BASIC RESEARCH PAPER

PTK2-mediated degradation of ATG3 impedes cancer cells susceptible to DNA damagetreatment

Ke Maa, Wan Fua, Ming Tanga, Chaohua Zhanga, Tianyun Houa, Ran Lia, Xiaopeng Lua, Yanan Wanga, Jingyi Zhoua,Xue Lia, Luyao Zhanga, Lina Wanga, Ying Zhaoa, and Wei-Guo Zhua,b,c

aKey Laboratory of Carcinogenesis and Translational Research (Ministry of Education), State Key Laboratory of Natural and Biomimetic Drugs, BeijingKey Laboratory of Protein Posttranslational Modifications and Cell Function, Department of Biochemistry and Molecular Biology, School of BasicMedical Sciences, Peking University Health Science Center, Beijing, China; bSchool of Medicine, Shenzhen University, Shenzhen, China; cPeking-Tsinghua University Center for Life Science, Peking University, Beijing, China

ARTICLE HISTORYReceived 25 March 2016Revised 3 December 2016Accepted 8 December 2016

ABSTRACTATG3 (autophagy-related 3) is an E2-like enzyme essential for autophagy; however, it is unknown whetherit has an autophagy-independent function. Here, we report that ATG3 is a relatively stable protein inunstressed cells, but it is degraded in response to DNA-damaging agents such as etoposide or cisplatin.With mass spectrometry and a mutagenesis assay, phosphorylation of tyrosine 203 of ATG3 was identifiedto be a critical modification for its degradation, which was further confirmed by manipulating ATG3Y203E

(phosphorylation mimic) or ATG3Y203F (phosphorylation-incompetent) in Atg3 knockout MEFs. In addition,by using a generated phospho-specific antibody we showed that phosphorylation of Y203 significantlyincreased upon etoposide treatment. With a specific inhibitor or siRNA, PTK2 (protein tyrosine kinase 2)was confirmed to catalyze the phosphorylation of ATG3 at Y203. Furthermore, a newly identified functionof ATG3 was recognized to be associated with the promotion of DNA damage-induced mitoticcatastrophe, in which ATG3 interferes with the function of BAG3, a crucial protein in the mitotic process,by binding. Finally, PTK2 inhibition-induced sustained levels of ATG3 were able to sensitize cancer cells toDNA-damaging agents. Our findings strengthen the notion that targeting PTK2 in combination with DNA-damaging agents is a novel strategy for cancer therapy.

KEYWORDSATG3; cancer therapy; mitoticcatastrophe; PTK2; tyrosinephosphorylation

Introduction

Macroautophagy/autophagy is a tightly regulated pathway thatcan be stimulated by multiple forms of cellular stress.1-5 Dur-ing the autophagic process, cells form double-membranedcompartments, termed phagophores, which sequester dam-aged organelles, proteins, or portions of the cytoplasm; matu-ration into an autophagosome is followed by subsequentdelivery of the cargo to the lysosome.,6,7 The molecular mech-anisms of autophagosome formation are evolutionarily con-served and depend upon several autophagy-related (ATG)proteins.8 For example, BECN1 (Beclin 1) can govern theautophagic process by regulating PIK3C3-dependent genera-tion of phosphatidylinositol-3-phosphate and the subsequentrecruitment of additional ATG proteins that orchestrate auto-phagosome formation.9

Recently, a growing number of studies have shown thatATG proteins also play a role in autophagy-independent func-tions.10-13 The ATG12–ATG5-ATG16L1 protein complex,whose well-known function is participating in autophagosomeformation, has an autophagy-independent role in the antiviralactivity triggered by IFNG/IFN-g.13 Another essential protein

in autophagy induction, ATG7, is also reported to induce cellcycle arrest in response to metabolic stress.11 In addition,BECN1 participates in the association of kinetochore proteinsand mitosis independent of its function in autophagy.12 There-fore, searching for autophagy-independent functions of ATGproteins seems to be a promising field of research.

As an E2-like enzyme essential for autophagy, ATG3 can cata-lyze the conjugation of MAP1LC3/ATG8 and phosphatidyletha-nolamine (PE).14,15 In addition to regulating MAP1LC3–PE/MAP1LC3-II conjugation, ATG3 also forms a complex withATG12 to regulate mitochondrial homeostasis and cell deathmediated by mitochondrial pathways.16-18 Because ATG3 isinvolved in many biological processes, mice deficient in the Atg3gene die within the first d after birth with reduced amino acid lev-els.19 However, it is unknown whether ATG3 is also involved inan autophagy-independent biologic function.

PTK2/FAK (protein tyrosine kinase 2) is a cytoplasmicprotein tyrosine kinase that is overexpressed and activated inseveral advanced-stage solid cancers.20 It can promote glucoseconsumption, lipogenesis, and glutamine dependency topromote cancer cell proliferation, motility, and survival.21

CONTACT Ying Zhao zhaoying0812@bjmu.edu.cn Peking University Health Science Center, Xueyuan Rd. Haidian District, Beijing, China, 100191; Wei-Guo Zhuzhuweiguo@bjmu.edu.cn or zhuweiguo@szu.edu.cn Peking University Health Science Center, Xueyuan Rd. Haidian District, Beijing, China, 100191; Shenzhen

University, Nanhai Ave 3688, Shenzhen, Guangdong, P.R. China, 518060.

Color versions of one or more of the figures in the article can be found online at www.tandfonline.com/kaup.Supplemental data for this article can be accessed on the publisher’s website.

© 2017 Taylor & Francis

AUTOPHAGY2017, VOL. 13, NO. 3, 579–591http://dx.doi.org/10.1080/15548627.2016.1272742

Targeting PTK2 in endothelial cells is sufficient to inducetumor cell sensitization to DNA-damaging therapies by down-regulating the NFKB/NF-kB pathway.22 Small molecule PTK2inhibitors (PTK2-Is) prevent tumor progression in mice andare being evaluated in clinical trials.23-27 However, the greatestefficacy of PTK2-Is has been observed in combination withother tyrosine kinase inhibitors28,29 or cytotoxic drugs,30,31 butthe real mechanism has yet to be fully revealed.

In this study, we found that in response to cancer chemothera-peutic agent treatment, PTK2 induced ATG3 phosphorylation,which led to its significant degradation but was not associated withthe induction of autophagy. In addition, PTK2 inhibition caused asustained level of ATG3, leading to a significant decrease in cell via-bility. These results implicate ATG3 phosphorylation in the main-tenance of cell viability in response to DNA damage and alsosupport the notion that targeting PTK2 in combination with che-motherapy is a novel cancer therapeutic strategy.

Results

ATG3 is degraded during DNA damage treatment

ATG proteins have been reported to exert autophagy-indepen-dent functions. For example, ATG5 expression is induced byDNA-damaging agents and promotes mitotic catastrophe inde-pendent of autophagy.32 Therefore, we examined several ATGprotein levels in response to treatment with DNA-damagingdrugs. Human colon cancer cell lines HCT116 and LoVo weretreated with etoposide for 3 h or cisplatin for 6 h, washed, andincubated with fresh medium. As shown in Figure 1A–D,among the ATG proteins tested, only ATG3 protein levels weregradually decreased after etoposide or cisplatin treatment. Toverify whether this phenomenon was cell type-dependent, thelevels of ATG proteins were also measured in the cervical can-cer cell line HeLa and osteosarcoma cell line U2OS after etopo-side treatment. Consistent with the previous results, ATG3 wasdecreased at the protein level (Figure S1A-B). Furthermore, weused irradiation (IR) or camptothecin to treat HCT116 cellsand found that this is a general phenomenon that occurs inresponse to DNA damage inducers (Figure S1C-D).

Because etoposide or cisplatin treatment had no effect onATG3mRNA levels (Figure 1E–F), protein degradation might beresponsible for the decrease in ATG3 protein levels in responseto DNA-damaging drug treatment. To determine the pathwaysinvolved in the ATG3 degradation, we pretreated HCT116 cellswith a panel of inhibitors that included the proteasome inhibitorMG132 and the lysosome inhibitor chloroquine (CHQ). Treat-ment with MG132 significantly blocked the etoposide-inducedreduction of ATG3 levels, but CHQ had no such effect on ATG3degradation (Figure 1G), suggesting that ATG3 is degraded bythe proteasomal pathway in response to etoposide treatment.

