piroplasms in free-ranging bobcats and cougars … · piroplasms in free-ranging bobcats and...
TRANSCRIPT
![Page 1: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/1.jpg)
PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS IN THE UNITED
STATES: DISTRIBUTION, PREVALENCE, AND INTRASPECIFIC VARIATION
by
BARBARA C. SHOCK
(Under the Direction of Michael Yabsley)
ABSTRACT
Cytauxzoon felis, a tick-borne protozoal parasite (family Theileridae), is the causative
agent of cytauxzoonosis in domestic cats in the United States. The parasite was first identified in
domestic cats from Missouri, Texas, and Arkansas in the 1970’s and is now common in the
southeastern and Midwestern US. The bobcat (Lynx rufus) has been identified as the natural
reservoir of C. felis. The overall goal of this project was to better understand the natural history
of C. felis in bobcats and cougars (Puma concolor). Based on PCR testing of >700 wild felids,
infected bobcats were identified in numerous eastern and central states, with higher prevalence
rates being found in states where Amblyomma americanum is present in addition to
Dermancentor variabilis. Sequence analysis of internal transcribed spacer (ITS)-1 and ITS-2
regions revealed extensive genetic variation. Interestingly, one bobcat was infected with a
Babesia sp. which is the first report in a bobcat.
INDEX WORDS: Cytauxzoon felis, Babesia, Lynx rufus, Puma concolor, piroplasm
![Page 2: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/2.jpg)
PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS IN THE UNITED
STATES: DISTRIBUTION, PREVALENCE, AND INTRASPECIFIC VARIATION
by
BARBARA C. SHOCK
B. S., West Virginia University, 2008
A Thesis Submitted to the Graduate Faculty of The University of Georgia in Partial Fulfillment
of the Requirements for the Degree
MASTER OF SCIENCE
ATHENS, GEORGIA
2010
![Page 3: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/3.jpg)
© 2010
Barbara C. Shock
All Rights Reserved
![Page 4: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/4.jpg)
PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS IN THE UNITED
STATES: DISTRIBUTION, PREVALENCE, AND INTRASPECIFIC VARIATION
by
BARBARA C. SHOCK
Major Professor: Michael J. Yabsley
Committee: Fred Quinn David S. Peterson
Electronic Version Approved:
Maureen Grasso Dean of the Graduate School The University of Georgia August 2010
![Page 5: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/5.jpg)
iv
DEDICATION
I would like to dedicate this manuscript to my grandmothers, Betty Fern Weaver
and Jean Shock. Your support and love have been unending.
![Page 6: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/6.jpg)
v
ACKNOWLEDGEMENTS
First I would like to thank Dr. Michael John Yabsley for being my major
professor. I have learned so much in the past two years from you. You are an engaging
and entertaining researcher, and I just hope that I can someday read a paper before you
have already. I look forward to working with you in the future.
My biggest thanks goes to my parents, Mark and Linda Shock for your support
and love. It’s always helpful to call home and have someone tell you they’re proud of
you. I would also like to especially thank my dad for helping me to collect samples for
this project and telling me about SCWDS. Although I have missed my family and friends
from home, they have always shown me the utmost support and love (this means you
Chelsie). I have to give a special thank you to Jenn and Todd Stueckle for first taking me
on in their lab as an undergrad and now for being my friends.
There are so many people at SCWDS that I am grateful to (and for), but I prefer to
thank you in person.
In addition, I’d like to thank numerous personnel from state agencies who
collected felid samples. The studies in this thesis were primarily funded by the Morris
Animal Foundation (DO8FE-003). Additional support was provided by the Federal Aid
to Wildlife Restoration Act (50 Stat. 917) and through sponsorship from fish and wildlife
agencies in Alabama, Arkansas, Florida, Georgia, Kansas, Kentucky, Louisiana,
Maryland, Mississippi, Missouri, North Carolina, Oklahoma, Puerto Rico, South
Carolina, Tennessee, Virginia, and West Virginia.
![Page 7: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/7.jpg)
vi
TABLE OF CONTENTS
Page
ACKNOWLEDGEMENTS .................................................................................................v
LIST OF TABLES ............................................................................................................ vii
LIST OF FIGURES ......................................................................................................... viii
CHAPTER
1 INTRODUCTION and LITERATURE REVIEW ...........................................1
Introduction .................................................................................................1
Literature Review: Tick-borne protozoa of felids ......................................2
Literature Cited .........................................................................................35
2 DISTRIBUTION AND PREVALENCE OF CYTAUXZOON FELIS IN
BOBCATS, LYNX RUFUS, FROM THIRTEEN STATES ........................49
3 EXTENSIVE GENETIC VARIABILITY OF CYTAUXZOON
FELIS FROM BOBCATS (LYNX RUFUS) AND COUGARS
(PUMA CONCOLOR) ..............................................................................65
4 NOVEL BABESIA IN A BOBCAT, GA ........................................................81
5 CONCLUSIONS.............................................................................................87
![Page 8: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/8.jpg)
vii
LIST OF TABLES
Page
Table 2.1: PREVALENCE OF C. FELIS IN BOBCATS .................................................63
![Page 9: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/9.jpg)
viii
LIST OF FIGURES
Page
Figure 1.1: PHYLOGENETIC RELATIONSHIPS BETWEEN GLOBAL SAMPLES
OF CYTAUXZOON FROM FELIDS ...................................................................................4
Figure 1.2: APPROXIMATE DISTRIBUTION OF DERMACENTOR VARIABILIS ......21
Figure 1.3: APPROXIMATE DISTRIBUTION OF AMBLYOMMA AMERICANUM .....21
Figure 2.1: DISTRIBUTION OF C. FELIS IN BOBCATS ..............................................64
![Page 10: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/10.jpg)
1
CHAPTER 1
INTRODUCTION AND LITERATURE REVIEW
INTRODUCTION
Vector-borne pathogens are a significant cause of morbidity and mortality among people
and animals worldwide. Ticks are second only to mosquitoes as vectors of pathogens which
include a wide range of viruses, bacteria, and protozoa as well as some contribution to fungal
infection. Currently, there are three recognized genera of tick-borne protozoans, Theileria,
Cytauxzoon, and Babesia. The three are considered piroplasms because of their signet ring form
in erythrocytes. Babesia is the most numerous of the three and can be found all over the world in
mammals and birds. Theileria and Cytauxzoon are very closely related, and both also have a
global distribution. Infection with the piroplasms causes clinical signs which range from
subclinical parasitemia to mortality, depending on the type and strain of the parasite as well as
the host immune function.
Among felids, only Cytauxzoon and Babesia have been reported. Cytauxzoon felis and
Babesia felis are emerging significant pathogens in the United States and Africa, respectively.
Numerous other infections of felids with Cytauxzoon and Babesia spp. have been reported from
a variety of wild and exotic worldwide, but little work has been done to fully characterize these
parasites. In the United States, the reservoir species for C. felis is the North American bobcat
(Lynx rufus). Bobcats have been documented dying from infection with C. felis, but unlike the
high rates of mortality seen in domestic cats, most infected bobcats are subclinical carriers who
show little to no signs of infection. Due to the high prevalences of C. felis previously reported in
![Page 11: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/11.jpg)
2
bobcats and the general lack of clinical signs, it is assumed that C. felis has been endemic in the
bobcat population for a long time. The overall goal of this project is to better understand the
natural history of C. felis in its wild felid reservoir. This goal had two focuses: quantifying the
distribution and prevalence of C. felis in wild felid populations; and characterizing the strains of
C. felis which are circulating in wild felids.
LITERATURE REVIEW: TICK-BORNE PROTOZOA OF FELIDS
Genera Cytauxzoon and Theileria
Cytauxzoon and Theileria species are two closely related tick-transmitted protozoan
parasites in the phylum Apicomplexa, class Aconoidasida, order Piroplasmorida, and family
Theilieridae (Kocan and Waldrup, 2001). Theileria are found in a wide range of hosts, primarily
ruminants, while Cytauxzoon is restricted to felids (Nijhof et al., 2005). Cytauxzoon are
distinguished from Theileria by the location of schizogony, with the cytauxzoons in felids
replicating in mononuclear phagocytes while theilerias in ungulates replicate in either
lymphocytes or mononuclear phagocytes (Ferris, 1997; Cowell et al., 1988; Preston et al., 1999;
Nijhof et al., 2005). Transmission of Cytauxzoon and Theileria occurs when sporozoites are
transferred to a vertebrate host during tick feeding. Experimental trials indicate transmission
occurs 3-5 days after tick-feeding commences (Hazen-Karr et al., 1987). Within the vertebrate
host, sporozoites first infect endothelial macrophages and undergo merogeny (Kocan et al.,
1992). Merozoites are released within 14 days, which then infect erythrocytes to form
intraerythrocytic piroplasms. These piroplasms are pleomorphic and can be round, oval, bipolar
or rod-shaped and range from 0.3 to 2.0 μm in diameter. Rarely, Maltese crosses and paired
![Page 12: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/12.jpg)
3
piroplasms may be observed (Simpson et al., 1985; Kier et al., 1987; Kocan et al., 1992).
Transmission is completed when infected erythrocytes are ingested by a tick during feeding.
Although not well described, it is believed that sporogony occurs in the tick vector and that the
parasites migrate to the tick salivary glands prior to transmission. Experimental studies have
shown that the parasites are maintained transstadially (Blouin et al., 1984; Blouin et al., 1987;
Kocan et al., 1988).
The genus Cytauxzoon was first described in a gray duiker (Sylvicaprae grimmia) from
South Africa (Nietz and Thomas, 1948). Although numerous Theileria spp. had been described
before, the new genus was proposed because the parasite replicated in mononuclear phagocytes,
which had not been observed at that time in Theileria. The division of these parasites into
separate genera was a source of contention between Levine, who had classified the cytauxzoons
with the theilierias, and Brocklesby, who supported the separate genera based on the distinct cell
lineages used in schizogony (Brocklesby, 1979; Levine et al., 1980). Several other Cytauxzoon
spp. have been reported from African ungulates including: kudu, Tragelaphus strepsiceros;
eland, Taurotraugs oryx; and giraffe, Giraffa camelopardalis; however, these parasites are now
considered to be Theileria spp. (Neitz, 1964; Brocklesby, 1962; McCully et al., 1970; Nijhof et
al., 2005). Clinical morbidity and mortality ascribed to Cytauxzoon spp., but more likely
Theileria spp., has been reported in: tsessebe, Damaliscus lunatus; roan antelope, Hippotragus
equinus; sable antelope, H. niger; and suspected in an impala, Aepyceros melampus (Jardine,
1992; Bigalke, 1989; Wilson et al., 1974; Wilson et al., 1977; Carmichael and Hobday, 1975).
Currently Cytauxzoon spp. have been reported from domestic cats and wild felids in
seven countries including the United States, Brazil, Germany, France, Mongolia, Spain, and
Zimbabwe (Foggin and Roberts, 1982; Ketz-Riley et al., 2003; Mendes-de-Almeida et al., 2004;
![Page 13: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/13.jpg)
4
Reichard et al., 2005; Luaces et al., 2005; Millan et al., 2007; Peixoto et al., 2007; Andre et al.,
2009; Criado-Fornelio et al., 2009). Molecular characterization suggest that multiple species of
Cytauxzoon infect felid species worldwide (Figure 1.1).
FIGURE 1.1. Phylogenetic relationships between global samples of Cytauxzoon from felids.
Sequences obtained from GenBank.
Genus Babesia
Babesia spp. are small piroplasms that have been detected in numerous mammalian hosts,
including several wild felid species. Babesia spp. are in the phylum Apicomplexa, class
Aconoidasida, order Piroplasmorida, and family Babesiidae. Similar to the Theileridae, Babesia
spp. are obligate intraerythrocytic protozoan parasites and are transmitted by Ixodid ticks. They
are distinguished from members of the Theileridae by the absence of tissue schizogenous stage.
Additionally Babesia spp. can also be transmitted transovarially in ticks while Theileridae are
Spain Iberian Lynx EF094469
Spain Iberian Lynx EF094468
France Domestic cat EU622908
Spain Iberian Lynx EF094470
Spain Domestic cat AY309956
Spain Iberian Lynx AY496273
Mongolia Pallas cat AF531418
Mongolia Pallas cat AY485691
Mongolia Pallas cat AY485690
Stabilate 153 (MO) L19080
Texas Domestic cat AY531524
Oklahoma Domestic cat AF399930
Theileria youngi Woodrat AF245279
Babesia sp. cougar DQ329138
100
100 98
10066
86
68
0.01
![Page 14: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/14.jpg)
5
only transstadially transmitted between stages of ticks. Historically, Babesia are divided into two
morphologic groups, the “large” Babesia, which measure more than 2.5 μm, and the “small”
Babesia which measure 1.0 to 2.5 μm in size. Because of morphologic similarity among the large
and small piroplasms, genetic characterization is the best method to identify species (Kocan and
Waldrup, 2001).
A number of Babesia spp. have been recognized in felids from around the world. Large
Babesia include B. herpailuri and B. pantherae from wild felids in Africa and small Babesia
include B. felis and B. leo from domestic cats and other felids in Africa, B. cati in domestic cats
from India, B. canis canis from domestic cats in Spain, B. canis presentii from domestic cats in
Israel; a Babesia sp. from domestic cats in Portugal (called Theileria annae), and a Babesia sp.
from Florida panthers in the United States (Jacobson et al., 2000; Criado-Fornelio et al., 2003;
Penzhorn et al., 2004; Criado-Fornelio et al., 2004; Baneth et al., 2004; Yabsley et al., 2006).
Domestic feline babesiosis is generally a mild chronic disease, although the pathogenicity
depends on the species or sometimes the strain of the parasite (Penzhorn, 2006). The most
common clinical signs include anorexia and lethargy. When disease is present, Babesia spp.
generally cause hemolytic anemia, but most felids do not develop clinical disease unless
presented with a secondary or immunocompromising infection or stressor (Shoeman et al.,
2001). However, exceptions occur as B. felis is a significant pathogen of cats in South Africa
(Penzhorn et al., 2004).
![Page 15: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/15.jpg)
6
Cytauxzoon spp. in felid species from the United States
Domestic cats
Cytauxzoonosis was first recognized in domestic cats (Felis domesticus) in Missouri,
Arkansas, and Texas during the early 1970’s by the presence of piroplasm-infected erythrocytes
and microscopic lesions (schizont-laden cells lining the walls of blood vessels) as well as
piroplasm-infected erythrocytes (Bendele et al., 1976; Wagner, 1976; Wightman et al., 1977). A
similar syndrome had been previously recognized in African ungulates for many years (Neitz
and Thomas, 1948; Neitz, 1957; Martin and Brocklesby, 1960; McCully et al., 1970; Wilson et
al., 1974); thus these feline infections represented the first reports of a Cytauxzoon-like illness in
the United States as well as the first report in a felid. Based on previous research involving
Theileria and Cytauxzoon, the parasite was presumed to be tick-transmitted. The parasite,
Cytauxzoon felis, has now been described in domestic cats from Alabama, Arkansas, Florida,
Georgia, Kansas, Kentucky, Louisiana, Mississippi, Missouri, North Carolina, Oklahoma, South
Carolina, Tennessee, Texas, and Virginia (Bendele et al., 1976; Wagner, 1976, Wightman et al.,
1977; Ferris, 1979; Glenn and Stair, 1982; Hauck, 1982; Kocan and Kocan, 1991; Meier and
Moore, 2000; Birkenheuer et al., 2006; Haber et al., 2007).
Bobcats
Piroplasms morphologically consistent with C. felis was described in bobcats as early as
1930 (Wenyon and Hamerton, 1930) and were again observed in two free-ranging bobcats when
C. felis was first recognized in domestic cats (Wagner, 1976). To better characterize this
piroplasms, researchers at the University of Missouri, College of Veterinary Medicine tested the
ability of C. felis to infect 30 different domestic, laboratory, and wildlife species (Kier et al.,
![Page 16: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/16.jpg)
7
1982a). Inoculation of blood, spleen and lymph node or tissue homogenate from experimentally
infected domestic cats into laboratory mice (Mus musculus, ICR), immunosuppressed nude
laboratory mice (M. musculus, BALB/c-nu), rats (Rattus norvegicus), gerbils (Meriones
unguiculatus), hamsters (Mesocricetus auratus), guinea pigs (Cavia porcellus), a chinchilla
(Chinchilla laniger), rabbits (Oryctolaugs cuniculus), squirrel monkeys (Saimiri sciureus), a dog
(Canis familiaris), a cow (Bos Taurus), a goat (Capra hircus), a sheep (Ovis aries), a pig (Sus
scrofa), coyotes (Canis latrans), a fox (Vulpes fulva), skunks (Mephitis mephitis), raccoons
(Procyon lotor), a woodchuck (Marmota monax), a marmot (Marmota flaviventris), opossums
(Didelphis marsupialis), ground squirrels (Citellus tridecemlineatus), a grey squirrel (Sciurus
carolinensis), a vole (Microtus ochrogaster), white-footed mice (Peromyscus maniculatus), bats
(Myotis lucifugus), cottontail rabbit (Sylvilagus floridanus), a deer (Odocoileus virginianus), an
ocelot (Felis pardalis), a mountain lion (P. concolor), and bobcats resulted in infections only in
domestic sheep and the two bobcats. It is unknown why the domestic cats, ocelot, and mountain
lion failed to develop infections. The inoculated sheep developed a low but persistent
parasitemia, but no clinical signs of disease. However, domestic cats inoculated with tissue
homogenates from the sheep did not develop cytauxzoonosis.
Numerous studies have established that bobcats are experimentally and naturally
susceptible to infection with C. felis. In addition, variability in disease progression in
experientially infected bobcats has been observed that may be related to infectious dose, route, or
stage or subspecies of bobcat, a combination of both, or some other factor (Kier et al., 1982b;
Kier et al., 1983). The first experimental inoculation trial gave very different results for two
different bobcats (Kier et al., 1982a; Kier et al., 1982b). One bobcat from Florida (here termed
Lynx rufus floridanus), developed clinical signs of cytauxzoonosis including anorexia,
![Page 17: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/17.jpg)
8
depression, and parasitemia, and died two weeks post-inoculation. Histological examination of
tissues revealed large numbers of schizonts occluding vessels. The second bobcat (here termed
Lynx rufus rufus) developed a subclinical parasitemia. The eastern bobcat, which survived the
initial infection with C. felis, was inoculated four subsequent times, none of which resulted in
clinical signs. However, the bobcat did develop transiently elevated infected red blood cell
(IRBC) counts and after splenectomy and steroid treatment, the bobcat developed moderate
anemia, reticulocytosis, and elevated IRBC counts. This bobcat maintained a subclinical
parasitemia for 1,372 days (approximately 4 years) before dying of congestive heart failure.
Upon necropsy, no schizogenous states of C. felis were observed and the final parasitemia was
8.5% (Kier et al., 1982b). Domestic cats inoculated with blood from these two bobcats also
presented with variable disease: cats inoculated with blood from the surviving eastern bobcat
survived while cats inoculated with blood from the Florida bobcat died. This study had three
important findings: 1) bobcats can develop disease, 2) bobcats can have long-term parasitemias,
and 3) domestic cats can survive experimental infection.
Simultaneously, a survey of blood smears from bobcats from Oklahoma showed that 13
of 21 (62%) were positive for Cytauxzoon-like piroplasms (Glenn et al., 1982). The average
parasitema observed was 1-3%, but ranged from 0.5% to 5%. Of the 13 positive bobcats, one
exhibited anemia, a classic sign of cytauxzoonosis in the domestic cat. A subsequent study
collected blood from four wild-caught bobcats which had a naturally occurring infection with an
intraerythrocytic piroplasm and showed that the parasites caused fatal cytauxzoonosis in a single
domestic cat (Glenn et al., 1983). Three other inoculated cats developed subclinical infections
(Glenn et al., 1983). A single cat that was subsequently inoculated with a domestic cat-origin
virulent inoculum of C. felis developed fatal cytauxzoonosis within 14 days. Two of the original
![Page 18: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/18.jpg)
9
wild-caught bobcats were also inoculated with the same strain of C. felis as the domestic cat, but
they did not develop clinical disease. Histologically, schizogenous forms of C. felis were not
observed in any tissues from the bobcats or from the two subclinically infected domestic cats.
