the pnr promoter with the tup promoter. She created a
plasmid construct containing the pnr enhancer sequence with 200 bases of the pnr promoter
replaced by 200 bases of the tup promoter (the 200 bases of the tup promoter included a GAGA
factor binding site). These constructs were then linked to a yellow reporter gene containing a 2kb
intron (to allow for hybridization of the fluorescent probe). The replacement of the pnr promoter by
tup gradually changed the stochastic pattern of transcriptional activation to a more synchronous
pattern (data not shown). Thus, Dr. Lagha showed that the 200 bases around the TSS of pnr and tup
are not only critical in determining the transcriptional activation pattern of the endogenous gene,
but are also capable of transforming the induction pattern from synchronous to stochastic, or vice
versa, when swapped with one another.
In addition to the different transcriptional activation patterns, Dr. Lagha’s Pol II ChIP-Seq
data showed a substantial difference in the amount of polymerase detected at the promoter of the
endogenous tup and pnr genes. The Pol II ChIP-Seq was done in developmental mutants, in which
the genes have been shown to be transcriptionally silent, so any Pol II ChIP-Seq signal seen at the
promoter is not due to active transcription of the gene. The Gd7 embryo is mutant for dorsal and
hence develops into an embryo composed of a homogenous population of only dorsal ectoderm
cells. The Toll10b mutant develops into an embryo composed of a homogenous population of only
42
mesoderm cells (Boettiger & Levine, 2009).The tup gene in the Toll10b mutant was shown to have
more Pol II ChIP-Seq reads at the promoter than the pnr gene, suggesting that the synchronicity of
the tup gene may be due to a paused polymerase. Also, because the replacement of the pnr
promoter with the tup promoter changed the stochastic transcriptional pattern to a more
synchronous pattern, it was hypothesized that a paused polymerase introduced by the tup promoter
might be responsible for creating the synchronous pattern.
To study this hypothesis, four experiments were done to test for a paused polymerase on
the Pnr_Tup_Y transgene. First, it was shown that in embryos from a cross of flies carrying the
Pnr_Tup_Y transgene with females heterozygous mutant for Nelf-E and Spt5 (subunits of NELF and
DSIF, respectively) the synchronous pattern of transcriptional activation was disrupted (data not
shown). Additionally, mutant embryos from flies carrying the transgene crossed with females
heterozygous mutant for the GAGA factor-encoding trithorax-like gene also showed a disruption in
the synchronous transcriptional activation pattern (data not shown). As GAGA factor, NELF, and DSIF
are involved in setting up a paused polymerase, this data suggests that the paused Pol II does play a
role in establishing the synchronous activation pattern of the Pnr_Tup_Y transgene.
Pol II ChIP-qPCR data with primers specific for the tup/yellow junction and the yellow ORF
show a higher amount of Pol II at the promoter in comparison to the body of the transgene in
Toll10b mutants. Pol II ChIP-seq data in the Toll10b mutants carrying the Pnr_Tup_Y transgene
shows enrichment for Pol II at the promoter (data not shown). These results supported the
hypothesis that the tup promoter transformed the transcriptional activation pattern by introducing
a paused polymerase into the pnr gene. However, it cannot be certain whether the Pol II ChIP-Seq
signal detected at the promoter represents polymerase in a pre-initiation complex versus
atranscriptionally engaged polymerase. To clarify this, I performed permanganate genomic
footprinting on the Pnr_Tup_Y transgene.
43
Permanganate Genomic Footprinting of the Pnr_Tup_Y transgene.
As described in the introduction, I performed permanganate genomic footprinting on Dr.
Lagha’s Pnr_Tup_Yellow transgene in Toll10b mutant embryos to determine if the polymerase
detected by Pol II ChIP-Seq is transcriptionally engaged or not. I also performed the reaction on
endogenous tup using the same sample of DNA from permanganate-treated embryos.
Sequence details and primer design
The plasmid insert contained pnr enhancer sequence with 200 bases of the pnr promoter
replaced with 200 bases of the tup promoter. Sequence from the yellow gene was again used as a
reporter and directly followed the tup promoter (Figure 5-1). Dr. Lagha annotated the TSS indicated
on Figure 5-4 using Mod-ENCODE data from flybase.org for 2-4 hour embryos. A GAGA factor
binding site is located at -124 from the TSS.