Next, to determine whether ubiquitination is required forATG3 degradation, an HA-ubiquitin plasmid was transfectedinto HCT116 cells; ATG3 ubiquitination was detected by co-IPwith an anti-ATG3 antibody followed by immunoblotting withan anti-HA antibody. As shown in Figure 1H, ATG3-conju-gated ubiquitin after etoposide treatment was increased in com-parison with that in untreated cells. These results demonstrate

that the degradation of ATG3 occurs mainly through a ubiqui-tin-proteasome-dependent pathway.

PTK2 regulates ATG3 degradation

To test whether the post-translational modifications of ATG3 playa role in its degradation, a protein extract of HCT116 cells wasimmunoprecipitated with an anti-ATG3 antibody and probedwith an anti-phosphorylated serine, an anti-phosphorylated threo-nine, an anti-phosphorylated tyrosine or an anti-acetylated lysineantibody. Acetylation of ATG3 at lysine and phosphorylation ofATG3 at serine or threonine did not show a significant change inHCT116 cells in response to etoposide treatment (Figure S2A-B).By contrast, a significant increase in phosphorylated ATG3 at atyrosine was detected in etoposide-treated HCT116 cells(Figure 2A), suggesting that ATG3 tyrosine phosphorylation maybe involved in regulating its stability.

Next, we used several well-characterized tyrosine kinase inhibi-tors, SRC Inhibitor-1, an inhibitor of SRC; Erlotinib, an inhibitor ofEGFR; and PF-573228, an inhibitor of PTK2, to investigate whichcellular signaling pathway is involved in ATG3 degradation.HCT116 cells were pre-incubated with SRC Inhibitor-1, erlotinibor PF-573228 for 1 h followed by treatment with etoposide foranother 3 h. Forty-eight h after etoposide treatment, blockage ofPTK2 by PF-573228 completely inhibited etoposide-inducedATG3 degradation, whereas the others did not (Figure 2B). To fur-ther confirm the role of PTK2 in ATG3 degradation, HCT116 cellswere transfected with either nonspecific or PTK2-specific siRNA,and ATG3 degradation was then detected. The efficiency of theRNAi against PTK2 was significant, and, as expected, upon etopo-side treatment ATG3 was degraded in the cells transfected with thenegative control siRNA. In contrast, ATG3 remained at higher lev-els in the cells transfected with the PTK2 siRNA (Figure 2C), sug-gesting that PTK2 plays a critical role in ATG3 degradation inresponse to DNA damage.

Y203 phosphorylation of ATG3 is required for itsdegradation

To test which phosphorylation site is critical for ATG3 degrada-tion, we purified the ATG3 protein and performed an analysis withmass spectrometry (MS). As shown in Figure S3, a mass spectrom-etry analysis indicated that a highly conserved site, Y203, of ATG3was phosphorylated after etoposide treatment. To further confirmthis site, we generated an antibody for the Y203-phosphorylatedpeptide of ATG3 (Figure 3A). Using this antibody, we found thatY203-phosphorylated ATG3 was increased after etoposide treat-ment (Figure 3B).Moreover, etoposide-inducedATG3 phosphory-lation at Y203 was downregulated by the PTK2 inhibitor PF-573228 (Figure 3C).

To further confirm the role of ATG3 phosphorylation at Y203in its degradation, we generated ATG3 wild-type (ATG3-WT),ATG3Y203E (phosphorylation-mimic) and ATG3Y203F (phosphory-lation-incompetent) inducible cell lines in Atg3 KO MEFs. Asshown in Figure 3D and E, ATG3 was a relatively stable protein,with a half-life in excess of 12 h. In contrast, the half-life of thephosphorylation-mimic protein ATG3Y203E was significantlyshortened to 3 h. This reduction in the half-life of ATG3Y203E

resulted from an increasing ubiquitination of ATG3. As shown in

580 K. MA ET AL.

Figure 3F, ATG3Y203E-conjugated to ubiquitin was greatlyincreased compared with wild-type ATG3. The above results dem-onstrate that phosphorylation of ATG3 at Y203 is associated withits ubiquitination, which destabilizes the ATG3 protein underDNA damage conditions.

Y203 phosphorylation of ATG3 is dispensable forautophagy induction

Because ATG3 is an autophagy essential gene, we next investi-gated the role of phosphorylation of ATG3 in autophagy induc-tion. Autophagy in Atg3 knockout cells could not be rescued by

expression of ATG3Y203E only, as the phosphorylation-mimicwas unstable in cells. However, when Atg3 knockout cells trans-fected with the ATG3Y203E-encoding plasmid were incubatedwith MG132, autophagy was fully rescued (Figure 4A–C).These results suggested that Y203 phosphorylation of ATG3 isnot critical for autophagy induction. Next, because ATG3 wasdegraded during the DNA damage process, we wanted to fur-ther explore whether there was any connection between ATG3degradation and autophagy. A PTK2 RNAi plasmid was trans-fected into HCT116 cells to establish a stable PTK2 knockdowncell line; a nonspecific RNAi plasmid was used as a negativecontrol. These cell lines were separately treated with etoposide

Figure 1. ATG3 is degraded in response to treatment with DNA-damaging drugs. (A) HCT116 cells were treated with DMSO or etoposide (40 mM) for 3 h and then incu-bated with fresh medium for the indicated time. Western blotting was performed to detect different ATG proteins. (B) HCT116 cells were treated with etoposide at variousconcentrations for 3 h and then incubated with fresh medium for 48 h. (C, D) Cisplatin (10 mM) (C) or etoposide (40 mM) (D) were introduced into HCT116 or LoVo cells,respectively. Cells were then treated as described in (A). (E, F) HCT116 cells were treated with etoposide (E) or cisplatin (F) as indicated, and then quantitative PCR (qPCR)was used to measure the mRNA levels of ATG3. The data are presented as the mean § SD (n D 3). NS, no significance. (G) HCT116 cells were treated with etoposide for3 h and then incubated with fresh medium for 48 h in the presence or absence of CHQ (10 mM) or MG132 (1 mM). Western blotting was performed to detect endogenousATG3 protein levels. (H) HCT116 cells were transfected with HA-ubiquitin. Cells were treated 24 h after transfection with or without etoposide for 3 h and then incubatedin fresh medium for 48 h. MG132 (1 mM) was added 12 h before collection. Cell lysates were immunoprecipitated with an anti-ATG3 antibody and blotted with an anti-ATG3 or anti-HA antibody.

AUTOPHAGY 581

for 3 h and then cultured in fresh medium for up to 48 h. Celllysates were extracted for western blotting to detect changes inATG3 and MAP1LC3, a marker of autophagy induction. Asshown in Figure 4D, although ATG3 protein levels were res-cued by PTK2 RNAi, no obvious difference of MAP1LC3-IIaccumulation was detected between the PTK2 stable-knock-down cell line and control cell line, suggesting that sustainedlevels of ATG3 caused by knocking down or inhibiting PTK2are not related to autophagy induction.

ATG3Y203F promotes DNA damage-induced mitoticcatastrophe by inhibiting BAG3

Previous studies have shown that some autophagy-related pro-teins can affect the DNA repair process.32-36 Next, we testedwhether sustained levels of ATG3 could regulate this process.Homologous recombination (HR) and nonhomologous end-joining (NHEJ) are 2 major pathways for the repair of DNAdouble-strand breaks.37 Therefore, we used the direct-repeat(DR)-GFP reporter and the pEJ5-GFP reporter to monitor theHR and NHEJ pathways, respectively. As shown in Figure S4A-B, the efficiency of HR or NHEJ did not substantially changebetween the ATG3-WT cell line and ATG3Y203F cell line, sug-gesting that Y203 phosphorylation is not involved in the DNArepair process.

In addition to the involvement of ATG3 in autophagy,overexpressed ATG3 induces apoptosis in extracellularmatrix (ECM)-attached colorectal cancer cells.38 To investi-gate whether ATG3 degradation affects apoptosis, we usedthe ATG3-WT or ATG3Y203F-inducible cell lines for flowcytometry analysis. As shown in Figure S5, in response toetoposide treatment, there was no obvious difference in theapoptosis process between the ATG3-WT cell line andATG3Y203F cell line.

