practical exam preparatory period: 30 minutes exam period: 2 hours 4 tasks task 1: prepare a...
DESCRIPTION
Setup a PCR Choose appropriate primers 6 primers: 3 forward and 3 reverse Ex. GGTTGGCCTT AACCGGAACC Setup PCR reaction Choice of primers 1 point PCR amplicon 4 pointsTRANSCRIPT
![Page 1: Practical exam Preparatory period: 30 minutes Exam period: 2 hours 4 tasks Task 1: Prepare a single solution Task 2: Setup a PCR Task 3: Design](https://reader036.vdocuments.mx/reader036/viewer/2022081808/5a4d1b4a7f8b9ab0599a5476/html5/thumbnails/1.jpg)
Practical examPractical exam Preparatory period: 30 minutesPreparatory period: 30 minutes Exam period: 2 hoursExam period: 2 hours 4 tasks4 tasks
Task 1: Prepare a single solutionTask 1: Prepare a single solution Task 2: Setup a PCRTask 2: Setup a PCR Task 3: Design an experiment to Task 3: Design an experiment to
resolve an ambiguous restriction mapresolve an ambiguous restriction map Task 4: Pour and run a gelTask 4: Pour and run a gel
![Page 2: Practical exam Preparatory period: 30 minutes Exam period: 2 hours 4 tasks Task 1: Prepare a single solution Task 2: Setup a PCR Task 3: Design](https://reader036.vdocuments.mx/reader036/viewer/2022081808/5a4d1b4a7f8b9ab0599a5476/html5/thumbnails/2.jpg)
Task 1: Prepare solutionTask 1: Prepare solution Preparation of a solution with Preparation of a solution with
multiple ingredientsmultiple ingredients Evaluation based on absorbance Evaluation based on absorbance
readingreading ± 20% 5 points± 20% 5 points ± 20 - 30% 2.5 points± 20 - 30% 2.5 points ≥ ≥ 30% 0 points30% 0 points
![Page 3: Practical exam Preparatory period: 30 minutes Exam period: 2 hours 4 tasks Task 1: Prepare a single solution Task 2: Setup a PCR Task 3: Design](https://reader036.vdocuments.mx/reader036/viewer/2022081808/5a4d1b4a7f8b9ab0599a5476/html5/thumbnails/3.jpg)
Setup a PCRSetup a PCR Choose appropriate primersChoose appropriate primers
6 primers: 3 forward and 3 reverse6 primers: 3 forward and 3 reverse Ex.Ex. GGTTGGCCTT AACCGGAACCGGTTGGCCTT AACCGGAACC
Setup PCR reactionSetup PCR reaction
Choice of primers 1 pointChoice of primers 1 point PCR amplicon 4 pointsPCR amplicon 4 points
Ingredients Stock Conc. Final Conc. Volume Water Complete to 50µL
Taq PCR buffer 10X 1X Assigned « Forward » primer 2µM 0.2µM
« Reverse » primer 2µM 0.2µM MgCl2 50mM 1.5mM dNTP 2mM 200µM
Template Taq polymerase 5 units/µL 0.05 units/µL
![Page 4: Practical exam Preparatory period: 30 minutes Exam period: 2 hours 4 tasks Task 1: Prepare a single solution Task 2: Setup a PCR Task 3: Design](https://reader036.vdocuments.mx/reader036/viewer/2022081808/5a4d1b4a7f8b9ab0599a5476/html5/thumbnails/4.jpg)
Resolve ambiguous mapResolve ambiguous map
1.0 3.0
3.7 1.03.0 1.0
Experimental design; gel plan: 5 pointsExperimental design; gel plan: 5 points
![Page 5: Practical exam Preparatory period: 30 minutes Exam period: 2 hours 4 tasks Task 1: Prepare a single solution Task 2: Setup a PCR Task 3: Design](https://reader036.vdocuments.mx/reader036/viewer/2022081808/5a4d1b4a7f8b9ab0599a5476/html5/thumbnails/5.jpg)
Pour, load, run gelPour, load, run gel All gels must be loaded and All gels must be loaded and
migration initiated at the latest 15 migration initiated at the latest 15 minutes before the end of the exam minutes before the end of the exam periodperiod
All gels will be stopped 15 minutes All gels will be stopped 15 minutes after the exam periodafter the exam period
Load all samples indicated on gel Load all samples indicated on gel planplan
![Page 6: Practical exam Preparatory period: 30 minutes Exam period: 2 hours 4 tasks Task 1: Prepare a single solution Task 2: Setup a PCR Task 3: Design](https://reader036.vdocuments.mx/reader036/viewer/2022081808/5a4d1b4a7f8b9ab0599a5476/html5/thumbnails/6.jpg)
Final exam – 3 hoursFinal exam – 3 hours 10 bioinfo questions – 10 points10 bioinfo questions – 10 points 5 calculations – 5 points5 calculations – 5 points 1 bonus calculation – 1 point1 bonus calculation – 1 point 5 theoretical questions (MC) – 5 5 theoretical questions (MC) – 5
pointspoints 3 out of 4 problems – 5 points each3 out of 4 problems – 5 points each
5 parts/problem5 parts/problem
![Page 7: Practical exam Preparatory period: 30 minutes Exam period: 2 hours 4 tasks Task 1: Prepare a single solution Task 2: Setup a PCR Task 3: Design](https://reader036.vdocuments.mx/reader036/viewer/2022081808/5a4d1b4a7f8b9ab0599a5476/html5/thumbnails/7.jpg)
DNA fingerprintsDNA fingerprints Determing number of loci
Determine both extremes In this case 8 and 13
Dertermine max and min for each extreme
In the case of 8: max 8, min 4 In the case of 13: max 13, min 7
Determine range 7-8 loci
What is maximum number of homozygous loci if number of bands is 13?