LM-PCR primers were designed downstream from the TSS at the tup/yellow junction unique
to the transgene, which is located 86 bases away from the TSS. Only the LM-3 primer was designed
to overlap the unique tail-up/yellow junction; LM-1 and LM-2 both were designed in the yellow
sequence and would likely recognize the endogenous yellow sequence as well. However, the LM-3
primer provided the specificity needed to label only the amplification products from the Pnr_Tup_Y
transgene.
44
I prepared samples for LM-PCR as described in Chapter 2. Hypersensitive thymines are
shown at +33, 34, 48, and 51, indicating that the polymerase observed at the promoter of the
Pnr_Tup_Yellow transgene is transcriptionally engaged (Figure 5-2 A). Naked DNA was treated for
thirty seconds with permanganate, while embryos were treated for sixty seconds with
permanganate. A thirty second treatment of naked DNA was settled on as it produced
approximately equal intensity in signal between permanganate treated naked DNA and embryo
DNA.
Permanganate genomic footprinting of the endogenous tup.
The endogenous tup gene was analyzed with permanganate genomic footprinting to
determine if the pattern of permanganate reactivity was similar to the Pnr_Tup_Yellow transgene
45
(Figure 5-2 B). Hypersensitive thymines were seen at +33, 34, 48, 51, and 62, as seen in the
transgene. A common problem in both the transgenic and endogenous reactions was the high level
of background cutting (Naked 30”, Figure 5-2 A and B). However, the thymines at +33/34 in the
Embryos 60” lane are two of the strongest bands above background, even though they appear more
faint than the stronger bands in the Embryo 60” lane that are lower on the gel.
46
47
Permanganate genomic footprinting of the endogenous pnr gene.
Because it was hypothesized that a paused polymerase introduced by the tup promoter was
the reason the 200 bp of the tup promoter changed the stochastic transcriptional activation pattern
to a more synchronous one, the endogenous pnr gene was analyzed with permanganate genomic
footprinting to (hopefully) confirm that it did not contain a paused polymerase. However, the
primers designed (listed in Appendix A) did not produce bands that correlated with the endogenous
pnr sequence, so the permanganate reactivity of the pnr gene was unable to be determined.
Dr. Lagha’s work on the Twist_Snail_Yellow transgenic promoter.
Dr. Lagha constructed a transgenic line containing a Bacterial Artificial Chromosome (BAC)
containing a 25kb sequence of the twist gene and the yellow reporter gene. She replaced 100 bases
of the twist promoter with 100 bases of the snail promoter (discussed in the next section and called
Twi_Sna_Yellow). The transgene was analyzed in Gd7 mutants (consisting of a homogenous
population of dorsal ectoderm cells) in which the transgene is transcriptionally silent. Pol II was
detected at the promoter of the Twi_Sna_Y ellow transgene from both Pol II ChIP-Seq and ChIP-
qPCR (data not shown). Data on the transcriptional activation pattern on the endogenous twist or
endogenous snail genes Twi_Yellow transgene or the Twi_Sna_Yellow transgene was not provided,
however. The same result, therefore, of the minimal promoter being capable of transforming the
transcriptional activation pattern of a gene could not be concluded with the snail/twist combination
as with the pnr/tup gene combination. However, the Pol II ChIP-Seq signal at the promoter of the
Twi_Sna_Yellow transgene showed polymerase detected in an ectopic situation, so I perfomed
permanganate footprinting to determine whether the detected polymerase was transcriptionally
engaged or in a pre-initiation complex.
Permanganate Genomic Footprinting of the Twi_Sna_Yellow gene.
Sequence description and primer design
48
The Twi_Sna_Yellow sequence is depicted in Figure 5-4. Dr. Lagha annotated the
transcription start site (TSS) using ModENCODE RNA-Seq data from Flybase.org for 2-4 hour old
embryos. A TATA box lies 30 bases upstream of the TSS and falls within the snail promoter
sequence.