As several reports have demonstrated that DNA-damagingagents are able to induce mitotic catastrophe,32,39,40 we investi-gated the changes in nuclear morphology between ATG3-WTand ATG3Y203F cells following exposure to etoposide. Inresponse to etoposide treatment, the nuclei became significantlylarger, and some cells also contained micronuclei. Comparedwith the ATG3-WT cell line, the ATG3Y203F cells had moreabnormal nuclei after etoposide treatment (Figure 5A–D). Inaddition, FACS analysis was used to detect the changes of DNAcontent in WT or Y203F cells treated with etoposide. Consis-tent with the above results, the hyperploid cell population (>4N DNA cells) in Y203F cells was much higher than that inWT cells (Figure 5E). These results suggest that sustainedATG3 may be able to promote DNA damage-induced mitoticcatastrophe.

We next focused on the potential mechanisms of action forATG3. It has been reported that ATG3 is able to interact withBAG3 (BCL2 associated athanogene 3),41 which plays animportant role in mitotic catastrophe.42 As shown in Figure 5F,we found that the interaction between ATG3 and BAG3 wasenhanced in response to etoposide treatment. These results sug-gest that ATG3 may promote DNA damage-induced mitoticcatastrophe through its interaction with BAG3.

Sustained ATG3 is related to the inhibition of cell growthin response to DNA-damaging agents

Next, we generated an ATG3 knockout HCT116 cell line usingthe CRISPR/Cas9 system. Plasmids encoding ATG3-WT andATG3Y203F were separately transfected into the ATG3 knockoutHCT116 cell line (Figure 6A). Subsequently, we tested the col-ony formation of the ATG3-WT and ATG3Y203F cell linesunder the treatment of etoposide, cisplatin or IR. Surprisingly,we found that the ATG3Y203F cell line exhibited reduced

Figure 2. Involvement of PTK2 kinase in ATG3 degradation. (A) MEF cells were treated with or without etoposide (20 mM) for 6 h, and then incubated with fresh medium.The cell lysates were immunoprecipitated with an anti-ATG3 antibody and blotted with an anti-phospho-tyrosine antibody. (B) HCT116 cells were pre-incubated with PF-573228 (PTK2 inhibitor), SRC Inhibitor-1 (SRC inhibitor) or erlotinib (EGFR inhibitor) for 1 h and then treated with or without etoposide (40 mM). Three h later, the mediumwas changed, and cells were incubated in fresh medium in the presence or absence of kinase inhibitors for the indicated time. Western blotting was performed using anti-ATG3, anti-p-PTK2, anti-p-SRC or anti-p-EGFR antibodies. (C) HCT116 cells were transfected with a PTK2-specific siRNA or negative control. 48 h after transfection, the cellswere treated with or without etoposide for 3 h and then incubated with fresh medium for 48 h. Endogenous ATG3 protein levels were measured by western blotting,and the efficiency of PTK2 siRNA was validated by monitoring total PTK2 and p-PTK2. The bands were quantified with ImageJ software. The numbers below the blot indi-cate the relative levels of p-PTK2 in each group.

582 K. MA ET AL.

survival rates relative to the ATG3-WT cell line in response toDNA-damaging drugs (Figure 6B–C and Figure S6A-B). Inaddition, we also tested colony formation in ATG7 knockoutcells and obtained similar results (Figure S7A-B), suggestingthat autophagy is independent of the function of ATG3 thatmediates inhibition of cell growth in response to DNA damage.Furthermore, we used NOD-SCID mice to find whether sus-tained levels of ATG3 can sensitize cancer cells to treatmentwith DNA-damaging drugs ex vivo. Plasmids encoding ATG3-WT and ATG3Y203F were separately transfected into ATG3knockout HCT116 cells, and then the cells were injected subcu-taneously into NOD-SCID mice. Consistent with the colonyformation data, the ATG3Y203F tumors showed less growth rel-ative to the ATG3-WT tumors in response to etoposide treat-ment (Figure 6D–E). These results suggested that sustainedlevels of ATG3 may be beneficial for the inhibition of cellgrowth both in vitro and in vivo when cells are undergoing

DNA damage. Accordingly, we predicted that PTK2 inhibition,which can maintain the stability of ATG3, would be able to sen-sitize cancer cells to DNA-damaging reagents.

HCT116 cells were treated with etoposide alone or in combi-nation with different tyrosine kinase inhibitors to observechanges in cell proliferation assayed with the WST-1 reagent.Consistent with our hypothesis, the PTK2 inhibitor PF-573228,but not the SRC nor EGFR inhibitors, was able to enhance eto-poside-induced inhibition of cell proliferation (Figure 6F). Forthe long-term cell survival assay, we measured the colony for-mation of HCT116 cells under the treatment of DNA-damag-ing drugs combined with different tyrosine kinase inhibitors.After etoposide or cisplatin treatment, the colony formationrate was dramatically decreased in the PTK2 inhibitor PF-573228-treated cells but not in the SRC Inhibitor-1- or Erloti-nib-treated cells (Figure 6G-H). The nature of PTK2 inhibitioncombined with chemotherapeutic agent-induced cell growth

Figure 3. ATG3 degradation is dependent on its Y203 phosphorylation. (A) HCT116 cells were transfected with plasmids encoding FLAG-ATG3 WT or ATG3Y203F. The celllysates were extracted 24 h after transfection for co-IP with an anti-FLAG antibody and probed with an anti-Y203-phosphorylated ATG3 antibody. (B) MEF cells weretreated with or without etoposide (20 mM) for 6 h and then incubated with fresh medium. The cell lysates were immunoprecipitated with an anti-ATG3 antibody and blot-ted with an anti-Y203-phosphorylated ATG3 antibody. The numbers below the blot indicate the relative levels of p-ATG3 in each group. (C) MEF cells were pre-incubatedwith PF-573228 for 1 h and then treated with or without etoposide (20 mM) for 6 h. After 48 h incubating in fresh medium, the cells were prepared for co-IP with an anti-ATG3 antibody and detected with an anti-Y203-phosphorylated ATG3 antibody. (D) ATG3-inducible MEF cells were treated with doxycycline (Doxy, 1 mg/ml) to induceWT, Y203E or Y203F ATG3 and then exposed to cycloheximide (CHX, 10 mM/ml). The protein level of ATG3 was measured by western blotting. (E) Graphs show the relativeexpression of WT or mutant ATG3 with the indicated treatments in (D). The data are presented as the mean§ SD (nD 3). (F) HCT116 cells were co-transfected with FLAG-ATG3 (WT, Y203E or Y203F) and HA-ubiquitin. The cells were treated with MG132 (2 mM) 24 h later for 8 h. Proteins were then immunoprecipitated from the cell extractswith anti-FLAG M2 beads, and the immune-complexes were probed with the anti-ATG3 or anti-HA antibody.

AUTOPHAGY 583

inhibition was further explored by knocking down PTK2 inHCT116 cells. As we expected, both etoposide and cisplatindecreased the efficiency of colony formation in PTK2 knock-down cells (Figure 6I-K), suggesting that the efficiency ofDNA-damaging drugs is enhanced by PTK2 inhibition.

Discussion

In this study, we identified an autophagy-independent functionof ATG3 during the DNA damage process. After treatmentwith DNA-damaging agents, PTK2 phosphorylates ATG3 atY203, through which the degradation of ATG3 is promoted viathe ubiquitin-proteasome-dependent pathway. Inhibition ofPTK2 combined with DNA-damaging drug treatment causessustained levels of ATG3, leading to a significant decrease incell proliferation in a mitotic catastrophe-dependent manner.

Previous studies have shown that several autophagy-relatedproteins can be degraded through the proteasomal pathway.43-48

For example, ubiquitin E3 ligase RNF5 interacts with ATG4Band controls ATG4B stability through proteasome-dependentdegradation.44 In addition, free ATG12 is highly unstable andrapidly degraded by the proteasomal pathway.45 These resultssuggest that autophagy-related regulators may be regulated bythe ubiquitin-proteasome system. Although ATG3 is very stablein normal conditions (Figure 3D)49 our data showed that ATG3can also be ubiquitinated and degraded under the conditions of

DNA damage (Figure 1). Consistently, it has already beenreported that there are several potential ubiquitination sites onATG3.50,51 Therefore, further studies need to be performed todetermine whether these ubiquitination sites are also responsiblefor ATG3 degradation in response to DNA-damaging agents.