Examination of 10 naturally-infected bobcats revealed that schizonts of C. felis were
absent from the liver, lungs, spleen, and lymph nodes. Spleen homogenates from four of the
bobcats were inoculated into domestic cats. Schizonts of C. felis were not seen in any tissues of
the naturally infected free-ranging bobcats. Additionally, the domestic cats inoculated with the
spleen homogenate did not develop clinical signs of cytauxzoonosis, but did develop subclinical
parasitemias. Later the same group studied the clinical progression of C. felis in bobcats
following exposure to infected D. variabilis (Blouin et al., 1987).
In the second part of the study (Blouin et al., 1987), the researchers splenectomized a
naturally infected bobcat which had a previous parasitemia of 1%. After the splenectomy, a
spleen homogenate was inoculated into a domestic cat. D. variabilis nymphs were allowed to
feed on this bobcat. Two bobcats (no. 2, 3) which had been determined to be uninfected with C.
felis were parasitized by the infected ticks. Prescapular lymph nodes were removed from the two
bobcats at 11 days post-exposure for impression smears and inoculation into domestic cats. A
second prescapular lymph node was removed from bobcat 3 after 30 days post-exposure, and
smears and inoculation were performed. The first, splenectomized, bobcat displayed no clinical
signs of C. felis and schizogenous stages of C. felis were not observed in a histological
examination of the spleen. Schizogenous stages were observed in reticuloendothelial
macrophages in the 11 day post-tick attachment lymph node impression smears of bobcats 2 and
3 and the domestic cats which were inoculate with these tissue homogenates died of acute
cytauxzoonosis 11 and 14 days post-inoculation respectively. Interestingly, bobcat 2 developed
![Page 19: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/19.jpg)
10
clinical signs of cytauxzoonosis 19 days post-tick attachment and died. Gross and microscopic
lesions revealed classical signs of cytauxzoonosis. The lymph node impression smear from
bobcat 3 which was made 30-days post-tick exposure revealed no schizogenous stages of C. felis
and the domestic cat inoculated with this tissue homogenate developed a parasitemia of 2-3% but
showed no clinical signs of C. felis. Gross and microscopic evaluation of bobcat 3 after
euthanasia 60 days post-tick attachment revealed no schizogenous stages of C. felis and only a
8% erythrocytic parasitemia. This paper reveals that development of the schizogenous phase in
bobcats can be initiated by sporozoites transmission from the tick vector. It is also evidence that,
in general, schizogenous development of C. felis in bobcats is limited and the erythrocytic stage
is maintained and dominant. Due to the death of one bobcat (no. 2) in this study from tick-
transmitted C. felis, and a previous experimental death of a bobcat (Kier et al., 1982a; Kier et al.,
1982b), it can be assumed that while most bobcats in the wild probably have limited
schizogenous stages, some may die of naturally acquired C. felis infections.
Although a few experimental studies (Kier et al., 1982b; Blouin et al., 1984) indicated
that bobcats could develop clinical disease, evidence for natural mortality is limited. Only a
single case has been reported (Nietfeld and Pollock, 2002). In 2000, a moribund free-ranging
bobcat kitten collected from an open field near Wamego, KS had severe anemia and respiratory
difficulty (Nietfeld and Pollock, 2002). Gross examination revealed multifocal petechiae,
splenomegaly, and pericardial effusion. Histological examination revealed subacute pulmonary
thrombosis, mild vasculitis in the brain, and schizont-filled macrophages occluding the blood
vessels of all examined tissues.
The first study to examine the prevalence of C. felis in bobcat populations based on PCR
testing was Birkenheuer et al. (2008) who tested bobcats from North Carolina and Pennsylvania.
![Page 20: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/20.jpg)
11
Currently, C. felis has not been reported from domestic cats in Pennsylvania, but has been
reported numerous times from domestic cats in North Carolina (Birkenheuer et al., 2006a).
Based on PCR, samples were collected from legally-trapped bobcats in 33% of 32 bobcats from
North Carolina and 7% of 70 bobcats from Pennsylvania were positive for C. felis. This
represented the first report of C. felis from any felid in Pennsylvania and the authors alerted
veterinary practitioners to the possibility of C. felis infection in domestic cats in that state.
The high prevalence and low pathogenicity of C. felis for bobcats suggests that C. felis
has been endemic in the populations for some time. As no Babesia or Theilieria spp. have yet
been described in bobcats, it can be assumed the piroplasm described in a bobcat in 1930 by
Wenyon and Hamerton was in fact C. felis and that the infection has been endemic in the
population since at least the early 1900s. As the distribution of A. americanum and D. variabilis
changes over time, it is probable that naïve populations of bobcats will become exposed to this
parasite. As Birkenheuer et al. (2008) stressed, further studies are warranted to better understand
the natural history and epidemiology of C. felis in bobcat populations.
Florida panthers
The first report of C. felis in a Florida panther (Puma concolor coryi or Felis concolor
coryi) was in 1991. The detection was accidental and occurred when researchers with the Florida
Game and Fresh Water Fish Commission and Cornell University unknowingly infected a
domestic cat with C. felis during a study to determine if a 3 yr-old female panther had feline
immunodeficiency virus (FIV) (Butt et al., 1991). The researchers intraperitoneally inoculated a
FIV antigen and antibody-negative adult domestic cat with 1.5x106 mononuclear cells from the
panther and 11 days later the cat became depressed and febrile. Although supportive care was
![Page 21: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/21.jpg)
12
administered, the cat died the next day and upon necropsy, gross lesions such as petechial
hemorrhages and splenic enlargement were noted. Microscopic examination of tissues revealed
schizont-filled mononuclear cells which completely occluding vessels. Examination of blood
smears indicated that the cat had a 10% parasitemia (Butt et al., 1991). Retrospective analysis of
blood smears from the infected Florida panther revealed she was infected; however, the panther
had received two blood transfusions from other P. concolor donors, so it was unclear if this
infection was natural or iatrogenic.
A subsequent study was conducted to determine the prevalence of C. felis in the Florida
panthers and introduced Texas cougars (Puma concolor stanleyana) (Rotstein et al., 1999). The
Texas cougars included in the study were translocated into Florida to introduce additional
genetic variability and to increase the population size, which at that point was estimated to be
~50 panthers (Maehr, 1997). A retrospective analysis (1983-1997) of blood smears revealed that
39% of the Texas cougars (11/28) and 35% of the Florida panthers (22/63) were infected with C.
felis. Interestingly, a 7 day-old kitten was positive for C. felis. No difference in prevalence was
noted between the sexes. Infected Florida panthers had significantly lower mean cell hemoglobin
and monocytes counts and significantly higher neutrophil and eosinophil counts compared with
infected Texas cougars. However, all the values were within the normal range of expected values
so the authors concluded that there was no biological significance associated with the differences
(Rostein et al., 1999). These data suggested that the Florida panther may be a reservoir for C.
felis.
To better understand the role of Florida panthers as a potential reservoir, a PCR-based
survey was conducted (Yabsley et al., 2006). Amplification of a conserved segment of the 18S
rRNA gene revealed that 39 of 41 panthers were infected, which was significantly more than
![Page 22: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/22.jpg)
13
indicated by blood smear analysis (only 15 infected). Surprisingly, after sequence analysis, the
majority of the panthers (95%, 32 of 39 infected panthers) were infected with a novel Babesia sp.
and only seven were infected with C. felis (Yabsley et al., 2006). Two of the cougars were co-
infected with C. felis and the Babesia sp. This represented the first report of a Babesia sp. in a
felid from North America.
Because two morphologically similar piroplasms had been reported in the Florida
panther, the conclusions of Rotstein et al. (1991) were re-examined. Although, fatal
cytauxzoonosis has not been described in a Florida panther, Harvey et al. (2007) described three
cases of cougars that had acute C. felis infections that resulted in mild clinical signs and mild
hematologic and biochemical abnormalities. Of the three case reports in Harvey et al. (2007),
one cougar demonstrated clinical signs after infection (year 1989) including anorexia,
depression, and dehydration. This cougar was also infested with A. americanum, a confirmed
vector of the C. felis (Reichard et al., 2009). Sequential testing of blood indicated that the cougar
remained infected for at least one year while in the Florida facility and was still infected in 2005
when it was euthanized due to diabetes at her new home in Savannah, Georgia. It is unknown if
she maintained the same subclinical C. felis infection for at >16 years or if she acquired a new
infection while in Georgia. The other two cases were western cougars that were part of the
genetic restoration study for the Florida panthers. These cougars were housed in northern Florida
in 1995 before their release into southern Florida and were negative for C. felis (and Babesia sp.)
during the initial 3-week quarantine period. After their third week at the facility, the cougars
developed anemia and had become infected with C. felis. Neither cougar showed clinical signs
and both were released in southern Florida. The cougars died in 1999 and 2001 of illnesses
unrelated to cytauxzoonosis, although both were PCR positive for C. felis at the time of death.
![Page 23: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/23.jpg)
14
These data indicated that during acute infections with C. felis, cougars can develop mild
hemolytic anemia as well as liver injury, but they to survive and develop subclinical infections.
Exotic felids
Acute fatal cytauxzoonosis has been reported in a white tiger (P. tigris) (Garner et al.,
1996) that was housed at the same facility which housed many of the infected cougars from
previous studies (Butt et al., 1991; Rotstein et al.,1991; Harvey et al., 2007). The 7-year-old
female had a two-day history of anorexia and lethargy and on the third day of illness, two female
A. americanum were found and removed. She subsequently developed icterus, a low hematocrit
(26%), and was mildly dehydrated. Two days later, she was recumbent and developed petechiae
and profuse bleeding at puncture sites. She also had a parasitemia of 5% and a mild
nonregenerative anemia, moderate leucopenia, neutropenia, lymphopenia, and severe
thrombocytopenia. Histologically, C. felis was present in mononuclear phagocytes which were
found in large quantities occluding capillaries as well as small arteries and veins (Garner et al.,
1996).
Infection dynamics, clinical signs, and pathology of C. felis
The classic clinical signs observed from C. felis in domestic cats begin with anemia and
depression and are quickly followed by fever, dehydration, icterus, splenomegaly, and
hepatomegaly. The pathognomonic signs of C. felis infection are erythrocyte hemolysis and
occlusion of the lumen of blood vessels by large schizont-laden mononuclear phagocytes in the
lungs, liver, lymph nodes, and spleen (Simpson et al., 1985; Kier et al., 1987; Kocan and Kocan,
1991; Kocan et al., 1992).
![Page 24: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/24.jpg)
15
A large group of researchers from the University of Missouri, which had first identified
the illness in domestic cats, and the Plum Island Animal Disease Center (PIADC) investigated
experimental routes of infection in the domestic cat (Wagner et al., 1980). Experimental
infection trials with 131 domestic cats were conducted with parenteral administration of either
fresh or liquid nitrogen-frozen blood or tissue homogenates that were collected from domestic
cats with acute cytauxzoonosis. Two cats were splenectomized to determine if splenectomization
enhanced the infection. Two uninoculated cats were held with the inoculated cats until they died
of cytauxzoonosis and then a further 60 days to determine if the parasite could be transmitted
directly from cat to cat. Additionally, one cat was administered tissue homogenate via gastric
lavage, while the same suspension was intraperitoneally inoculated into another cat to determine
if the parasite could be obtained by ingestion. This study determined that domestic cats do not
acquire C. felis via contact or ingestion of infectious tissues. This study also determined that the
minimum infectious dose of C. felis for a domestic cat is a 0.25mL subcutaneous inoculation of a
1:10 dilution of frozen standardized spleen inoculum. The standard progression to acute
cytauxzoonosis was between 17 and 20 days, with an average of 18.4 days. Of the 131 cats
included in this study, 54% died of clinical cytauxzoonosis and 46% were euthanized due to
acute cytauxzoonosis. The most frequent clinical signs were pyrexia, depression, anorexia and
dehydration initially followed by fever, lethargy, severe dehydration, icterus then coma and
death (Wagner et al., 1980).
Concurrent with the Wagner et al., (1980) study, researchers at the PIADC
experimentally infected >500 domestic cats and numerous domestic livestock species with C.
felis to elucidate the relationship between this piroplasm and the organisms observed in African
ungulates and to address the potential threat of this parasite to livestock in the United States
![Page 25: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/25.jpg)
16
(Ferris, 1979). The study was discontinued after C. felis was proven to not be a threat to domestic
livestock; however, these data significantly added to the knowledge of C. felis in the United
States. Importantly, one of over 500 domestic cats that were infected in this larger study survived
which was the first report of a domestic cat surviving infection with C. felis. Additionally,
researchers concluded that C. felis can be experimentally transmitted by inoculation of as little as
0.2 ml of blood, splenic, hepatic, pulmonary and lymph node homogenates by any route of
injection (eg. intravenous, intraperitoneal, subcutaneous, intradermal, etc). They confirmed that
initial clinical signs, depression and anorexia, were typically seen 5-7 days post infection and
that fever slowly rose to 40-41.1 C and stays at that level an average of 3-5 days before dropping.
Before death, pyrexia, anemia, icterus and dehydration as well as dyspnea were observed and
death usually occurred one to two weeks after development of clinical signs. After necropsy,
gross examination revealed splenomegaly and petechial hemorrhages on lymph nodes and lungs.
Microscopic evaluation revealed schizogenous stages of the parasite in reticuloendothelial
histocytic cells which occluded blood vessels. The lungs were the organ most heavily affected,
followed by the spleen, and then the liver and lymph nodes. The highest parasitemia observed in
this study was 4% with an average of 1%, but researchers in Missouri had reported a parasitemia
as high as 25% (Ferris, 1979; Wagner et al., 1980).
The pathology of experimental infections of domestic cats with C. felis was more
completely described by Kier et al. (1987). Experimentally infected cats were sacrificed from
day 1 to day 19 post-inoculation (PI) for histological evaluation. By day 16 PI cats were
exhibiting classic clinical signs of infection. Parasitemias were first noted 10 days PI. The first
schizogenous stage of C. felis was observed at day 12 PI and there was a significant correlation
between levels of parasitemia with temperature rise, presence of tissue stages, and decreased
![Page 26: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/26.jpg)
17
white blood cell counts. Recently, a retrospective study of the pulmonary histopathology of C.
felis infection was conducted on 148 domestic cats from January 1995 to June 2005 in Oklahoma
(Snider et al., 2010). Interstitial pneumonia was found to be moderate in most cases, numbers of
alveolar macrophages and intra-alveolar hemorrhages were low, and in many cases, infiltrations
of neutrophils were noted. Similar to previous studies, extensive vascular occlusion, one of the
hallmark signs of acute cytauxzoonosis, was noted (Snider et al., 2010).
Both in situ hybridization and immunohistochemical techniques have been used to study
the pathogenesis of cytauxzoonosis in domestic cats (Susta et al., 2009). Using a riboprobe
targeting the 18S rRNA region of Babesia microti, C. felis-infected cells were most often
observed in the pulmonary intravascular macrophages and alveolar macrophages and
macrophages in the spleen, but ISH-positive cells were also seen in the kidneys, heart, and brain.
Using immunohistochemistry with a monoclonal antibody (Mac387), C. felis-infected cells were
found to be negative for calprotein which indicates a decrease in diapedesis which would provide
more circulating parasites available to the tick. Immunohistochemistry of two proliferation
markers, the proliferating cell nuclear antigen and p53, also showed that infected cells replicate
more frequently. While C. felis is in the cytoplasm, it blocks the translocation of the p53
proapoptotic protein, to the nucleus which would prevent the cell from undergoing apoptosis
(Susta et al., 2009).
A single case of abortion and death due to cytauxzoonosis in a domestic cat from Georgia
has been reported (Weisman et al., 2007). The 1-year old cat was in her 5th or 6th week of
gestation when she aborted and died. Fetal tissue, including skeletal muscle, developing bone
and bone marrow, and placenta were negative for piroplasms and schizogenous stages of C. felis.
Although it is unknown if C. felis can be transmitted transplacentally, there is evidence for
![Page 27: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/27.jpg)
18
transplacental transmission of T. equi and T. sergenti in horses and cows, respectively (Baek et
al., 2003; Phipps and Otter, 2004; Allsopp et al., 2007).
Diagnostic testing for C. felis
Previously, the standard method of diagnosis for C. felis infection was blood smear
analysis to detect the piroplasm infected red blood cells (Glenn et al., 1982; Kier et al., 1982a;
Ferris, 1979). Recently, molecular methods have been used to detect infection with greater
sensitivity. Polymerase chain reaction (PCR) can be used to detect low numbers of parasites and
to characterize the piroplasms found (Birkenheuer et al., 2006; Brown et al., 2008). Serologic
tests for C. felis have been investigated, but domestic cats typically have high numbers of
intraerthrocytic forms that are easily observed during acute infections. With the increased
recognition of chronically infected cats, however, serologic testing might be useful for
population-based studies (Shindel et al., 1978; Cowell et al., 1988).
Treatment and survival in C. felis
Numerous treatment regimes have been tested including parvaquone, imidocarb,
dimiazene aceturate, buparvaquone; however, imidocarb is currently the drug of choice (Green et
al., 1999). Although several cats survived infection during these clinical trials (4 of hundreds), no
treatment, even imidocarb, has been considered 100% effective and consistent in managing the
protozoan infection. In 1987, Uilenberg et al. inoculated a domestic cat with C. felis and treated
it with parvaquone. This cat was subsequently immune to the same inoculum. Another study
used a combination of parvaquone and buparvaquone in 17 cats, and although one infected cat
survived, another cat not treated also survived (Motzel and Wagner, 1990). Importantly, data
![Page 28: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/28.jpg)
19
indicate that cats that are treated can remain parasitemic which might allow them to continue the
life cycle by infecting ticks (e.g. three cats in Arkansas that were treated with imidocarb
dipropionate remained parasitemic for 7 months, 15 months, and 29 months) (Brown et al.,
2008).
Historically, this disease was considered by be nearly uniformly fatal for domestic cats,
but over the years there have been indications (during experiment studies or field-based studies)
that some cats could survive and develop subclinical chronic infections (Ferris, 1979; Meinkoth
et al, 2000; Brown et al., 2008; Haber et al., 2007). Increased recognition of subclinical
infections suggests that either cats are adapting to the parasite, less virulent strains of the parasite
are beginning to emerge in domestic cats, or better diagnostic assays are detecting these chronic
asymptomatic cases. From 1997 to 1998, Meinkoth et al. (2000) reported 18 cats from Arkansas
and Oklahoma which had survived natural infections with C. felis. Four of the cases were
asymptomatic and were identified only after one of their housemates showed clinical signs of
cytauxzoonosis; these cats had shown no clinical signs. Only one of the cats was treated with
imidocarb and all the cats were still parasitemic after 154 days. A single cat tested after 6 yrs was
still infected (from Walker and Cowell, 1995). Three other studies have reported a number of
cats that either survived infection or were chronic carriers including two of 34 cats in North
Carolina, two of 961 cats from Florida, three cats in Arkansas, and one of 75 cats from
Tennessee (Birkenheuer et al., 2006; Haber et al., 2007; Brown et al. 2008). Importantly, these
data suggest that domestic cats can develop long-term parasitemias which could allow them to
serve as reservoirs for the parasite.
![Page 29: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/29.jpg)
20
Vectors of Cytauxzoon felis
In experimental studies, C. felis has been transmitted by two Ixodid tick species,
Dermacentor variabilis, the American dog tick, and Amblyomma americanum, the lone star tick.
