principles of pathogenesis bacterial infection professor mark pallen university of birmingham

Download Principles of Pathogenesis Bacterial Infection Professor Mark Pallen University of Birmingham

Post on 15-Jan-2016

212 views

Category:

Documents

0 download

Embed Size (px)

TRANSCRIPT

  • Principles of PathogenesisBacterial InfectionProfessor Mark PallenUniversity of Birmingham

  • Microbes and humansVery few microbes arealways pathogenicMany microbes arepotentially pathogenicMost microbes arenever pathogenic

  • Microbes and humansDisease can come about in several overlapping ways1. Some bacteria are entirely adapted to the pathogenic way of life in humans. They are never part of the normal flora but may cause subclinical infection, e.g. M . tuberculosis2. Some bacteria which are part of the normal flora acquire extra virulence factors making them pathogenic, e.g. E. coli3. Some bacteria from the normal flora can cause disease if they gain access to deep tissues by trauma, surgery, lines, especially if associated with a foreign body, e.g. S. epidermidis4. In immunocompromised patients many free-living bacteria and components of the normal flora can cause disease, especially if introduced into deep tissues, e.g. Acinetobacter

  • How do we know that a given pathogen causes a specific disease?Koch's postulatesthe pathogen must be present in every case of the diseasethe pathogen must be isolated from the diseased host & grown in pure culturethe specific disease must be reproduced when a pure culture of the pathogen is inoculated into a healthy susceptible hostthe pathogen must be recoverable from the experimentally infected host

  • Spectrum of virulencepoliomyelitis in a child0.1-1% of infections are clinically apparentrubella50% of infections are clinically apparentrabies100% of infections are clinically apparentThe iceberg concept of infectious diseaseasymptomatic infectionclassical clinical diseaseless severe disease

  • How do we know that a given pathogen causes a specific disease?potential pathogen isolated from or detected in clinical samples Recognised syndromes patient's clinical condition e.g. septicaemia, endocarditis,osteomyelitis meningitis,UTI, pneumoniapharyngitisDiagnosis and effective treatment of infection depends not just on isolating an organism, but in establishing a plausible link between the laboratory findings, recognised syndromes and the patient's clinical condition

  • Microbes and humansEvidence for a potential pathogen being clinical significant (particularly for bacteria)Isolated in abundanceIsolated in pure cultureIsolated on more than one occasionIsolated from deep tissues Evidence of local inflammationEvidence of immune response to pathogenFits with clinical picture

  • Normal floraAll body surfaces possess a rich normal bacterial flora, especially the mouth, nose, gingival crevice, large bowel, skinThis can be a nuisance in thatit can contaminate specimensit can cause diseaseThis is beneficial in thatit can protect against infection by preventing pathogens colonising epithelial surfaces (colonisation resistance)removal of the normal flora with antibiotics can cause superinfection, usually with resistant microbesEndogenous viruses reside in the human genomeworries about similar pig viruses in xenografts

  • Bacterial Virulence A simplistic viewSome bacterial proteins (exotoxins) can elicit the features of a bacterial infection when injected as pure proteins, e.g. tetanus toxin, botulinum toxindiphtheria toxin, anthrax toxinVaccination with inactivated toxins (toxoids) led to a spectacular decline in the incidence of many bacterial infections.Leading to the simplistic idea that all bacteria need to cause disease is a single toxin

  • Bacterial Virulence A more sophisticated viewThere are many different ways to define a virulence factorneeded to colonise and/or damage tissuesMolecular Kochs postulatesDelete gene, show loss of virulence in model system, add gene back (e.g. on plasmid), show restoration of virulenceBiochemical evidence of damaging potentialdistinguishes pathogen from commensalComparative genomicsexpressed or essential in vivobut not in the lab?

  • Bacterial Virulence A more sophisticated viewVirulence as a process isMULTIFACTORIAL A bacterial army, like a human army, needs more than just its firearms to enter and secure enemy territoryAn army marches on its stomach NapoleonMULTIDIMENSIONALA programme of events organised in time and space

  • Steps in successful infectionSex comes before diseaseacquire virulence genesSense environmentand Switch virulence genes on and offSwim to site of infectionStick to site of infection Scavenge nutrientsespecially ironSurvive stressStealthavoid immune systemStrike-back damage host tissuesSubverthost cell cytoskeletal and signalling pathwaysSpread through cells and organsScatter

  • Bacterial Sex acquiring virulence genesBacteria have three ways of exchanging DNATransformation cells take up naked DNATransduction phages carry DNAConjugationcells mate through specialised appendages

  • Bacterial Sex Mobile genetic elementsTransposonsST enterotoxin genesVirulence Plasmidse.g. TTSSs in Shigella, Yersinia; toxins in Salmonella, E. coli, anthraxPhage-encoded virulencee.g. botulinum toxins, diphtheria toxin, shiga-like toxin (linked to lysis), staphylococcal toxins, TTSS substrates in Salmonella.