As a protein-conjugating enzyme for MAP1LC3 lipida-tion, the biological function of ATG3 is mainly focused onautophagy.14,15 The fact that autophagy protects cells fromgenotoxic stress and maintains genome integrity has alreadybeen established.33,52-56 Autophagy, however, is unlikely itselfto be responsible for the DNA damage-induced tumor cellgrowth inhibition. It has been reported that very low levelsof ATG5 expression are sufficient for autophagy induction.57

Similar to ATG5, we also found that although most ATG3was degraded after etoposide treatment, autophagy could stillbe induced by the small amount of nondegraded ATG3(Figure 4D). These results are consistent with previousreports that show incomplete deletion of Atg3 in macro-phages can still allow MAP1LC3 lipidation.58 In addition, wefound that sustained levels of ATG3 induced by PTK2 inhi-bition can still sensitize cancer cells to DNA-damagingreagents in autophagy-deficient cells (Figure S7A-B), suggest-ing that autophagy is not crucial for ATG3 mediated inhibi-tion of cell growth in response to DNA damage. Thus, wespeculate that activity of ATG3 other than autophagy induc-tion, leads to its crosstalk with the DNA damage response

Figure 4. Y203 phosphorylation of ATG3 is not critical for autophagy induction. (A) Atg3 KO MEF cells were transfected with plasmids encoding MYC-his-ATG3 WT orATG3Y203E. MG132 (2 mM) was added into the medium 12 h after transfection for another 12 h to prevent ATG3Y203E degradation. Cell lysates were extracted to detectATG3 and MAP1LC3 proteins. (B) Atg3 KO MEF cells were transfected with plasmids encoding FLAG-ATG3 WT, ATG3Y203E or ATG3Y203F. MG132 was added 12 h before col-lection. Immunofluorescence was performed after staining with anti-FLAG and anti-MAP1LC3 antibodies. Scale bars: 20 mm. (C) Quantification of the MAP1LC3 puncta-positive cells is shown in (B). The criterion for being counted was a cell with more than 10 puncta. The data are presented as the mean § SD (n D 3). �p < 0.05; NS, nosignificance. (D) PTK2 stable-knockdown HCT116 cells and WT-HCT116 cells were treated with DMSO or etoposide (40 mM) for 3 h and then incubated with fresh mediumfor up to 48 h. CHQ (10 mM) was added 1 h before collection. Western blotting was performed to detect ATG3 and MAP1LC3 protein levels. An anti-p-PTK2 antibody wasused to validate the efficiency of PTK2 siRNA.

584 K. MA ET AL.

pathway. Recent evidence has shown that overexpressedATG3 triggers apoptosis in the ECM-attached colorectal can-cer cells.38 However, in our system, we found that there wasno difference between ATG3-WT and ATG3Y203F in the apo-ptosis process after DNA-damaging drug treatment(Figure S5). Instead, we found sustained levels of ATG3 wereable to enhance DNA damage-induced mitotic catastrophe(Figure 5), and this might be a new function of ATG3 inde-pendent of autophagy and apoptosis.

Furthermore, we also revealed that ATG3 may take partin the mitotic process by binding BAG3. As a member of theBAG family of co-chaperones that interacts with HSPA (heatshock protein family A [Hsp70] member), BAG3 can regu-late many important biologic processes such as development,apoptosis and autophagy.59 Recently, a novel HSPB8-depen-dent mitotic function of BAG3, which can guide spindle ori-entation and proper chromosome segregation, has beenuncovered.42 In addition, a proteomic study of BAG3 showed

Figure 5. ATG3Y203F is able to promote DNA damage-induced mitotic catastrophe. (A) ATG3-inducible MEF cells were treated with doxycycline (Doxy, 1 mg/ml) to induceWT or Y203F ATG3 and then exposed to etoposide. Then, the cells were stained with Giemsa. Scale bars: 20 mm. (B) Statistical analysis of the abnormal nuclei in (A). Thedata are presented as the mean § SD based on 3 independent experiments. ��p < 0.01. (C) ATG3-inducible MEF cells were treated as described in (A), and immunos-tained with an antibody against TUBA (green). Nuclei were counterstained with DAPI (blue). Scale bars: 10 mm. (D) Statistical analysis of the abnormal nuclei in (C). Thedata are presented as the mean § SD based on 3 independent experiments. ��p < 0.01. (E) ATG3-inducible MEF cells were treated as described in (A), and the cells werecollected and analyzed by FACS. (F) HCT116 cells were treated with DMSO or etoposide (40 mM) for 3 h and then incubated with fresh medium for 48 h. The cell lysateswere extracted for co-IP with an anti-ATG3 antibody and probed with an anti-BAG3 antibody.

AUTOPHAGY 585

that ATG3 is a newly identified binding partner.41 In thisstudy, we observed an increase in levels of interactionbetween BAG3 and ATG3 in response to DNA-damagingdrug treatment (Figure 5F). Accordingly, we postulate thatATG3 can inhibit the mitotic function of BAG3 after DNA-

damaging drug treatment, which may be mediated by inter-fering with the formation of the BAG3 protein complex.When degradation of ATG3 was blocked after DNA-damag-ing drug treatment, the increased levels of ATG3 couldsequester more BAG3, which may improve the suppression

Figure 6. Sustained ATG3 is related to tumor cell growth inhibition in response to DNA-damaging agents. (A) Cas9 ATG3 knockout cells were transfected with plasmidsencoding FLAG-ATG3 WT ATG3Y203F. Western blotting was performed to detect the ATG3 and MAP1LC3 protein levels. (B) Cells overexpressing FLAG-ATG3-WT or FLAG-ATG3Y203F from (A) were treated with or without etoposide (40 mM) for 3 h or cisplatin (10 mM) for 6 h. Then, the cells were washed with fresh medium and allowed togrow for approximately 2 wk. The cells were stained with methylene blue before counting. (C) Statistical analysis of the surviving fraction in (B). The data are presentedas the mean § SD based on 3 independent experiments. ��p < 0.01. (D) Cells overexpressing FLAG-ATG3-WT or FLAG-ATGY203F cells were injected into the NOD-SCIDmice, and the tumors were detected 3 weeks later (4 mice per group). (E) Tumors were weighed and analyzed. �p < 0.05. (F) HCT116 cells were pre-incubated with PF-573228, SRC Inhibitor-1 or erlotinib for 1 h and then treated with or without etoposide (40 mM) for 3 h. Cell proliferation was tested with the WST-1 assay, and the dataare presented as the mean § SD. Student t test was performed by comparing drug-treated cells versus untreated cells. �p < 0.05; ��p < 0.01. (G) HCT116 cells were pre-incubated with PF-573228, SRC Inhibitor-1 or erlotinib for 1 h and then treated with or without etoposide or cisplatin. Then, the cells were treated as described in (B). (H)Statistical analysis of the surviving fraction in (G). The data are presented as the mean § SD based on 3 independent experiments. ��p < 0.01. (I) Western blotting wasperformed to detect the endogenous PTK2 level in stable PTK2 knockdown and negative control cell lines. (J) PTK2 stable-knockdown HCT116 cells and WT-HCT116 cellswere treated with or without etoposide or cisplatin. Then, the drug was removed and the colonies were counted after 2 wk. (K) Quantification of the surviving fraction in(J). The data are presented as the mean § SD based on 3 independent experiments. ��p < 0.01.

586 K. MA ET AL.

of BAG3 activity, leading to enhanced DNA damage-inducedmitotic catastrophe.

Accumulating evidence suggests that PTK2 can promotecancer cell proliferation, motility, and survival.21 These multi-ple functions of PTK2 work through kinase-dependent orkinase-independent mechanisms. As a protein tyrosine kinase,PTK2 can activate the phosphoinositide 3-kinase-AKT1 path-way by binding with the PIK3R/p85 subunit of phosphoinosi-tide 3-kinase60 to induce survival signals and prevent cancercell death.31,61,62 Targeting of PTK2 in endothelial cells is suffi-cient to induce tumor cell sensitization to DNA-damaging ther-apies by downregulating the NFKB pathway.22 Additionally, arecent study showed that some ATG proteins can colocalizewith PTK2 and PXN.63 Consistently, our data showed that inresponse to treatment with DNA-damaging agents, PTK2-induced ATG3 phosphorylation led to its degradation. Further-more, PTK2 inhibition combined with DNA-damaging drugsinduced sustained levels of ATG3, leading to a significantdecrease in cell viability.