D. variabilis is a moderate-sized tick (2-6 mm long) that has a three-host lifecycle involving
small mammals for the larval and nymph stages and large mammals for the adult stage (Allan,
2001). D. variabilis has a distribution involving the entire Eastern United States, the Pacific
coast, and parts of Idaho and Montana (Allan, 2001) and is primarily found in areas with forest
undergrowth (Allan, 2001; Figure 1.2). Ticks of the genus Amblyomma are larger ticks (4-8mm),
that tend to be catholic in their feeding habits, with three all stages feeding on a variety of
different hosts. In general, the genus is restricted to areas of warmer temperature and high
humidity for development of each life stage (Semtner et al., 1973; Koch and Dunn, 1980b). The
distribution of A. americanum ranges primarily in the Southeastern and south-central United
States, although new reports indicate range expansion (Allan, 2001, Figure 1.3) into coastal
regions of Maine and other Northeastern states (Keirans and Lacombe, 1998). The preferred
habitat of A. americanum is subclimax forests (Sonenshine and Levy, 1971).
![Page 30: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/30.jpg)
21
FIGURE 1.2. Approximate distribution of Dermacentor variabilis (CDC, 2009)
FIGURE 1.3. Approximate distribution of Amblyomma americanum (CDC, 2009)
C. felis was first experimentally transmitted from a bobcat to a domestic cat by D.
variabilis (Blouin et al., 1984). Lab-raised nymphs were fed to repletion on a splenectomized
![Page 31: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/31.jpg)
22
bobcat with a parasitemia of 40%, allowed to molt to the adult stage, and then were fed on
splenectomized domestic cats. Both domestic cats died of acute cytauxzoonosis at 13 and 17
days post-tick engorgement. Tissue impression smears displayed the schizogenous stage of C.
felis and the domestic cats displayed clinical and microscopic evidence of infection with C. felis.
Inoculation of a domestic cat with parasitemic blood from the same bobcat resulted in a
subclinical infection which was maintained for 6 months. This study was the first to show that D.
variabilis transstadially maintains C. felis and can transmit the parasite to felids. The study also
showed that clinical outcome in domestic cats may be related to the route of infection because
blood-inoculation (as was seen previously) caused subclinical infection whereas tick-
transmission produced acute cytauxzoonosis (Blouin et al., 1984).
D. variabilis also successfully transmitted C. felis infection from a splenectomized
parasitemic bobcat to two un-splenectomized bobcats which were previously determined to be
uninfected with C. felis by both blood smears and inoculation of whole blood into domestic cats
(Blouin et al., 1987). One of the bobcats died 19 days post tick-attachment of clinical
cytauxzoonosis which was the first indication that bobcats could develop clinical disease.
The first survey of ticks for C. felis infection was conducted by Bondy et al. (2005) who
screened 1, 362 ticks (Rhipicephalus sanguineus, D. variabilis, A. americanum) from Missouri.
Unfortunately, all the ticks for this study were collected from domestic dogs and cats which
complicated interpretation of the results. Of all the samples included in the study, only three
(0.93%) A. americanum nymphs were PCR positive for C. felis; however, all three were
collected from a domestic cat which was confirmed to be infected with C. felis. Although this
study suggested a role of A. americanum in the transmission of C. felis to domestic cats, there
were several caveats which prevented the A. americanum from being confirmed as a vector.
![Page 32: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/32.jpg)
23
First, since the ticks were removed from a C. felis positive individual, it is impossible to
determine if the felid acquired the infection from the A. americanum, if the ticks were positive
because they were engorged with C. felis-infected feline blood, or if the vectors were positive
because they had acquired the parasite from a previously infected felid. Secondly, clinical signs
of infection usually do not develop for at least two weeks post-tick engorgement so the
likelihood of one of these nymphs being the vector is very low (Bondy et al., 2005; Blouin et al.,
1987; Blouin et al., 1984).
Nevertheless, A. americanum was suspected to be a vector because the ubiquitous nature
of the tick in regions where C. felis had been identified in domestic cats (Reichard et al., 2008)
and epidemiologically, peaks of cytauxzoonosis in domestic cats in May and September
correlated with natural peaks in A. americanum activity (Reichard et al., 2008). A. americanum
was confirmed as a competent vector when Reichard et al., (2009) conducted a transmission trial
using lab-raised A. americanum, D. variabilis, R. sanguineus, and Ixodes scapularis nymphs that
had fed on a subclinically C. felis-infected cat. Only the cat infested with adult A. americanum
exhibited clinical signs of cytauxzoonosis (11 dpi), while none of the other cats infested with
adult D. variabilis, R. sanguineus, and I. scapularis became infected. Similarly, in a subsequent
study D. variabilis failed to transmit C. felis (Edwards et al., 2010). Although D. variabilis did
not transmit C. felis in these two studies, there are a number of differences between these studies.
The parasitemia of the initial felids used in the studies (40% in Blouin et al., (1984) vs. 0.015%
in Reichard et al., (2008)) and the immune status of the subject felids (splenectomized vs. un-
splenectomized).
After A. americanum was confirmed to be a vector, a field-based study of wild-caught
questing ticks from natural habitats surrounding Stillwater, Oklahoma was conducted. C. felis
![Page 33: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/33.jpg)
24
was detected in A. americanum (MIRs of 0.5% (1 of 178) for adult males, 1.5% (3 of 197) for
adult females, and 0.8% (3 of 393) for nymphs (Edwards et al., 2010). All 160 D. variabilis were
negative.
Currently, both D. variabilis and A. americanum are considered competent vectors of the
parasite (Blouin et al. 1984; Blouin et al., 1987; Reichard et al., 2008); however, very little is
understood about the importance of each vector species in the overall ecology of C. felis. Based
on A. americanum densities in areas where cytauxzoonosis is common and the epidemiologic
association with A. americanum activity, A. americanum likely represents the primary vector of
C. felis.
Seasonality and risk factors for C. felis
Because cytauxzoonosis is a tick-borne disease, a marked seasonality in diagnosed cases
has been noted. A retrospective analysis of cases submitted to the Oklahoma Animal Disease
Diagnostic Laboratory (n=180) during 1995-2006 and the Boren Veterinary Medical Teaching
Hospital (n=52) during 1998-2006 found a bimodal pattern with a large peak in the spring and
early summer months of April, May and June, and a small peak in the autumn months of August
and September (Reichard et al., 2009). These peaks correspond with the activity of the tick
vectors, especially A. americanum.
The authors were able to identify the geographic coordinates and landscape
characteristics for 41 of the cases and 68.3% were reported to occur in low density residential
areas. More cases (19.5%) occurred in urban edge habitat than expected at random. Significantly
more cases of cytauxzoonosis were associated with wooded cover and proximity to natural or
unmanaged areas. This study is a confirmation of observations clinicians and researchers had
![Page 34: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/34.jpg)
25
been making for years about the risk factors associated with cytauxzoonosis in domestic cats.
Basically, cats which reside in habitats that support tick vectors, bobcats or both are more likely
to become infected with C. felis. Importantly, risk of C. felis infection is greatly reduced (nearly
preventable) by limiting tick exposure by keeping cats indoors.
Genetic characterization of Cytauxzoon felis from domestic cats
There have been at least three reasons postulated for the increased recognition of
chronically infected asymptomatic cats: 1) better treatment strategies, 2) better diagnostics, or 3)
variable strains of C. felis that differ in their virulence for domestic cats. Although many
treatment strategies have been attempted in reducing the parasitemia in domestic cats (Green et
al., 1999; Motzel and Wagner, 1995), none have been consistently effective and recently there
have been increasing reports of natural subclinical chronically-infected domestic cats
(Birkenheuer et al., 2006; Brown et al., 2008). Although diagnostics, particularly molecular
techniques, have improved, historically experimental studies have suggested that different
strains of C. felis had variable pathogenicity for cats as some strains induced clinical disease
while others induced subclinical chronic infections (Kier et al., 1982b).
If genetic markers could be identified to identify clinically different strains, then the
clinical outcome and treatment protocols might be more easily predicted (Brown et al., 2009a).
One of the most commonly used markers for this type of analysis is the noncoding first and
second internal transcribed spacer regions of the ribosomal RNA operon (ITS-1 and ITS-2).
These targets are more likely to have genetic variability compared with the conserved regions of
this operon (e.g., 18S, 5.8S, and 28S rRNA) (Hills and Dixon, 1991). The ITS-1 and ITS-2
regions have been useful in examining variability among a related hemoparasite, Babesia canis,
![Page 35: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/35.jpg)
26
as well as two other apicomplexans, Cyclospora cayetanensis and Eimeria spp. (Brown et al.,
2009a; Barta et al., 1998; Olivier et al., 2001; Zahler et al., 1998).
From 2005 to 2007, samples of C. felis from domestic cats from Arkansas and Georgia
were genetically characterized and analyzed by clinical outcome (Brown et al., 2009a).
Unambiguous ITS-1 and ITS-2 sequences of C. felis were obtained for 88 of 112 C. felis
samples. These sequences were divided into three distinct genotypes (ITSA, ITSB, ITSC) each
of which were detected in at least five cats. Additionally, eight other unique sequences were
noted (Brown et al., 2009a). Within the ITS-1 region (~458bp), variability was due to eight
single nucleotide polymorphisms (SNPs) and one single nucleotide insertion and within the ITS-
2 region (~265bp), variability was due to four SNPs and one 40 base pair insertion. ITSA was
the most commonly identified genotype (54.5% of samples) followed by ITSB (23.9%), and
ITSC (5.7%). Of cats infected with the ITSA genotype, a significant number (38/48, 79.2%)
survived infection compared to those infected with the ITSB genotype (4/21, 19.0%) and the
ITSC genotype (0/5, 0%). These data suggested that specific ITS genotypes may be associated
with clinical outcome in domestic cats (Brown et al., 2009a).
In addition, most of the cats that survived C. felis infection were from the Midwest and
the ITSA genotype was identified in 84.2% of Arkansas samples but from only one sample
collected from Georgia. Conversely, ITSB was identified in 67.7% of the samples from Georgia,
but no samples from Arkansas. ITSC was only detected in samples from Georgia (5/57, 8.8%).
Thus, these data also indicate that certain strains of C. felis circulate in different geographic
regions.
Recently, a retrospective study (1995-2007) of 98 C. felis histology specimens from
Georgia found similar results (Brown et al., 2009b). Although 85 of the 98 samples yielded
![Page 36: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/36.jpg)
27
unambiguious ITS-2 sequences, only 21 samples yielded near complete ITS-1 region sequences.
To increase numbers, the ITS-1 sequence analysis was restricted to 290 base pairs, which
allowed a total of 48 samples to be included in the study. Three identified genotypes (ITSa,
ITSb, and ITSc) were detected as well as 8 additional unique sequences. Twenty-seven of the
samples were ITSa, 8 were ITSb, and 3 were ITSc. One of the eight new sequences (described as
ITSd) was found in 3 cats, while the others were only found in a single cat each. In the previous
study (Brown et al., 2009a), infection with ITSa was significantly associated with a fatal clinical
outcome but unfortunately, the clinical outcome of the cats from Brown et al., (2009b) could not
be determined because many of the cats were euthanized and submitted as clinical cases. The
genotype ITSA from the previous study was only identified in 3 samples from different years,
which supports the previous findings that this genotype may be rare in eastern states (Brown et
al. 2009b).
Further studies are required from more spatially diverse domestic cat populations to
determine if specific genotypes are circulating in domestic cats. Currently the data support that
certain genotype are associated with specific geographic areas (Brown et al., 2009b).
Furthermore, one particular genotype has been associated with pathogenicity for domestic cats
(Brown et al., 2009a). Whether or not the strains of C. felis identified in these studies reflect the
strains of C. felis which circulate in wild felids or the tick vectors is unknown.
![Page 37: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/37.jpg)
28
Cytauxzoon spp. from felid species outside of the United States
Germany
The only report of Cytauxzoon in Germany was a fatal infection in 1984 in a female
Bengal tiger (Panthera tigris) which was captive-born in a German zoo (Jakob and Wesemeier,
1996). The tiger was 18 weeks old when it became anorexic, lethargic, and dyspnoeic and
rapidly died from acute pneumonia (Jakob and Wesemeier, 1996). Gross findings revealed
heavily congested lungs with numerous petechial hemorrhages. All of the examined lymph nodes
and the spleen were enlarged and hemorrhagic. Microscopic evaluation revealed mononuclear
phagocytes occluding the blood vessels of all examined organs. Macroschizonts were clearly
visible. Piroplasms were observed in the erythrocytes. Cytauxzoonosis is suspected based on the
congestion and edema of the lungs, splenomegaly and hemorrhagic lymph nodes, and
observation of intramononuclear cell schizonts. Unfortunately genetic characterization of the
samples was not conducted. No ticks were observed on the tiger and a brother to the tiger was
born and raised to maturity in the same enclosure. Importantly, 14 months before the death of the
young tiger, three bobcats had been imported directly from the United States to the zoo.
Parasitemia has been shown to last over four months in bobcats, and many reports suggest that
the animals may remain subclinically infected for years (Keir et al., 1982b). At the time, no
examinations were conducted on the bobcats or their blood, so the origin of the infection is
unknown (Jakob and Wesemeier, 1996). As many C. felis researchers have indicated (Millan et
al., 2007; Reichard et al., 2005), transport of wild felids without a full clinical evaluation and
quarantine period can have devastating consequences.
![Page 38: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/38.jpg)
29
Spain
The first report of a Cytauxzoon sp. in Europe was in a domestic cat from Spain (Criado-
Fornelio et al., 2004). Only a single cat of 100 (1%) was PCR positive for a Cytauxzoon sp. that
was, based on 18S rRNA gene sequence analysis, 98% similar to C. manul and 95% with a
Cytauxzoon sp. (stabilate 153) that was originally reported to be from a domestic cat from South
Africa (Criado-Fiorello et al., 2004), however stabiliate 153 is believed to be from a cat from
The Netherlands that was subcutaneously inoculated with a domestic cat spleen stabiliate from
Missouri, USA (Uilenberg et al., 1987). Phylogenetic analysis of the Cytauxzoon sp. from Spain
(see phylogenetic tree, Figure 1.1) suggests that it is a distinct species from C. felis.
The first report of a Cytauxzoon sp. in a wild European felid was in the Iberian lynx
(Lynx pardinus) which is one of the world’s most endangered felid and is only found in two
isolated populations in southern Spain (Nowell and Jackson, 1996; Johnson et al., 2004; Peña et
al., 2003; Millan et al., 2007). The Doñana National Park population has approximately 40
individuals while the Sierra Morena population contains between 90 and 120 individuals
(Guzman et al., 2003). The first report was from a free-ranging injured lynx that was taken for a
health check from the Sierra Morena population and examination of a blood smear revealed a 4%
parasitemia. Sequence analysis of 1,675 bp of the 18S rRNA gene indicated that the Cytauxzoon
sp. from the lynx only differed from the domestic cat Spanish sample by 11 bases. Interestingly,
the lynx Cytauxzoon sp. was 99.6% identical to C. manul (differed by only 8 bases) (Luaces et
al., 2005). A retrospective analysis of blood and tissue samples collected from 50 lynx from
1993-2003 was uniformly negative for Cytauxzoon infections (Luaces et al., 2005). Since no
clinical signs were observed in the infected male lynx from this study, the infection was assumed
to be subclinical. Nevertheless, this Cytauxzoon sp. is a concern because the Iberian lynx is
![Page 39: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/39.jpg)
30
endangered and typically nonpathogenic organisms can become pathogenic due to inbreeding
and during coinfections with pathogens that cause immunodeficiency, the Cytauxzoon sp. is a
serious consideration (Johnson et al., 2004; Peña et al., 2003).
A study on the prevalence of the Cytauxzoon sp. in wild-caught lynx from Sierra Morena
found that 3 of 9 (33%) lynx were infected (Millan et al., 2007). All three were juveniles. Eleven
lynx from Doñana were all negative. Sequence analysis of the 18S rRNA gene of these positives
revealed minimal variation (differed from each other by 0.6%, but differed from the previous
lynx sample by 1%). According to this analysis, the sequences were 99.4% identical to C. felis
from the United States. Currently no vector has been identified and the lack of infection in the
Doñana population may be due to lack of vector either because of environmental restrictions or
host-specific extinction.
France
Cytauxzoon sp. infections of domestic cats in France were first reported in 2008 (Criado-
Fornelio et al., 2008). A single cat of 116 cats (0.8%) surveyed were PCR positive for a
Cytauxzoon sp. Genetic characterization of the 18S rRNA region revealed that the piroplasm was
99% similar to the Cytauxzoon sp. described in Spanish felids (Criado-Fornelio et al., 2004;
Criado-Fornelio et al., 2007b; Millan et al., 2007). The low prevalence in domestic cats in France
was similar to the low prevalence in domestic cats in Spain (Criado-Fornelio et al., 2004; Criado-
Fornelio et al., 2007b).
![Page 40: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/40.jpg)
31
Mongolia
In October and December of 2000, four Pallas’s cats (Otocolobus manul) were
transported from Mongolia to Oklahoma. During route quarantine examination, small
intraerythrocytic piroplasms were observed on stained blood smears and parasitemias <1%.
Morphologic analysis and host (felid) suggested that the piroplasms were C. felis. Amplification
and sequencing of the 1,485 bp of the rRNA gene indicated that it was related to C. felis, but
likely represented a different species of Cytauxzoon (only 3.6% different from C. felis compared
to the differences from Babesia leo (10.13%) and B. felis (9.49%)). This was the first report of
erythroparasitemia in Pallas’s cats and probably the first report of a piroplasm in free-ranging
felids in Mongolia (Ketz-Riley et al., 2003).
The initial study of the Cytauxzoon sp. in Mongolian Pallas’s cats did not formally
propose a new species for the organism. In 2005, a second study was conducted to further
investigate the phylogenetic relationship between this Cytauxzoon sp. and C. felis (Reichard et
al., 2005). In the first study, only blood from one of the four imported Pallas’s cats was available
for analysis, but in the second study, samples from two of the remaining cats were analyzed.
After PCR amplification and sequencing of the entire18S rRNA gene, the authors concluded that
the mean corrected percent sequence divergence between the Pallas’s cat Cytauxzoon sp. and C.
felis was 1.49%. In addition, the Pallas’s cat Cytauxzoon sp. was found to only be 0.389%
divergent from a Spanish sample of a Cytauxzoon-like sp.. The species name Cytauxzoon manul,
based on the vertebrate host from which the piroplasm was first detected, was proposed
(Reichard et al., 2005). The vector for C. manul is currently unknown, but is presumably an
Ixodid tick.
![Page 41: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/41.jpg)
32
Recently, a random, blind study was conducted to determine both the infectivity of C.
manul for domestic cats as well as the ability of C. manul to provide cross-protection for
infection with C. felis (Joyner et al., 2007). Three cats were immunosuppressed with
dexamethasone and three others were inoculated with sterile water, after which, the cats were
intravenously inoculated with 2 ml of heparinized blood from the i-positive Pallas’s cat blood
(parasitemia >1x106). None of the cats displayed clinical signs of disease, but both groups
became parasitemic within two weeks of inoculation and at least two cats were still parasitemic
37 days post-inoculation. Weekly splenic aspirates were performed and no schizogenous forms
of C. manul were found. All of the domestic cats were then challenged with C. felis-infected
splenic homogenate and all developed clinical cytauxzoonosis within 5 days post-inoculation.
The findings from this study suggest that the intraerythrocytic stage of C. manul is infective for
domestic cats, but that the tissue stage of the infection does not occur. Importantly, cat inoculated
with C. manul did not develop any cross-protection against subsequent C. felis infection.
The lack of schizongony has been reported in other studies involving C. felis and bobcats and
domestic cats. When domestic cats and bobcats are incoculated with intraerythrocytic states of C.
felis, disease is limited, but when bobcats or domestic cats are inoculated with schizogenous
stages, severe disease can result (Glenn et al., 1983; Kier et al., 1982b). It is unknown if clinical
disease would have developed in domestic cats if they had been inoculated with schizogenous
stages of C. manul (Joyner et al., 2007).