To analyze this transgene with permanganate genomic fooptprinting, LM-PCR primers were
designed at the unique junction of the twist/yellow sequence to guarantee that the LM-PCR reaction
was specific for the transgene and not for the endogenous yellow sequence. The LM-1 primer for
the transgene was designed in only the yellow sequence, but both the LM-2 and LM-3 primers
overlap the sequence unique to the transgene at the twist/yellow junction and will hence amplify
and label only the products specific to the transgene.
49
Samples for LM-PCR were prepared as described in Chapter 2. Hypersensitive thymines were
found at +22/23, 39, 48, and 50, indicating that the polymerase observed at the promoter of the
Twist_Snail_Yellow transgene is transcriptionally engaged (Figure 5-4 A).
Permangante genomic footprinting of endogenous snail and endogenous twist.
Permanganate genomic footprinting was done on the endogenous snail gene to determine
the endogenous hyper-reactivity pattern (Figure 5-4 B). Hyper-reactive thymines are indicated at
+41 and +48. Because the transgenic snail gene differed in sequence at these positions, the hyper-
reactivity pattern cannot be compared directly between sequences. However, the thymine at +41 in
the endogenous snail is in a similar position to the hyper-reactive thymine at +39 in the transgenic
snail. Endogenous twist was analyzed with LM-PCR as well with DNA from the same samples as the
endogenous snail and transgenic snail reactions, but this reaction failed to produce any meaningful
bands (data not shown).
50
51
Discussion.
The results of Dr. Lagha’s work provide a clear example of a minimal promoter being
capable of transforming the transcriptional activation pattern of a gene from stochastic to
synchronous. Furthermore, the synchronicity introduced by the minimal promoter can be attributed
to a paused polymerase. The loss of synchronicity when the tup minimal promoter is replaced by the
pnr minimal promoter is striking, and the complementary experiment of the tup minimal promoter
being capable of turning the stochastic pnr gene synchronous provides convincing evidence that the
activation pattern is being heavily influenced by the 200 bases surrounding the TSS.
The evidence for the synchronicity being determined by a paused polymerase comes first
from the fact that a decrease in both NELF and Spt5 affect the rate of transcriptional activation. A
decrease in GAGA factor, another factor important in pausing, has the same effect (unpublished
data not shown). Finally, the presence of a paused polymerase on the transgene was proven with a
combination of ChIP-Seq, ChIP-qPCR, and permanganate footprinting data. This data, in comparison
to the ChIP-Seq data on the unmodified pnr-yellow transgene suggests that the tup promoter is
responsible for introducing a paused polymerase on the transgene (data not shown).
This work further uncovers the mechanism of how the transcriptional activation patterns
originally presented by Boettiger (2009) occur. Their paper was able to provide evidence for a
correlation between synchronicity and the presence of a paused polymerase, but it did not provide
conclusive evidence that a paused polymerase was in anyway determining a gene’s transcriptional
activation pattern. Overall, this data can be taken to represent one example of a minimal promoter
being able to transform the transcriptional activation pattern of a gene from stochastic to
synchronous by introducing a paused polymerase onto the gene. This example provides evidence for
a mechanism in which a gene is primed to activate transcription in a synchronous manner across a
52
developing embryo due to a paused polymerase, which sets up clear evidence for the biological
importance of Pol II pausing in development.
The necessity for my permanganate footprinting data on the transgenic constructs was due
to the limitation of both ChIP-Seq and ChIP-qPCR. The data from both of these assays is not able to
provide evidence for whether or not the Pol II detected at the promoter is in a paused Pol II complex
or in a pre-initiation complex. Because the permanganate footprinting assay is able to detect a
transcription bubble formed by a polymerase actively engaged in transcription, this assay was used
to complete the ChIP-seq and qPCR data. The permanganate assay that I performed was able to
show that the detected polymerase is transcriptionally engaged, supporting the model of a paused
polymerase being introduced by the tup promoter. However, I have a couple of concerns about the
design of the permangate experiment, which are addressed below.