Previous studies have shown that PTK2 is overexpressedand activated in several advanced-stage solid cancers.20,64,65

As a promising target for cancer therapy, some specific smallmolecule inhibitors (PTK2-Is) are being evaluated in clinicaltrials.23-27 In addition, several studies have shown that com-bination regimens may be more effective for cancer ther-apy.27,66,67 For example, PTK2 inhibition combined withirradiation can improve the radio-sensitivity of radio-resis-tant cancer stem cells via the WNT signaling pathway.68

PTK2 knockout in endothelial cells can enhance the effectsof DNA-damaging cancer therapy.22 Y15, a small moleculePTK2 inhibitor, can inhibit cell growth in vitro and in vivoand enhance the efficacy of chemotherapy.27 Consistent withprevious reports, we demonstrated that sustained levels ofATG3 induced by PTK2 inhibition can sensitize cancer cellsto DNA-damaging reagents both in vitro and in vivo. Wealso found that among several tyrosine kinase inhibitors, thePTK2 inhibitor had a much stronger effect on cancer cellcolony formation when combined with DNA-damagingagents in this study. Although the specific mechanism of thetumor suppression function of ATG3 is not clear, targetingPTK2 combined with chemotherapeutic agents may be a use-ful strategy for the development of novel cancer therapies inthe future.

In conclusion, our results showed that ATG3 is phosphory-lated and degraded in response to cancer chemotherapeuticagents in a PTK2-dependent manner. Sustained levels of ATG3after a combination regimen result in a significant decrease incell viability in cancer cells through a mitotic catastrophe-dependent manner. Further studies exploring the mechanismof PTK2 inhibitors in combinatorial therapies will help us pro-mote the rational use of chemotherapy drugs.

Methods

Reagents

Etoposide (E1383), cisplatin (P4394), chloroquine (C6628), PF-573228 (PZ0117), SRC Inhibitor-1 (S2075), doxycycline(D9891) and Anti-FLAG M2 beads (A2220) were purchased

from Sigma-Aldrich; erlotinib (S1023) was purchased fromSelleck Chemicals; MG132 (474790) was purchased fromMerck; and Tet System Approved fetal bovine serum (631106)was purchased from Clontech.

Antibodies

Antibodies to ATG3 (M133–3), ATG10 (M151–3) andTUBA (PM054) were from MBL; ATG5 (2630), phospho-tyrosine (9416), acetylated-lysine (9441), phospho-PTK2(Tyr576/577; 3281), phospho-SRC (Tyr416; 6943), andMAP1LC3 (2775) were purchased from Cell Signaling Tech-nology; ATG7 (sc-33211), ACTB (sc-7210), and HA-probe(sc-7392) were purchased from Santa Cruz BiotechnologyInc.; phospho-serine (ab9332) and phospho-EGFR (Tyr1068;1138–1) were purchased from Abcam; PTK2 (BS3583) waspurchased from Bioworld Technology, Inc.; and BAG3(10599–1-AP) was purchased from Proteintech Group Inc.

Plasmids

Based on the obtained DNA sequence of the murine Atg3homolog, we amplified an open-reading frame of the murineAtg3 cDNA by high-fidelity PCR, cloned the fragment into thep3XFLAG-CMV-10 (Sigma-Aldrich, E4401), pcDNA3.1-MYC-his (Invitrogen, V855–20) or pTRIPZ (Thermo FisherScientific, RHS4750) vectors, and designated the resultant plas-mids as the FLAG-ATG3, MYC-his-ATG3 and pTRIPZ-ATG3plasmids. ATG3Y203E- and ATG3Y203F-encoding plasmids weregenerated with a site-directed mutagenesis kit (Agilent Tech-nologies, 200523).

Cell culture and transfection

HCT116 (CCL¡247) and LoVo (CCL¡229) cell lines werepurchased from the American Type Culture Collection andgrown in McCoy’s 5A medium (Macgene, CM10050) orDMEM (Macgene, CM15019) supplemented with 10% fetalbovine serum in a 37�C incubator with a humidified, 5% CO2

atmosphere. Atg3 knockout MEF cells were kindly providedby Dr. M. Komatsu (Niigata University) and grown inDMEM supplemented with 10% fetal bovine serum and 1Xnon-essential amino-acid (Macgene, CC25025) in 5% CO2 at37�C. DR-GFP-U2OS and EJ5-GFP-HEK293 stable cell lineswere from Dr. Xingzhi Xu (Shenzhen University Health Sci-ence Center), and grown in DMEM. For transfecting cancercell lines, Lipofectamine 2000 (Invitrogen, 11668–027) wasused following the manufacturer’s instructions, while theNeon transfection system (Invitrogen, MPK5000) was usedfor transfection of MEF cells.

Establishment of ATG3-inducible MEF cell lines

The ATG3-inducible cell line was generated using the pTRIPZ-ATG3 WT, Y203E and Y203F plasmids. Plasmids were trans-fected into Atg3 knockout MEF cells, and the stable cell linewas established by selection with 4 mg/ml puromycin (Sigma-Aldrich, P8833).

AUTOPHAGY 587

Generation of Cas9 ATG3 knockout and PTK2 knockdowncell lines

The Cas9 ATG3 knockout cell lines were generated usingCRISPR–Cas9 methods in HCT116 cells. We used the SpCas9–2A-Puro vector purchased from Addgene (#48139; depositedby Feng Zhang).69 The ATG3 gRNA was designed by onlinesoftware (http://crispr.mit.edu), and the gRNA sequence ofATG3 was 50-GTGAAGGCATACCTACCAAC-30. The plas-mids were transfected into HCT116 cells and selected with2.5 mg/ml puromycin. The stable PTK2 knockdown cell lineswere established by a PTK2-specific RNAi plasmid. The non-specific or shPTK2 plasmids were transfected into HCT116cells and selected using 500 mg/ml hygromycin B (Roche,10843555001).

Immunoblot analysis

Equal amounts of proteins were size-fractionated by 7.5–15%SDS-PAGE. For immunoprecipitation, cells were harvestedand then lysed in a Nonidet P40 buffer (1% Nonidet P40[Amersco, E109], 150 mM NaCl, 50 mM Tris at pH 7.5, and5 mM EDTA) supplemented with complete protease inhibi-tor cocktail (Roche, 5892791001) and phosphatase inhibitorcocktail (Applygen, P1260). Whole-cell lysate proteins wereused for immunoprecipitation with the indicated antibodies.Generally, 2 mg of antibody was added to 1 ml of cell lysate,which was incubated at 4�C for 8 to 12 h. After the additionof protein G-agarose beads (GE Healthcare, 17–0618–01),the incubation was continued for 2 h. Immunoprecipitateswere extensively washed with lysis buffer and eluted withSDS loading buffer by boiling for 5 min. All bands of blotswere scanned with a phosphorimager, and the relative inten-sity of each band was normalized to each band of ACTB.The data collected came from at least 3 independentexperiments.

Real-time PCR analysis of mRNA

Total RNA was isolated with TRIzol reagent (Invitrogen,15596026). The cDNA was synthesized from 2 mg of RNAby using the Quantscript RT Kit (TianGen, KR103). Theprimer sequences of ATG3 and ACTB for RT-PCR were asfollows: ATG3, GATGGCGGATGGGTAGATACA,TCTTCACATAGTGCTGAGCAATC; ACTB, CCAACCGC-GAGAAGATGA, CCAGAGGCGTACAGGGATAG.

Immunofluorescence analysis

Cells were cultured on confocal dishes to approximately 60% con-fluence. After transfection and treatment, cells were fixed with 4%paraformaldehyde and permeabilized with methanol. The disheswere incubated with blocking solution (0.8% BSA [Amresco, 0332]in phosphate-buffered saline [Macgene, CC008]) and exposedovernight to a primary antibody (1:100 dilution for all antibodies)at 4�C. After being washed 3 times with blocking solution, thedishes were exposed to a secondary antibody (1:100 dilution) andconjugated to FITC-TRITC (fluorescein isothiocyanate-tetra-methyl rhodamine isothiocyanate; ZSGB-Bio, ZF-0312). The cells

were observed and documented under a confocal microscope(Olympus BX-51, America Inc.).