Brazil
A piroplasm, most likely a Cytauxzoon sp., was first reported in Brazil in 2004 a colony
of urban stray domestic cats living in the Rio de Janeiro zoological garden (Mendes-de-Almeida
![Page 42: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/42.jpg)
33
et al., 2004). The general goal of the project was to understand the pathogens and other health
problems associated with feral domestic cats. Over a two month period, 47 cats were captured
for the study and full genetic and health evaluations were conducted. Besides finding other
pathogens such as mycoplasmas (Haemobartonella felis, 38%), the authors discovered a small
intraerythrocytic piroplasm in 47% of the cats. Based on morphology, the authors were unable to
identify the hemoparasite as either a Babesia sp. or a Cytauxzoon sp. No ticks were found on any
of the animals. To date, no phylogenetic analysis has been conducted on the specimens to
determine their identity, but this was the first report of a felid piroplasm in South America
(Mendes-de-Almeida et al., 2004).
Fatal cytauxzoonosis was reported in a captive reared lioness (Panthera leo) and her 6-
month-old cub in the Volta Redonda Municipal Zoo, Rio de Janeiro State, Brazil (Peixoto et al.,
2007). In 1998, the 6-month old cub died after a 24-hour depression. Gross examination revealed
hemothorax, endocardial and pulmonary edema, and petechial hemorrhages. Forty-five days later
the mother of the cub also died. Clinical signs were observed five days before its death. The
clinical signs and lesions in the lioness were suggestive of cytauxzoonosis including pulmonary
edema, depression, anemia, thrombocytopenia and petechial hemorrhages. Several biochemical
abnormalities including pyuria, hematuria, proteinuria, as well as pulmonary edema and
petechial hemorrhages were observed in the lioness. Microscopic evaluation of tissues from both
felids revealed mononuclear phagocytes containing schizogenous forms consistent with a
Cytauxzoon sp. Electron microscopy revealed schizonts consistent with Cytauxzoon which were
delimited by a thin double membrane inside the cytoplasm of macrophages. Amblyomma
cajennense ticks were collected from the lioness. The authors believed that this infection
represented a South American strain of C. felis because the organisms observed were
![Page 43: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/43.jpg)
34
ultrastructrually identical to C. felis and sequence analysis of the 18S rRNA region from both
these samples found a 99% similarity with C. felis from a domestic cat from the United States
(Scofield, 2006). This study represents the first report of a Cytauxzoon sp. infection in P. leo.
In 2006, blood samples were collected from 72 Brazilian wild-captive felids from five
zoos and screened for infection with Cytauxzoon sp. (Andre et al., 2009). There were seven felid
species included in the study including: 9 pumas (P. concolor); 29 ocelots (Leopardus pardalis);
6 jaguarondi (Puma yagouaroundi); 2 margays (Leopardus wiedii); 14 little spotted cats
(Leopardus tigrinus); 3 pampas cats (Oncifelis colocolo); and 9 jaguars (Panthera onca). PCR
testing revealed that 13% of the animals were infected, including six ocelots, two pumas, and one
jaguar from two different zoos. The Cytauxzoon spp. detected in these felids was 99% similar to
the previous sample from the Brazilian lioness and 98% similar to C. felis from domestic cats.
No clinical signs or symptoms were associated with the infection in these felids and no ticks
were found on the felids. The authors concluded that wild felids in Brazil, similar to wild felids
in the United States, may be reservoirs for Cytauxzoon species. And, like the occasional death in
bobcats in the United States (Nietfeld and Pollack, 2002), native wild felids in Brazil may
occasionally die from infection (Peixoto et al., 2007).
Africa
At least two papers have reported Cytauxzoon-like organisms from wild felids in Africa
and an additional two papers from Africa have reported piroplasms indistinguishable from
Cytauxzoon or Babesia. In 1929, Davis described a piroplasm of the Sudanese wild cat (Felis
ocreata, probably Felis silvestris), but it unclear if schizogenous stages were observed and no
further studies have been conducted. Piroplasms have also been described from the West African
![Page 44: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/44.jpg)
35
civet cat (Viverra civetta), but no further analyses have been conducted (Wenyon and Hamerton,
1930). Cytauxazoon-like organisms in the erythrocytes of two cheetahs from Africa have been
reported (Zindle et al., 1981). In 1982, a Cytauxzoon-like disease was reported in a domestic cat
from Zimbabwe (Foggin and Roberts, 1982). Based on necropsy, the cat had schizogenous stages
in reticuloendothelial cells in the spleen, lymph nodes, lungs and liver. The researchers stated
that this disease had been observed in other domestic felids from the area. In a separate study,
piroplasms were observed in erythrocytes of genets (Genetta genetta). A domestic cat was
inoculated with blood from an infected genet and developed parasitemia. Then the cat was
treated with imidocarb and survived and no necropsy was performed (Foggin and Roberts,
1982). Although no further studies have been conducted on wild or domestic felids in Zimbabwe,
this evidence strongly suggests that Cytauxzoon is circulating in African felids.
LITERATURE CITED
Allan, S.A., In: Samuel, W.M., Pybus, M.J., Kocan, A.A. (Eds.), Parasitic Diseases of Wild
Mammals. Iowa State University Press, Ames, Iowa, 72-94.
Allsopp, M.T., Lewis, B.D., Penzhorn, B.L., 2007, Molecular evidence for transplacental
transmission of Theileria equi from carrier mares to their apparently healthy foals. Vet
Parasitol 148, 130-136.
Andre, M.R., Adania, C.H., Machado, R.Z., Allegretti, S.M., Felippe, P.A., Silva, K.F., Nakaghi,
A.C., Dagnone, A.S., 2009, Molecular detection of Cytauxzoon spp. in asymptomatic
Brazilian wild captive felids. J Wildl Dis 45, 234-237.
![Page 45: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/45.jpg)
36
Baek, B.K., Soo, K.B., Kim, J.H., Hur, J., Lee, B.O., Jung, J.M., Onuma, M., Oluoch, A.O.,
Kim, C.H., Kakoma, I., 2003, Verification by polymerase chain reaction of vertical
transmission of Theileria sergenti in cows. Can J Vet Res 67, 278-282.
Baneth, G., Kenny, M.J., Tasker, S., Anug, Y., Shkap, V., Levy, A., Shaw, S.E., 2004, Infection
with a proposed new subspecies of Babesia canis, Babesia canis subsp. presentii, in
domestic cats. J Clin Microbiol 42, 99-105.
Barta, J.R., Coles, B.A., Schito, M.L., Fernando, M.A., Martin, A., Danforth, H.D., 1998,
Analysis of infraspecific variation among five strains of Eimeria maxima from North
America. Int J Parasitol 28, 485-492.
Bendele, R.A., Schwartz, W.L., Jones, L.P.,1976, Cytauxzoon-like disease in Texas cats.
Southwest Vet 29, 244-246.
Bigalke, R.D., 1989, The current status of research on diseases of wildlife in South Africa and
south west Africa/Namibia. J S Afr Vet Assoc 60, 7-10.
Birkenheuer, A.J., Cohn, L.A., Levy, M.G., Breitschwerdt, E.B., Marr, H.S., 2008a, Atovaquone
and azithromycin for the treatment of Cytauxzoon felis. J Vet Intern Med 22, 703-704.
Birkenheuer, A.J., Le, J.A., Valenzisi, A.M., Tucker, M.D., Levy, M.G., Breitschwerdt, E.B.,
2006a, Cytauxzoon felis infection in cats in the mid-Atlantic states: 34 cases (1998-2004).
J Am Vet Med Assoc 228, 568-571.
Birkenheuer, A.J., Marr, H., Alleman, A.R., Levy, M.G., Breitschwerdt, E.B., 2006b,
Development and evaluation of a PCR assay for the detection of Cytauxzoon felis DNA
in feline blood samples. Vet Parasitol 137, 144-149.
![Page 46: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/46.jpg)
37
Birkenheuer, A.J., Marr, H.S., Warren, C., Acton, A.E., Mucker, E.M., Humphreys, J.G., Tucker,
M.D., 2008b, Cytauxzoon felis infections are present in bobcats (Lynx rufus) in a region
where cytauxzoonosis is not recognized in domestic cats. Vet Parasitol 153, 126-130.
Blouin, E.F., Kocan, A.A., Glenn, B.L., Kocan, K.M., Hair, J.A., 1984, Transmission of
Cytauxzoon felis Kier, 1979 from bobcats, Felis rufus (Schreber), to domestic cats by
Dermacentor variabilis (Say). J Wildl Dis 20, 241-242.
Blouin, E.F., Kocan, A.A., Kocan, K.M., Hair, J., 1987, Evidence of a Limited Schizogonous
Cycle for Cytauxzoon felis in Bobcats Following Exposure to Infected Ticks. J Wildlife
Dis 23, 499-501.
Bondy, P.J., Cohn, L.A., Kerl, M.E., 2005a, Feline cytauxzoonosis. Comp Cont Educ Pract 27,
69-75.
Bondy, P.J., Jr., Cohn, L.A., Tyler, J.W., Marsh, A.E., 2005b, Polymerase chain reaction
detection of Cytauxzoon felis from field-collected ticks and sequence analysis of the
small subunit and internal transcribed spacer 1 region of the ribosomal RNA gene. J
Parasitol 91, 458-461.
Brocklesby, D.W., 1962, Cytauxzoon taurotragi (Martin and Brocklesby, 1960) a piroplasm of
the eland (Taurotragus oryx pattersonianus (Lydekker, 1906)). Research in Vet Sci 3,
334-344.
Brocklesby, D.W., 1979, Recent observations on tick-borne protozoa. In: Wilde J.K.H. (ed)
Tick-Borne Diseases and their Vectors. Edinburgh University Press, 262-286.
Brown, H.M., Berghaus, R.D., Latimer, K.S., Britt, J.O., Rakich, P.M., Peterson, D.S., 2009,
Genetic variability of Cytauxzoon felis from 88 infected domestic cats in Arkansas and
Georgia. J Vet Diagn Invest 21, 59-63.
![Page 47: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/47.jpg)
38
Brown, H.M., Modaresi, S.M., Cook, J.L., Latimer, K.S., Peterson, D.S., 2009, Genetic
variability of archived Cytauxzoon felis histologic specimens from domestic cats in
Georgia, 1995-2007. J Vet Diagn Invest 21, 493-498.
Brown, H.M., Latimer, K.S., Erikson, L.E., Cashwell, M.E., Britt, J.O., Peterson, D.S., 2008,
Detection of persistent Cytauxzoon felis infection by polymerase chain reaction in three
asymptomatic domestic cats. J Vet Diagn Invest 20, 485-488.
Butt, M.T., Bowman, D., Barr, M.C., Roelke, M.E., 1991, Iatrogenic transmission of Cytauxzoon
felis from a Florida panther (Felix concolor coryi) to a domestic cat. J Wildl Dis 27, 342-
347.
Carmichael, I.H., Hobday, E., 1975, Blood parasites of some wild bovidae in Botswana.
Onderstepoort J Vet Res 42, 55-62.
Cowell, R.L., Fox, J.C., Panciera, R.J., Tyler, R.D., 1988, Detection of Anticytauxzoon
Antibodies in Cats Infected with a Cytauxzoon Organism from Bobcats. Vet Parasitol 28,
43-52.
Criado-Fornelio, A., 2007, A review of nucleic-acid-based diagnostic tests for Babesia and
Theileria, with emphasis on bovine piroplasms. Parassitologia 49 Suppl 1, 39-44.
Criado-Fornelio, A., Buling, A., Pingret, J.L., Etievant, M., Boucraut-Baralon, C., Alongi, A.,
Agnone, A., Torina, A., 2009, Hemoprotozoa of domestic animals in France: Prevalence
and molecular characterization. Vet Parasitol 159, 73-76.
Criado-Fornelio, A., Gonzalez-del-Rio, M.A., Buling-Sarana, A., Barba-Carretero, J.C., 2004,
The "expanding universe" of piroplasms. Vet Parasitol 119, 337-345.
![Page 48: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/48.jpg)
39
Criado-Fornelio, A., Martinez-Marcos, A., Buling-Sarana, A., Barba-Carretero, J.C., 2003a,
Molecular studies on Babesia, Theileria and Hepatozoon in southern Europe. Part I.
Epizootiological aspects. Vet Parasitol 113, 189-201.
Criado-Fornelio, A., Martinez-Marcos, A., Buling-Sarana, A., Barba-Carretero, J.C., 2003b,
Molecular studies on Babesia, Theileria and Hepatozoon in southern Europe. Part II.
Phylogenetic analysis and evolutionary history. Vet Parasitol 114, 173-194.
Criado-Fornelio, A., Martinez-Marcos, A., Buling-Sarana, A., Barba-Carretero, J.C., 2003c,
Presence of Mycoplasma haemofelis, Mycoplasma haemominutum and piroplasmids in
cats from southern Europe: a molecular study. Vet Microbiol 93, 307-317.
Davis, 1929, On a piroplasm of the Sudanese wild cat (Felis ocreata), Trans Roy Soc Trop Med
Hyg 22, 523-534.
Edwards, A.C., Reichard, M.V., Meinkoth, J.H., Snider, T.A., Meinkoth, K.R., Heinz, R.E.,
Little, S.E., 2010, Confirmation of Amblyomma americanum (Acari: Ixodidae) as a vector
for Cytauxzoon felis (Piroplasmorida: Theileriidae) to domestic cats. J Med Ent.
Ferris, D.H., 1979, A progress report on the status of a new disease of American cats:
cytauxzoonosis. Comp Immunol Microbiol Infect Dis 1, 269-276.
Foggin, C.M., Roberts, H.M., 1982, A cytauxzoonosis-like disease in a cat in Zimbabwe,
Zimbabwe Vet J 13, 28-29.
Garner, M.M., Lung, N.P., Citino, S., Greiner, E.C., Harvey, J.W., Homer, B.L., 1996, Fatal
cytauxzoonosis in a captive-reared white tiger (Panthera tigris). Vet Pathol 33, 82-86.
Glenn, B.L., Kocan, A.A., Blouin, E.F., 1983, Cytauxzoonosis in bobcats. J Am Vet Med Assoc
183, 1155-1158.
![Page 49: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/49.jpg)
40
Glenn, B.L., Rolley, R.E., Kocan, A.A., 1982, Cytauxzoon-like piroplasms in erythrocytes of
wild-trapped bobcats in Oklahoma. J Am Vet Med Assoc 181, 1251-1253.
Glenn, B.L., Stair, E.L., 1984, Cytauxzoonosis in domestic cats: report of two cases in
Oklahoma, with a review and discussion of the disease. J Am Vet Med Assoc 184, 822-
825.
Greene, C.E., Latimer, K., Hopper, E., Shoeffler, G., Lower, K., Cullens, F., 1999,
Administration of diminazene aceturate or imidocarb dipropionate for treatment of
cytauxzoonosis in cats. J Am Vet Med Assoc 215, 497-500, 482.
Guzman, J.N., Garcia, F.J., Garrote, G., Perez de Ayala, R., Iglesias, M.C., 2003, Resultados del
censo diagnostico de las poblaciones de lince iberico (Lynx pardinus) en Espana (2002).
In proceedings: VI Jornadas de la Sociedad Espanola para la Conservacion y el Estudio
de los Mamiferos- an Iberian Conference, Secretaria de la SECEM (ed.). SECEM, Apdo.
15450, 29080, Malaga, Spain, 89.
Haber, M.D., Tucker, M.D., Marr, H.S., Levy, J.K., Burgess, J., Lappin, M.R., Birkenheuer, A.J.,
2007, The detection of Cytauxzoon felis in apparently healthy free-roaming cats in the
USA. Vet Parasitol 146, 316-320.
Harvey, J.W., Dunbar, M.R., Norton, T.M., Yabsley, M.J., 2007, Laboratory findings in acute
Cytauxzoon felis infection in cougars (Puma concolor couguar) in Florida. J Zoo Wildlife
Med 38, 285-291.
Hauck, W.N., Snider, T.G., Lawrence, J.E., 1982, Cytauxzoonosis in a native Louisiana cat, J
Am Vet Med Asso 180, 1472-1474.
![Page 50: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/50.jpg)
41
Hazen-Karr, C.G., Kocan, A.A., Kocan, K.M., Hair, J.A., 1987, The ultrastructure of sporogony
in Theileria cervi (Bettencourt et al., 1907) in salivary glands of female Amblyomma
americanum (L.) ticks. J Parasitol 73, 1182-1188.
Hillis, D.M., Dixon, M.T., 1991, Ribosomal DNA: molecular evolution and phylogenetic
inference. Q Rev Biol 66, 411-453.
Hoover, J.P., Walker, D.B., Hedges, J.D., 1994, Cytauxzoonosis in cats: eight cases (1985-1992).
J Am Vet Med Assoc 205, 455-460.
Jackson, C.B., Fisher, T., 2006, Fatal cytauxzoonosis in a Kentucky cat (Felis domesticus). Vet
Parasitol 139, 192-195.
Jacobson, L.S., Schoeman, T., Lobetti, R.G., 2000, A survey of feline babesiosis in South Africa.
J S Afr Vet Assoc 71, 222-228.
Jakob, W., Wesemeier, H.H., 1996, A fatal infection in a Bengal tiger resembling
cytauxzoonosis in domestic cats. J Comp Pathol 114, 439-444.
Jardine, J.E., 1992, The pathology of cytauxzoonosis in a tsessebe (Damaliscus lunatus). J S Afr
Vet Assoc 63, 49-51.
Joyner, P.H., Reichard, M.V., Meinkoth, J.H., Milne, V.E., Confer, A.W., Kocan, A.A., Hoover,
J.P., 2007, Experimental infection of domestic cats (Felis domesticus) with Cytauxzoon
manul from Pallas' cats (Otocolobus manul). Vet Parasitol 146, 302-306.
Keirans, J.E., Lacombe, E.H., 1998, First records of Amblyomma americanum, Ixodes (Ixodes)
dentatus, and Ixodes (Ceratixodes) uriae (Acari: Ixodidae) from Maine. J Parasitol 84,
629-631.
![Page 51: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/51.jpg)
42
Ketz-Riley, C.J., Reichard, M.V., Van Den Bussche, R.A., Hoover, J.P., Meinkoth, J., Kocan,
A.A., 2003, An intraerythrocytic small piroplasm in wild-caught Pallas's cats
(Otocolobus manul) from Mongolia. J Wildlife Dis 39, 424-430.
Kier, A.B., Wagner, J.E., Kinden, D.A., 1987, The pathology of experimental cytauxzoonosis. J
Comp Pathol 97, 415-432.
Kier, A.B., Wagner, J.E., Morehouse, L.G., 1982a, Experimental Transmission of Cytauxzoon
felis from Bobcats (Lynx rufus) to Domestic Cats (Felis domesticus). Am J Vet Res 43,
97-101.
Kier, A.B., Wightman, S.R., Wagner, J.E., 1982b, Interspecies transmission of Cytauxzoon felis.
Am J Vet Res 43, 102-105.
Kocan, A.A., Blouin, E.F., Glenn, B.L., 1985, Hematologic and serum chemical values for free-
ranging bobcats, Felis rufus (Schreber), with reference to animals with natural infections
of Cytauxzoon felis Kier, 1979. J Wildlife Dis 21, 190-192.
Kocan, A.A., Kjemtrup, A., Meinkoth, J., Whitworth, L.C., Murphy, G.L., Decker, L., Lorenz,
M., 2001, A genotypically unique Babesia gibsoni-like parasite recovered from a dog in
Oklahoma. J Parasitol 87, 437-438.
Kocan, A.A., Kocan, K.M., 1991, Tick-transmitted diseases of wildlife in North America. Bull
Soc Vector Eco 16, 94-108.
Kocan, A.A., Kocan, K.M., Blouin, E.F., Mukolwe, S.W., 1992, A Redescription of schizogony
of Cytauxzoon felis in the domestic cat. Ann Ny Acad Sci 653, 161-167.
Kocan, K.M., Wickwire, K.B., Ewing, S.A., Hair, J.A., Barron, S.J., 1988, Preliminary studies of
the development of Anaplasma marginale in salivary glands of adult, feeding
Dermacentor andersoni ticks. Am J Vet Res 49, 1010-1013.
![Page 52: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/52.jpg)
43
Kocan, A.A., Waldrup, K.A., 2001, In: Samuel, W.M., Pybus, M.J., Kocan, A.A. (Eds.),
Parasitic Diseases of Wild Mammals. Iowa State University Press, Ames, Iowa, 524-536.