Although the permanganate footprinting assay was able to show that the polymerase
observed at the promoter of the Pnr_Tup_Y transgene by the Pol II-ChIP-Seq and qPCR is
transcriptionally engaged, a more thorough analysis of the location of Pol II by permanganate
footprinting would be required to show that the tup core promoter really is introducing a paused
polymerase into the Pnr_Tup_Y transgene. First, the transgene would need to be analyzed using
primers upstream of the TSS (and they would need to overlap the sequence at the junction unique
to the transgene at pnr/tup). The current set of LM-PCR primers is designed only 86 bases
downstream from the TSS due to the requirement for the primers to overlap the unique tup/yellow
junction. LM-PCR primers are usually designed downstream from the TSS to avoid the potential
problem of the RNA/DNA heteroduplex on the transcribed strand blocking oxidation by
permanganate, which oxidizes single-stranded thymines. However, permanganate footprinting has
been shown to work using upstream primers, so a possible way of looking further into the
Pnr_Tup_Y transgene, and hence determining if the signal observed indicates a paused polymerase
53
or not, may be possible. This result would provide a more thorough analysis of Pol II on the
transgene.
Additionally, the Pol II ChIP-Seq reads in the mutant lines (data not shown) show that the
endogenous pnr gene is not enriched for Pol II at the promoter. This result suggests that the pnr
gene does not have a paused polymerase in the Gd7 and Toll10b mutants. The stochastic
transcriptional activation pattern of pnr gene also indicates that the endogenous pnr gene does not
have a paused polymerase, as the synchronous activation of a gene correlates with a paused Pol II.
However, the permanganate footprinting reaction did not work on the endogenous pnr gene (data
not shown), so it is impossible to say what the hyperactivity pattern is on this gene. Also, the ideal
negative control to show that the tup promoter introduced a paused polymerase into the
Pnr_Tup_Yellow transgene would be to show that a paused polymerase is not present on the
Pnr_Yellow transgene (which maintains the pnr promoter instead of replacing it with the tup
promoter). Collectively, these results would show that the tup promoter was responsible for
introducing a paused polymerase into the Pnr_Tup_Yellow transgene. This data would then support
the result that a paused polymerase introduced by the tup promoter is able to change the stochastic
activation pattern of the pnr gene into a synchronous transcriptional activation pattern.
A final issue with the Pnr_Tup_Yellow permanganate footprinting was that the original
signal was very weak, so extra cycles were added to boost the intensity of the signal. The technical
detail of having to increase the amplification step by ten cycles and the labeling cycle by one cycle
for the Pnr_Tup_Yellow LM-PCR reaction may have been due to the fact that only the LM-3 primer
was specific to the unique overlap of the tup/yellow junction. Because the LM-1 and LM-2 primers
would have recognized the endogenous yellow gene as well, there likely would have been
endogenous yellow products in the reaction. The LM-3 primer would have been able to hybridize to
these products, but would not have been able to extend (because the bases at the 3’ end are in the
54
tup sequence). The P-32 labeled LM-3 primer may have then been tied up in the reaction and
resulted in low signal intensity for the final Pnr_Tup_Yellow transgene amplification products. Thus,
the amplification cycle was increased by 10 cycles to generate more product, and the labeling cycle
was increased by one cycle to increase the labeling of the amplification products.
In the Twist_Snail_Yellow line, the same limitation was encountered of the LM-PCR primers
being too close to the TSS (144 bases downstream of the TSS in this case). This limitation did not
allow for a thorough analysis of the permanganate hyper-reactivity into the body of the gene, so a
more thorough analysis could result from designing primers upstream of the TSS at the twist/snail
junction unique to the transgene as well.
55
Appendix
List of LM-PCR primers.
The calculated Tms were provided by Primer3 for all primers but endogenous pnr, which were
calculated with IDT (marked with a **). Primers marked with a * indicate the primer that is specific
to the transgene.