Colony formation assay

Cells were plated and exposed to 40mM etoposide for 3 h.Then, etoposide was removed by washing 3 times. Cells weretrypsinized and plated into 60-mm plates. After 2 wk, methanolfixation and staining with methylene blue was undertaken toidentify visible colonies. Plating efficiencies were calculated asfollows: number of colonies formed/number of cells plated.Surviving fractions were calculated as follows: number of colo-nies formed/number of cells plated (treated) x plating efficiency(untreated).

WST-1 assay

Equal numbers of cells (approximately 5000/well) were seededinto a 96-well plate 24 h before experimentation. Cells weretreated with etoposide separately or combined with differenttyrosine kinase inhibitors. After treatment, WST-1 (Dojindo,S311) was added into the 96-well plate. The absorbance of eachsample was read at 450 nm.

DR-GFP assay and EJ5-GFP assay

DR-U2OS and EJ5-HEK293 cells were plated in 6-well platesand transfected with plasmids encoding FLAG-ATG3 WT orATG3Y203F. The cells were then transfected with the pCBASceplasmid (encoding I-SceI enzyme; Addgene, #26477; depositedby Maria Jasin). After 48 h, the percentage of GFPC cells perwell was determined by FACS.

Disclosure of potential conflicts of interest

No potential conflicts of interest were disclosed.

Acknowledgment

We thank Dr. Masaaki Komatsu for providing Atg3 knockout MEF cells.

Funding

This study was supported by National Natural Science Foundation ofChina (31570812, 81222028, 81321003, 81472581, 81530074,81672712,91319302 and 31261140372); Discipline Construction Fundingof Shenzhen (2016), and grants (JCYJ20160427104855100) from ShenzhenMunicipal Commission of Science and Technology Innovation.

References

[1] Kroemer G, Marino G, Levine B. Autophagy and the integrated stressresponse. Mol Cell 2010; 40:280-93; PMID:20965422; http://dx.doi.org/10.1016/j.molcel.2010.09.023

[2] Kaur J, Debnath J. Autophagy at the crossroads of catabolism andanabolism. Nature reviews Molecular cell biology 2015; 16:461-72;PMID:26177004; http://dx.doi.org/10.1038/nrm4024

[3] Efeyan A, Comb WC, Sabatini DM. Nutrient-sensing mechanismsand pathways. Nature 2015; 517:302-10; PMID:25592535; http://dx.doi.org/10.1038/nature14190

588 K. MA ET AL.

[4] Zhao Y, Yang J, Liao W, Liu X, Zhang H, Wang S, Wang D, Feng J,Yu L, Zhu WG. Cytosolic FoxO1 is essential for the induction ofautophagy and tumour suppressor activity. Nature cell biology 2010;12:665-75; PMID:20543840; http://dx.doi.org/10.1038/ncb2069

[5] Zhao Y, Li X, Cai MY, Ma K, Yang J, Zhou J, Fu W, Wei FZ, Wang L,Xie D, et al. XBP-1u suppresses autophagy by promoting the degra-dation of FoxO1 in cancer cells. Cell research 2013; 23:491-507;PMID:23277279; http://dx.doi.org/10.1038/cr.2013.2

[6] He C, Klionsky DJ. Regulation mechanisms and signaling pathwaysof autophagy. Annu Rev Genet 2009; 43:67-93; PMID:19653858;http://dx.doi.org/10.1146/annurev-genet-102808-114910

[7] Navone F, Genevini P, Borgese N. Autophagy and Neurodegenera-tion: Insights from a Cultured Cell Model of ALS. Cells 2015; 4:354-86; PMID:26287246; http://dx.doi.org/10.3390/cells4030354

[8] Mizushima N, Yoshimori T, Ohsumi Y. The role of Atg proteins inautophagosome formation. Annu Rev Cell Dev Biol 2011; 27:107-32;PMID:21801009; http://dx.doi.org/10.1146/annurev-cellbio-092910-154005

[9] Wirawan E, Lippens S, Vanden Berghe T, Romagnoli A, Fimia GM,Piacentini M, Vandenabeele P. Beclin1: a role in membrane dynam-ics and beyond. Autophagy 2012; 8:6-17; PMID:22170155; http://dx.doi.org/10.4161/auto.8.1.16645

[10] Bestebroer J, V’Kovski P, Mauthe M, Reggiori F. Hidden behindautophagy: the unconventional roles of ATG proteins. Traffic 2013;14:1029-41; PMID:23837619; http://dx.doi.org/10.1111/tra.12091

[11] Lee J, Kim HR, Quinley C, Kim J, Gonzalez-Navajas J, Xavier R, RazE. Autophagy suppresses interleukin-1beta (IL-1beta) signaling byactivation of p62 degradation via lysosomal and proteasomal path-ways. J Biol Chem 2012; 287:4033-40; PMID:22167182; http://dx.doi.org/10.1074/jbc.M111.280065

[12] Fremont S, Gerard A, Galloux M, Janvier K, Karess RE, Berlioz-Tor-rent C. Beclin-1 is required for chromosome congression and properouter kinetochore assembly. EMBO Rep 2013; 14:364-72;PMID:23478334; http://dx.doi.org/10.1038/embor.2013.23

[13] Hwang S, Maloney NS, Bruinsma MW, Goel G, Duan E, Zhang L,Shrestha B, Diamond MS, Dani A, Sosnovtsev SV, et al. Nondegrada-tive role of Atg5-Atg12/ Atg16L1 autophagy protein complex in anti-viral activity of interferon gamma. Cell host & microbe 2012; 11:397-409; http://dx.doi.org/10.1016/j.chom.2012.03.002

[14] Ichimura Y, Kirisako T, Takao T, Satomi Y, Shimonishi Y, IshiharaN, Mizushima N, Tanida I, Kominami E, Ohsumi M, et al. A ubiqui-tin-like system mediates protein lipidation. Nature 2000; 408:488-92;PMID:11100732; http://dx.doi.org/10.1038/35044114

[15] Tanida I, Tanida-Miyake E, Komatsu M, Ueno T, Kominami E.Human Apg3p/Aut1p homologue is an authentic E2 enzyme for multi-ple substrates, GATE-16, GABARAP, and MAP-LC3, and facilitatesthe conjugation of hApg12p to hApg5p. J Biol Chem 2002; 277:13739-44; PMID:11825910; http://dx.doi.org/10.1074/jbc.M200385200

[16] Radoshevich L, Murrow L, Chen N, Fernandez E, Roy S, Fung C,Debnath J. ATG12 conjugation to ATG3 regulates mitochondrialhomeostasis and cell death. Cell 2010; 142:590-600; PMID:20723759;http://dx.doi.org/10.1016/j.cell.2010.07.018

[17] Metlagel Z, Otomo C, Takaesu G, Otomo T. Structural basis ofATG3 recognition by the autophagic ubiquitin-like protein ATG12.Proceedings of the National Academy of Sciences of the UnitedStates of America 2013; 110:18844-9; PMID:24191030; http://dx.doi.org/10.1073/pnas.1314755110

[18] Moloughney JG, Monken CE, Tao H, Zhang H, Thomas JD, LattimeEC, Jin S. Vaccinia virus leads to ATG12-ATG3 conjugation anddeficiency in autophagosome formation. Autophagy 2011; 7:1434-47;PMID:22024753; http://dx.doi.org/10.4161/auto.7.12.17793

[19] Sou YS, Waguri S, Iwata J, Ueno T, Fujimura T, Hara T, Sawada N,Yamada A, Mizushima N, Uchiyama Y, et al. The Atg8 conjugationsystem is indispensable for proper development of autophagic isola-tion membranes in mice. Molecular biology of the cell 2008;19:4762-75; PMID:18768753; http://dx.doi.org/10.1091/mbc.E08-03-0309

[20] Sulzmaier FJ, Jean C, Schlaepfer DD. FAK in cancer: mechanisticfindings and clinical applications. Nature reviews Cancer 2014;14:598-610; PMID:25098269; http://dx.doi.org/10.1038/nrc3792

[21] Zhang J, Hochwald SN. The role of FAK in tumor metabolism andtherapy. Pharmacol Ther 2014; 142:154-63; PMID:24333503; http://dx.doi.org/10.1016/j.pharmthera.2013.12.003