Koch, H.G., Dunn, J.C., 1980a, Ticks collected from small and medium-sized wildlife hosts in
LeFlore County, Oklahoma. Southwestern Ent 5, 214-221.
Levine, N.D., Corliss, J.O., Cox, C.E., Deroux, G., Grain, J., Honigberg, B.M., Leedale, G.F.,
Loeblich, A.R., Lom, J., Lynn, D., Merinfeld, E.G., Page, F.C., Poljansky, G., Sprague,
V., Vavra, J., Wallace, F.G., 1980, A newly revised classification of the protozoa. J
Protozoology 27, 37-58.
Lopez-Rebollar, L.M., Penzhorn, B.L., de Waal, D.T., Lewis, B.D., 1999, A possible new
piroplasm in lions from the Republic of South Africa. J Wildlife Dis 35, 82-85.
Luaces, I., Aguirre, E., Garcia-Montijano, M., Velarde, J., Tesouro, M.A., Sanchez, C., Galka,
M., Fernandez, P., Sainz, A., 2005, First report of an intraerythrocytic small piroplasm in
wild Iberian lynx (Lynx pardinus). J Wildlife Dis 41, 810-815.
McCully, R.M., Keep, M.E., Basson, P.A., 1970, Cytauxzoonosis in a giraffe (Giraffa
camelopardalis (Linnaeus, 1758)) in Zululand. Onderstepoort J Vet Res 37, 7-9.
Meier, H.T., Moore, L.E., 2000, Feline cytauxzoonosis: A case report and literature review. J
Am Anim Hosp Assoc 36, 493-496.
Meinkoth, J., Kocan, A.A., Whitworth, L., Murphy, G., Fox, J.C., Woods, J.P., 2000, Cats
surviving natural infection with Cytauxzoon felis: 18 cases (1997-1998). J Vet Intern Med
14, 521-525.
Meinkoth, J.H., Kocan, A.A., 2005, Feline cytauxzoonosis. Vet Clin N Am-Small 35, 89.
Mendes-de-Almeida, F., Faria, M.C., Branco, A.S., Serrao, M.L., Souza, A.M., Almosny, N.,
Charme, M., Labarthe, N., 2004, Sanitary conditions of a colony of urban feral cats (Felis
![Page 53: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/53.jpg)
44
catus Linnaeus, 1758) in a zoological garden of Rio de Janeiro, Brazil. Rev Inst Med
Trop Sao Paulo 46, 269-274.
Millan, J., Naranjo, V., Rodriguez, A., de la Lastra, J.M., Mangold, A.J., de la Fuente, J., 2007,
Prevalence of infection and 18S rRNA gene sequences of Cytauxzoon species in Iberian
lynx (Lynx pardinus) in Spain. Parasitology 134, 995-1001.
Motzel, S.L., Wagner, J.E., 1990, Treatment of experimentally induced cytauxzoonosis in cats
with parvaquone and buparvaquone. Vet Parasitol 35, 131-138.
Neitz, W.O., Thomas, A.D., 1948, Cytauxzoon sylvicaprae gen. nov., spec. nov., a protozoon
responsible for a hitherto undescribed disease in the duiker, Sylvicapra grimmia (Linne).
Onderstepoort J Vet Sci Anim Ind 23, 63-76.
Neitz, W.O., 1957, Theileriosis, gonderioses and cytauxzoonoses. A review. Onderstepoort J Vet
Res 27, 275-430.
Neitz, W.O., 1964, Cytauxzoonosis in African antelopes, Bulletin de l'Office International des
Epizooties 62, 1009-1015.
Nietfeld, J.C., Pollock, C., 2002, Fatal cytauxzoonosis in a free-ranging bobcat (Lynx rufus). J
Wildlife Dis 38, 607-610.
Nijhof, A.M., Pillay, V., Steyl, J., Prozesky, L., Stoltsz, W.H., Lawrence, J.A., Penzhorn, B.L.,
Jongejan, F., 2005, Molecular characterization of Theileria species associated with
mortality in four species of African antelopes. J Clin Microbiol 43, 5907-5911.
Nowell, K., Jackson, P., 1996, Wild cats: status survey and conservation action plan. IUCN,
Gland, Switzerland.
![Page 54: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/54.jpg)
45
Olivier, C., van de Pas, S., Lepp, P.W., Yoder, K., Relman, D.A., 2001, Sequence variability in
the first internal transcribed spacer region within and among Cyclospora species is
consistent with polyparasitism. Int J Parasitol 31, 1475-1487.
Peixoto, P.V., Soares, C.O., Scofield, A., Santiago, C.D., Franca, T.N., Barros, S.S., 2007, Fatal
cytauxzoonosis in captive-reared lions in Brazil. Vet Parasitol 145, 383-387.
Pena, L., Garcia, P., Fernandez, P., Galka, M., Benito, A., Sanchez, C., 2003, Histological
evidences of immunodeficiency in Iberian lynx (Lynx pardinus). In Proceedings: 21st
Annual Conference of the European Society of Veterinary Pathologists, Dublin.
Penzhorn, B.L., 2006, Babesiosis of wild carnivores and ungulates. Vet Parasitol 138, 11-21.
Penzhorn, B.L., Schoeman, T., Jacobson, L.S., 2004, Feline babesiosis in South Africa: a review.
Ann N Y Acad Sci 1026, 183-186.
Phipps, L.P., Otter, A., 2004, Transplacental transmission of Theileria equi in two foals born and
reared in the United Kingdom. Vet Rec 154, 406-408.
Reichard, M.V., Baum, K.A., Cadenhead, S.C., Snider, T.A., 2008a, Temporal occurrence and
environmental risk factors associated with cytauxzoonosis in domestic cats. Vet Parasitol
152, 314-320.
Reichard, M.V., Meinkoth, J.H., Edwards, A.C., Snider, T.A., Kocan, K.M., Blouin, E.F., Little,
S.E., 2008b, Transmission of Cytauxzoon felis to a domestic cat by Amblyomma
americanum. Vet Parasitol.
Reichard, M.V., Meinkoth, J.H., Edwards, A.C., Snider, T.A., Kocan, K.M., Blouin, E.F., Little,
S.E., 2009, Transmission of Cytauxzoon felis to a domestic cat by Amblyomma
americanum. Vet Parasitol 161, 110-115.
![Page 55: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/55.jpg)
46
Reichard, M.V., Van Den Bussche, R.A., Meinkoth, J.H., Hoover, J.P., Kocan, A.A., 2005, A
new species of Cytauxzoon from Pallas' cats caught in Mongolia and comments on the
systematics and taxonomy of piroplasmids. J Parasitol 91, 420-426.
Rotstein, D.S., Taylor, S.K., Harvey, J.W., Bean, J., 1999, Hematologic effects of
cytauxzoonosis in Florida panthers and Texas cougars in Florida. J Wildlife Dis 35, 613-
617.
Schoeman, T., Lobetti, R.G., Jacobson, L.S., 2001, Feline babesiosis: signalment, clinical
pathology, and co-infection. J S Afr Vet Assoc 72, 4-11.
Scofield, A., 2006, Analises genotipica e filogenetica do gene 18S RNAr de isolados brasileiros
de Cytauxzoon felis (Apicomplexa: Theileriidae), Thesis, Universidad Federal Rural do
Rio de Janeiro, Brazil.
Semtner, P.J., Hair, J.A., 1973a, The ecology and behavior of the lone star tick (Acarina:
Ixodidae). IV. The daily and seasonal activity patterns of adults in different habitat types.
J Med Entomol 10, 337-344.
Semtner, P.J., Hair, J.A., 1973b, The ecology and behavior of the lone star tick (Acarina:
Ixodidae). V. Abundance and seasonal distribution in different habitat types. J Med
Entomol 10, 618-628.
Semtner, P.J., Sauer, J.R., Hair, J.A., 1973, The ecology and behavior of the lone star tick
(Acarina: Ixodidae). 3. The effect of season on molting time and post-molt behavior of
engorged nymphs and adults. J Med Entomol 10, 202-205.
Shindel, N., Dardiri, A.H., Ferris, D.H., 1978, Indirect Fluorescent-Antibody Test for Detection
of Cytauxzoon-Like Organisms in Experimentally Infected Cats. Can J Comp Med 42,
460-465.
![Page 56: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/56.jpg)
47
Simpson, C.F., Harvey, J.W., Carlisle, J.W., 1985, Ultrastructure of the intraerythrocytic stage of
Cytauxzoon felis. Am J Vet Res 46, 1178-1180.
Snider, T.A., Confer, A.W., Payton, M.E., 2010, Pulmonary histopathology of Cytauxzoon felis
infections in the cat. Vet Pathol. (In press).
Sonenshine, D.E., Levy, G.F., 1971, The ecology of the lone star tick, Amblyomma americanum
(L.), in two contrasting habitats in Virginia (Acarina: Ixodidae). J Med Entomol 8, 623-
635.
Susta, L., Torres-Velez, F., Zhang, J., Brown, C., 2009, An in situ hybridization and
immunohistochemical study of cytauxzoonosis in domestic cats. Vet Pathol 46, 1197-
1204.
Uilenberg, G., Franssen, F.F., Perie, N.M., 1987, Relationships between Cytauxzoon felis and
African piroplasmids. Vet Parasitol 26, 21-28.
Wagner, J.E., 1976, A fatal cytauxzoonosis-like disease in cats. J Am Vet Med Assoc 168, 585-
588.
Wagner, J.E., Morehouse, L.G., 1976, Animal susceptibility studies with a Cytauxzoon agent of
feline origin. J Am Vet Med Assoc 169, 1135-1135.
Walker, D.B., Cowell, R.L., 1995, Survival of a domestic cat with naturally acquired
cytauxzoonosis. J Am Vet Med Assoc 206, 1363-1365.
Weisman, J.L., Woldemeskel, M., Smith, K.D., Merrill, A., Miller, D., 2007, Blood smear from a
pregnant cat that died shortly after partial abortion. Vet Clin Path 36, 209-211.
Wenyon, C.M., Hamerton, A.E., 1930, Piroplasms of the West African civet cat (Viverra civetta)
and the Bay lynx (Felis rufa) of North America. Roy Soc Trop Med and Hyg, 24, 7-8.
![Page 57: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/57.jpg)
48
Wightman, S.R., Kier, A.B., Wagner, J.E., 1977, Feline cytauxzoonosis: clinical features of a
newly described blood parasite disease. Feline Pract, 24-26.
Wilson, D.E., Bartsch, R.C., Bigalke, R.D., Thomas, S.E, 1974, Observations on mortality rates
and disease in roan and sable antelope in nature reserves in the Transvall. J S African
Wildl Manag Asso 4, 203-206.
Wilson, D.E., Hirst, S.M., 1977, Ecology and factors limiting roan and sable antelope
populations in South Africa, Wildl Monographs 54.
Yabsley, M.J., Murphy, S.M., Cunningham, M.W., 2006, Molecular detection and
characterization of Cytauxzoon felis and a Babesia species in cougars from Florida. J
Wildlife Dis 42, 366-374.
Zahler, M., Schein, E., Rinder, H., Gothe, R., 1998, Characteristic genotypes discriminate
between Babesia canis isolates of differing vector specificity and pathogenicity to dogs.
Parasitol Res 84, 544-548.
Zinkl, J.G., Mcdonald, S.E., Kier, A.B., Cippa, S.J., Small, P.J., 1981, Cytauxzoon-like
organisms in erythrocytes of 2 cheetahs. J Am Vet Med Assoc 179, 1261-1262.
![Page 58: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/58.jpg)
49
CHAPTER 2
DISTRIBUTION OF CYTAUXZOON FELIS IN BOBCATS, LYNX RUFUS, FROM THIRTEEN
STATES1
1Shock, Barbara C., Staci M. Murphy, Laura L. Patton, Philip M. Shock, Colleen Olfenbuttel, Jeff Beringer, Suzanne Prange, Daniel M. Grove, Matt Peek, Jay Butfiloski, Daymond W. Hughes, J. Mitchell Lockhart, Sarah Bevins, Victor F. Nettles, Holly M. Brown, David S. Peterson, and Michael J. Yabsley. 2010. Submitted to Veterinary Parasitology.
![Page 59: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/59.jpg)
50
Abstract Cytauxzoon felis, a protozoan parasite of wild and domestic felids, is the causative agent
of cytauxzoonosis in domestic and some exotic felids in the United States. Previous research has
identified the bobcat (Lynx rufus) as the natural reservoir for this parasite. C. felis has been
experimentally transmitted by two tick species, Dermacentor variabilis and Amblyomma
americanum, which have overlapping distributions throughout the southeastern United States.
Our objective of the current study was to determine the distribution and prevalence of C. felis in
free-ranging bobcat populations from 13 states including California, Colorado, Florida, Georgia,
Kansas, Kentucky, Missouri, North Carolina, North Dakota, Ohio, Oklahoma, South Carolina,
and West Virginia). These states were selected because D. variabilis is present in each state, but
A. americanum is only currently known to be present in a subset of these states. Blood or spleen
samples from 697 trapper harvested or road-killed bobcats were tested for C. felis infection by a
polymerase chain reaction (PCR) assay which targets the first ribosomal internal transcribed
spacer region (ITS-1). Significantly higher prevalences of C. felis were detected from Missouri
(79%, n=39), North Carolina (63%, n=8), Oklahoma (60%, n=20), South Carolina (57%, n=7),
Kentucky (55%, n=74), Florida (44%, n=45), and Kansas (27%, n=41) compared with Georgia
(9%, n=159), North Dakota (2.4%, n=124), Ohio (0%, n=19), and West Virginia (0%, n=37). In
addition to bobcats, we tested a limited number of samples (n=8) from other wild felids and only
one cougar (Puma concolor) from Louisiana was positive, which represents the first report in an
infected cougar outside the Florida panther population. These data also indicate that C. felis is
present in North Dakota where C. felis has not been reported in domestic cats. Based on linear
regression analysis, prevalence rates were significantly higher in states where there are
established populations of A. americanum, which supports recent data on the experimental
![Page 60: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/60.jpg)
51
transmission of C. felis by A. americanum and the fact that domestic cat cases are temporally
associated with A. americanum activity. Collectively, these data confirm that bobcats are a
common reservoir for C. felis and that A. americanum likely is an epidemiologically important
vector.
Introduction
Piroplasms in the genus Cytauxzoon (Family Theileridae) are related to members of the
genera Theileria and Babesia, and Cytauxzoon spp. are increasingly reported in domestic and
wild felid species worldwide (Luaces et al., 2005; Criado-Fiarello et al., 2004; Pexioto et al.,
2005; Ketz-Riley et al., 2000). The genera Cytauxzoon is currently restricted to felid species due
to the schizogenous replication in mononuclear phagocytes (Nijhof et al., 2005). Other
Cytauxzoon sp. previously described in African ungulates have since been reclassified as
Theileria spp. (Nijhof et al., 2005). In the United States, only one species, Cytauxzoon felis, has
been detected and it is an emerging infectious pathogen of domestic cats in Southeastern,
Midwestern, and Mid-Atlantic States (Wagner, 1976; Ferris, 1979; Kier et al., 1982b;
Birkenheuer et al., 2006). Cytauxzoon spp. are vectored by Ixodid ticks, and C. felis has been
experimentally transmitted by two ticks, Dermacentor variabilis and Amblyomma americanum
(Blouin et al., 1984; Kocan et al., 1992; Reichard et al., 2009; Edwards et al., 2010).
C. felis was first described in domestic cats from Missouri in 1976 (Wagner, 1976). Since
that time, C. felis has been detected in domestic cats (Felis catus) from numerous states
including Alabama, Arkansas, Florida, Georgia, Kansas, Kentucky, Louisiana, Mississippi,
Missouri, North Carolina, Oklahoma, South Carolina, Tennessee, Texas, and Virginia (Bendele
et al., 1976; Wagner, 1976, Wightman et al., 1977; Ferris, 1979; Glenn and Stair, 1982; Hauck,
![Page 61: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/61.jpg)
52
1982; Kocan and Kocan, 1991; Meier and Moore, 2000; Birkenheuer et al., 2006; Haber et al.,
2007). Historically, infection with the parasite was considered uniformly fatal for domestic cats
due to the development of acute clinical cytauxzoonosis (Ferris, 1979). The pathognomonic sign
of C. felis infection in the domestic cat, occlusion of blood vessels by schizont-laden
macrophages, is also presumed to be responsible for much of the observed morbidity and
mortality. Recently, however, research and surveillance studies have indicated that some
domestic cats can survive infection and become persistently parasitemic (Kier et al., 1982b;
Meinkoth and Kocan, 2005; Haber et al., 2007; Brown et al., 2008).
The bobcat (Lynx rufus) is considered to be the natural reservoir for C. felis in the United
States (Kier et al., 1982a; Kier et al., 1982b; Glenn et al., 1983; Glenn and Stair; Blouin et al.,
1984). Naturally infected bobcats rarely display clinical signs and there is only one report from
Kansas of a naturally infected young bobcat dying of clinical cytauxzoonosis (Nietfeld and
Pollock, 2002). Experimental studies have shown that bobcats can develop acute cytauxzoonosis
when inoculated with schizogenous stages of the parasite, but no clinical signs were observed
when the bobcats were inoculated with the intraerythrocytic stages (Kier et al., 1982b; Glenn et
al., 1983) Similarly, bobcats experimentally infected via tick transmission typically have a
limited schizogenous phase which leads to a long-term subclinical parasitemia (Blouin et al.
1987). Few studies have examined the prevalence of the parasite within bobcat population, but
previously, high prevalences were detected in Oklahoma (31%-60%) and North Carolina (33%)
and a low prevalence was detected in Pennsylvania (7%) (Glenn et al., 1982; Glenn et al., 1983;
Kocan and Blouin, 1985; Birkenheuer et al., 2008).
C. felis has also infected other felids in Florida including free-ranging panthers (Puma
concolor) and a captive white tiger (Panthera tigris) (Butt et al., 1991; Rotstein et al., 1999;
![Page 62: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/62.jpg)
53
Garner et al., 1996). The tiger died of acute cytauxzoonosis. In the endangered Florida panther
populations, C. felis has been described as causing mild hemolytic anemia and liver damage, but
no deaths have been attributed to the parasite (Yabsley et al., 2006; Harvey et al., 2007). Free-
ranging cougars may therefore be another natural, subclinical reservoir for C. felis.
In the current study, we conducted a comprehensive study of the distribution and
prevalence of C. felis in free-ranging bobcat populations from thirteen states. Limited cougar
samples from three other states were included in the study as well as one serval sample
(Leptailurus serval). The objective of this project was to gain a better understanding of the
natural history of the parasite within wild felid populations with the hope of increasing the health
of domestic, exotic, and wild felids in the United States.
Materials and Methods
Sample collection
Samples were collected opportunistically from a variety of sources including trapper-
harvested, road-killed, or clinical case submissions of mortalities. Spleen samples were either
collected from fresh carcasses and frozen at -20 C prior to DNA extraction or entire carcasses
were frozen and later necropsied to collect spleen samples. When fresh carcasses were available,
a blood sample was collected from the heart or thoracic cavity. From 1999 to 2010, 697 blood or
spleen samples were collected from as many bobcats from thirteen states (California, Colorado,
Florida, Georgia, Kansas, Kentucky, Missouri, North Carolina, North Dakota, Ohio, Oklahoma,
South Carolina, and West Virginia; Figure 1). Additionally, seven cougar samples were collected
from Georgia (n=1), Louisiana (n=1), and North Dakota (n=5) and one escaped exotic serval
(genus species) sample was collected from Louisiana.