Gene Primer Sequence Calculated Tm Annealing Temp
Transgenic tup LM1 5’-ACAAGAATCCACCCTTTGT 54.4°C 51.0°C
Transgenic tup LM2 5’-CACCCTTTGTCCTGGAACAT 59.8°C 54.0°C
Transgenic tup LM3* 5’-CCTGGAACATGGGATCCTAGC 63.0°C 58.0°C
Endogenous tup LM1 5’-ACGGCTATCGAGCTAAGAC 54.8°C 51.0°C
Endogenous tup LM2 5’-GAGCTAAGACGGTCGATGTT 57.0°C 54.0°C
Endogenous tup LM3 5’-GCTAAGACGGTCGATGTTCG 60.9°C 58.0°C
Transgenic snail LM1 5’-ACTCCAACAGGTAGAGCATT 53.9°C 51.0°C
Transgenic snail LM2* 5’-AGAGCATTTGGTGATCTTGC 57.9°C 54.0°C
Transgenic snail LM3 5’-GCATTTGGTGATCTTGCTTGG 62.8°C 58.0°C
Endogenous snail
LM1 5’-CGGCCATTTTTGATGT 53.4°C 51.0°C
Endogenous snail
LM2 5’-CCATTTTTGATGTGTGTGTGA 57.9°C 54.0°C
Endogenous snail
LM3 5’-TGTGTGTGTGATTAAGTTTTAGTTTCC
59.8°C 58.0°C
Endogenous Twist
LM1 5’-ATAAGCTACAAGCCCACACT 54.17°C 51°C
Endogenous Twist
LM2 5’-CTACAAGCCCACACTTGCTT 58.04°C 54°C
Endogenous Twist
LM3 5’-CCCACACTTGCTTGGCTTTT 62.46°C 58°C
Endogenous pnr LM1 GCGAACAAACAAACTAAAAA 47.6°C** 51°C
Endogenous pnr LM2 TAAAAAACGCCCCGAAGTAAA 52.8°C** 54°C
Enodgenous pnr LM3 CCCCGAAGTAAACAAAAACTTAATCCC 56.4°C** 58°C
56
Bibliography.
Biggin, M. D., & Tjian, R. (1988). Transcription Factors That Activate the UItrabithorax Promoter in Developmentally Staged Extracts kk : Cell, 53, 699-711.
Boehm, A., Saunders, A., & Werner, J. (2003). Transcription factor and polymerase recruitment, modification, and movement on dhsp70 in vivo in the minutes following heat shock. Molecular and cellular, 23(21), 7628-7637. doi:10.1128/MCB.23.21.7628
Boettiger, A. N., & Levine, M. (2009). Synchronous and stochastic patterns of gene activation in the Drosophila embryo. Science (New York, N.Y.), 325(5939), 471-3. doi:10.1126/science.1173976
Champlin, D. T., Frasch, M., Saumweber, H., & Lis, J. T. (1991). Characterization of a Drosophila protein associated with boundaries of transcriptionally active chromatin. Genes & Development, 5(9), 1611-1621. doi:10.1101/gad.5.9.1611
Core, L. J., & Lis, J. T. (2008). Transcription Regulation Through Promoter-Proximal Pausing of RNA Polymerase II. Science, 319(5871), 1791-1792. doi:10.1126/science.1150843.Transcription
Fernandes, M., Xiao, H., & Lis, J. T. (1995). Binding of heat shock factor to and transcriptional activation of heat shock genes in Drosophila. Nucleic acids research, 23(23), 4799-804. Retrieved from http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=307467&tool=pmcentrez&rendertype=abstract
Ghosh, S. K. B., Missra, A., & Gilmour, D. S. (2011). Negative ELongation Factor, NELF, accelerates the rate at which heat shock genes are shut-off by facilitating dissociation of heat shock factor. Molecular and cellular biology, (August). doi:10.1128/MCB.05930-11
Gilchrist, D. A., Dos Santos, G., Fargo, D. C., Xie, B., Gao, Y., Li, L., & Adelman, K. (2011). Pausing of RNA polymerase II Disrupts DNA-specified Nucleosome Organization to Enable Precise Gene Regulation. Cell, 143(4), 540-551. doi:10.1016/j.cell.2010.10.004.Pausing
Gilmour, D. S. (2009). Promoter proximal pausing on genes in metazoans. Chromosoma, 118(1), 1-10. doi:10.1007/s00412-008-0182-4
Gilmour, D. S., & Fan, R. (2009). Detecting transcriptionally engaged RNA polymerase in eukaryotic cells with permanganate genomic footprinting. Methods, 48(4), 368-374. Retrieved from http://www.sciencedirect.com/science/article/pii/S1046202309000425