[22] Tavora B, Reynolds LE, Batista S, Demircioglu F, Fernandez I, Lech-ertier T, Lees DM, Wong PP, Alexopoulou A, Elia G, et al. Endothe-lial-cell FAK targeting sensitizes tumours to DNA-damagingtherapy. Nature 2014; 514:112-6; PMID:25079333; http://dx.doi.org/10.1038/nature13541

[23] Schwock J, Dhani N, Hedley DW. Targeting focal adhesion kinasesignaling in tumor growth and metastasis. Expert Opin Ther Targets2010; 14:77-94; PMID:20001212; http://dx.doi.org/10.1517/14728220903460340

[24] Infante JR, Camidge DR, Mileshkin LR, Chen EX, Hicks RJ, RischinD, Fingert H, Pierce KJ, Xu H, Roberts WG, et al. Safety, pharmaco-kinetic, and pharmacodynamic phase I dose-escalation trial of PF-00562271, an inhibitor of focal adhesion kinase, in advanced solidtumors. J Clin Oncol 2012; 30:1527-33; PMID:22454420; http://dx.doi.org/10.1200/JCO.2011.38.9346

[25] Lee BY, Timpson P, Horvath LG, Daly RJ. FAK signaling inhuman cancer as a target for therapeutics. Pharmacology & ther-apeutics 2015; 146:132-49; http://dx.doi.org/10.1016/j.pharmthera.2014.10.001

[26] Shanthi E, Krishna MH, Arunesh GM, Venkateswara Reddy K, Soor-iya Kumar J, Viswanadhan VN. Focal adhesion kinase inhibitors inthe treatment of metastatic cancer: a patent review. Expert opinionon therapeutic patents 2014; 24:1077-100; PMID:25113248; http://dx.doi.org/10.1517/13543776.2014.948845

[27] Heffler M, Golubovskaya VM, Dunn KM, Cance W. Focal adhe-sion kinase autophosphorylation inhibition decreases colon can-cer cell growth and enhances the efficacy of chemotherapy.Cancer biology & therapy 2013; 14:761-72; http://dx.doi.org/10.4161/cbt.25185

[28] Lu H, Wang L, Gao W, Meng J, Dai B, Wu S, Minna J, Roth JA, Hof-stetter WL, Swisher SG, et al. IGFBP2/FAK pathway is causally asso-ciated with dasatinib resistance in non-small cell lung cancer cells.Molecular cancer therapeutics 2013; 12:2864-73; PMID:24130049;http://dx.doi.org/10.1158/1535-7163.MCT-13-0233

[29] Bagi CM, Christensen J, Cohen DP, Roberts WG, Wilkie D, SwansonT, Tuthill T, Andresen CJ. Sunitinib and PF-562,271 (FAK/Pyk2inhibitor) effectively block growth and recovery of human hepatocel-lular carcinoma in a rat xenograft model. Cancer biology & therapy2009; 8:856-65; http://dx.doi.org/10.4161/cbt.8.9.8246

[30] Halder J, Lin YG, Merritt WM, Spannuth WA, Nick AM, Honda T,Kamat AA, Han LY, Kim TJ, Lu C, et al. Therapeutic efficacy of anovel focal adhesion kinase inhibitor TAE226 in ovarian carcinoma.Cancer research 2007; 67:10976-83; PMID:18006843; http://dx.doi.org/10.1158/0008-5472.CAN-07-2667

[31] Kang Y, Hu W, Ivan C, Dalton HJ, Miyake T, Pecot CV, Zand B, LiuT, Huang J, Jennings NB, et al. Role of focal adhesion kinase in regu-lating YB-1-mediated paclitaxel resistance in ovarian cancer. Journalof the National Cancer Institute 2013; 105:1485-95; PMID:24062525;http://dx.doi.org/10.1093/jnci/djt210

[32] Maskey D, Yousefi S, Schmid I, Zlobec I, Perren A, Friis R, SimonHU. ATG5 is induced by DNA-damaging agents and promotesmitotic catastrophe independent of autophagy. Nature communica-tions 2013; 4:2130. PMID:23945651; http://dx.doi.org/10.1038/ncomms3130

[33] Wang Y, Zhang N, Zhang L, Li R, Fu W, Ma K, Li X, Wang L, WangJ, Zhang H, et al. Autophagy Regulates Chromatin Ubiquitination inDNA Damage Response through Elimination of SQSTM1/p62.Molecular cell 2016; 63:34-48; PMID:27345151; http://dx.doi.org/10.1016/j.molcel.2016.05.027

[34] Liu C, He W, Jin M, Li H, Xu H, Liu H, Yang K, Zhang T, Wu G, RenJ. Blockage of Autophagy in C6 Glioma Cells Enhanced Radiosensi-tivity Possibly by Attenuating DNA-PK-Dependent DSB Due toLimited Ku Nuclear Translocation and DNA Binding. Currentmolecular medicine 2015; 15:663-73; PMID:26321753; http://dx.doi.org/10.2174/1566524015666150831141112

[35] Zhang D, Tang B, Xie X, Xiao YF, Yang SM, Zhang JW. The inter-play between DNA repair and autophagy in cancer therapy. Cancer

AUTOPHAGY 589

biology & therapy 2015; 16:1005-13; http://dx.doi.org/10.1080/15384047.2015.1046022

[36] Mo N, Lu YK, Xie WM, Liu Y, Zhou WX, Wang HX, Nong L, Jia YX,Tan AH, Chen Y, et al. Inhibition of autophagy enhances the radio-sensitivity of nasopharyngeal carcinoma by reducing Rad51 expres-sion. Oncol Rep 2014; 32:1905-12; PMID:25175062

[37] Sancar A, Lindsey-Boltz LA, Unsal-Kacmaz K, Linn S. Molecularmechanisms of mammalian DNA repair and the DNA damagecheckpoints. Annu Rev Biochem 2004; 73:39-85; PMID:15189136;http://dx.doi.org/10.1146/annurev.biochem.73.011303.073723

[38] Yoo BH, Zagryazhskaya A, Li Y, Koomson A, Khan IA, Sasazuki T,Shirasawa S, K VR. Upregulation of ATG3 contributes to autophagyinduced by the detachment of intestinal epithelial cells from theextracellular matrix, but promotes autophagy-independent apoptosisof the attached cells. Autophagy 2015; 11:1230-46; PMID:26061804;http://dx.doi.org/10.1080/15548627.2015.1056968

[39] Eom YW, Kim MA, Park SS, Goo MJ, Kwon HJ, Sohn S, Kim WH,Yoon G, Choi KS. Two distinct modes of cell death induced by doxo-rubicin: apoptosis and cell death through mitotic catastrophe accom-panied by senescence-like phenotype. Oncogene 2005; 24:4765-77;PMID:15870702; http://dx.doi.org/10.1038/sj.onc.1208627

[40] Huang X, Tran T, Zhang L, Hatcher R, Zhang P. DNA damage-induced mitotic catastrophe is mediated by the Chk1-dependentmitotic exit DNA damage checkpoint. Proceedings of the NationalAcademy of Sciences of the United States of America 2005;102:1065-70; PMID:15650047; http://dx.doi.org/10.1073/pnas.0409130102

[41] Chen Y, Yang LN, Cheng L, Tu S, Guo SJ, Le HY, Xiong Q, Mo R, LiCY, Jeong JS, et al. Bcl2-associated athanogene 3 interactome analysisreveals a new role in modulating proteasome activity. Molecular &cellular proteomics : MCP 2013; 12:2804-19; http://dx.doi.org/10.1074/mcp.M112.025882

[42] Fuchs M, Luthold C, Guilbert SM, Varlet AA, Lambert H, Jette A,Elowe S, Landry J, Lavoie JN. A Role for the Chaperone ComplexBAG3-HSPB8 in Actin Dynamics, Spindle Orientation and ProperChromosome Segregation during Mitosis. PLoS genetics 2015; 11:e1005582. PMID:26496431; http://dx.doi.org/10.1371/journal.pgen.1005582

[43] Jiao H, Su GQ, Dong W, Zhang L, Xie W, Yao LM, Chen P, WangZX, Liou YC, You H. Chaperone-like protein p32 regulates ULK1stability and autophagy. Cell death and differentiation 2015.