![Page 63: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/63.jpg)
54
Molecular Analysis
Genomic DNA was extracted from100μl of whole blood or 10 mg spleen using the
Qiagen DNA Purification Kit (Germantown, MD) following the manufacturer’s protocol. A
nested PCR protocol was used that amplifies the entire internal transcribed spacer (ITS)-1 rRNA
region of most piroplasms including Cytauxzoon, Babesia, and Theileria spp. (Bostrom et al.,
2008). Briefly, for primary amplification, 5 μl of DNA was added to 20 μl of a master mix
containing 10 mM Tris-Cl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM each dNTP (Promega,
Madison, Wisconsin), 2.5 units Taq DNA Polymerase (Promega), and 0.8 μM of primers ITS-
15C (5’-CGATCGAGTGATCCGGTGAATTA) and ITS-13B (5’-
GCTGCGTCCTTCATCGTTGTG). Cycling parameters were 94 C for 1 min followed by 35
cycles of 94 C for 30 sec, 52 C for 30 sec, 72 C for 1 min, and a final extension at 72 C for 5
min. For the nested PCR, 1 μl of primary product was used as template in a 25 μl reaction
containing the same PCR components except primers, ITS-15D (5’-
AAGGAAGGAGAAGTCGTAACAAGG) and ITS-13C (5’-
TTGTGTGAGCCAAGACATCCA) were used. The cycling parameters were the same as the
primary reaction except the annealing temperature was 49 C.
To prevent and detect contamination, DNA extraction, primary and secondary
amplification, and product analysis were done in separate dedicated areas. A negative water
control was included in each set of DNA extraction, and a different water control was included in
each set of primary and secondary PCR reactions. All amplicons of approximately 550 bp were
purified with a Qiagen gel extraction kit (Germantown, MD) and bi-directionally sequenced at
the University of Georgia Integrated Biotechnology Laboratory (Athens, GA).
![Page 64: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/64.jpg)
55
Data Analysis
Linear regression and chi-square analysis were performed using MiniTab version 16
statistical software.
Results
Based on PCR testing and sequence analysis, 138 of the 697 (20%) bobcats were positive
for C. felis (Table 1). and infected bobcats were detected in all states except California,
Colorado, Ohio, and West Virginia. Significantly higher prevalence rates (>50%) were detected
in Kentucky (55%), South Carolina (57%), North Carolina (63%), Oklahoma (65%), and
Missouri (79%) (Table 2.1). All amplicons were sequenced and confirmed to be C. felis. A
limited number of bobcats had positive amplification with our PCR protocol but were
determined to be infected with other protozoan parasites (e.g. Heptazoon spp., Toxoplasma
gondii, and Babesia spp.).
All states in this study have reported the presence of D. variabilis, but A. americanum has
not been reported from California, Colorado, or North Dakota and only low prevalences have
been reported from southern Ohio and West Virginia. Simple linear regression (y= 0.004 +
0.49x) showed that a high prevalence of A. americanum in a state was significantly correlated
with a higher prevalence of C. felis in bobcats (F= 22.89, p= 0.001). No sex differences in C.
felis infection rate were seen in the bobcat populations. Chi-squre analysis revealed that there
were significant differences in prevalences between states (Table 2.1). Although limited
numbers of other free-ranging felids were tested, we detected C. felis in a single panther from
Louisiana.
![Page 65: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/65.jpg)
56
Discussion
This is the most comprehensive study of the distribution and prevalence of C. felis in
bobcats, the natural wildlife reservoir of C. felis in the United States. A total of 707 felids from
fourteen states were examined for the parasite. Because C. felis prevalence is higher in wild
felids compared with domestic cats, testing of wild felids provides a more sensitive method to
determine the distribution and prevalence of C. felis in the United States. Interestingly, we
detected a low prevalence of C. felis in North Dakota which is the first report of C. felis in any
felid from this state as well as the most northerly report of C. felis since Birkenheuer et al. (2008)
reported the parasite in free-ranging bobcats from Pennsylvania. In addition, we detected a C.
felis positive cougar in Louisiana which represents the first report of C. felis in a cougar outside
the state of Florida. Although C. felis has been reported in domestic cats from Georgia,
Kentucky, and South Carolina, this is the first report of C. felis from a free-ranging wild felid in
these states.
We found a significant correlation between higher prevalence rates of C. felis in states
where both confirmed tick vectors are known to be present and common. These data are in
agreement with reports of clinical cytauxzoonosis in domestic cats which only been reported
from Southeastern, Midwestern, and Mid-Atlantic states, but not from California, Colorado,
North Dakota, Ohio, or West Virginia. Of all the states where A. americanum numbers are low to
absent, C. felis was only reported in North Dakota (2%). North Dakota is well outside the known
range of A. americanum, which is not reported to be north of Iowa or west of Nebraska (CDC,
2009), although unpublished reports of A. americanum exist for South Dakota (M. Wimberly,
unpublished data). Aside from the prevalence of the state of Georgia (9%), all other prevalences
![Page 66: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/66.jpg)
57
were above 30%. These field data suggest that A. americanum may play a more primary role in
the maintenance and dissemination of the parasite in wild felids. Recent tick transmission studies
have indicated that A. americanum may be a more competent vector of C. felis than D. variabilis
as in repeated trials the latter was an unsuccessful vector whereas A. americanum transstadially
transmitted the parasite under identical situations (Reichard et al., 2009; Edwards et al., 2010).
Additionally, C. felis has only been detected from wild-caught questing A. americanum from
Oklahoma (MIR 0.5-1.5%), while there is no report of C. felis from questing D. variabilis
(Edwards et al., 2010).
Most of the information about the about the status of L. rufus as a reservoir for C. felis
was determined by studies on Oklahoma bobcats in the 1980s (Kier et al., 1982a; Kier et al.,
1982b; Kocan and Blouin, 1985; Blouin et al., 1987) which revealed high prevalences of
subclinical infection with C. felis (31-60%). A study by Birkenheuer et al. (2008) also revealed a
prevalence of C. felis infection in bobcats from North Carolina (33%), which the data from this
study supports (63%). This study indicates that C. felis is more widespread and prevalent in
bobcat populations than previously suspected. The high prevalences observed in presumably
healthy free-ranging wild felids are further confirmation of L. rufus as the primary reservoir for
the parasite. While no felids in this study died of clinical cytauxzoonosis, experimental animals
and the of naturally infected young bobcat dying of cytauxzoonosis suggest that some bobcats
die of C. felis each year, undetected. Molecular characterization of C. felis detected in domestic
cats from Arkansas and Georgia suggest that there are strains of C. felis circulating in domestic
cat which varying in their pathogenicity (Brown et al., 2009a; Brown et al., 2009b). Domestic
cats which become persistently parasitemic can in turn become a reservoir for wild felids.
![Page 67: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/67.jpg)
58
Acknowledgements The authors thank numerous personnel from state agencies who collected felid samples. This
study was primarily funded by the Morris Animal Foundation (DO8FE-003). Additional support
was provided by the Federal Aid to Wildlife Restoration Act (50 Stat. 917) and through
sponsorship from fish and wildlife agencies in Alabama, Arkansas, Florida, Georgia, Kansas,
Kentucky, Louisiana, Maryland, Mississippi, Missouri, North Carolina, Oklahoma, Puerto Rico,
South Carolina, Tennessee, Virginia, and West Virginia.
References Bendele, R.A., Schwartz, W.L., Jones, L.P.,1976, Cytauxzoon-like disease in Texas cats.
Southwest Vet 29, 244-246.
Birkenheuer, A.J., Marr, H., Alleman, A.R., Levy, M.G., Breitschwerdt, E.B., 2006,
Development and evaluation of a PCR assay for the detection of Cytauxzoon felis DNA
in feline blood samples. Vet Parasitol 137, 144-149.
Birkenheuer, A.J., Marr, H.S., Warren, C., Acton, A.E., Mucker, E.M., Humphreys, J.G., Tucker,
M.D., 2008, Cytauxzoon felis infections are present in bobcats (Lynx rufus) in a region
where cytauxzoonosis is not recognized in domestic cats. Vet Parasitol 153, 126-130.
Blouin, E.F., Kocan, A.A., Glenn, B.L., Kocan, K.M., Hair, J.A., 1984, Transmission of
Cytauxzoon felis Kier, 1979 from bobcats, Felis rufus (Schreber), to domestic cats by
Dermacentor variabilis (Say). J Wildl Dis 20, 241-242.
Blouin, E.F., Kocan, A.A., Kocan, K.M., Hair, J., 1987, Evidence of a limited schizogonous
cycle for Cytauxzoon felis in bobcats following exposure to infected ticks. J Wildlife Dis
23, 499-501.
![Page 68: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/68.jpg)
59
Bostrom, B., Wolf, C., Greene, C., Peterson, D.S., 2008, Sequence conservation in the rRNA
first internal transcribed spacer region of Babesia gibsoni genotype Asia isolates. Vet
Parasitol 152, 152-157.
Brown, H.M., Berghaus, R.D., Latimer, K.S., Britt, J.O., Rakich, P.M., Peterson, D.S., 2009,
Genetic variability of Cytauxzoon felis from 88 infected domestic cats in Arkansas and
Georgia. J Vet Diagn Invest 21, 59-63.
Brown, H.M., Modaresi, S.M., Cook, J.L., Latimer, K.S., Peterson, D.S., 2009, Genetic
variability of archived Cytauxzoon felis histologic specimens from domestic cats in
Georgia, 1995-2007. J Vet Diagn Invest 21, 493-498.
Brown, H.M., Latimer, K.S., Erikson, L.E., Cashwell, M.E., Britt, J.O., Peterson, D.S., 2008,
Detection of persistent Cytauxzoon felis infection by polymerase chain reaction in three
asymptomatic domestic cats. J Vet Diagn Invest 20, 485-488.
Butt, M.T., Bowman, D., Barr, M.C., Roelke, M.E., 1991, Iatrogenic transmission of Cytauxzoon
felis from a Florida panther (Felis concolor coryi) to a domestic cat. J Wildl Dis 27, 342-
347.
Criado-Fornelio, A., Gonzalez-del-Rio, M.A., Buling-Sarana, A., Barba-Carretero, J.C., 2004,
The "expanding universe" of piroplasms. Vet Parasitol 119, 337-345.
Edwards, A.C., Reichard, M.V., Meinkoth, J.H., Snider, T.A., Meinkoth, K.R., Heinz, R.E.,
Little, S.E., 2010, Confirmation of Amblyomma americanum (Acari: Ixodidae) as a vector
for Cytauxzoon felis (Piroplasmorida: Theileriidae) to domestic cats. J Med Ent.
Ferris, D.H., 1979, A progress report on the status of a new disease of American cats:
cytauxzoonosis. Comp Immunol Microbiol Infect Dis 1, 269-276.
![Page 69: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/69.jpg)
60
Garner, M.M., Lung, N.P., Citino, S., Greiner, E.C., Harvey, J.W., Homer, B.L., 1996, Fatal
cytauxzoonosis in a captive-reared white tiger (Panthera tigris). Vet Pathol 33, 82-86.
Glenn, B.L., Kocan, A.A., Blouin, E.F., 1983, Cytauxzoonosis in bobcats. J Am Vet Med Assoc
183, 1155-1158.
Glenn, B.L., Rolley, R.E., Kocan, A.A., 1982, Cytauxzoon-like piroplasms in erythrocytes of
wild-trapped bobcats in Oklahoma. J Am Vet Med Assoc 181, 1251-1253.
Haber, M.D., Tucker, M.D., Marr, H.S., Levy, J.K., Burgess, J., Lappin, M.R., Birkenheuer, A.J.,
2007, The detection of Cytauxzoon felis in apparently healthy free-roaming cats in the
USA. Vet Parasitol 146, 316-320.
Hauck, W.N., Snider, T.G., Lawrence, J.E., 1982, Cytauxzoonosis in a native Louisiana cat, J
Am Vet Med Asso 180, 1472-1474.
Harvey, J.W., Dunbar, M.R., Norton, T.M., Yabsley, M.J., 2007, Laboratory findings in acute
Cytauxzoon felis infection in cougars (Puma concolor couguar) in Florida. J Zoo Wildlife
Med 38, 285-291.
Ketz-Riley, C.J., Reichard, M.V., Van Den Bussche, R.A., Hoover, J.P., Meinkoth, J., Kocan,
A.A., 2003, An intraerythrocytic small piroplasm in wild-caught Pallas's cats
(Otocolobus manul) from Mongolia. J Wildlife Dis 39, 424-430.
Kier, A.B., Wagner, J.E., Morehouse, L.G., 1982a, Experimental Transmission of Cytauxzoon
felis from Bobcats (Lynx rufus) to Domestic Cats (Felis domesticus). Am J Vet Res 43,
97-101.
Kier, A.B., Wightman, S.R., Wagner, J.E., 1982b, Interspecies Transmission of Cytauxzoon felis.
Am J Vet Res 43, 102-105.
![Page 70: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/70.jpg)
61
Kocan, A.A., Kocan, K.M., 1991, Tick-transmitted diseases of wildlife in North America. Bull
Soc Vector Eco 16, 94-108.
Kocan, A.A., Kocan, K.M., Blouin, E.F., Mukolwe, S.W., 1992, A Redescription of Schizogony
of Cytauxzoon felis in the Domestic Cat. Ann Ny Acad Sci 653, 161-167.
Luaces, I., Aguirre, E., Garcia-Montijano, M., Velarde, J., Tesouro, M.A., Sanchez, C., Galka,
M., Fernandez, P., Sainz, A., 2005, First report of an intraerythrocytic small piroplasm in
wild Iberian lynx (Lynx pardinus). J Wildlife Dis 41, 810-815.
Meier, H.T., Moore, L.E., 2000, Feline cytauxzoonosis: A case report and literature review. J
Am Anim Hosp Assoc 36, 493-496.
Meinkoth, J.H., Kocan, A.A., 2005, Feline cytauxzoonosis. Vet Clin N Am-Small 35, 89-+.
Nietfeld, J.C., Pollock, C., 2002, Fatal cytauxzoonosis in a free-ranging bobcat (Lynx rufus). J
Wildlife Dis 38, 607-610.
Nijhof, A.M., Pillay, V., Steyl, J., Prozesky, L., Stoltsz, W.H., Lawrence, J.A., Penzhorn, B.L.,
Jongejan, F., 2005, Molecular characterization of Theileria species associated with
mortality in four species of African antelopes. J Clin Microbiol 43, 5907-5911.
Peixoto, P.V., Soares, C.O., Scofield, A., Santiago, C.D., Franca, T.N., Barros, S.S., 2007, Fatal
cytauxzoonosis in captive-reared lions in Brazil. Vet Parasitol 145, 383-387.
Reichard, M.V., Meinkoth, J.H., Edwards, A.C., Snider, T.A., Kocan, K.M., Blouin, E.F., Little,
S.E., 2008, Transmission of Cytauxzoon felis to a domestic cat by Amblyomma
americanum. Vet Parasitol.
Rotstein, D.S., Taylor, S.K., Harvey, J.W., Bean, J., 1999, Hematologic effects of
cytauxzoonosis in Florida panthers and Texas cougars in Florida. J Wildlife Dis 35, 613-
617.
![Page 71: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/71.jpg)
62
Wagner, J.E., 1976, A fatal cytauxzoonosis-like disease in cats. J Am Vet Med Assoc 168, 585-
588.
Wightman, S.R., Kier, A.B., Wagner, J.E., 1977, Feline cytauxzoonosis: clinical features of a
newly described blood parasite disease. Feline Pract, 24-26.
Yabsley, M.J., Murphy, S.M., Cunningham, M.W., 2006, Molecular detection and
characterization of Cytauxzoon felis and a Babesia species in cougars from Florida. J
Wildlife Dis 42, 366-374.
![Page 72: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/72.jpg)
63
Table 2.1. Prevalence of Cytauxzoon felis in bobcats. Percentages with different letters are
significantly different (p<0.05).
State Tick species prevalent No.positive for C. felis/No.tested
(% infected)
California Dv 0/26 (0%) a
Colorado Dv 0/67 (0%) a
Ohio Dv 0/19 (0%) a
West Virginia Dv 0/37 (0%) a
North Dakota Dv 3/172 (2%) a
Georgia Dv and Aa 13/143 (9%) b
Kansas Dv and Aa 12/39 (31%) c
Florida Dv and Aa 16/45 (36%) c
Kentucky Dv and Aa 41/74 (55%) c
South Carolina Dv and Aa 4/7 (57%) c
North Carolina Dv and Aa 5/8 (63%) c
Oklahoma Dv and Aa 13/20 (65%) c, d
Missouri Dv and Aa 31/39 (79%) d
138/697
![Page 73: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/73.jpg)
64
Figure 2.1. Distribution of Cytauxzoon felis in bobcats. Light grey counties represent counties
from which bobcats and/or cougars were sampled. Dark grey counties that at least one positive
wild felid was detected.
![Page 74: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/74.jpg)
65
CHAPTER 3
EXTENSIVE GENETIC VARIABILITY OF CYTAUXZOON FELIS FROM BOBCATS (LYNX
RUFUS) AND COUGARS (PUMA CONCOLOR)
1Shock, Barbara C., Staci M. Murphy, Laura L. Patton, Philip M. Shock, Colleen Olfenbuttel, Jeff Beringer, Suzanne Prange, Daniel M. Grove, Matt Peek, Jay Butfiloski, Daymond W. Hughes, J. Mitchell Lockhart, Victor F. Nettles, Holly M. Brown, Adam J. Birkenheuer, David S. Peterson, and Michael J. Yabsley. 2010. To be submitted to Veterinary Parasitology.
![Page 75: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/75.jpg)
66
Abstract
Cytauxzoon felis, a tick-borne protozoan parasite, is the causative agent of
cytauxzoonosis in domestic cats in the United States. The natural reservoir for this parasite is the
bobcat, Lynx rufus, which typically develops only limited or no clinical signs of illness.
Although not likely important reservoirs, C. felis has also been detected in free-ranging Florida
panthers (Puma concolor coryii). Recent studies have identified specific genotypes of C. felis
circulating in domestic cats which are associated with different clinical outcomes and specific
spatial locations. In the current study, we investigated the intraspecific variation of the C. felis
internal transcribed spacer (ITS)-1 and ITS-2 rRNA regions from 153 bobcats and eight cougars
from 11 states (Florida, Georgia, Kansas, Kentucky, Louisiana, Missouri, North Carolina, North
Dakota, South Carolina, Oklahoma, and Pennsylvania). Unambiguous ITS-1 and ITS-2 data
were obtained for 131 and 106 samples, respectively, and both ITS-1 and ITS-2 sequences were
obtained for 82 (51%) samples. Within the ITS-1 region, sequences from 46 bobcats were
identified which were identical to those previously reported in domestic cats and we identified 60
unique sequences. Samples from 46 bobcats and one cougar had ITS-1 sequences identical to the
most common sequence reported from domestic cats. The most common ITS-2 sequence from
domestic cats was also common in wild felids (36 bobcats and a cougar). Five other ITS-2
sequences had been previously reported in domestic cats; the remaining ITS-1 and ITS-2
sequences from wild felids were novel. Samples from three Florida panthers and a bobcat from
MO had a 40/41-bp insert in the ITS-2 similar to one described previously in a cat from AR.
Additionally, a previously undescribed 198/199-bp insert was detected in the ITS-2 sequence
from in four bobcats. Collectively, nine bobcats and one cougar were infected with genotype
ITSA and two bobcats were infected with genotypes ITSB and ITSC. Eight bobcats from
![Page 76: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/76.jpg)
67
southwestern Georgia and northwestern Florida were infected with a novel genotype (ITSD).
These data indicate that based on ITS1 and ITS2 sequences, numerous C. felis strains circulate in
wild felids and that some genotypes may cluster in specific spatial locations.