  • Bacterial Sex Pathogenicity IslandsConcept originated from study of uropathogenic E. coli strains Defining Features Carriage of (many) virulence genesPresence in pathogenic versus non-pathogenic strainsDifferent G+C content from host chromosomeOccupy large chromosomal regions (10-100 Kb)Compact distinct genetic units, often flanked by DRs, tRNAs, ISsPresence of (cryptic) mobility genesUnstable, prone to deletion

  • Bacterial Sex Pathogenicity Islandsoften encode secretion systemsLEE region in EPECSpi1, Spi2 in SalmonellaCag in H. pylorican also encode adhesins, siderophores, toxins Uropathogenic E. coli (Pai I, II, IV, V)Yersinia spp. (HPI)V. cholerae (VPI or TCP-ACF element)

  • Sense environmentBacteria can sense changes in environment e.g. in temperature, nutrient availability, osmolarity, cell density (quorum sensing).In simplest cases, change in intracellular concentration of ion linked directly to gene expressione.g. fall in intra-cellular iron levels triggers de-repression of diphtheria toxin gene In more complex cases, sophisticated signal transduction cascades allow bacteria to regulate gene expression in response to environmental cuesthe pathogen as an information processor

  • Switch virulence factors on and offA multi-layered hierarchyChanges in DNA sequenceGene amplificationGenetic rearrangementse.g. Hin flip-flop control of flagellar phase variationTranscriptional RegulationActivators and Repressors(helix-turn-helix motif)mRNA folding and stabilityTranslational RegulationPost-translational RegulationStability of protein, controlled cleavageCovalent modificationse.g. phosphorylation in two-component sensor-regulator systems

  • SwimMany bacterial pathogens are motileEnterics, Campylobacter, Helicobacter, spirochaetesMotility crucial for virulence in some casesUsual organelle of motility=flagellumVariantsTwitching motilitySwarming

  • StickTo avoid physical and immunological removal, bacteria must adhere tocell surfaces and extracellular matrixe.g. in respiratory, gastrointestinal and genitourinary tractssolid surfacese.g. teeth, heart valves, prosthetic materialother bacteriaDirect interactionMolecular bridging via e.g. fibronectinAdherence often combined with manipulation of host cell signalling and cytoskeletonInvasionIntimate adherence

  • StickCommon adherence mechanismsCapsules and slimeBiofilm formationGram-positive adhesinsMSCRAMMs (microbial surface components recognizing adhesive matrix molecules), e.g. protein AFimbriaeGram-negative adhesins (CHO and protein receptors)Fimbriae, Afimbrial adhesins (FHA, Pertactin etc.)Outer Membrane Proteins Types III-IV secretion

  • Stick

  • Scavenge nutrientse.g. ironFree iron levels very low in body fluidsAcute phase response causes further drop Iron overload increases susceptibility to infectionMany different bacterial systems for scavenging ironSiderophores chelate available iron & transport it into bacteriaIron can be scavenged direct from host iron-binding proteins, e.g by lactoferrin-binding proteinsOften co-ordinately regulated e.g. by fur locus in E. coliSome pathogens avoid the problem by cutting out need for iron, e.g. Treponema pallidumIron used to regulate aggressive virulence factorsDiphtheria toxin (DtxR repressor)Shiga-like toxinPseudomonas aeruginosa exotoxin A

  • Survive StressIn addition to nutrient-limitation stress, pathogens face many other stressesAcid stress within stomachHeat shock during feverOxidative stress within phagocytesStress response proteins, such as chaperonins feature as immunodominant antigensDetoxification proteins play a role in virulence, e.g. periplasmic Cu,Zn-superoxide dismutasesInfectious dose for enteric pathogens much lower in achlorhydria (no need to overcome acid stress)

  • Stealthavoid immune systemIgA proteasesmetalloproteases active against IgAImmunoglobulin-binding proteinse.g. protein A of S. aureusResist complement, opsonisation Capsule (usually polysaccharide)LipopolysaccharideSurface proteins and OMPsAntigenic mimicrye.g. sialic acid capsule of group B meningococcus

  • Stealthavoid immune systemAntigenic or phase variationInvolves surface structures such as proteins, LPS, capsulesVariety of mechanismsslip-strand mispairingflip-flopcassettesAdopt cryptic nicheinside phagocytesin biofilm67700 67710 67720GAAGTGCATTTAACTT**GGGGGGGGGGGTAATGAAGTGCATTTAACTT*GGGGGGGGGGGGTAATGAAGTGCATTTAACTTGGGGGGGGGGGGGTAATGAAGTGCATTTAACTT***GGGGGGGGGGTAATGAAGTGCATTTAACTT**GGGGGGGGGGGTAATGAAGTGCATTTAACTT****GGGGGGGGGTAATGAAGTGCATTTAACTT*GGGGGGGGGGGGTAATGAAGTGCATTTAACTT**GGGGGGGGGGGTAATGAAGTGCATTTAACTT***GGGGGGGGGGTAATGAAGTGCATTTAAC

Recommended

View more >