[44] Kuang E, Okumura CY, Sheffy-Levin S, Varsano T, Shu VC, Qi J,Niesman IR, Yang HJ, Lopez-Otin C, Yang WY, et al. Regulation ofATG4B stability by RNF5 limits basal levels of autophagy and influ-ences susceptibility to bacterial infection. PLoS genetics 2012; 8:e1003007. PMID:23093945; http://dx.doi.org/10.1371/journal.pgen.1003007

[45] Haller M, Hock AK, Giampazolias E, Oberst A, Green DR, DebnathJ, Ryan KM, Vousden KH, Tait SW. Ubiquitination and proteasomaldegradation of ATG12 regulates its proapoptotic activity. Autophagy2014; 10:2269-78; PMID:25629932; http://dx.doi.org/10.4161/15548627.2014.981914

[46] Platta HW, Abrahamsen H, Thoresen SB, Stenmark H. Nedd4-dependent lysine-11-linked polyubiquitination of the tumour sup-pressor Beclin 1. The Biochemical journal 2012; 441:399-406;PMID:21936852; http://dx.doi.org/10.1042/BJ20111424

[47] Zhang T, Dong K, Liang W, Xu D, Xia H, Geng J, Najafov A, Liu M,Li Y, Han X, et al. G-protein-coupled receptors regulate autophagyby ZBTB16-mediated ubiquitination and proteasomal degradation ofAtg14L. eLife 2015; 4:e06734. PMID:25821988

[48] Li J, Qi W, Chen G, Feng D, Liu J, Ma B, Zhou C, Mu C, Zhang W,Chen Q, et al. Mitochondrial outer-membrane E3 ligase MUL1 ubiq-uitinates ULK1 and regulates selenite-induced mitophagy. Auto-phagy 2015; 11:1216-29; PMID:26018823; http://dx.doi.org/10.1080/15548627.2015.1017180

[49] Wang Y, Wang XD, Lapi E, Sullivan A, Jia W, He YW, Ratnayaka I,Zhong S, Goldin RD, Goemans CG, et al. Autophagic activity dictatesthe cellular response to oncogenic RAS. Proceedings of the NationalAcademy of Sciences of the United States of America 2012;

109:13325-30; PMID:22847423; http://dx.doi.org/10.1073/pnas.1120193109

[50] Wagner SA, Beli P, Weinert BT, Scholz C, Kelstrup CD, Young C,Nielsen ML, Olsen JV, Brakebusch C, Choudhary C. Proteomic anal-yses reveal divergent ubiquitylation site patterns in murine tissues.Molecular & cellular proteomics : MCP 2012; 11:1578-85; http://dx.doi.org/10.1074/mcp.M112.017905

[51] Kim W, Bennett EJ, Huttlin EL, Guo A, Li J, Possemato A, Sowa ME,Rad R, Rush J, Comb MJ, et al. Systematic and quantitative assess-ment of the ubiquitin-modified proteome. Molecular cell 2011;44:325-40; PMID:21906983; http://dx.doi.org/10.1016/j.molcel.2011.08.025

[52] Mizushima N. Autophagy in protein and organelle turnover. ColdSpring Harbor symposia on quantitative biology 2011; 76:397-402;PMID:21813637; http://dx.doi.org/10.1101/sqb.2011.76.011023

[53] Mizushima N, Komatsu M. Autophagy: renovation of cells and tis-sues. Cell 2011; 147:728-41; PMID:22078875; http://dx.doi.org/10.1016/j.cell.2011.10.026

[54] Green DR, Levine B. To be or not to be? How selective autophagyand cell death govern cell fate. Cell 2014; 157:65-75;PMID:24679527; http://dx.doi.org/10.1016/j.cell.2014.02.049

[55] Holohan C, Van Schaeybroeck S, Longley DB, Johnston PG. Cancerdrug resistance: an evolving paradigm. Nature reviews Cancer 2013;13:714-26; PMID:24060863; http://dx.doi.org/10.1038/nrc3599

[56] Vessoni AT, Filippi-Chiela EC, Menck CF, Lenz G. Autophagy andgenomic integrity. Cell death and differentiation 2013; 20:1444-54;PMID:23933813; http://dx.doi.org/10.1038/cdd.2013.103

[57] Hosokawa N, Hara Y, Mizushima N. Generation of cell lines withtetracycline-regulated autophagy and a role for autophagy in control-ling cell size. FEBS letters 2006; 580:2623-9; PMID:16647067; http://dx.doi.org/10.1016/j.febslet.2006.04.008

[58] Choi J, Park S, Biering SB, Selleck E, Liu CY, Zhang X, Fujita N,Saitoh T, Akira S, Yoshimori T, et al. The parasitophorous vacu-ole membrane of Toxoplasma gondii is targeted for disruptionby ubiquitin-like conjugation systems of autophagy. Immunity2014; 40:924-35; PMID:24931121; http://dx.doi.org/10.1016/j.immuni.2014.05.006

[59] Rosati A, Graziano V, De Laurenzi V, Pascale M, Turco MC. BAG3:a multifaceted protein that regulates major cell pathways. Cell DeathDis 2011; 2:e141. PMID:21472004; http://dx.doi.org/10.1038/cddis.2011.24

[60] Reiske HR, Kao SC, Cary LA, Guan JL, Lai JF, Chen HC. Require-ment of phosphatidylinositol 3-kinase in focal adhesion kinase-pro-moted cell migration. J Biol Chem 1999; 274:12361-6;PMID:10212207; http://dx.doi.org/10.1074/jbc.274.18.12361

[61] Lane D, Goncharenko-Khaider N, Rancourt C, Piche A. Ovariancancer ascites protects from TRAIL-induced cell death throughalphavbeta5 integrin-mediated focal adhesion kinase and Akt activa-tion. Oncogene 2010; 29:3519-31; PMID:20400979; http://dx.doi.org/10.1038/onc.2010.107

[62] Zheng Y, Gierut J, Wang Z, Miao J, Asara JM, Tyner AL. Proteintyrosine kinase 6 protects cells from anoikis by directly phos-phorylating focal adhesion kinase and activating AKT. Oncogene2013; 32:4304-12; PMID:23027128; http://dx.doi.org/10.1038/onc.2012.427

[63] Sandilands E, Serrels B, McEwan DG, Morton JP, Macagno JP,McLeod K, Stevens C, Brunton VG, Langdon WY, Vidal M, et al.Autophagic targeting of Src promotes cancer cell survival followingreduced FAK signalling. Nature cell biology 2012; 14:51-60; http://dx.doi.org/10.1038/ncb2386

[64] Canel M, Secades P, Rodrigo JP, Cabanillas R, Herrero A, Suarez C,Chiara MD. Overexpression of focal adhesion kinase in head andneck squamous cell carcinoma is independent of fak gene copy num-ber. Clinical cancer research : an official journal of the AmericanAssociation for Cancer Research 2006; 12:3272-9; PMID:16740747;http://dx.doi.org/10.1158/1078-0432.CCR-05-1583

[65] Zhao J, Guan JL. Signal transduction by focal adhesion kinase in can-cer. Cancer metastasis reviews 2009; 28:35-49; PMID:19169797;http://dx.doi.org/10.1007/s10555-008-9165-4

590 K. MA ET AL.

[66] Thakur R, Trivedi R, Rastogi N, Singh M, Mishra DP. Inhibition ofSTAT3, FAK and Src mediated signaling reduces cancer stem cell load,tumorigenic potential and metastasis in breast cancer. Scientific reports2015; 5:10194. PMID:25973915; http://dx.doi.org/10.1038/srep10194

[67] Golubovskaya VM, Huang G, Ho B, YemmaM,Morrison CD, Lee J, Eli-ceiri BP, Cance WG. Pharmacologic blockade of FAK autophosphoryla-tion decreases human glioblastoma tumor growth and synergizes withtemozolomide. Molecular cancer therapeutics 2013; 12:162-72;PMID:23243059; http://dx.doi.org/10.1158/1535-7163.MCT-12-0701

[68] Williams KE, Bundred NJ, Landberg G, Clarke RB, Farnie G. Focaladhesion kinase and Wnt signaling regulate human ductal carcinomain situ stem cell activity and response to radiotherapy. Stem cells2015; 33:327-41; PMID:25187396; http://dx.doi.org/10.1002/stem.1843

[69] Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F.Genome engineering using the CRISPR-Cas9 system. Nature pro-tocols 2013; 8:2281-308; PMID:24157548; http://dx.doi.org/10.1038/nprot.2013.143

AUTOPHAGY 591