Introduction
Cytauxzoon felis, a tick-borne protozoan parasite, is the causative agent of
cytauxzoonosis in domestic cats in the United States. The parasite was first identified in
domestic cats from Missouri, Texas and Arkansas in the 1970s (Bendele et al., 1976; Wagner,
1976; Wightman et al., 1977) and has subsequently been identified in domestic cats from
numerous southeastern, Midwestern, and Mid-Atlantic states (Wagner, 1976; Ferris, 1979; Kier
et al., 1982b; Birkenheuer et al., 2006). In domestic cats, C. felis infection causes erythrocyte
hemolysis and occlusion of the lumen of blood vessels by large schizont-laden mononuclear
phagocytes in the lungs, liver, lymph nodes, and spleen (Simpson et al., 1985; Kier et al., 1987;
Kocan and Kocan, 1991; Kocan et al., 1992). Historically, the mortality rate due to this parasite
was near100%; however, recent studies have discovered an increasing number of domestic cats
that have subclinical chronic infections (Ferris, 1979; Haber et al., 2007; Birkenheuer et al.,
2006). Both Amblyomma americanum (lone star tick) and Dermacentor variabilis (American dog
tick) are confirmed vectors. Both tick species are common in the southeastern and Midwestern
United states where the majority of C. felis infections have been identified (Blouin et al., 1984;
Kocan et al., 1992; Reichard et al., 2009; Edwards et al., 2010; Shock et al., submitted).
The bobcat (Lynx rufus) is considered to be the primary wildlife reservoir. High
prevalences of C. felis infections have been documented in bobcat populations (Lynx rufus) from
Missouri, Oklahoma, and North Carolina (Wagner, 1976; Glenn et al., 1983; Birkenheuer et al.,
![Page 77: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/77.jpg)
68
2008). Experimental and field-based studies indicate that the majority of infected bobcats suffer
no clinical disease; however, rare cases of experimental and natural infections can result in
mortality (Kier et al., 1982a; Kier et al., 1982b; Glenn et al., 1983; Blouin et al., 1984; Blouin et
al., 1987; Neitfeld and Pollock, 2002). For example, a bobcat experimentally inoculated with
schizogenous stages of the parasite died of acute cytauxzoonosis, while bobcats experimentally
infected via tick transmission only developed a limited schizogenous phase which lead to long-
term subclinical parasitemia (Kier et al., 1982a; Blouin et al. 1987). A single report of mortality
of a young bobcat from C. felis infection has been reported in Kansas (Nietfeld and Pollock,
2002). Florida panthers (Puma concolor coryii) have also been identified as a possible reservoir
for C. felis, although the parasite appears to cause a mild hemolytic anemia (Butt et al., 1991;
Yabsley et al., 2006; Harvey et al. 2007). Worldwide, Cytauxzoon spp. that are distinct from C.
felis, have been identified in numerous wild felid species (Luaces et al., 2005; Pexioto, 2005;
Ketz-Riley et al., 2003; Butt et al., 1991).
Increasing reports of subclinical infections that appear to be unrelated to treatment
(Birkenheuer et al,. 2006; Haber et al., 2007; Brown et al., 2008) suggest that different strains of
C. felis may differ in their virulence for domestic cats or that cats are evolving resistance to
clinical disease associated with this parasite. Currently there is no data on virulence genes for C.
felis, but two recent studies have examined genetic variation within the internal transcribed
spacer (ITS) regions of the ribosomal RNA genes (Brown et al., 2009a; Brown et al., 2009b).
These two studies identified several genotypes and numerous unique gene sequences in C. felis
samples from domestic cats from Georgia and Arkansas. Significant spatial correlations and
associations with clinical outcome were associated with specific genotypes (Brown et al.,
2009a). These data suggest that specific genotypes are associated with clinical outcome in
![Page 78: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/78.jpg)
69
domestic cats, and if confirmed, these genetic markers could be used to better predict the clinical
outcome and to guide treatment and management protocols (Brown et al., 2009a). Currently,
there is no information regarding the genetic variation among C. felis samples from wild felids in
the United States. We hypothesize that testing of wild felid samples will reveal additional
genotypes and that spatial correlations with genotype will be more easily identified because of
the high prevalence of C. felis these reservoirs and the lack of movement of wild felids to new
geographic regions.
Materials and Methods
Samples
We included DNA samples from 161 Cytauxzoon felis-infected bobcats (n=153) and
cougars (n=8) that were determined to be positive during three previous studies on these wild
felids (Yabsley et al., 2006; Birkenheuer et al., 2008; Shock et al., unpublished). These samples
were confirmed positive for C. felis by either amplification of a segment of the 18S rRNA gene
or the ITS-1 region followed by sequence analysis. All DNA samples were held at -20C or -80C
until testing in the current study.
Genetic characterization
Two different regions were targeted to identify genetic variability, the ITS-1 and ITS-2
regions. The ITS-1 region was amplified using a nested PCR that amplifies this genetic region
from most piroplasms including Cytauxzoon, Babesia, and Theileria spp. (Bostrom et al., 2008).
Briefly, for primary amplification, 5 μl of DNA was added to 20 μl of a master mix containing
10 mM Tris-Cl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM each dNTP (Promega, Madison,
Wisconsin), 2.5 units Taq DNA Polymerase (Promega), and 0.8 μM of primers ITS-15C (5’-
![Page 79: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/79.jpg)
70
CGATCGAGTGATCCGGTGAATTA) and ITS-13B (5’-GCTGCGTCCTTCATCGTTGTG).
Cycling parameters were 94 C for 1 min followed by 35 cycles of 94 C for 30 sec, 52 C for 30
sec, 72 C for 1 min, and a final extension at 72 C for 5 min. For the nested PCR, 1 μl of primary
product was used as template in a 25 μl reaction containing the same PCR components except
primers ITS-15D (5’-AAGGAAGGAGAAGTCGTAACAAGG) and ITS-13C (5’-
TTGTGTGAGCCAAGACATCCA) were used. The cycling parameters were the same as the
primary reaction except the annealing temperature was 49 C. A single PCR was used to amplify
the ITS-2 region. The same master mix protocol was used except for the inclusion of primers
FOR7 (5’ -AGCCAATTGCGATAAGCATT) and REV7 (5’-
TCACTCGCCGTTACTAGGAGA) and the cycling parameters were 96 for 3 min followed by
30 cycles of 94 C for 30 sec, 60 C for 30 sec, 72 C for 1 min 30 sec, and a final extension at 72 C
for 7 min.
To prevent and detect contamination, primary and secondary amplification, and product
analysis were done in separate dedicated areas. A negative water control was included in each set
of DNA extraction, and one water control was included in each set of primary and secondary
PCR reactions. All amplicons of the appropriate size (~550 bp for ITS1 and ~300 bp for ITS2)
were purified with a Qiagen gel extraction kit (Germantown, MD) and bi-directionally
sequenced at the University of Georgia Integrated Biotechnology Laboratory (Athens, GA).
Chromatogram data were analyzed using Sequencher (Ann Arbor, MI) and sequences
with ambiguous bases (other than simple incorporation of two nucleotides at a single position)
were excluded from the study. Sequences obtained from this study and available in GenBank
were aligned using the multisequence alignment ClustalX program within MEGA (Molecular
Evolutionary Genetics Analysis) version 3.1 program (Kumar et al., 2004).
![Page 80: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/80.jpg)
71
Results
Amplification and sequencing of the two ITS regions of C. felis from samples previously
determined to be infected with C. felis yielded unambiguous ITS1 data for 131 of 161 (81%)
samples from GA, FL, KS, KY, LA, MO, NC, ND, OK, PA and SC and ITS2 data for 106 of
161 (66%) samples from GA, FL, KY, LA, MO, NC, ND, OK, PA and SC. Combined ITS1 and
ITS2 sequence data was available for 82 of the 161 samples (51%). Assignment of samples to a
particular genotype was only conducted on samples that had both ITS1 and ITS2 data (as
described by Brown et al., 2009a, 2009b) which included felids from Georgia (n=7 bobcats),
Florida (n=12 bobcats, 1 Florida panther), Kentucky (n=27 bobcats), Missouri (n=22 bobcats),
North Carolina (n=6 bobcats), Oklahoma (n=6 bobcats), and Louisiana (1 cougar).
Within the 458-bp ITS1 region, there were 100 single nucleotide polymorphisms (SNPs)
or insertions/deletions. The most common ITS-1 sequence detected in this study was identical to
EU450802 and was found in 46 bobcats (2 from GA, 2 from FL, 21 from KY, 3 from KS, 9 from
MO, 2 from OK, and 7 from NC) and in the cougar from LA. The second most common ITS-1
sequence was detected in 18 bobcats from FL (n=12) and GA (n=4). Two sequences from OK,
one each from MO and NC, and one each from KS and NC were identical to each other. The
remaining 60 sequences were unique.
Within the 265-bp ITS2 region of C. felis (excluding the two insertions mentioned
below), there was a total of 184 SNPs and 10 single nucleotide insertions, and 12 single
nucleotide deletions. Sequences from 36 bobcats (one each from GA, NC, and ND, three from
FL, 5 from OK, 12 from KY, and 13 from MO) and the cougar from LA had identical sequences
to one previously detected in domestic cats in AR and GA (EU450804). Sequences from single
bobcats from GA and SC were identical to EU450805 and FJ536418, respectively. Three bobcats
![Page 81: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/81.jpg)
72
from MO, GA, and KY had sequences identical to FJ536419. Additional sequences that were
identical to each other were identified in multiple bobcats including nine samples from GA and
FL, four samples from KY, three samples from FL, two samples from KY, and two samples from
NC and MO.
Three ITS-2 sequences from Florida panthers had a 40bp insert nearly identical (38 or 39
of 40 bases) to an insert in a sequence from a single domestic cat (EU450806) from AR;
however, numerous SNPs within the non-insert region of the ITS2 distinguished these sequences
from EU450806. An additional sample from a bobcat from MO had a 41bp insert at the sample
location as EU450806 and the samples from the Florida panthers. Two samples from bobcats
from NC had a 199bp insert after position 152 (EU450804) that were 94.4% identical to each
other. Two additional bobcats from PA and KY had a similar 198bp insert (98.9% identical to
each other and 94.9-95.9% similar to the NC samples).
When the ITS1 and ITS2 sequences were combined, ten wild felids (nine bobcats from
FL (1), KY (2), OK (2), and MO (4) and the cougar from LA) were infected with the C. felis
ITSA genotype that is common in domestic cats (Brown et al., 2009a),. Genotype ITSB (from
Brown et al., 2009a) and sequence type ITSd (from Brown et al., 2009b) were each detected in a
single bobcat from GA. Based on the criteria of Brown et al., (2009a) we identified a novel
genotype (ITSD) from eight bobcats from GA (2) and FL (6).
Discussion
In the current study, we characterized the genetic variation in the ITS1 and ITS2 regions
of C. felis from wild felids, primarily bobcats, from numerous states in the eastern and central
United States. Compared with two previous studies (Brown et al., 2009a; Brown et al., 2009b)
![Page 82: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/82.jpg)
73
and a limited number of other sequences available in GenBank, we observed more
polymorphisms in both of these genetic targets including SNPs and individual
insertions/deletions in both ITS1 and ITS2 and a novel 198/199bp insert in the ITS2. This
increased genetic diversity is not surprising because bobcats are the natural reservoirs of C. felis
and infections have been documented as early as 1930 (Wenyon and Hamerton, 1930). In
addition to being the primary reservoir, bobcats are useful for this type of project because they
are exposed to more potentially infected ticks than domestic cats and prevalence rates in bobcat
populations in some regions may exceed 50% which provides greater numbers of parasites for
characterization at single locations (Shock et. al., submitted). Unfortunately, many bobcats in the
current project appeared to be coinfected with multiple strains which created difficulty in
sequence analysis. Also, infected bobcats have been identified in regions where domestic cat
infections have not been reported (Birkenheuer et al., 2008; Shock et al., submitted).
Recently there have been increasing reports of natural subclinical chronically-infected
domestic cats as was normally only seen in wild felids infected with C. felis (Birkenheuer et al.,
2006; Haber et al., 2007; Brown et al., 2008). There have been at least three reasons postulated
for the increased recognition of chronically infected asymptomatic cats: 1) better treatment
strategies, 2) better diagnostics, or 3) strains of C. felis that differ in their virulence for domestic
cats. Although many treatment strategies have been attempted in reducing the parasitemia in
domestic cats (Green et al., 1999; Motzel and Wagner, 1995), none have been consistently
effective. Although diagnostics, particularly molecular techniques, have improved, previous
experimental studies suggested that different strains of C. felis had variable pathogenicity for cats
as some strains induced clinical disease while others induced subclinical chronic infections (Kier
et al., 1982b).
![Page 83: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/83.jpg)
74
The first study to genetically characterize a large number of C. felis samples was
conducted on samples from domestic cats from AR and GA (Brown et al., 2009a). Significantly,
one genotype (ITSA) of combined ITS1 and ITS2 sequences was associated with an increased
survival rate of the infected domestic cats while cats infected with the two other genotypes
(ITSB and ITSC) were more likely to die from the infection. Interestingly, a possible geographic
association was found in the study; a significant proportion (84%) of the C. felis samples from
AR were identified as the ITSA genotype, and the majority of samples (68%) from GA were
classified as genotype ITSB (Brown et al., 2009a). However, a subsequent study of only GA
samples found that ITSC was the predominate genotype followed by genotype ITSB (Brown et
al., 2009b). Genotypes ITSA and ITSB can only be differentiated based on ITS-2 sequence
because they have identical ITS-1 sequences. In the current study, we detected the ITSA
genotype in nine bobcats from multiple states (FL, KY, OK, and MO) and the single cougar from
LA, but the majority of positives were from the central US (90%). Unfortunately, no bobcats
from AR were available for testing. The ITSB genotype was found in a single bobcat from GA,
which in one study was the predominate genotype detected in domestic cats from Georgia
(Brown et al., 2009a). Interestingly, the ITS-1 sequence (EU450802) that was most common in
both previous studies was the most common ITS-1 sequence detected in wild felids. Similarly,
the individual ITS-2 sequence that was most common in wild felids was the most commonly
found sequence in domestic cats (EU45804)
No significant geographic clustering was observed for the individual ITS1 and ITS2
sequences which were in general, found throughout the study area, including the most common
ITS1 and ITS2 sequences which were found in 46 bobcats and the cougar from LA. However,
we did identify a novel genotype (ITSD) in 8 bobcats that was restricted to northern FL and
![Page 84: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/84.jpg)
75
southern GA (sampling sites in these two areas were very close to each other). The identification
of a novel genotype in this region was likely because a large number of samples were collected
from a small geographic region where no cat samples have previously been tested (Brown et al.,
2009a; Brown et al., 2009b). In the current study, our samples were opportunistically collected
which resulted in few individuals being sampled at the majority of our sites so although
numerous novel sequence types were detected, only one novel genotype was identified.
Alternatively, domestic cats may be more like to become infected with only certain genotypes or
genetic sequences (Brown et al., 2009a; Brown et al., 2009b). Additional samples from both wild
and domestic felids are needed from geographically discrete areas to detect if clustering of
sequence types or selection in domestic cats is occurring.
It is important to note that neither of the sequenced regions examined in the current
study, or previous ones (Brown et al., 2009a, 2009b), are related to virulence genes or any
potential protein involved in pathogenicity. They are simply being used as potential markers for
observed biological or spatial differences. Future studies should target genes that are associated
with pathogenicity or antigenic variation in related pathogens (e.g., Babesia spp.) such as the
ones that encode for the variant erythrocyte surface antigen-1 (VESP1), leucine aminopeptidase,
or, heat shock protein-70 proteins (Yamasaki et al., 2007; Jia et al., 2009; Xiao et al., 2010)
Acknowledgements
The authors thank numerous personnel from state agencies who collected felid samples.
This study was primarily funded by the Morris Animal Foundation (DO8FE-003). Additional
support was provided by the Federal Aid to Wildlife Restoration Act (50 Stat. 917) and through
SCWDS sponsorship from fish and wildlife agencies in Alabama, Arkansas, Florida, Georgia,
![Page 85: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/85.jpg)
76
Kansas, Kentucky, Louisiana, Maryland, Mississippi, Missouri, North Carolina, Oklahoma,
Puerto Rico, South Carolina, Tennessee, Virginia, and West Virginia.
References
Bendele, R.A., Schwartz, W.L., Jones, L.P.,1976, Cytauxzoon-like disease in Texas cats.
Southwest Vet 29, 244-246.
Barta, J.R., Coles, B.A., Schito, M.L., Fernando, M.A., Martin, A., Danforth, H.D., 1998,
Analysis of infraspecific variation among five strains of Eimeria maxima from North
America. Int J Parasitol 28, 485-492.
Birkenheuer, A.J., Le, J.A., Valenzisi, A.M., Tucker, M.D., Levy, M.G., Breitschwerdt, E.B.,
2006, Cytauxzoon felis infection in cats in the mid-Atlantic states: 34 cases (1998-2004).
J Am Vet Med Assoc 228, 568-571.
Birkenheuer, A.J., Marr, H.S., Warren, C., Acton, A.E., Mucker, E.M., Humphreys, J.G., Tucker,
M.D., 2008, Cytauxzoon felis infections are present in bobcats (Lynx rufus) in a region
where cytauxzoonosis is not recognized in domestic cats. Vet Parasitol 153, 126-130.
Blouin, E.F., Kocan, A.A., Glenn, B.L., Kocan, K.M., Hair, J.A., 1984, Transmission of
Cytauxzoon felis Kier, 1979 from bobcats, Felis rufus (Schreber), to domestic cats by
Dermacentor variabilis (Say). J Wildl Dis 20, 241-242.
Blouin, E.F., Kocan, A.A., Kocan, K.M., Hair, J., 1987, Evidence of a limited schizogonous
cycle for Cytauxzoon felis in bobcats following exposure to infected ticks. J Wildlife Dis
23, 499-501.
![Page 86: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/86.jpg)
77
Bostrom, B., Wolf, C., Greene, C., Peterson, D.S., 2008, Sequence conservation in the rRNA
first internal transcribed spacer region of Babesia gibsoni genotype Asia isolates. Vet
Parasitol 152, 152-157.
Brown, H.M., Berghaus, R.D., Latimer, K.S., Britt, J.O., Rakich, P.M., Peterson, D.S., 2009,
Genetic variability of Cytauxzoon felis from 88 infected domestic cats in Arkansas and
Georgia. J Vet Diagn Invest 21, 59-63.
Brown, H.M., Modaresi, S.M., Cook, J.L., Latimer, K.S., Peterson, D.S., 2009, Genetic
variability of archived Cytauxzoon felis histologic specimens from domestic cats in
Georgia, 1995-2007. J Vet Diagn Invest 21, 493-498.
Brown, H.M., Latimer, K.S., Erikson, L.E., Cashwell, M.E., Britt, J.O., Peterson, D.S., 2008,
Detection of persistent Cytauxzoon felis infection by polymerase chain reaction in three
asymptomatic domestic cats. J Vet Diagn Invest 20, 485-488.
Butt, M.T., Bowman, D., Barr, M.C., Roelke, M.E., 1991, Iatrogenic transmission of Cytauxzoon
felis from a Florida panther (Felix concolor coryi) to a domestic cat. J Wildl Dis 27, 342-
347.
Edwards, A.C., Reichard, M.V., Meinkoth, J.H., Snider, T.A., Meinkoth, K.R., Heinz, R.E.,
Little, S.E., 2010, Confirmation of Amblyomma americanum (Acari: Ixodidae) as a vector
for Cytauxzoon felis (Piroplasmorida: Theileriidae) to domestic cats. J Med Ent.
Ferris, D.H., 1979, A progress report on the status of a new disease of American cats:
cytauxzoonosis. Comp Immunol Microbiol Infect Dis 1, 269-276.
Glenn, B.L., Kocan, A.A., Blouin, E.F., 1983, Cytauxzoonosis in bobcats. J Am Vet Med Assoc
183, 1155-1158.
![Page 87: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/87.jpg)
78
Greene, C.E., Latimer, K., Hopper, E., Shoeffler, G., Lower, K., Cullens, F., 1999,
Administration of diminazene aceturate or imidocarb dipropionate for treatment of
cytauxzoonosis in cats. J Am Vet Med Assoc 215, 497-500, 482.
Haber, M.D., Tucker, M.D., Marr, H.S., Levy, J.K., Burgess, J., Lappin, M.R., Birkenheuer, A.J.,
2007, The detection of Cytauxzoon felis in apparently healthy free-roaming cats in the
USA. Vet Parasitol 146, 316-320.