Jedlicka, P., Mortin, M. a, & Wu, C. (1997). Multiple functions of Drosophila heat shock transcription factor in vivo. The EMBO journal, 16(9), 2452-62. doi:10.1093/emboj/16.9.2452
57
Lee, C., Li, X., Hechmer, A., Eisen, M., Biggin, M. D., Venters, B. J., Jiang, C., et al. (2008). NELF and GAGA factor are linked to promoter-proximal pausing at many genes in Drosophila. Molecular and cellular biology, 28(10), 3290-300. doi:10.1128/MCB.02224-07
Li, J., & Gilmour, D. S. (2011). Promoter proximal pausing and the control of gene expression. Current Opinion in Genetics & Development, 21(2), 231-235. Retrieved from http://www.sciencedirect.com/science/article/pii/S0959437X11000141
Lis, J T, Mason, P., Peng, J., Price, D. H., & Werner, J. (2000). P-TEFb kinase recruitment and function at heat shock loci. Genes & development, 14(7), 792-803. Retrieved from http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=316500&tool=pmcentrez&rendertype=abstract
Ni, Z., Saunders, A., Fuda, N. J., Yao, J., Suarez, J.-R., Webb, W. W., & Lis, J. T. (2008). P-TEFb is critical for the maturation of RNA polymerase II into productive elongation in vivo. Molecular and cellular biology, 28(3), 1161-70. doi:10.1128/MCB.01859-07
Rougvie, a E., & Lis, J. T. (1988). The RNA polymerase II molecule at the 5’ end of the uninduced hsp70 gene of D. melanogaster is transcriptionally engaged. Cell, 54(6), 795-804. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/3136931
Wada, T, Takagi, T., Yamaguchi, Y., Watanabe, D., & Handa, H. (1998). Evidence that P-TEFb alleviates the negative effect of DSIF on RNA polymerase II-dependent transcription in vitro. The EMBO journal, 17(24), 7395-403. doi:10.1093/emboj/17.24.7395
Wang, X., Hang, S., Prazak, L., & Gergen, J. P. (2010). NELF potentiates gene transcription in the Drosophila embryo. PloS one, 5(7), e11498. doi:10.1371/journal.pone.0011498
Westerheide, S., Anckar, J., & Jr, S. S. (2009). Stress-inducible regulation of heat shock factor 1 by the deacetylase SIRT1. Science’s, 323(February), 1063-1066. Retrieved from http://stke.sciencemag.org/cgi/content/abstract/sci;323/5917/1063
Wu, C.-huey, Yamaguchi, Y., Benjamin, L. R., Horvat-gordon, M., Washinsky, J., Enerly, E., Larsson, J., et al. (2003). NELF and DSIF cause promoter proximal pausing on the hsp70 promoter in Drosophila. Genes & Development, 1402-1414. doi:10.1101/gad.1091403.lation
Wu, Carl. (1995). Heat shock transcription factors: structure and regulation. Annual review of cell and developmental biology, 11, 441-469. Retrieved from http://www.annualreviews.org/doi/pdf/10.1146/annurev.cb.11.110195.002301
Yamaguchi, Yuki, Takagi, T., & Wada, T. (1999). NELF , a Multisubunit Complex Containing RD , Cooperates with DSIF to Repress RNA Polymerase II Elongation. Cell, 97, 41-51.
Zeitlinger, J., Stark, A., Kellis, M., Hong, J.-woo, Adelman, K., Levine, M., & Young, R. A. (2007). RNA polymerase stalling at developmental control genes in the Drosophila melanogaster embryo. Nature genetics, 39(12), 1512-1516. doi:10.1038/ng.2007.26.RNA
58
Zobeck, K., Buckley, M., & Zipfel, W. (2010). Recruitment Timing and Dynamics of Transcription Factors at the< i> Hsp70</i> Loci in Living Cells. Molecular cell, 40(6), 965-975. doi:10.1016/j.molcel.2010.11.022.Recruitment