Harvey, J.W., Dunbar, M.R., Norton, T.M., Yabsley, M.J., 2007, Laboratory findings in acute
Cytauxzoon felis infection in cougars (Puma concolor couguar) in Florida. J Zoo Wildlife
Med 38, 285-291.
Jia, H., Terkawi, M.A., Aboge, G.O., Goo, Y.K., Luo, Y., Li, Y., Yamagishi, J., Nishikawa, Y.,
Igarashi, I., Sugimmoto, C., Fugisaki, K., Xuan, X., 2009, Characterization of a leucine
aminopeptidase of Babesia gibsoni. Parasit 136, 945-52.
Ketz-Riley, C.J., Reichard, M.V., Van Den Bussche, R.A., Hoover, J.P., Meinkoth, J., Kocan,
A.A., 2003, An intraerythrocytic small piroplasm in wild-caught Pallas's cats
(Otocolobus manul) from Mongolia. J Wildlife Dis 39, 424-430.
Kier, A.B., Wagner, J.E., Morehouse, L.G., 1982a, Experimental transmission of Cytauxzoon
felis from bobcats (Lynx rufus) to domestic cats (Felis domesticus). Am J Vet Res 43, 97-
101.
Kier, A.B., Wightman, S.R., Wagner, J.E., 1982b, Interspecies transmission of Cytauxzoon felis.
Am J Vet Res 43, 102-105.
Kocan, A.A., Kocan, K.M., Blouin, E.F., Mukolwe, S.W., 1992, A redescription of schizogony
of Cytauxzoon felis in the domestic cat. Ann Ny Acad Sci 653, 161-167.
![Page 88: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/88.jpg)
79
Kumar, S.K., Tamura, K., Nei, M., 2004, MEGA3: Integrated software for molecular
evolutionary genetics analysis and sequence alignment. Briefings in Bioinformatics 5,
150–163.
Luaces, I., Aguirre, E., Garcia-Montijano, M., Velarde, J., Tesouro, M.A., Sanchez, C., Galka,
M., Fernandez, P., Sainz, A., 2005, First report of an intraerythrocytic small piroplasm in
wild Iberian lynx (Lynx pardinus). J Wildlife Dis 41, 810-815.
Motzel, S.L., Wagner, J.E., 1990, Treatment of experimentally induced cytauxzoonosis in cats
with parvaquone and buparvaquone. Vet Parasitol 35, 131-138.
Nietfeld, J.C., Pollock, C., 2002, Fatal cytauxzoonosis in a free-ranging bobcat (Lynx rufus). J
Wildlife Dis 38, 607-610.
Olivier, C., van de Pas, S., Lepp, P.W., Yoder, K., Relman, D.A., 2001, Sequence variability in
the first internal transcribed spacer region within and among Cyclospora species is
consistent with polyparasitism. Int J Parasitol 31, 1475-1487.
Peixoto, P.V., Soares, C.O., Scofield, A., Santiago, C.D., Franca, T.N., Barros, S.S., 2007, Fatal
cytauxzoonosis in captive-reared lions in Brazil. Vet Parasitol 145, 383-387.
Reichard, M.V., Meinkoth, J.H., Edwards, A.C., Snider, T.A., Kocan, K.M., Blouin, E.F., Little,
S.E., 2008, Transmission of Cytauxzoon felis to a domestic cat by Amblyomma
americanum. Vet Parasitol.
Wagner, J.E., 1976, A fatal cytauxzoonosis-like disease in cats. J Am Vet Med Assoc 168, 585-
588.
Wightman, S.R., Kier, A.B., Wagner, J.E., 1977, Feline cytauxzoonosis: clinical features of a
newly described blood parasite disease. Feline Pract, 24-26.
![Page 89: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/89.jpg)
80
Yabsley, M.J., Murphy, S.M., Cunningham, M.W., 2006, Molecular detection and
characterization of Cytauxzoon felis and a Babesia species in cougars from Florida. J
Wildlife Dis 42, 366-374.
Yamasaki, M., Inokuma, H., Sugimoto, C., Shaw, S.E., Aktas, M., Yabsley, M.J., Yamato, O.,
Maede, Y., 2007, Comparison and phylogenetic analysis of the heat shock protein 70
gene of Babesia parasites from dogs. Vet Parasitol 145, 217-227.
Wenyon, C.M., Hamerton, A.E., 1930, Piroplasms of the West African civet cat (Viverra civetta)
and the Bay lynx (Felis rufa) of North America. Roy Soc Trop Med and Hyg, 24, 7-8.
Xiao, Y.P., Al-Khedery, B., Allred, D.R., 2010, The Babesia bovis VESA1 virulence factor
subunit 1b is encoded by the 1beta branch of the ves multigene family. Mol Biochem
Parasit 171, 81-88.
Zahler, M., Schein, E., Rinder, H., Gothe, R., 1998, Characteristic genotypes discriminate
between Babesia canis isolates of differing vector specificity and pathogenicity to dogs.
Parasitol Res 84, 544-548.
![Page 90: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/90.jpg)
81
CHAPTER 4
NOVEL BABESIA IN A BOBCAT, GEORGIA
Barbara C. Shock, J. Mitchell Lockhart, Adam J. Birkenheuer, and Michael J. Yabsley. 2010. To
be submitted as Letter to the Editor of Emerging Infectious Diseases.
![Page 91: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/91.jpg)
82
To the Editor:
Currently, only two piroplasms have been reported from felines in the North America,
Cytauxzoon felis in domestic cats, bobcats (Lynx rufus), and cougars (Puma concolor) from the
Eastern United States and a novel Babesia species in Florida panthers (P. c. coryii) from
southern Florida (Glenn et al., 1983; Yabsley et al., 2006). During a C. felis surveillance study
involving bobcats (n=799) and cougars (n=49) from thirteen states (Florida, Georgia, Kansas,
Kentucky, Louisiana, Missouri, North Carolina, North Dakota, Ohio, Oklahoma, Pennsylvania,
South Carolina, and West Virginia) a Babesia species was detected in a single female bobcat
from Thomas County, Georgia (n=159; 0.63%).
Sequence analysis of the ITS-1 region indicated that the greatest similarity (92%) was
with a novel large Babesia sp. (Coco) first identified in a domestic dog from North Carolina in
2002 (GenBank accession number: AY618928) (Birkenheuer et al., 2004). The only difference
between the sequence from the bobcat and Babesia sp. (Coco) was that the bobcat Babesia sp.
contained a 45-bp insertion at nucleotide site 434. Based on the identical sequence from bases 1
to 434 and 435 to 557, we believe that this bobcat Babesia sp. represents a variant of Babesia sp.
Coco and not a novel Babesia sp., although additional studies are needed to definitively
determine the con-specificity of these two Babesia. Similar results have been reported with C.
felis where some strains contain a 40 bp insert (Brown et al., 2009a)
To better understand why this bobcat was infected with a variant of Babesia sp. (Coco)
which had only previously been reported from dogs, we conducted additional pathogen screening
using the limited samples available from this trapper-harvested animal. Serum from the bobcat
tested negative for Feline Immunodeficiency virus (FIV) using the IDEXX Snap test. A titer was
1:10 for Feline panleukopenia virus, which was not interpreted as an infection. Interestingly,
![Page 92: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/92.jpg)
83
PCR testing for other parasites revealed that the bobcat was co-infected with C. felis (ITS-2) and
a Bartonella sp. Unfortunately, a blood smear was not available from the Babesia sp. infected
bobcat so that morphologic data could be collected on the Babesia sp. Histological examination
of selected tissues was unrewarding due to the level of necrosis, but Sarcocystis cysts were
observed in muscle tissue. All of these findings are considered incidental and may have
predisposed this bobcat to be more susceptible to Babesia.
Currently, little is known about the natural history of Babesia sp. Coco and the Babesia
sp. detected in the bobcat from Georgia. Babesia sp. Coco was first reported from an
immunosuppressed dog undergoing chemotherapy for lymphoma (Birkenheuer et al., 2004).
Since the initial detection eight additional canine infections have been reported from dogs with
history of travel to Mid-Atlantic states. Six of these dogs were splenectomized and two were
immunosuppressed due to oncolytic drugs (Birkenheuer et al., 2004; Holman et al., 2009;
Sikorski et al., 2010). At least 5 of the 9 dogs infected with Babesia sp. Coco had a history of
tick exposure and at least one sustained bites to the face, a risk factor for other Babesia sp. such
as B. gibsoni (Holman et al., 2009; Yeagley et al., 2009; Sikorski et al., 2010).
Worldwide, several Babesia spp. have been reported from felids including B. herpailuri
and B. pantherae from wild felids in Africa, B. felis and B. leo from domestic cats and wild felids
in Africa, B. cati in domestic cats from India, B. canis canis from domestic cats in Spain, B.
canis presentii from domestic cats in Israel; a Babesia sp. from domestic cats in Portugal,
(Penzhorn et al., 2004; Criado-Fornelio et al., 2004; Jacobson et al., 2000; Baneth et al., 2004).
In the United States, the only report of a Babesia species in a felid is the novel Babesia sp. from
Florida panthers (Yabsley et al., 2006). The panther Babesia sp. appears to be restricted to
Florida panthers because, in the current study, infections were not detected in cougars from TX,
![Page 93: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/93.jpg)
84
LA, GA, or ND. The Babesia sp. from the Florida panther is a small piroplasm and is
indistinguishable from C. felis, whereas Babesia sp. Coco is a large Babesia and based on
sequence analysis of the ITS-1 region, the bobcat Babesia sp. is easily distinguished from the
Florida panther Babesia sp.
In summary, a Babesia sp. closely related to Babesia sp. Coco was detected in a single
bobcat from Georgia which is the first report Babesia infection of a bobcat and the second report
of Babesia in felids from the United States. Based on our data, wild felids, bobcats particularly,
do not likely represent a natural host of Babesia sp. Coco, thus additional surveillance studies are
needed to identify the natural host of this parasite which has been found in immunosuppressed
dogs from numerous southern states.
Acknowledgements
The authors thank numerous personnel from state agencies who collected felid samples.
This study was primarily funded by the Morris Animal Foundation (DO8FE-003) and additional
support was provided by the Federal Aid to Wildlife Restoration Act (50 Stat. 917) and through
sponsorship from fish and wildlife agencies in Alabama, Arkansas, Florida, Georgia, Kansas,
Kentucky, Louisiana, Maryland, Mississippi, Missouri, North Carolina, Oklahoma, Puerto Rico,
South Carolina, Tennessee, Virginia, and West Virginia.
References
Baneth, G., Kenny, M.J., Tasker, S., Anug, Y., Shkap, V., Levy, A., Shaw, S.E., 2004, Infection
with a proposed new subspecies of Babesia canis, Babesia canis subsp. presentii, in
domestic cats. J Clin Microbiol 42, 99-105.
![Page 94: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/94.jpg)
85
Birkenheuer, A.J., Neel, J., Ruslander, D., Levy, M.G., Breitschwerdt, E.B., 2004, Detection and
molecular characterization of a novel large Babesia species in a dog. Vet Parasitol 124,
151-160.
Brown, H.M., Berghaus, R.D., Latimer, K.S., Britt, J.O., Rakich, P.M., Peterson, D.S., 2009,
Genetic variability of Cytauxzoon felis from 88 infected domestic cats in Arkansas and
Georgia. J Vet Diagn Invest 21, 59-63.
Criado-Fornelio, A., Gonzalez-del-Rio, M.A., Buling-Sarana, A., Barba-Carretero, J.C., 2004,
The "expanding universe" of piroplasms. Vet Parasitol 119, 337-345.
Glenn, B.L., Kocan, A.A., Blouin, E.F., 1983, Cytauxzoonosis in bobcats. J Am Vet Med Assoc
183, 1155-1158.
Holman, P.J., Backlund, B.B., Wilcox, A.L., Stone, R., Stricklin, A.L., Bardin, K.E., 2009,
Detection of a large unnamed Babesia piroplasm originally identified in dogs in North
Carolina in a dog with no history of travel to that state. J Am Vet Med Assoc 235, 851-
854.
Jacobson, L.S., Schoeman, T., Lobetti, R.G., 2000, A survey of feline babesiosis in South Africa.
J S Afr Vet Assoc 71, 222-228.
Penzhorn, B.L., Schoeman, T., Jacobson, L.S., 2004, Feline babesiosis in South Africa: a review.
Ann N Y Acad Sci 1026, 183-186.
Sikorski, L.E., Birkenheuer, A.J., Holowaychuk, M.K., McCleary-Wheeler, A.L., Davis, J.M.,
Littman, M.P., 2010, Babesiosis caused by a large Babesia species in 7
immunocompromised dogs. J Vet Intern Med 24, 127-131.
![Page 95: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/95.jpg)
86
Yabsley, M.J., Murphy, S.M., Cunningham, M.W., 2006, Molecular detection and
characterization of Cytauxzoon felis and a Babesia species in cougars from Florida. J
Wildlife Dis 42, 366-374.
Yeagley, T.J., Reichard, M.V., Hempstead, J.E., Allen, K.E., Parsons, L.M., White, M.A., Little,
S.E., Meinkoth, J.H., 2009, Detection of Babesia gibsoni and the canine small Babesia
'Spanish isolate' in blood samples obtained from dogs confiscated from dogfighting
operations. J Am Vet Med Assoc 235, 535-539.
![Page 96: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/96.jpg)
87
CHAPTER 5
CONCLUSIONS
Cytauxzoon felis, a protozoan parasite of wild and domestic felids, is the causative agent
of cytauxzoonosis in domestic and some exotic felids in the United States. Previous research has
identified the bobcat (Lynx rufus) as the natural reservoir for this parasite. C. felis has been
experimentally transmitted by two tick species, Dermacentor variabilis and Amblyomma
americanum, which have overlapping distributions throughout the southeastern United States.
Part of the current study was to determine the distribution and prevalence of C. felis in
free-ranging bobcat populations from 13 states including California, Colorado, Florida, Georgia,
Kansas, Kentucky, Missouri, North Carolina, North Dakota, Ohio, Oklahoma, South Carolina,
and West Virginia. These states were selected because D. variabilis is present in each state, but
A. americanum is only currently known to be present in a subset of these states. Blood or spleen
samples from 697 trapper-harvested or road-killed bobcats were tested for C. felis infection by a
polymerase chain reaction (PCR) assay which targets the first ribosomal internal transcribed
spacer region (ITS-1). Significantly higher C. felis prevalences were detected from Missouri
(79%, n=39), North Carolina (63%, n=8), Oklahoma (60%, n=20), South Carolina (57%, n=7),
Kentucky (55%, n=74), Florida (44%, n=45), and Kansas (27%, n=41) compared with Georgia
(9%, n=159), North Dakota (2.4%, n=124), Ohio (0%, n=19), and West Virginia (0%, n=37). In
addition to bobcats, we tested a limited number of samples (n=8) from other wild felids and only
one cougar (Puma concolor) from Louisiana was positive, which represents the first report in an
![Page 97: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/97.jpg)
88
infected cougar outside the Florida panther population. These data also indicate that C. felis is
present in North Dakota where C. felis has not been reported in domestic cats. Based on linear
regression analysis, prevalence rates were significantly higher in states where there are
established populations of A. americanum, which supports recent data on the experimental
transmission of C. felis by A. americanum and the fact that domestic cat cases are temporally
associated with A. americanum activity. Collectively, these data confirm that bobcats are a
common reservoir for C. felis and that A. americanum likely is an epidemiologically important
vector.
Interestingly, we detected a single bobcat from Georgia that was infected with a Babesia
sp. which is the first report Babesia infection of a bobcat and the second report of a Babesia sp,
in felids from the United States. The Babesia sp. was closely related to Babesia sp. Coco which
has only been reported from 9 immunosuppressed domestic dogs. Based on our data, wild felids,
bobcats particularly, do not likely represent a natural host of Babesia sp. Coco, thus additional
surveillance studies are needed to identify the natural host of this parasite.
The next goal of this project was to genetically characterize select samples of C. felis
circulating in wild felids. Although most domestic cats infected with the parasite die of clinical
illness, increasing numbers of cats have been identified surviving infection. Because the bobcat
is the natural reservoir, they typically only develop limited or no clinical signs of illness.
Previous studies, including our own, show that in many areas, free-ranging bobcats have high
prevalence rates. Although not likely important reservoirs, C. felis has also been detected in free-
ranging Florida panthers. Recent studies have identified specific genotypes of C. felis circulating
in domestic cats which are associated with different clinical outcomes and specific spatial
locations. In the current study, we investigated the intraspecific variation of the C. felis internal
![Page 98: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/98.jpg)
89
transcribed spacer (ITS)-1 and ITS-2 rRNA regions from 153 bobcats and eight cougars from 11
states (Florida, Georgia, Kansas, Kentucky, Louisiana, Missouri, North Carolina, North Dakota,
South Carolina, Oklahoma, and Pennsylvania). Unambiguous ITS-1 and ITS-2 data were
obtained for 131 and 106 samples, respectively, and both ITS-1 and ITS-2 sequences were
obtained for 82 (51%) samples. Within the ITS-1 region, sequences from 46 bobcats were
identified which were identical to those previously reported in domestic cats and we identified 60
unique sequences. Samples from 46 bobcats and one cougar had ITS-1 sequences identical to the
most common sequence reported from domestic cats. The most common ITS-2 sequence from
domestic cats was also common in wild felids (36 bobcats and a cougar). Five other ITS-2
sequences had been previously reported in domestic cats; the remaining ITS-1 and ITS-2
sequences from wild felids were novel. Samples from three Florida panthers and a bobcat from
MO had a 40/41-bp insert in the ITS-2 similar to one described previously in a cat from AR.
Additionally, a previously undescribed 198/199-bp insert was detected in the ITS-2 sequence
from in four bobcats. Collectively, nine bobcats and one cougar were infected with genotype
ITSA and two bobcats were infected with genotypes ITSB and ITSC. Eight bobcats from
southwestern Georgia and northwestern Florida were infected with a novel genotype (ITSD).
These data indicate that based on ITS1 and ITS2 sequences, numerous C. felis strains circulate in
wild felids and that some genotypes may cluster in specific spatial locations.
Collectively, these studies indicate that the prevalence of C. felis is high in many
populations of bobcat, especially in those where A. americanum densities are high compared
with D. variabilis. Genetic characterization data indicate that C. felis samples from wild felids
has significantly more variability in the ITS-1 and ITS-2 regions compared with domestic cats.
This is probably attributable to the long relationship between this parasite and its natural wild
![Page 99: PIROPLASMS IN FREE-RANGING BOBCATS AND COUGARS … · piroplasms in free-ranging bobcats and cougars in the united states: distribution, prevalence, and intraspecific variation by](https://reader031.vdocuments.mx/reader031/viewer/2022021902/5b9af78309d3f22d2a8c5e11/html5/thumbnails/99.jpg)
90
mammalian hosts, as domestic cats are spill-over or accidental hosts for the parasite. These
studies also revealed the infection of a bobcat with a novel species of Babesia only previously
reported from immunocompromised dogs, which is the first report of a Babesia sp. in bobcats
and the second report of a Babesia sp. in a felid from the United States. The current study is the
most comprehensive study on piroplasms in free-ranging wild felid populations in the United
States.
Future research into C. felis in bobcat populations should focus on areas where A.
americanum is expanding into naïve populations of wild felids. A majority of the bobcats in this
study were presumably healthy free-ranging felids, but L. rufus has been known to die of
cytauxzoonosis. C. felis could be a selection force on bobcat populations in areas such as the
American West and states such as Ohio and West Virginia, where C. felis has not been reported
in domestic or wild felids. Population level studies could address the dynamics of infection and
survival as C. felis emerges in these areas.
Another way to understand the role of C. felis in bobcat populations would be to address
the bobcat population itself. A genetics study on bobcats could reveal if there are subspecies or
types of bobcats which are more susceptible to infection with C. felis. In addition, a long-term
tracking study could investigate the immune responses in felids infected and uninfected with C.
felis. Although C. felis causes little to no harm to bobcat populations currently, with the rise of
feral cat populations in the United States, these wild felids have increasing contact with new
diseases. It will be important to understand the role of C. felis in bobcat populations as their
exposure to novel health threats increases.